Genetic Diversity and Phylogeny of the Endangered Okinawa Rail, Gallirallus Okinawae

Genes Genet. Syst. (2010) 85, p. 55–63 Genetic diversity and phylogeny of the endangered Okinawa Rail, Gallirallus okinawae Kiyoaki Ozaki,1* Yoshihiro Yamamoto2 and Satoshi Yamagishi1 1Yamashina Institute for Ornithology, 115 Konoyama, Abiko, Chiba 270-1145, Japan 2Department of Genetics, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501, Japan (Received 6 November 2009, accepted 28 January 2010) Genetic diversity of the wild population of the endangered Okinawa Rail, Gallirallus okinawae, was revealed by analyzing haplotypes in the mitochondrial control region for 177 individuals. We found 6 haplotypes with nucleotide differences at 6 sites. The four major haplotypes, Type 1 to Type 4, were present in 121 (68.4%), 21 (11.9%), 8 (4.5%) and 25 individuals (14.1%), respectively. Type 5 and Type 6 were each found in one individual. The gene diversity (h) and nucleotide diversity (π) of Okinawa Rail were calculated to be 0.499 ± 0.040 and 0.00146 ± 0.00098, respectively. Gene diversity in Okinawa Rail is higher than that found in other endangered avian species, but the relative nucleotide diversity is lower due to few nucleotide differences among the haplotypes. Our sample of 177 individuals represents 20–25% of the total population, and thus allows a rigorous estimate of the population structure of Okinawa Rail, and makes it unlikely that more haplotypes would be found with additional sampling. The low nucleotide diversity in the control region may indicate that Okinawa Rail has gone through a recent bottleneck. The minimal span network of haplotypes, and the distribution pattern of sampled individuals, indicate that the number of birds with rare haplotypes, Type 5 and 6, decreased during the recent population decline caused by habitat loss and introduced predators. Our results are relevant to the current conservation program for the endangered Okinawa Rail, and perhaps for other species of flightless rails. Key words: genetic diversity, Gallirallus okinawae, mitochondrial DNA, Okinawa Rail, phylogenetic analysis other pests (Kishida, 1931). In addition, habitat frag- INTRODUCTION mentation due to anthropogenic causes also contributed In 1981, a new avian species was discovered in the to the population decline. Similarly, other species of northern part of Okinawa Island, Japan (Yamashina and island-dwelling flightless rails have declined as a result of Mano, 1981). This endemic forest species was named the predation and habitat fragmentation (Taylor, 1998). Okinawa Rail, Gallirallus okinawae, and is nearly flight- Recently, the Yamashina Institute for Ornithology ini- less and nests on the ground (Harato and Ozaki, 1993). tiated the Mitochondrial Genome Project with the goal of The population size of Okinawa Rail was estimated to be sequencing the entire mitochondrial genome of endan- 1,800 individuals in 1986 (Hanawa and Morishita, 1986), gered birds of Japan (Yamamoto et al., 2005). With this however, surveys in 2004 and 2005 revealed that the pop- information, it is possible to identify nucleotide variations ulation had dropped to 810 and 720 individuals, respec- in mitochondria and haplotypes, and elucidate current tively (Ozaki et al., 2006). This decline was primarily population structure. For the Okinawa Rail, we also due to predation by the Asian mongoose, Herpestes used the sequence of the mitochondrial genome to mea- javanicus (Ozaki et al., 2002), introduced in 1910 to con- sure nucleotide diversity and conduct a phylogenetic trol the venomous snake, Protobothrops flavoviridis, and analysis. Phylogenetic analyses, based on mitochondrial sequence data, have been conducted for some rail species Edited by Hidenori Tachida in order to better understand their evolution of flightless- * Corresponding author. E-mail: [email protected] ness (Trewick, 1997; Slikas et al., 2002). These authors Note: Nucleotide sequence data reported are available in the DDBJ/EMBL/GenBank databases under the accession num- concluded that the evolution of flightlessness in rails was bers AP010821, AP010822 and AP010823. rapid and independent. Houde et al. (1997) analyzed 56 K. OZAKI et al. phylogenetic relationships between Gruiformes birds, ples were preserved in 100% ethanol. After washing including rails, using DNA sequences of mitochondrial samples twice with DNA extraction buffer containing 50 12S-rRNA genes. Also, a phylogeny of five core families mM Tris-HCl (pH 8.0), 10 mM EDTA and 100 mM NaCl, in Gruiformes was conducted using sequence data of four DNA was extracted using the SDS-protease-phenol mitochondrial and three nuclear genes (Fain et al., 2007). method (Sambrook et al., 1989). A phylogenetic analysis of Okinawa Rail was made to clarify its relationship to