DOCSLIB.ORG

Thoroughbred Racehorse Mitochondrial DNA Demonstrates Closer Than Expected Links Between Maternal Genetic History and Pedigree Records M.A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Thoroughbred Racehorse Mitochondrial DNA Demonstrates Closer Than Expected Links Between Maternal Genetic History and Pedigree Records M.A J. Anim. Breed. Genet. ISSN 0931-2668 ORIGINAL ARTICLE Thoroughbred racehorse mitochondrial DNA demonstrates closer than expected links between maternal genetic history and pedigree records M.A. Bower1, M. Whitten2,*, R.E.R. Nisbet3, M. Spencer4, K.M. Dominy5, A.M. Murphy6, R. Cassidy7, E. Barrett1, E.W. Hill8 & M. Binns2,† 1 McDonald Institute for Archaeological Research, University of Cambridge, Cambridge, UK 2 Department of Veterinary Basic Sciences, Royal Veterinary College, London, UK 3 Sansom Institute for Health Research, University of South Australia, Adelaide, SA, Australia 4 School of Environmental Sciences, University of Liverpool, Liverpool, UK 5 Department of Medical and Molecular Genetics, School of Medicine, King’s College London, Guy’s Hospital, London, UK 6 Department of Veterinary Basic Sciences, Royal Veterinary College, London, UK 7 Department of Anthropology, Goldsmiths College, London, UK 8 School of Agriculture, Food, Science and Veterinary Medicine, University College Dublin, Dublin, Ireland Keywords Summary General Studbook; maternal lineage; The potential future earnings and therefore value of Thoroughbred foals mitochondrial DNA; pedigree records; untested in the racing arena are calculated based on the performance of thoroughbred horse. their forebears. Thus, lineage is of key importance. However, previous Correspondence research indicates that maternally inherited mitochondrial DNA (mtDNA) M.A. Bower, McDonald Institute for does not correspond to maternal lineage according to recorded pedigree, Archaeological Research, University of casting doubt on the voracity of historic pedigrees. We analysed mtDNA of Cambridge, Downing Street, Cambridge CB2 296 Thoroughbred horses from 33 maternal lineages and identified an 3ER, UK. Tel: 01223 339330; Fax: 07990 interesting trend. Subsequent to the founding of the Thoroughbred breed 514733; E-mail: [email protected] in the 16th century, well-populated maternal lineages were divided into sub-lineages. Only six in 10 of the Thoroughbreds sampled shared mito- Current Address: *Max Planck Research chondrial haplotype with other members of their maternal lineage, Group on Comparative Population Linguistics, despite having a common maternal ancestor according to pedigree Max Planck Institute for Evolutionary records. However, nine in 10 Thoroughbreds from the 103 sub-lineages Anthropology, Leipzig, Germany sampled shared mtDNA with horses of their maternal pedigree sub-line- †Equine Analysis Systems, Lexington, KY age. Thus, Thoroughbred maternal sub-lineage pedigree represents a more 40347, USA accurate breeding record than previously thought. Errors in pedigrees must have occurred largely, though, not exclusively, at sub-lineage foun- Received: 30 March 2012; dation events, probably due to incomplete understanding of modes of accepted: 16 June 2012 inheritance in the past, where maternal sub-lineages were founded from individuals, related, but not by female descent. kept of all Thoroughbreds since the establishment of Introduction the breed to inform breeding choices (Huggins 2000). Horse racing is one of the most popular sports world- These records are held in the General Studbook of wide. The majority of horse races involve the Thor- England (GSB), the first edition of which was pub- oughbred breed, founded in the British Isles in the lished at the end of the 18th century (Weatherby 16th and 17th centuries. Native British mares were 1791). The GSB represents the oldest and most crossed with imported Middle Eastern stallions to give complete record of animal breeding in the world. rise to the elite Thoroughbred we know today (Bower However, recent scientific research comparing the et al. 2011). Extensive pedigree records have been mitochondrial DNA (mtDNA) of Thoroughbred horses © 2012 Blackwell Verlag GmbH • J. Anim. Breed. Genet. (2012) 1–9 doi:10.1111/j.1439-0388.2012.01018.x Thoroughbred racehorse maternal genetic history M. A. Bower et al. has called into question the voracity of the pedigrees foundation events. If maternal sub-lineage is a more recorded in the GSB (Hill et al. 2002; Harrison & Turri- accurate indicator of maternal genetic ancestry than on-Gomez 2006) and thus the validity of the General lineage alone, it would suggest that the GSB is a more Studbook as a record of genetic inheritance. Mito- accurate record of past breeding choices than previ- chondrial D-loop DNA is highly variable and has been ously demonstrated, if only at the sub-lineage level. used extensively for phylogenetic reconstruction of domestic horse origins (Jansen et al. 2002; McGahern Materials and methods et al. 2006; Lei et al. 2009), including the Thorough- bred (Bower et al. 2011). However, it is also a power- Mitochondrial DNA sequences for n = 296 Thorough- ful tool in pedigree reconstruction (Bowling et al. bred horses were included in this study and comprised 2000; Luı´s et al. 2006; A´ lvarez et al. 2012). n = 196 Thoroughbred horse mtDNA sequences Because mitochondrial DNA is maternally inher- generated in the study and 100 mtDNA sequences ited, it follows that horses from the same maternal from the Hill et al., study (Hill et al. 2002). Maternal lineage according to pedigree records should share the lineages and sub-lineages were numbered following same mitochondrial sequence. An analysis of 100 the Lowe Family Figure system (Lowe 1913; Bobinski Thoroughbreds showed that eight of 19 maternal lin- 1953). Pedigrees were traced back to the founding eages contained horses with more than one mito- mare of the maternal lineage of each individual chondrial haplotype, despite being related by direct (Bobinski 1953; Weatherby 2010). Close relatives female descent according to the General Studbook (less than three generations) and individuals for (Hill et al. 2002). Subsequently, in a much larger whom pedigree records were not available were study, Harrison & Turrion-Gomez (2006) identified 28 excluded (n = 10). of 33 Thoroughbred lineages that had horses with mtDNA different to that of the founding female of DNA isolation, amplification and sequencing their maternal lineage, suggesting extensive errors in pedigree records. This has been attributed to confu- Whole genomic DNA was isolated from pulled sion of mares at the foundation stages of the breed hairs according to Allen et al. (1998) and from blood and variability in how accurately or ably early samples using a Nucleon DNA Extraction Kit breeding records were kept, prior to the formalization (Amersham Biosciences UK Limited, Little Chalfont of the breeding record in 1791, although some are Buckinghamshire, UK) following the manufacturer’s attributable to more recent recording events (19th instructions. century – 1980). Amplification of the equine mitochondrial D-loop Subsequent to the founding of the Thoroughbred was performed by PCR. Reactions were performed in breed, well-populated maternal lineages were divided 12.5 ll consisting of 1 ll of DNA extract, 19 HiSpec into sub-lineages (e.g. Lowe Family 1a, 1b etc., Lowe additive (Bioline, UK), 19 PCR buffer (Bioline UK 1913). A sub-lineage was formed where a lineage Limited, London, UK), 2.41 mM MgCl2,25lM each of branched from multiple maternally related horses dNTP and 0.25 U Immolase hot start DNA polymerase (e.g. multiple daughters of a given mare). Being a (Bioline). 0.4 lM of each primer was used. Forward sub-section of a maternal lineage, sub-lineage horses primer: 5′ACCCTGGTCTTGTAAACCAG, reverse primer: should share mtDNA, not only with their sub-lineage 5′TGGTTGCTGATGCGGA. (Hill et al. 2002). Thermo- founder, but also with their original maternal lineage cycling conditions were as follows: initial activation at founder, or tap-root mare. However, if horses share 94°C for 10 min was followed by 39 cycles of 94°C for mtDNA with members of their maternal sub-lineage 1 min, 52°C for 1 min and 72°C for 1 min. Sequenc- but not their maternal lineage, this would indicate ing reactions were carried out in both directions using that sub-lineages represent multiple foundation the Big Dye® Terminator v3.1 cycle (Applied Biosys- events involving horses not related by female descent. tems®, Life Technologies Ltd., Paisley, UK) sequencing We hypothesized that the majority of the errors in kit and internal sequencing primer 5′GTTATGTGT- the GSB pedigree records were occurred at sub-line- GAGCATGGGC. Sequencing products were analysed age founding events. To investigate this, we surveyed on an ABI 3100 Genetic Analyzer, and base calling ® 296 Thoroughbred horses (the largest Thorough- was performed using ABI Prism AB DNA Sequencing bred mtDNA data set available in the public domain Analysis Software v5.1.1. (Applied Biosystems®) All to date). We compared mtDNA and sub-lineage PCR amplicons were sequenced in two directions, pedigrees to investigate whether errors in Thorough- sequences were proof read and compared, and contigs bred pedigrees occurred at maternal sub-lineage were constructed using Mega 4 (Kumar et al. 2004). 