DOCSLIB.ORG

US 2002/0051792 A1 WNSLOW Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
US 2002/0051792 A1 WNSLOW Et Al US 2002005 1792A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2002/0051792 A1 WNSLOW et al. (43) Pub. Date: May 2, 2002 (54) RECOMBINANT VIRUS EXPRESSING Related U.S. Application Data FOREIGN DNA ENCODING FELINE CD80, FELINE CD86, FELINE CD28, FELINE (63) Non-provisional of provisional application No. CTLA-4 OR FELINE INTEFERON-GAMMA 60/083,870, filed on May 1, 1998. AND USES THEREOF Publication Classification (51) Int. Cl. ................................................. A61K 39/12 (76) Inventors: BARBARA.J. WINSLOW, DEL (52) U.S. Cl. .......................................................... 424/199.1 MAR, CA (US); MARK D. COCHRAN, CARLSBAD, CA (US) (57) ABSTRACT The present invention involves a recombinant virus which comprises at least one foreign nucleic acid inserted within a Correspondence Address: non-essential region of the Viral genome of a virus, wherein PAMELA G. SALKELD, ESQ. each Such foreign nucleic acid encodes a protein. The SCHERING-PLOUGH CORPORATION, protein which is encoded is Selected from the groups con PATENT DEPARTMENT Sisting of a feline CD28 protein or an immunogenic portion 2000 GALLOPING HILL ROAD, BUILDING thereof, a feline cD80 protein or an immunogenic portion K-6-1 thereof, a feline CD86 protein or an immunogenic portion MALSTOP 1990 thereof, or a feline CTLA-4 protein or an immunogenic KENILWORTH, NJ 07033 (US) portion thereof. The protein is capable of being expressed when the recombinant Virus is introduced into an appropiate (*) Notice: This is a publication of a continued pros host. The present invention also involves a recombinant ecution application (CPA) filed under 37 Virus further comprising a foreign nucleic acid encoding an CFR 1.53(d). immunogen derived from a pathogen. The present invention also compriseS recombinant viruses which are capable of (21) Appl. No.: 09/303,040 enhancing an immune response in a feline. The present invention also comprises recombinant viruses which are (22) Filed: Apr. 30, 1999 capable of Suppressing an immune respons in a feline. Patent Application Publication May 2, 2002 Sheet 1 of 13 US 2002/0051792 A1 FIG. 1A-1 FeB71.TAMU ATGGGCACGCAGCA AAGTGGAAAACACCACT ACTGAAGCACCCATACCCAAGCTCTT 6O Met Giy His Alo Ala Lys trip Lys Thr Pro Leu Leu Lys His Pro Tyr Pro Lys leu Phe -------- CCGCCGAGCTAGC AGTCTTTTTTAC CTGTTCAGGTATCAT CCAGGGAACAAG 120 Pro Leu Leu Met Leu Ala Ser Leu Phe Tyr Phe Cys Ser Giy Ile le Gin Val Asn Lys ACAGTGGAAGAAGTAGCAGTACTATCCTGTGATTACAACATTTCCACCAAAGAACTGACG i8O Thr Val Glu Glu Wol Ala Wol lieu Ser Cys Asp Tyr Asn the Ser Thrys Glu Leu Thr GAAATTCGAATCTATTGGCAAAAGGATGATGAAATGGTGTTGGCTGT CATGTCTGGCA AA 240 Glu Te Arg e Tyr Trp Gin Lys Asp Asp Glu Met Val Leu Ala Val Met Ser Gly lys GT ACAAGTGIGGCCCAAGTACAAGAACCGCACATTCACTGACGTCACCGAT. AACCACTCC 300 Wol Gin Val Trip Pro llys Tyr Lys Asn Arg Thr Phe Thr Asp Val Thr Asp Asn His Ser ATTGTGATCATGGCTCTGCGCCTGTCAGACAATGGCAAAT ACACTTGTATTATCAAAAG 36O lie Wai le Met Aio eu Arg Leu Ser Asp Asn Gly Lys Tyr Thr Cys Ile lie Gin Lys ATTGAAAAAGGGTCTTACAAAGTGAAACACCTGACTTCGGTGATGTTATTGGTCAGAGCT (i2O ille Glu lys Gly Ser Tyr Lys Val Lys His Leu Thr Ser Val Met Leu Leu Val Arg Alo GAC TCCCTGTCCCTAGTATAACTGATCTTGGAAATCCA TCTCATAACATCAAAAG