A Positive Selection Vector for Cloning High Molecular Weight DNA
Total Page：16
File Type：pdf, Size：1020Kb
Proc. Natl. Acad. Sci. USA Vol. 89, pp. 2056-2060, March 1992 Biochemistry A positive selection vector for cloning high molecular weight DNA by the bacteriophage P1 system: Improved cloning efficacy (high molecular weight genomic DNA/bacteriophage P1 cloning/sacB gene/positive selection) JAMES C. PIERCE, BRIAN SAUER, AND NAT STERNBERG The Du Pont Merck Pharmaceutical Company, Wilmington, DE 19880-0328 Communicated by James D. Watson, November 13, 1991 ABSTRACT The bacteriophage P1 cloning system can Analysis of the P1 human library revealed that a small package and propagate DNA inserts that are up to 95 kilobases. number of the initial clones (10-20%6) contained P1 vector Clones are maintained in Escherichia coil by a low-copy DNA without inserts and that these clones grew significantly replicon in the P1 cloning vector and can be amplified by faster than those with inserts. Consequently, when the var- inducing a second replicon in the vector with isopropyl (3-D- ious pools were amplified to prepare DNA for subsequent thiogalactopyranoside. To overcome the necessity of screening analysis, the majority of the vector molecules (as much as clones for DNA inserts, we have developed a P1 vector with a 80%) had no inserts. This made it more difficult than expected positive selection system that is based on the properties of the to isolate unique copy sequences from the library and to use sacB gene from Bacilus amyloliquefaciens. Expression of that those sequences in genome mapping strategies. Moreover, gene kills E. coli cells that are grown in the presence ofsucrose. the problem might be more pronounced if the ligation reac- In the new P1 vector (pAdlOsacBII) sacB expression is regu- tion used to generate a library of cloned inserts was less than lated by a synthetic E. coli promoter that also contains a P1 C1 optimal, as, for example, if the insert or vector DNA was repressor binding site. A unique BamHI cloning site is located improperly digested or if the ratio of vector DNA to insert between the promoter and the sacB structural gene. Cloning DNA was very high. Under these circumstances, one might DNA fragments into the BamHI site interrupts sacB expression expect to generate a P1 library with a much higher initial and permits growth of plasmid-containing cells in the presence percentage of clones without inserts than was the case in our of sucrose. We have also bordered the BamHI site with unique original library. Finally, since there was no easy way of rare-cutting restriction sites Not I, Sal I, and Sfi I and with T7 preparing probes from the ends of the cloned insert in the and Sp6 promoter sequences to facilitate characterization and original vector, even those clones with inserts were difficult analysis ofP1 clones. We describe here the use ofNotI digestion to use for mapping studies. to size the cloned DNA fragments and RNA probes to identify To overcome these problems, we have constructed a the ends of those fragments. The positive selection P1 vector positive selection P1 vector (pAdlOsacBII) containing the provides a 65- to 75-fold discrimination of P1 clones that Bacillus amyloliquefaciens sacB gene that greatly minimizes contain inserts from those that do not. It therefore permits the recovery of clones without inserts and that permits the generation of genomic libraries that are much easier to use for simple analysis of the ends of the insert DNA by RNA probe gene isolation and genome mapping than are our previous techniques. The positive selection permits one to easily libraries. Also, the new vector makes it feasible to generate P1 evaluate the quality of the vector DNA and the results of libraries from small amounts of genomic insert DNA, such as ligation reactions before extensive clone analysis is neces- from sorted chromosomes. sary. Moreover, the vector contains unique and rare restric- tion sites to help size the insert. This cloning system has been used to construct a complete Drosophila library and a com- The bacteriophage P1 cloning system permits in vitro pack- plete mouse library (ref. 3; unpublished data). aging of P1 vectors containing foreign DNA inserts that are as large as 95 kilobase pairs (kbp) (1). That DNA can be faithfully replicated as a low-copy plasmid in Escherichia MATERIALS AND METHODS coli, can be amplified to high-copy number by adding iso- Construction of the pAdlOsacBll Vector. Construction was propyl ,3-D-thiogalactopyranoside to the medium, and can be initiated by cutting the parent vector pNS582tetl4AdlO readily isolated as supercoiled circles by standard molecular (henceforth called pAdlO) (2) at unique Sal I and BamHI techniques (1, 2). The cloning efficiency with the P1 system restriction sites in the tetracycline gene. The 276-bp DNA (105 clones recovered per ug of vector) is intermediate fragment between these sites was removed and replaced