2 © 2012 Blackwell Verlag GmbH • J. Anim. Breed. Genet. (2012) 1–9 M. A. Bower et al. Thoroughbred racehorse maternal genetic history All unique sequences were re-amplified and rese- sub-divided into 103 sub-lineages. In some cases, indi- quenced using high-fidelity Taq polymerase (Platinum vidual sub-lineages are under-represented in the data; Taq HiFi; Invitrogen, Life Technologies Ltd., Paisley, therefore, where sample number is below n = 3, UK) to confirm haplotype signature. Sequences were results are not discussed; however, low sample num- deposited in
Load more

Recommended publications
  • Thoroughbred Horses
    Thoroughbred Horses Visit Funny Cide at the KHP Hall of Champions! A long time ago, man tamed the horse. People used horses to farm and to ride. Today, people also race horses. The most popular breed for horse racing is the Thoroughbred. The Thoroughbred is the only horse that can compete in the Kentucky Derby. * This educational packet is intended for third, fourth, and fifth graders. It may be complete in small groups or individually. ! Name:_______________________________ Date:________________________________ The Life Cycle of a Thoroughbred Racehorse Racehorses are born on farms. 1 Baby horses are called foals. ! ! Mother horses are called Mares. Foals live with their mothers. Father horses are called Stallions. 2 ! ! When foals are about six months old they are weaned, meaning separated from their mothers. 3 Weanlings live in a herd made of up horses their age. ! ! When horses turn one year old, they are called yearlings. At this point, boy horses are called colts, and girl horses are called fillies. 4 ! ! 5 Horses start racing at two years old. ! ! Racehorses retire on farms after (hopefully) long careers. Some racehorses become pleasure horses, while others are bred to produce more 6 racehorses. ! ! What about horses? Where do horses live? Horses live in barns and outside. In a barn, a horse lives in a stall. Outside, a horse lives in a pasture. ! White Prince A Rare White Thoroughbred Visit him at the KHP! ! ! What do horses eat? Horses eat a lot during the day. From the time they are born, until they are about 5 months old, foals need to drink their mother’s milk.
    [Show full text]
  • Herd/Partnership Number: ______Name: ______
    Herd/Partnership Number: ________________ Name: __________________ BEFORE YOU SEND IN YOUR 2017 RARE BREEDS CLAIM, PLEASE USE THE CHECKLIST BELOW TO ENSURE ALL REQUIRED DOCUMENTATION IS ATTACHED TO YOUR CLAIM For Equines Only (Connemara Pony, Irish Draught, Kerry Bog Pony) Declaration form provided, completed and signed. Record Sheet provided, completed with 2017 details and signed. Proof of membership of Breed Society as issued. The original document or a certified true copy stamped as a true copy by a Department of Agriculture office, your local DVO office, an Agricultural Consultant or a Teagasc Advisor. (Connemara Pony Breeders Society, Kerry Bog Pony Co-Operative Society or The Irish Horse Board (Irish Draught Horse Breed only)) The original passport for each pony/horse you are claiming for in 2017 or a certified true copy of passport. Pages required are front page, markings page and ownership page all stamped as a true copy by a Department of Agriculture office, your local DVO office, an Agricultural Consultant or a Teagasc Advisor. Breeding females must produce registered offspring before the end of the contract; documentary evidence of offspring, from the Breed Society, must be provided. For Bovines Only (Kerry Cattle, Dexter, Irish Maol) Declaration form provided, completed and signed. Record Sheet provided completed with 2017 details and signed. Proof of membership of Breed Society for 2017. The original document or a certified true copy stamped as a true copy by a Department of Agriculture office, your local DVO office, an Agricultural Consultant or a Teagasc Advisor. (Kerry Cattle Society Ltd, Irish Moiled Cattle Society or UK Dexter Cattle Society) Birth Certificate(s)/Birth Notification(s) for each bovine you are claiming for.