GATA 480 Asp Phe Pro Vol. Pro Ser le Thr Asp leu Giy ASn Pro Ser His Asn ille lys Arg ile ATGTGCTTAACTTCTGGAGGTTTTCCAAAGCCT CACCTCTCCTGGCTGGAAAATGAAGAA 50 Met Cys Leu Thr Ser Giy Gly Phe Pro Lys Pro His Leu Ser Trp Leu Glu Asn Glu Glu GAATT AAATGCCATCA ACACAACAGTTTCCCAAGATCCTGAA ACTGAGCTCT ACACTATT 600 Gu eu Asn Alo e Asn Thr Thr Wal Ser Gin Asp Pro Glu Thr Gu eu tyr Thr ile AGCAGTGAACTGGATTTCAAT ATGACAAACAACC AT AGCTTCCTGTGT CTTGTCA AG TAT 66O Ser Ser Gu Leu Asp Phe Asn Met hr Asn Asn His Ser Phe lieu Cysteu Vol Lys Tyr Patent Application Publication May 2, 2002 Sheet 2 of 13 US 2002/0051792 A1 FiG. 1A-2 GGAAACTTACTAGTATCACAGATCTTC AACGGC AAAAATCAGAGCCACAGCCT CAAT 72O Gly Asn Leu Leu Wat Ser Gin Ile Phe ASn Trp Gln Lys Ser Glu Pro Gin Pro Ser Asn AATCAGCTCTGGATCAT, ATCCTGAGCT CAG TAGTAAGTGGGAT G T G GATCACTGCA 78O Asn Gin Leu Trp Ile Ile Ile Leu Ser Ser Val Val Ser Gly ille Val Val Ile Thr Alo CTTACCTTAAGATGCCTAGTCCACAGACCTGCTGCAAGGTGGAGACAAAGAGAAATGGGG 80 Leu i hr Leu Arg Cys Leu Val His Arg Pro Alo Alo Arg Trp Arg Gin Arg Glu Met Gly AGAGCGCGGAAATGGAAAAGATCT CACCTGTCT ACAT AGATTCTGCAGAACCACTGTATG 900 Arg Ala Arg lys Trp Lys Arg Ser His Leu Ser Thr - - - - - - - CAGAGCATCTGGAGGTAGCCTCTTTAGCTCTTCTCT ACT AG 941 Patent Application Publication May 2, 2002 Sheet 3 of 13 US 2002/0051792 A1 (1-/g)ogqoaulja)noldKi?o|goudoip^H Patent Application Publication May 2, 2002 Sheet 4 of 13 US 2002/0051792 A1 F.G. 2A-1 FeB71-SYNTRO ATGGGTCACGCAGCAAAGTGGAAAACACCACT ACTGAAGCACCCATATCCCAAGCTCTTT 6O Met Giy His Alo Alo Lys Trip Lys Thr Pro Leu Leu Lys His Pro Tyr Pro Lys Leu Phe ------ . CCGCTCTTGATGCTAGCTAGTCTTTTTT ACTTCTGTTCAGGTATCATCCAGGTGAACAAG 120 Pro Leu Leu Met Leu Ala Ser Leu Phe Tyr Phe Cys Ser Gly ile lie Gin Wol Asn Lys ACAGTGGAAGAAGTAGCAGTACTATCCTGTGATTACAACATTTCCACCAAAGAACTGACG 180 Thr Val Glu Glu Vol Alo Wat Leu Ser Cys Asp Tyr Asn ille Ser Thr Lys Glu Leu Thr GAAATTCGAATCATTGGCAAAAGGATGAGAAATGGGTTGGCTGT CATGCTGG CAAA 24O Glu le Arg ile Tyr Trp Gin Lys Asp Asp Glu Met Wai Leu Ala Wal Met Ser Giy Lys GT ACAAGTGGGCCCAAGTACAAGAA CCGCACATTCACTGACGTCACCGATA ACCACTCC 3OO Voi Gln Val Trp Pro Lys Tyr Lys Asn Arg Thr Phe Thr Asp Vol Thr Asp Asn His Ser ATTGTGATCATGGCTCTGCGCC GT CAGACAATGGCAAAT ACA CTTGTATCAT CAAAAG 360 Ile Vol Ile Met Ala Leu Arg Leu Ser Asp Asn Gly lys Tyr Thr Cys I e Ile Gin Lys ATTGAAAAAGGGTCTTACAAAGTGAAACAC CTGACTTCGGTGATGTATTGGT CAGAGCT 42O Ile Glu Lys Gly Ser Tyr Lys Vol lys His Leu Thr Ser Wal Met eu Leu Val Arg Ala GACT TCCCTGTCCCTAGTATAACTGATCTTGGAAATCCATCT CAT AACAT CAAAAGGATA 480 Asp Phe Pro Val Pro Ser tie Thr Asp Leu Giy ASn Pro Ser His Asn ille Lys Arg ile ATGTGCTTAACTTCTGGAGGTTTTCCAAAGCCT CAC CTCTCCTGGCTGGAAAATGAAGAA 540 Met Cys Leu Thr Ser Gly Gly Phe Pro Lys Pro His Leu Ser Trp Leu Glu Asn Glu Glu GAATTAAATGCC ATCAA CACAACAGTTTCCCAAGATCCTGAAACTGAGCTCT ACACT ATT 600 Glu Leu Asn Ala ille Asn Thr Thr Val Ser Gin Asp Pro Glu Thr Gu Leu Tyr Thr le AGCAGTGAACTGGATTT CAAT ATGACAAACAACCATAGCTTCCTGTGTCTTGT CAAGTAT 660 Ser Ser Glu Leu Asp Phe Asn Met Thr Asn Asn His Ser Phe Leu Cys Leu Val Lys lyr Patent Application Publication May 2, 2002 Sheet 5 of 13 US 2002/0051792 A1 FIG. 2A-2 GGAAACTTAAT AGTATCACAGAT CTTCAACTGGCAAAAATCAGAGCCACAGCCTTCTAAT 72O Gly Asn Leu le Val Ser Gin lie Phe Asn Trp Gin Lys Ser Glu Pro Gin Pro Ser Asn AATCAGCTCTGGATCATTATCCTGAGCTCAGTAGTAAGTGGGATTGTTGTGAT