with between those of the other two high molecular weight DNA a series of oligonucleotides to generate the sequence shown cloning systems-the A-cosmid system and the yeast artificial in Fig. 1. Starting from its 5' end, this sequence contains a chromosome (YAC) system. P1 clones can be more than SnaBI site, a Sfi I site, a Sal I site, a Sp6 promoter, a BamHI twice as large as cosmid clones, but they are significantly site, a T7 promoter, a Not I site, a P1 C1 repressor binding smaller than YAC clones. However, the fact that it is difficult site (4), and a near-consensus E. coli promoter. The E. coli to isolate more than several micrograms of YAC DNA from promoter and C1 binding sites overlap. All of the restriction YAC clones, while such amounts of DNA are easily obtain- sites except Sft I are unique to the vector, and Sf1 I is unique able from P1 clones, suggests that the P1 system may fill an to that portion ofthe vector that is recovered with the cloned important niche in genome mapping and sequencing strate- insert in E. coli after phage P1 packaging (2). To insert the B. gies. To address this issue a 50,000-member human DNA amyloliquefaciens sacB gene, we started with a 1.6-kb EcoRI library consisting of 26 pools of 2000 clones each was fragment from plasmid pBE501 (5) that contains the entire constructed (2). Abbreviations: kanR, kanamycin resistance; sucR, sucrose resis- The publication costs of this article were defrayed in part by page charge tance; CIP, calf intestinal alkaline phosphatase; BAP, bacterial payment. This article must therefore be hereby marked "advertisement" alkaline phosphate; FIGE, field-inversion gel electrophoresis; YAC, in accordance with 18 U.S.C. §1734 solely to indicate this fact. yeast artificial chromosome. 2056 Downloaded by guest on September 30, 2021 Biochemistry: Pierce et al. Proc. Natl. Acad. Sci. USA 89 (1992) 2057 SnaBI SfiI SalI Sp6 of the plasmid in bacterial strains without the repressor tends 5'TACGTAGGCCTAATTGGCCGTCGACATTTAGGTG to select for rearrangements that inactivate sacB and/or its E. ATGCATCCGGATTAACCGGCAGCTGTAAATCCAC coli promoter. NS3607 is a derivative of E. coli recA strain promoter BamHI DH~alacjq (6) that contains a resident Aimm21 prophage ACACTATAGAAGGATCCTCTCCCTATAGTGAGTC (Aimm21-P1:7A5b) that constitutively expresses the P1 C1 TGTGATATCTTCCTAGGAGAGGGATATCACTCAG repressor (7). NS3607 also contains a AimmALP1 prophage N T7 promoter (obtained from A. Wright, Tufts University Medical School) NotI cl binding site that constitutively expresses the laCjq repressor. This re- GTATTAGCGGCCGCAAATTTATTAGAGCAATATA pressor blocks replication of the P1 lytic replicon on the CATAATCGCCGGCGTTTAAATAATCTCGTTATAT vector (1, 2). Plasmid DNA was prepared from strain NS3607 E. coli promoter (pAdlOsacBII) as described by Pierce and Sternberg (8). GTCCTACAATGTCAAGCTCGA3' Standard DNA Methods. Restriction enzymes and T7 DNA CAGGATGTTACAGTTCGAGCT ligase were purchased from New England Biolabs. Calf intestinal alkaline phosphatase (CIP) was purchased from FIG. 1. Sequence of the promoter multiple cloning site region New England Nuclear. Bacterial alkaline phosphatase (BAP) upstream of the sacB gene in pAdlOsacBII. This sequence was was purchased from Bethesda Research Laboratories. The constructed by annealing two double-stranded oligonucleotides. restriction enzymes and the DNA ligase were used as spec- ified by the vendors. The phosphatases were used as de- sacB structural gene and ribosome binding site but lacks a scribed by Pierce and Sternberg (8). P1 plasmid DNA was promoter element. We blunt ended this fragment by anneal- isolated by the alkaline lysis method of Birnboim and Doly ing it to an EcoRI adapter that also contains an internal Spe (9). For Not I digests, the plasmid DNA was treated first with I restriction site and then inserted the entire construct into the proteinase K (100 ,ug/ml) (Boehringer Mannheim) and 0.1% SnaBI-cut pAdlO vector that had been modified as described SDS for 1 hr at 37°C, then extracted with phenol and above. This process destroys the vector SnaBI site. A chloroform, and finally dialyzed against TE buffer (10 mM construct was isolated in which the beginning of sacB was Tris HCI, pH 8.0/1 mM EDTA) for 1-2 hr (8). DNA frag- adjacent to the vector Sal I site (Fig. 2) and was designated ments that are <20 kb were fractionated by standard agarose pAdlOsacBII. gel electrophoresis in lx TBE buffer (10). Larger DNA Preparation of soeBiH Vector DNA. The pAdlOsacBII plas- fragments were fractionated by field-inversion gel electro- mid must be grown in a bacterial strain (NS3607) containing phoresis (FIGE) in 0.5x TBE buffer at 4°C. Samples were the P1 C1 repressor. The repressor binds to its operator site first electrophoresed in the gel for 1 hr at 3 V/cm and then in the E. coli promoter that regulates sacB expression in subjected to a switching regimen of 0.3 sec forward/0.1 sec pAdlOsacBII and prevents the expression of that gene.