    [Show full text]
  • Multiple Choice Choose the Answer That Best Completes Each Statement Or Question
    Name Date Hour 9 The Horse Industry Multiple Choice Choose the answer that best completes each statement or question. _______ 1. The horse was first domesticated in Europe and Asia about ____ . A. 1,000 years ago B. 3,000 years ago C. 5,000 years ago D. 8,000 years ago _______ 2. Horses were brought to the New World by Spanish explorers in the ____ . A. 15th century B. 16th century C. 17th century D. 18th century _______ 3. Horses are measured in terms of hands with a hand being ____ . A. two inches B. four inches C. six inches D. eight inches _______ 4. Ponies are shorter than horses and can be anywhere from 8 to ____ . A. 10 hands high B. 12.2 hands high C. 14.2 hands high D. 16 hands high _______ 5. Which horse breed is considered the oldest purebred horse in the world? A. Arabian B. Appaloosa C. Thoroughbred D. Quarter Horse Introduction to Agriscience | Unit 9 Test CIMC 1 _______ 6. Which horse breed has as one of its characteristics a distinctive spotted coat? A. Arabian B. Appaloosa C. Thoroughbred D. Quarter Horse _______ 7. Which horse breed was developed in the United States and got its name because of its great speed at short distances? A. Arabian B. Appaloosa C. Thoroughbred D. Quarter Horse _______ 8. Which horse breed was developed in the deserts of the Middle East? A. Arabian B. Appaloosa C. Thoroughbred D. Quarter Horse _______ 9. Which horse breed has a head characterized by a dished profile, prominent eye, large nostrils, and small muzzle? A.
    [Show full text]
  • Irish Breeds Quiz Answers 1. What County In
    Irish Breeds Quiz Answers 1. What county in Ireland does the Connemara Pony originate from? County Galway 2. Traditionally, for what purpose was the Irish Cob bred? To pull a cart / wagon To travel long distances To be suitable for children To be strong and sturdy 3. List three typical traits of the Irish Draught: 1. Versatile 2. Intelligent 3. Kind / willing nature Strong and sturdy, pulling / staying power / hardy 4. What are the two main composite breeds of the Irish Sport Horse? 1. Irish Draught 2. Thoroughbred 5. What is the smallest Irish native breed? Kerry Bog Pony 6. What three horse breeds can be included in a horse’s pedigree for it to qualify as a Traditional Irish Horse? Connemara Pony, Irish Draught, Thoroughbred 7. List three typical traits of the Connemara Pony: 1. Sure footed 2. Hardy 3. Calm / willing / kind temperament Staying power / intelligent / sound / athletic / versatile 8. Name one typical conformation trait of the Irish Cob: Stout, powerful, wide / short back, wide chest / good bone 9. For what activities were the Irish Draught originally bred? Farm work / pulling machinery, riding, hunting, driving 10. For what activities are Irish Draughts bred for today? Leisure / riding horses / allrounders, competition, cross breeding 11. What traits make the Irish Sport Horse so well suited to Equestrian sport today? Athleticism, jumping ability, courage, intelligence, soundness, kind temperament 12. What are the two main reasons for producing Kerry Bog Ponies? 1. To pull machinery 2. As riding ponies for children Companion ponies Showing .
    [Show full text]
  • Population Genetic Analysis of the Estonian Native Horse Suggests Diverse and Distinct Genetics, Ancient Origin and Contribution from Unique Patrilines
    G C A T T A C G G C A T genes Article Population Genetic Analysis of the Estonian Native Horse Suggests Diverse and Distinct Genetics, Ancient Origin and Contribution from Unique Patrilines Caitlin Castaneda 1 , Rytis Juras 1, Anas Khanshour 2, Ingrid Randlaht 3, Barbara Wallner 4, Doris Rigler 4, Gabriella Lindgren 5,6 , Terje Raudsepp 1,* and E. Gus Cothran 1,* 1 College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX 77843, USA 2 Sarah M. and Charles E. Seay Center for Musculoskeletal Research, Texas Scottish Rite Hospital for Children, Dallas, TX 75219, USA 3 Estonian Native Horse Conservation Society, 93814 Kuressaare, Saaremaa, Estonia 4 Institute of Animal Breeding and Genetics, University of Veterinary Medicine Vienna, 1210 Vienna, Austria 5 Department of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, 75007 Uppsala, Sweden 6 Livestock Genetics, Department of Biosystems, KU Leuven, B-3001 Leuven, Belgium * Correspondence: [email protected] (T.R.); [email protected] (E.G.C.) Received: 9 August 2019; Accepted: 13 August 2019; Published: 20 August 2019 Abstract: The Estonian Native Horse (ENH) is a medium-size pony found mainly in the western islands of Estonia and is well-adapted to the harsh northern climate and poor pastures. The ancestry of the ENH is debated, including alleged claims about direct descendance from the extinct Tarpan. Here we conducted a detailed analysis of the genetic makeup and relationships of the ENH based on the genotypes of 15 autosomal short tandem repeats (STRs), 18 Y chromosomal single nucleotide polymorphisms (SNPs), mitochondrial D-loop sequence and lateral gait allele in DMRT3.