CACT GCA 78O ASn Gin Leu Triple Ile Ile Leu Ser Ser Val Val Ser Gly Ile Val Val Ile Thr Ala CTTAC CTTAAGAT GCCTAGTCCACAGACCTGCTG CAAGGTGGAGACAAAGAGAAATGGGG 84O Leu Thr eu Arg Cys Leu Val His Arg Pro Aio Alo Arg Trp Arg Gin Arg Glu Met Gly AGAGCGCGGAAATGGAAAAGATCT CACCTGTCT ACAT AG 879 Arg Aid Arg lys Trip Lys Arg Ser His Leu Ser Thr - - - - - - - Patent Application Publication May 2, 2002 Sheet 6 of 13 US 2002/0051792 A1 ogzoffzOza0020810910;iOZ001080º03 Patent Application Publication May 2, 2002 Sheet 7 of 13 US 2002/0051792 A1 F.G. 3A-1 FeB72 GTTTCTGTGT CCTCGGGAA GT CACTGAGCTTATACATCTGGT CTCTGGGAGCTGCAG 60 GGATGGGCATTT GTGACAGCAC ATGGGACTGA GT CACACTCTCCTTGTGATGGCCCTCC Met----- Gly ille Cys Asp Ser Thr Met Giy Leu Ser His Thr Leu Leu Wal Met Ala Leu 2O TGCTCTCGGTGTTTCTTCCATGAAGAGTCAAGCATATTCAACAAG ACTGGAGAACTGC Leu Leu Ser Gly Val Ser Ser Met Lys Ser Gin Ala Tyr Phe Asn Lys Thr Giy Glu Leu 80 CATGCCATTTTACAAACTCTCAAAACATA AGCCTGGATGAGCTGGTAGTATTTTGGCAGG Pro Cys His Phe Thr Asn Ser Gin Asn ille Ser Leu Asp Glu Leu Val Val Phe Trp Gin 20 ACCAGGATAAGCTGGTTCGTATGAGATATTCAGAGGCAA AGAGAACCCT CAAAATGTTC Asp Gin Asp Lys Leu Val Leu Tyr Glu le Phe Arg Gly Lys Glu Asn Pro Gin Asn Val 9 ATCT CAAATATAAGGGCCGTACA AGCTTTGACAAG GACAACTGG ACCCTGAGA CTCCACA His Leu Lys Tyr Lys Giy Arg Thr Ser Phe Asp Lys Asp Asn Trp Thr Leu Arg Leu His 36O ATGTTCAGACAAGGACAAGGGCACATATCACTGTTTCATTCATTATAAAGGGCCCAAAG Asn Val Gin Ile Lys Asp Lys Gly Thr Tyr His Cys Phe Ile His Tyr Lys Gly Pro Lys "20 GACTAGTCCCATGCACCAAATGAGTTCTGACCTATCAGGCTTGCT AACTTCAGTCA AC Gly Leu Val Pro Met His Gin Met Ser Ser Asp Leu Ser Val Leu Ala Asn Phe Ser Gin " CTGAAATAACAGTAACTTCTAAT AGAACAGAAAATTCTGGCATCATAAATTGACCTGCT Pro Glu le Thr Val Thr Ser Asn Arg Thr Glu Asn Ser Gly Ile Ile Asn Leu Thr Cys "O CATCTATACAAGGTT ACCCAGAA CCTAAG GAGAT GTATTTTCAGCTAAACACTGAGAATT Ser Serile Gin Gly Tyr Pro Glu Pro Lys Glu Met Tyr Phe Gin Leu Asn Thr Glu Asn 99 CAACTACTAAG TATGATACT GTCATGAAGAAATCCAAAATAATGTGACAGAACTGTACA ser. Thr Thrys yr Asp Thr Val Met Lys Lys Ser Gin Asn Asn Val Thr Gu Leu Tyr ACGTTTCTACAGCTTGCCTTTTTCAGTCCCTGAAGCACACAATGTGAGCGTCTTTT GTG Asn Wol Ser Ie Ser Leu Pro Phe Ser Vol Pro Gu Alo His Asn Vol Ser Wol Phe Cys 72O ul-maruammurmuraiammarmamm-r-H CCCTGAAACGGAGACACTGGAGATGCTGCTCTCCCTAC CTTT CAAT AT AGAT GCAC AAC Ala Leu Lys Leu Gu Thr Leu Glu Met Leu Leu Ser Leu Pro Phe Asn ille Asp Ala Gin 79 CTAAG GATAAAG ACCCTGAACAAGGCC ACTTCCTCTGGATTGCGGCTGT ACTTGTAATG Pro Lys Asp Lys Asp Pro Glu Gin Giy His Phe Leu Trpile Ala Ala Val Leu Val Met '9 TTGTTGTTTTTGGGGATGGTG CCTTTAAAACAC TAAG GAAAAG GAAGAAGAAG CAGC Phe Val Val Phe Cys Gly Met Val Ser Phe Lys Thr Leu Arg Lys Arg Lys Lys Lys Gin 999 Patent Application Publication May 2, 2002 Sheet 8 of 13 US 2002/0051792 A1 FIG. 3A-2 CTGGCCCCTCTCAT GAATGTGAAACCATCAAAAGGGAGAGAAAAGAGAGCAAACAGACCA 960 Pro Gly Pro Ser His Gu Cys Glu Thr Ile Lys Arg Glu Arg Lys Glu Ser Lys Gin Thr ACGAAAGAGTACCATACCACGTAC CTGAGAGATCTGATGAAGCCCA GTGTGTTAACATTT Asn Glu Arg Val Pro Tyr His Val Pro Glu Arg Ser Asp Glu Ala Gin Cys Val Asn Ile 020 TGAAGACAGCCT CAGGGGACAAAAATCAGTAGGAAAATGGTGGCTTGGCGTGCTGACAAT Leu Lys Thr Alo Ser Gly Asp Lys ASn Gin 1 O8O - - - - - Patent Application Publication May 2, 2002.
Load more

Recommended publications
  • Araçatuba Virus: a Vaccinialike Virus Associated with Infection In