other rails using the correspond- Determination of the total mitochondrial genome ing sequences from the published data above. of the Okinawa Rail Some related DNA sequences of Analyses of genetic diversity of wild populations of mitochondrial 12S-rRNA and cytochrome-B (cytB) genes island-dwelling flightless rails have not been previously have been registered in the DNA data bank. Three 12S- conducted, though genetic diversity of captive Guam Rails rRNA genes from Clapper Rail (Rallus longirostris, Acces- (Gallirallus owstoni) has been examined using allozymes sion number: DQ485825), Water Rail (Rallus aquaticus: and minisatellite DNA profiles (Haig and Ballou, 1995). U77149) and Buff-banded Rail (Rallus philippensis In 2004, planning was initiated to develop a captive dieffenbachia: U88026) were aligned by clustalW, and breeding and re-introduction program for the endangered PCR primer ROMT02 was made in a preserved region of Okinawa Rail (Ozaki, 2008). Required baseline data for 12S-rRNA gene. ROMT01 was also designed in the cytB this plan included an estimate of the rail population size gene by comparison with four cytB genes of Clapper Rail and its genetic diversity. To evaluate genetic diversity, (Rallus longirostris: DQ485908), Water Rail (Rallus we determined the nucleotide sequences of the mitochon- aquaticus: U77172), Takahe (Porphyrio mantelli drial control region in 177 wild individuals. Here, we hochstetteri: U77167) and Sooty Crake (Porzana tabuensis: describe our haplotype analysis of the mitochondrial con- U77170). ROMT01 and ROMT02 primers were expected trol region, and describe the population structure of the to amplify the coding region between cytB and 12S-rRNA endangered Okinawa Rail. These results should also be genes of the Okinawa Rail, and their sequences are shown useful in conserving other flightless rails. in Table 1. Long PCR was carried out with ROMT01 and ROMT02 primers using total cellular DNA of Okinawa Rail as a MATERIALS AND METHODS template and the TaKaRa LA-PCR kit (Takara Bio. Co., Samples and DNA extraction DNA was extracted Shiga, Japan). The components of the procedure were: from 177 samples: 61 blood samples were obtained from denaturing the DNA at 96°C for 3 min, followed by 30 wild Okinawa Rails either captured for banding, or unin- cycles of denaturing at 98°C for 10 sec, primer annealing tentionally caught in mongoose traps; 20 tissue samples and elongating at 68°C for 15 min, and an additional elon- were collected from un-hatched dead embryos; and 96 gation at 72°C for 10 min. A DNA fragment, approxi- muscle samples were taken from dead birds, of which 67 mately 13 kb in size, was amplified and purified by had been killed by cars and 18 by predators. Samples, agarose gel electrophoresis. The DNA sequence of the and thus haplotypes, were collected from the northeast- fragment was determined using the M13 shotgun method ern portion of Okinawa Island (Fig. 4). All tissue sam- as described by Yamamoto et al. (2000). Next, ROMT03 Table 1. PCR primers used in the genetic analysis of Okinawa Rail Primer Sequence (5’-3’) Position2 ROMT011 GCCTGAAATAGCCTCTAGAAGGAGGATTTAGCAG 5617–5650 ROMT021 GTGTCTGCGGTATAGTGTATGGCTAGTAGTAGGC 179 –146 ROMT03 CCTAGAATCATTCGCCATCTCAGCCCTCACTATC 18340 –18373 ROMT04 CTACGTCTTGGTGCTAAGTGCACCTTCCGGTAC 5826 –5794 ROD01 CACCGCGGCATGTAATCATGTAC 2609 –2631 ROD02 GGACGAAGTCCATTGATGCTCAC 3274 –3252 ROD03 GGATCACCGACAGATCCTCGCTC 3156 –3178 ROD04 GTCTTTCGAACATTAACTAACATG 3664 –3641 1 The underscores in ROMT01 and ROMT02 primers show mismatched nucleotides compared with the mitochondrial genome of Okinawa Rail. Two and three mismatches were found because the primers were made from cytB and 12S- rRNA genes of related species. 2 Positions indicate corresponding sequence positions of the mitochondrial genome of Okinawa Rail (Accession No. AP010821). Genetic diversity and phylogeny of Okinawa Rail 57 and ROMT04 primers (Table 1) were made at both ends of the 13 kb DNA to amplify the rest of the mitochondrial genome. PCR conditions were: denaturation at 96°C for 3 min, 30 cycles of denaturing at 98°C for 10 sec, primer annealing and elongating at 68°C for 6 min, and an additional elongation at 72°C for 10 min. The long-PCR product was about 5 kb in length, and its DNA sequence was determined using the procedures described above. Total DNA sequence was obtained by combining both sequences, and was found to be 18,404 bp. The total mitochondrial genome sequence of Okinawa Rail was registered with the DNA data bank under accession number Fig. 1. Organization of mitochondrial control region of Okinawa AP010821. After determination of the entire mitochon- Rail. Repeat A, 649 bp, contains 4.36 repeats of a unique 149 drial genome, the first long PCR primers, ROMT01 and bp sequence. Repeat

Load more