    [Show full text]
  • List of Horse Breeds 1 List of Horse Breeds
    List of horse breeds 1 List of horse breeds This page is a list of horse and pony breeds, and also includes terms used to describe types of horse that are not breeds but are commonly mistaken for breeds. While there is no scientifically accepted definition of the term "breed,"[1] a breed is defined generally as having distinct true-breeding characteristics over a number of generations; its members may be called "purebred". In most cases, bloodlines of horse breeds are recorded with a breed registry. However, in horses, the concept is somewhat flexible, as open stud books are created for developing horse breeds that are not yet fully true-breeding. Registries also are considered the authority as to whether a given breed is listed as Light or saddle horse breeds a "horse" or a "pony". There are also a number of "color breed", sport horse, and gaited horse registries for horses with various phenotypes or other traits, which admit any animal fitting a given set of physical characteristics, even if there is little or no evidence of the trait being a true-breeding characteristic. Other recording entities or specialty organizations may recognize horses from multiple breeds, thus, for the purposes of this article, such animals are classified as a "type" rather than a "breed". The breeds and types listed here are those that already have a Wikipedia article. For a more extensive list, see the List of all horse breeds in DAD-IS. Heavy or draft horse breeds For additional information, see horse breed, horse breeding and the individual articles listed below.
    [Show full text]
  • Putting the Cart Before the Horse: Barriers to Enforcing a Code of Ethics for Thoroughbred Auctions in the United States Catharine Altier
    Brooklyn Law Review Volume 72 | Issue 3 Article 4 2007 Putting the Cart Before the Horse: Barriers to Enforcing a Code of Ethics for Thoroughbred Auctions in the United States Catharine Altier Follow this and additional works at: https://brooklynworks.brooklaw.edu/blr Recommended Citation Catharine Altier, Putting the Cart Before the Horse: Barriers to Enforcing a Code of Ethics for Thoroughbred Auctions in the United States, 72 Brook. L. Rev. (2007). Available at: https://brooklynworks.brooklaw.edu/blr/vol72/iss3/4 This Note is brought to you for free and open access by the Law Journals at BrooklynWorks. It has been accepted for inclusion in Brooklyn Law Review by an authorized editor of BrooklynWorks. NOTES Putting the Cart Before the Horse BARRIERS TO ENFORCING A CODE OF ETHICS FOR THOROUGHBRED AUCTIONS IN THE UNITED STATES I. INTRODUCTION In today’s thoroughbred racing world, sometimes what you see is not at all what you get. Even veteran horsemen will admit that “[t]here is a fine line between the showmanship of showing a horse at its fullest and fraud.”1 Most surprisingly, this deception often begins long before a thoroughbred has even run its first race. Sales practices that may appear fraudulent to horse racing outsiders are tolerated, or even accepted as customary practice, at thoroughbred auctions.2 For example, before being sold, horses are sometimes injected with steroids to make their chests appear stronger.3 Agents, hired to bid for prospective owners, have been caught defrauding their principals by colluding with sellers and accepting undisclosed commissions.4 Sellers even use agents to bid on their own 1 Joe Drape, No Gift Horses Here, So Look in Their Mouths, N.Y.