    RESEARCH Araçatuba Virus: A Vaccinialike Virus Associated with Infection in Humans and Cattle Giliane de Souza Trindade,* Flávio Guimarães da Fonseca,† João Trindade Marques,* Maurício Lacerda Nogueira,† Luiz Claudio Nogueira Mendes,‡ Alexandre Secorun Borges,‡§ Juliana Regina Peiró,‡ Edviges Maristela Pituco,¶ Cláudio Antônio Bonjardim,* Paulo César Peregrino Ferreira,* and Erna Geessien Kroon* We describe a vaccinialike virus, Araçatuba virus, associ- bovine herpes mammillitis, pseudocowpox, and cowpox infec- ated with a cowpoxlike outbreak in a dairy herd and a related tions (9–12). case of human infection. Diagnosis was based on virus growth After clinical and initial laboratory analysis, cowpox virus characteristics, electron microscopy, and molecular biology (CPXV) was considered to be the obvious etiologic agent techniques. Molecular characterization of the virus was done causing this human and cattle infection. CPXV (genus Ortho- by using polymerase chain reaction amplification, cloning, and poxvirus) is the causative agent of localized and painful vesic- DNA sequencing of conserved orthopoxvirus genes such as the vaccinia growth factor (VGF), thymidine kinase (TK), and ular lesions. The virus is believed to persist in wild host hemagglutinin. We used VGF-homologous and TK gene nucle- reservoirs (including mammals, birds, and rodents), cattle, zoo otide sequences to construct a phylogenetic tree for compari- animals, and domestic animals, including cats in parts of son with other poxviruses. Gene sequences showed 99% Europe and Asia. Contact of these reservoirs with susceptible homology with vaccinia virus genes and were clustered animals and people can trigger the onset of disease (13,14). together with the isolated virus in the phylogenetic tree. When humans are affected, the lesions occur on the hands and Araçatuba virus is very similar to Cantagalo virus, showing the sometimes on the arms, usually followed by axillary adenopa- same signature deletion in the gene.
    [Show full text]
  • Cowpox Virus: a New and Armed Oncolytic Poxvirus
    Cowpox Virus: A New and Armed Oncolytic Poxvirus. Marine Ricordel, Johann Foloppe, Christelle Pichon, Nathalie Sfrontato, Delphine Antoine, Caroline Tosch, Sandrine Cochin, Pascale Cordier, Eric Quéméneur, Christelle Camus-Bouclainville, et al. To cite this version: Marine Ricordel, Johann Foloppe, Christelle Pichon, Nathalie Sfrontato, Delphine Antoine, et al.. Cowpox Virus: A New and Armed Oncolytic Poxvirus.. Molecular Therapy - Oncolytics, Elsevier, 2017, 7, pp.1-11. 10.1016/j.omto.2017.08.003. hal-02622526 HAL Id: hal-02622526 https://hal.inrae.fr/hal-02622526 Submitted on 26 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0 International License Original Article Cowpox Virus: A New and Armed Oncolytic Poxvirus Marine Ricordel,1 Johann Foloppe,1 Christelle Pichon,1 Nathalie Sfrontato,1 Delphine Antoine,1 Caroline Tosch,1 Sandrine Cochin,1 Pascale Cordier,1 Eric Quemeneur,1 Christelle Camus-Bouclainville,2 Stéphane Bertagnoli,2 and Philippe Erbs1 1TRANSGENE S.A, 400 Boulevard Gonthier d’Andernach, 67400 Illkirch, France; 2IHAP, Université de Toulouse, INRA, ENVT, 31058 Toulouse, France Oncolytic virus therapy has recently been recognized as a prom- therapy,4,5 make it an ideal oncolytic agent for cancer treatment.
    [Show full text]
  • Burrow Dusting Or Oral Vaccination Prevents Plague-Associated Prairie
    EcoHealth DOI: 10.1007/s10393-017-1236-y Ó 2017 The Author(s). This article is an open access publication Original Contribution Burrow Dusting or Oral Vaccination Prevents Plague- Associated Prairie Dog Colony Collapse Daniel W. Tripp,1 Tonie E. Rocke,2 Jonathan P. Runge,3 Rachel C. Abbott,2 and Michael W. Miller1 1Colorado Division of Parks and Wildlife, Wildlife Health Program, 4330 Laporte Avenue, Fort Collins, CO 80521-2153 2United States Geological Survey, National Wildlife Health Center, 6006 Schroeder Road, Madison, WI 53711 3Colorado Division of Parks and Wildlife, Terrestrial Resources Program, 317 West Prospect Road, Fort Collins, CO 80526-2097 Abstract: Plague impacts prairie dogs (Cynomys spp.), the endangered black-footed ferret (Mustela nigripes) and other sensitive wildlife species. We compared efficacy of prophylactic treatments (burrow dusting with deltamethrin or oral vaccination with recombinant ‘‘sylvatic plague vaccine’’ [RCN-F1/V307]) to placebo treatment in black-tailed prairie dog (C. ludovicianus) colonies. Between 2013 and 2015, we measured prairie dog apparent survival, burrow activity and flea abundance on triplicate plots (‘‘blocks’’) receiving dust, vaccine or placebo treatment. Epizootic plague affected all three blocks but emerged asynchronously. Dust plots had fewer fleas per burrow (P < 0.0001), and prairie dogs captured on dust plots had fewer fleas (P < 0.0001) than those on vaccine or placebo plots. Burrow activity and prairie dog density declined sharply in placebo plots when epizootic plague emerged. Patterns in corresponding dust and vaccine plots were less consistent and appeared strongly influenced by timing of treatment applications relative to plague emergence. Deltamethrin or oral vaccination enhanced apparent survival within two blocks.
    [Show full text]
  • Novel Treatment of Colonic Dysplasia with an Oncolytic Vaccinia Virus
    Novel Treatment of Colonic Dysplasia with an Oncolytic Vaccinia Virus by Fernando Andres Angarita, MD A thesis submitted in conformity with the requirements for the degree of Masters of Science Institute of Medical Science University of Toronto © Copyright by Fernando Andres Angarita, 2013 Novel Treatment of Colonic Dysplasia with an Oncolytic Vaccinia Virus Fernando Andres Angarita Masters of Science Institute of Medical Science University of Toronto 2013 Abstract Colonic dysplasia is a non-invasive intraepithelial neoplastic process that can eventually become cancer. Novel therapies are needed for dysplastic lesions not amenable to standard treatment. Oncolytic viruses selectively kill tumours, but the effect on dysplasia is unknown. This study determined if oncolytic vaccinia virus (vvDD) infects colonic dysplasia. After chemically inducing colonic dysplasia, mice received intraperitoneal (IP) or intracolonic (IC) vvDD expressing red fluorescent protein (vvDD-RFP) or control. RFP signal was apparent at 24h post- virus infection (pvi), peaking at 72h (IC) and 120h (IP) pvi. vvDD-RFP infected high-grade dysplasia more so than low-grade dysplasia; normal tissue was unaffected. vvDD-RFP infected larger surface areas of dysplasia when administered IC than IP. Viral titres peaked earlier and higher with IC than IP delivery. vvDD-RFP-treated mice had less polyps and dysplasia and had higher survival rates than mock-treated animals. This study suggests that oncolytic virotherapy may have a role in treating colonic dysplasia. ii Contributions Dr. Fernando A. Angarita designed and carried out the experiments, analysed the data, and wrote the thesis. Dr. Hala El-Zimaity (Department of Pathology, Toronto General Hospital, University Health Network, Toronto, ON, Canada) graded the histopathology.