    [Show full text]
  • Special Issue Horse Genetics DIRECTOR’S Message
    CENTER FOR EQUINE HEALTH SCHOOL OF VETERINARY MEDICINE • UNIVERSITY OF CALIFORNIA, DAVIS SUMMER 2020 Special Issue Horse Genetics DIRECTOR’S Message s an equine genetics researcher, I am particularly excited to share A this special issue of the Horse Report with you. Inside, you will find a roadmap to many of the currently available equine genetic tests, including the AQHA “five-panel” test, and more. The equine genome sequence was published in 2009, the result of a years- long collaborative effort by the international equine research community. This resource drastically changed how researchers approach equine genetics and accelerated the rate of discovery. Increased availability and affordability allowed the application of advanced molecular tools to equine diseases and traits. As a result, genetic tests are available in a variety of breeds. Most available tests are for simple, Mendelian diseases and traits – those caused by a single gene or locus. Complex diseases and traits likely involve more than one gene and may be influenced by environmental effects. The 2018 release of a new equine genome sequence assembly, coupled with cost reductions that make whole-genome sequencing possible for large numbers of horses, are enabling research in these areas. As an equine geneticist and veterinarian, I am especially interested in applying whole genome sequencing and advanced diagnostic tools to equine precision medicine. This highly individualized approach will focus on early detection and prevention of disease, taking into account both genetic information and environmental factors. The idea is to target individuals based on their clinical condition as well as their unique body chemistry and genetics.
    [Show full text]
  • Electronic Supplementary Material - Appendices
    1 Electronic Supplementary Material - Appendices 2 Appendix 1. Full breed list, listed alphabetically. Breeds searched (* denotes those identified with inherited disorders) # Breed # Breed # Breed # Breed 1 Ab Abyssinian 31 BF Black Forest 61 Dul Dülmen Pony 91 HP Highland Pony* 2 Ak Akhal Teke 32 Boe Boer 62 DD Dutch Draft 92 Hok Hokkaido 3 Al Albanian 33 Bre Breton* 63 DW Dutch Warmblood 93 Hol Holsteiner* 4 Alt Altai 34 Buc Buckskin 64 EB East Bulgarian 94 Huc Hucul 5 ACD American Cream Draft 35 Bud Budyonny 65 Egy Egyptian 95 HW Hungarian Warmblood 6 ACW American Creme and White 36 By Byelorussian Harness 66 EP Eriskay Pony 96 Ice Icelandic* 7 AWP American Walking Pony 37 Cam Camargue* 67 EN Estonian Native 97 Io Iomud 8 And Andalusian* 38 Camp Campolina 68 ExP Exmoor Pony 98 ID Irish Draught 9 Anv Andravida 39 Can Canadian 69 Fae Faeroes Pony 99 Jin Jinzhou 10 A-K Anglo-Kabarda 40 Car Carthusian 70 Fa Falabella* 100 Jut Jutland 11 Ap Appaloosa* 41 Cas Caspian 71 FP Fell Pony* 101 Kab Kabarda 12 Arp Araappaloosa 42 Cay Cayuse 72 Fin Finnhorse* 102 Kar Karabair 13 A Arabian / Arab* 43 Ch Cheju 73 Fl Fleuve 103 Kara Karabakh 14 Ard Ardennes 44 CC Chilean Corralero 74 Fo Fouta 104 Kaz Kazakh 15 AC Argentine Criollo 45 CP Chincoteague Pony 75 Fr Frederiksborg 105 KPB Kerry Bog Pony 16 Ast Asturian 46 CB Cleveland Bay 76 Fb Freiberger* 106 KM Kiger Mustang 17 AB Australian Brumby 47 Cly Clydesdale* 77 FS French Saddlebred 107 KP Kirdi Pony 18 ASH Australian Stock Horse 48 CN Cob Normand* 78 FT French Trotter 108 KF Kisber Felver 19 Az Azteca
    [Show full text]
  • Equestrian Complex of the President of Turkmenistan
    Equestrian Complex of the President of Turkmenistan Divine horses, equine aristocrats, fabled steeds and effulgent diamonds - such flowery epithets have been lavished upon that unique equine breed - the Akhal-Teke. Prized by Alexander the Great, Darius the Great, Genghis Khan, Roman emperors, Marco Polo, and many others, the Akhal-Tekes have served people for over 3,000 years. These are one of the most beautiful, elegant and proud horses in the world. Its endurance and resistance to heat are second to none. The Akhal-Tekes come from the Kara-Kum Desert in Turkmenistan. It is a place for the toughest people and equines. The Turkmens would never have survived without the Akhal-Teke, and vice versa. Turkmens were the first desert people to produce a horse ideal for the tough desert conditions. Akhal-Teke horses are thought to be one of the oldest surviving horse breeds. Today's Akhal-Teke is a race, sports and endurance horse, and a riveting circus performer. The Akhal-Teke takes its name from a Turmen tribe Teke living in the Akhal oasis. The Turkmen horse-breeders have been perfecting the appearance and muscular system of the thoroughbred racers for ages in concordance with traditions and customs of their ancestors. Traditions of selection and feeding, reproduction and training of horses were handed over from generation to generation. A Turkmen has never separated himself from a horse. A horse was a family member; it was cherished and valued higher than one’s own life. A profile of Yanardag, a stallion known for its beautiful appearance and great racing qualities, is in the center of the State Emblem of Turkmenistan.
    [Show full text]
  • Discriminant Canonical Analysis of the Contribution of Spanish and Arabian Purebred Horses to the Genetic Diversity and Population Structure of Hispano-Arabian Horses
    UC Davis UC Davis Previously Published Works Title Discriminant Canonical Analysis of the Contribution of Spanish and Arabian Purebred Horses to the Genetic Diversity and Population Structure of Hispano-Arabian Horses. Permalink https://escholarship.org/uc/item/8w77w522 Journal Animals : an open access journal from MDPI, 11(2) ISSN 2076-2615 Authors Marín Navas, Carmen Delgado Bermejo, Juan Vicente McLean, Amy Katherine et al. Publication Date 2021-01-21 DOI 10.3390/ani11020269 Peer reviewed eScholarship.org Powered by the California Digital Library University of California animals Article Discriminant Canonical Analysis of the Contribution of Spanish and Arabian Purebred Horses to the Genetic Diversity and Population Structure of Hispano-Arabian Horses Carmen Marín Navas 1 , Juan Vicente Delgado Bermejo 1 , Amy Katherine McLean 2 , José Manuel León Jurado 3, Antonio Rodriguez de la Borbolla y Ruiberriz de Torres 4 and Francisco Javier Navas González 1,* 1 Department of Genetics, Faculty of Veterinary Sciences, University of Córdoba, 14071 Córdoba, Spain; [email protected] (C.M.N.); [email protected] (J.V.D.B.) 2 Department of Animal Science, University of California Davis, Davis, CA 95617, USA; [email protected] 3 Centro Agropecuario Provincial de Córdoba, Diputación Provincial de Córdoba, 14071 Córdoba, Spain; [email protected] 4 Unión Española de Ganaderos de Pura Raza Hispano-Árabe, 41001 Sevilla, Spain; [email protected] * Correspondence: [email protected]; Tel.: +34-957-21-87-06 Simple Summary: The demographic and genetic diversity structure and the contributions of Spanish (PRE) and Arabian Purebred (PRá) horses to the process of conformation of the Hispano-Arabian Citation: Marín Navas, C.; Delgado (Há) horse breed were evaluated.
    [Show full text]
  • Mitochondrial D-Loop Sequence Variation and Maternal Lineage in the Endangered Cleveland Bay Horse
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.19.104273; this version posted May 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Mitochondrial D-loop sequence variation and maternal lineage in the endangered Cleveland Bay horse A.C. Dell1,2*, M.C. Curry1, K.M. Yarnell3, G.R. Starbuck3 and P. B. Wilson2,3* 1 Department of Biological Sciences, University of Lincoln, Brayford Way, Brayford Pool, Lincoln LN6 7TS 2 Rare Breeds Survival Trust, Stoneleigh Park, Stoneleigh, Warwickshire CV8 2LG 3 School of Animal, Rural and Environmental Sciences, Brackenhurst Campus, Nottingham Trent University, Brackenhurst Ln, Southwell, Nottinghamshire, NG25 0QF * Corresponding authors: [email protected], [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.19.104273; this version posted May 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Genetic diversity and maternal ancestry line relationships amongst a sample of 96 Cleveland Bay horses were investigated using a 479bp length of mitochondrial D- loop sequence. The analysis yielded at total of 11 haplotypes with 27 variable positions, all of which have been described in previous equine mitochondrial DNA d- loop studies.
    [Show full text]