    [Show full text]
  • A Protein Phosphatase Related to the Vaccinia Virus VH1 Is Encoded In
    Proc. Natl. Acad. Sci. USA Vol. 90, pp. 4017-4021, May 1993 Biochemistry A protein phosphatase related to the vaccinia virus VH1 is encoded in the genomes of several orthopoxviruses and a baculovirus (phosphorylation/tyrosine/serine/raccoonpox virus) DAVID J. HAKES*, KAREN J. MARTELL*, WEI-Guo ZHAOt, ROBERT F. MASSUNGt, JOSEPH J. ESPOSITOt, AND JACK E. DIXON*: *Department of Biological Chemistry and The Walther Cancer Institute, The University of Michigan, Ann Arbor, MI 48109-0606; and tCenters for Disease Control and Prevention, Poxvirus Section, 1600 Clifton Road, Mailstop G18, Atlanta, GA 30333 Communicated by Theodor 0. Diener, January 19, 1993 (received for review September 17, 1992) ABSTRACT The vaccinia virus VH1 gene product is a dual phosphoserine- and phosphotyrosine-containing proteins (7). specificity protein phosphatase with activity against both phos- Both substrates seem to be hydrolyzed by a common mech- phoserine- and phosphotyrosine-containing substrates. We in- anism since mutagenesis of a critical cysteine at the active vestigated the potential presence of VH1 analogs in other site of the phosphatase leads to a loss in hydrolytic activity viruses. Hybridization and sequence data indicated that a toward both substrates. phosphatase related to the VH1 phosphatase is highly con- Because Yersinia and vaccinia virus infections radically served in the genomes of smallpox variola virus and other affect the host cell cycle, we speculated that phosphatases orthopoxviruses. The open reading frames from the raccoon- play a role in pathogenesis (5, 7). To begin exploring this pox virus and the smallpox variola virus Bangladesh major concept, we report here the identification and partial char- strain genomes encoding the VH1 analogs were sequenced and acterization of other phosphatase genes in orthopoxviruses found to be highly conserved with the vaccinia virus VH1.
    [Show full text]
  • Characterization of the Fecal Virome and Fecal Virus Shedding Patterns of Commercial Mink (Neovison Vison)
    Characterization of the Fecal Virome and Fecal Virus Shedding Patterns of Commercial Mink (Neovison vison) by Xiao Ting (Wendy) Xie A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Master of Science in Pathobiology Guelph, Ontario, Canada © Xiao Ting Xie, September, 2017 ABSTRACT Characterization of the Fecal Virome and Fecal Virus Shedding Patterns of Commercial Mink (Neovison vison) Wendy Xie Advisor: University of Guelph, 2017 Dr. Patricia V. Turner This study characterized the mink fecal virome using next-generation sequencing and investigated fecal shedding of mink-specific astrovirus, rotavirus and hepatitis E virus (HEV) over 4-years, using pooled fecal samples from commercial adult females and kits. Sequencing of 30 female and 37 kit pooled fecal samples resulted in 112,144 viral sequences with similarity to existing genomes. Of 109,612 bacteriophage sequences, Escherichia and Enterococcus–associated phage (16% and 11%, respectively) were most prevalent. Of 1237 vertebrate sequences, viral families Parvoviridae and Circoviridae were most prevalent and 27% of viral sequences identified were of avian origin. Astrovirus, rotavirus, and HEV were detected in 14%, 3%, and 9% of samples, respectively. HEV was detected in significantly more kit than female samples (p<0.0001), and astrovirus in more summer samples than winter samples (p=0.001). This research permits improved understanding of potential causative agents of mink gastroenteritis, as well as virus shedding in healthy commercial mink. ii ACKNOWLEDGEMENTS Firstly, thank you to Dr. Patricia V. Turner for all the opportunities, experiences, and mentorship in the time that I have been a part of this wonderful lab.
    [Show full text]
  • Cowpox Virus Encodes a Fifth Member of the Tumor Necrosis Factor Receptor Family: a Soluble, Secreted CD30 Homologue
    Cowpox virus encodes a fifth member of the tumor necrosis factor receptor family: A soluble, secreted CD30 homologue Joanne Fanelli Panus*, Craig A. Smith†, Caroline A. Ray*, Terri Davis Smith†, Dhavalkumar D. Patel‡, and David J. Pickup*§ *Department of Molecular Genetics and Microbiology and ‡Department of Medicine, Duke University Medical Center, Durham, NC 27710; and †Department of Biochemical Sciences, Immunex, 51 University Street, Seattle, WA 98101 Communicated by Wolfgang K. Joklik, Duke University Medical Center, Durham, NC, April 22, 2002 (received for review February 21, 2002) Cowpox virus (Brighton Red strain) possesses one of the largest cellular counterparts (4, 5), raising the possibility that cowpox genomes in the Orthopoxvirus genus. Sequence analysis of a virus may have acquired other members of the TNFR family. In region of the genome that is type-specific for cowpox virus this study, we show cowpox virus encodes one additional mem- identified a gene, vCD30, encoding a soluble, secreted protein that ber, a soluble, secreted form of CD30, the receptor for CD153. is the fifth member of the tumor necrosis factor receptor family known to be encoded by cowpox virus. The vCD30 protein contains Methods 110 aa, including a 21-residue signal peptide, a potential O-linked Cells and Viruses. Cowpox virus, Brighton Red strain (CPV-BR), glycosylation site, and a 58-aa sequence sharing 51–59% identity vaccinia virus, Western Reserve strain (VV-WR), and recom- with highly conserved extracellular segments of both mouse and binant viruses were grown in human osteosarcoma 143B cells. human CD30. A vCD30Fc fusion protein binds CD153 (CD30 ligand) VTF7–3, vaccinia virus expressing the T7 RNA polymerase (23), specifically, and it completely inhibits CD153͞CD30 interactions.
    [Show full text]
  • Thesis Immunogenicity Against a Vaccinia Virus-Vectored
    THESIS IMMUNOGENICITY AGAINST A VACCINIA VIRUS-VECTORED ORAL PLAGUE VACCINE IN BLACK-FOOTED FERRETS (MUSTELA NIGRIPES) Submitted by Deborah Grossblat McCuen Department of Biology In partial fulfillment of the requirements For the Degree of Master of Science Colorado State University Fort Collins, Colorado Spring 2020 Master’sAdvisor: Committee: Michael F. Antolin Co-Advisor: Michael W. Miller Lisa M. Angeloni Alan R. Schenkel Tony A. Schountz Copyright by Deborah Grossblat McCuen 2020 All Rights Reserved ABSTRACT IMMUNOGENICITY AGAINST A VACCINIA VIRUS-VECTORED ORAL PLAGUE VACCINE IN BLACK-FOOTED FERRETS (MUSTELA NIGRIPES) Black-footed ferrets (Mustela nigripes) are one of the most endangered mammals in North America, in part because they suffer high mortality when infected by plague, caused by the bacterium Yersinia pestis. An injectable plague vaccine is effective in black-footed ferrets but protecting wild ferrets is laborious because of the need to capture and handle these animals. In contrast, an orally delivered vaccine could be more easily distributed, as is the case with the Yersinia Pestis Vaccine that effectively protects the f , prairie dogs. We evaluated in black-footed ferrets the immunogenicity oferrets’ an ora mainl vaccinia prey virus vectored plague vaccine, previously shown to be protective in laboratory mice. We compared antibody response of the oral vaccine to the injectable plague vaccine. Although the oral vaccine appears to be safe in ferrets, lateral flow results indicated an absence of measurable antibody response to plague antigens. Furthermore, a plaque reduction neutralization test revealed that black-footed ferrets have some ability to neutralize vaccinia virus, even without delivery of the oral vaccine or any known exposure to orthopoxvirus.
    [Show full text]
  • Open Access the Raccoon (Procyon Lotor) As Potential Rabies Reservoir
    222 Berliner und Münchener Tierärztliche Wochenschrift 125, Heft 5/6 (2012), Seiten 222–235 IDT Biologika GmbH, Dessau – Rosslau, Germany1 Open Access Technische Universität Dresden, Institute for Forest Botany and Forest Zoology, Tharandt, Germany2 Berl Münch Tierärztl Wochenschr 125, 222–235 (2012) DOI 10.2376/0005-9366-125-222 The raccoon (Procyon lotor) as potential rabies reservoir species in Germany: a risk © 2012 Schlütersche Verlagsgesellschaft mbH & Co. KG assessment ISSN 0005-9366 Korrespondenzadresse: Der Waschbär (Procyon lotor) als potenzielle Tollwutreservoir- [email protected] spezies in Deutschland: eine Risikobewertung Eingegangen: 09.02.2011 Angenommen: 14.11.2011 Adriaan Vos1, Steffen Ortmann1, Antje S. Kretzschmar1, Berit Köhnemann2, Frank Michler2 Online first: 07.05.2012 http://vetline.de/zeitschriften/bmtw/ open_access.htm Terrestrial wildlife rabies has been successfully eliminated from Germany pre- dominantly as a result of the distribution of oral rabies vaccine baits. In case that Summary wildlife rabies would re-emerge among its known reservoir species in Germany, swift action based on previous experiences could spatially and temporally limit and subsequently control such an outbreak. However, if rabies emerged in the raccoon population in Germany (Procyon lotor), there are no tools or local experi- ence available to cope with this situation. This is especially worrisome for urban areas like Kassel (Hesse) due to the extremely high raccoon population density. A rabies outbreak among this potential reservoir host species in these urban settings could have a significant impact on public and animal health. Keywords: susceptibility, oral vaccination, vaccine, baits, raccoon, Germany Zusammenfassung Die terrestrische Tollwut wurde in Deutschland vor allem durch das Auslegen von oralen Impfstoffködern erfolgreich getilgt.
    [Show full text]
  • Oncolytic Properties of Non-Vaccinia Poxviruses
    www.oncotarget.com Oncotarget, 2018, Vol. 9, (No. 89), pp: 35891-35906 Research Paper Oncolytic properties of non-vaccinia poxviruses Marine Ricordel1,3, Johann Foloppe1, Christelle Pichon1, Annie Findeli1, Caroline Tosch1, Pascale Cordier1, Sandrine Cochin1, Eric Quémeneur1, Christelle Camus- Bouclainville2, Stéphane Bertagnoli2 and Philippe Erbs1 1Transgene SA, Illkirch-Graffenstaden 67405, France 2IHAP, INRA, Université de Toulouse, Toulouse 31058, France 3Current address: Polyplus-transfection SA, Illkirch-Graffenstaden 67400, France Correspondence to: Philippe Erbs, email: [email protected] Keywords: non-vaccinia poxviruses; oncolytic properties; RCNtk-/gfp::fcu1 Received: June 26, 2018 Accepted: October 24, 2018 Published: November 13, 2018 Copyright: Ricordel et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Vaccinia virus, a member of the Poxviridae family, has been extensively used as an oncolytic agent and has entered late stage clinical development. In this study, we evaluated the potential oncolytic properties of other members of the Poxviridae family. Numerous tumor cell lines were infected with ten non-vaccinia poxviruses to identify which virus displayed the most potential as an oncolytic agent. Cell viability indicated that tumor cell lines were differentially susceptible to each virus. Raccoonpox virus was the most potent of the tested poxviruses and was highly effective in controlling cell growth in all tumor cell lines. To investigate further the oncolytic capacity of the Raccoonpox virus, we have generated a thymidine kinase (TK)-deleted recombinant Raccoonpox virus expressing the suicide gene FCU1.
    [Show full text]
  • Hazard Characterization of Modified Vaccinia Virus Ankara Vector
    viruses Review Hazard Characterization of Modified Vaccinia Virus Ankara Vector: What Are the Knowledge Gaps? Malachy I. Okeke 1,*, Arinze S. Okoli 1, Diana Diaz 2 ID , Collins Offor 3, Taiwo G. Oludotun 3, Morten Tryland 1,4, Thomas Bøhn 1 and Ugo Moens 2 1 Genome Editing Research Group, GenØk-Center for Biosafety, Siva Innovation Center, N-9294 Tromso, Norway; [email protected] (A.S.O.); [email protected] (M.T.); [email protected] (T.B.) 2 Molecular Inflammation Research Group, Institute of Medical Biology, University i Tromsø (UiT)—The Arctic University of Norway, N-9037 Tromso, Norway; [email protected] (D.D.); [email protected] (U.M.) 3 Department of Medical and Pharmaceutical Biotechnology, IMC University of Applied Sciences Piaristengasse 1, A-3500 Krems, Austria; [email protected] (C.O.); [email protected] (T.G.O.) 4 Artic Infection Biology, Department of Artic and Marine Biology, UIT—The Artic University of Norway, N-9037 Tromso, Norway * Correspondence: [email protected]; Tel.: +47-7764-5436 Received: 27 September 2017; Accepted: 26 October 2017; Published: 29 October 2017 Abstract: Modified vaccinia virus Ankara (MVA) is the vector of choice for human and veterinary applications due to its strong safety profile and immunogenicity in vivo. The use of MVA and MVA-vectored vaccines against human and animal diseases must comply with regulatory requirements as they pertain to environmental risk assessment, particularly the characterization of potential adverse effects to humans, animals and the environment. MVA and recombinant MVA are widely believed to pose low or negligible risk to ecosystem health.
    [Show full text]
  • Orthopoxvirus Was Detected in Skin Lesions of Two Cat- Tle Herders from the Kakheti Region of Georgia (Country); This Virus Was Named Akhmeta Virus
    GENETIC DIVERSITY AND EVOLUTION crossm Isolation and Characterization of Akhmeta Virus from Wild- Caught Rodents (Apodemus spp.) in Georgia Jeffrey B. Doty,a Giorgi Maghlakelidze,b Irakli Sikharulidze,c Shin-Lin Tu,d Clint N. Morgan,a Matthew R. Mauldin,a Otar Parkadze,e Natia Kartskhia,e Maia Turmanidze,f Audrey M. Matheny,a Whitni Davidson,a Shiyuyun Tang,a Jinxin Gao,a Yu Li,a Chris Upton,d Darin S. Carroll,a Ginny L. Emerson,a Yoshinori Nakazawaa aU.S. Centers for Disease Control and Prevention, Poxvirus and Rabies Branch, Atlanta, Georgia, USA bU.S. Centers for Disease Control and Prevention, South Caucuses Office, Tbilisi, Georgia cNational Center for Disease Control and Public Health, Tbilisi, Georgia dDepartment of Biochemistry and Microbiology, University of Victoria, Victoria, Canada eNational Food Agency, Tbilisi, Georgia fLaboratory of the Ministry of Agriculture, Tbilisi, Georgia ABSTRACT In 2013, a novel orthopoxvirus was detected in skin lesions of two cat- tle herders from the Kakheti region of Georgia (country); this virus was named Akhmeta virus. Subsequent investigation of these cases revealed that small mam- mals in the area had serological evidence of orthopoxvirus infections, suggesting their involvement in the maintenance of these viruses in nature. In October 2015, we began a longitudinal study assessing the natural history of orthopoxviruses in Georgia. As part of this effort, we trapped small mammals near Akhmeta (n ϭ 176) and Gudauri (n ϭ 110). Here, we describe the isolation and molecular characteriza- tion of Akhmeta virus from lesion material and pooled heart and lung samples col- lected from five wood mice (Apodemus uralensis and Apodemus flavicollis) in these two locations.
    [Show full text]