A Positive Selection Vector for Cloning High Molecular Weight DNA

Proc. Natl. Acad. Sci. USA Vol. 89, pp. 2056-2060, March 1992 Biochemistry A positive selection vector for cloning high molecular weight DNA by the bacteriophage P1 system: Improved cloning efficacy (high molecular weight genomic DNA/bacteriophage P1 cloning/sacB gene/positive selection) JAMES C. PIERCE, BRIAN SAUER, AND NAT STERNBERG The Du Pont Merck Pharmaceutical Company, Wilmington, DE 19880-0328 Communicated by James D. Watson, November 13, 1991

ABSTRACT The bacteriophage P1 cloning system can Analysis of the P1 human library revealed that a small package and propagate DNA inserts that are up to 95 kilobases. number of the initial clones (10-20%6) contained P1 vector Clones are maintained in Escherichia coil by a low-copy DNA without inserts and that these clones grew significantly replicon in the P1 cloning vector and can be amplified by faster than those with inserts. Consequently, when the var- inducing a second replicon in the vector with isopropyl (3-D- ious pools were amplified to prepare DNA for subsequent thiogalactopyranoside. To overcome the necessity of screening analysis, the majority of the vector molecules (as much as clones for DNA inserts, we have developed a P1 vector with a 80%) had no inserts. This made it more difficult than expected positive selection system that is based on the properties of the to isolate unique copy sequences from the library and to use sacB gene from Bacilus amyloliquefaciens. Expression of that those sequences in genome mapping strategies. Moreover, gene kills E. coli cells that are grown in the presence ofsucrose. the problem might be more pronounced if the ligation reac- In the new P1 vector (pAdlOsacBII) sacB expression is regu- tion used to generate a library of cloned inserts was less than lated by a synthetic E. coli promoter that also contains a P1 C1 optimal, as, for example, if the insert or vector DNA was repressor binding site. A unique BamHI cloning site is located improperly digested or if the ratio of vector DNA to insert between the promoter and the sacB structural gene. Cloning DNA was very high. Under these circumstances, one might DNA fragments into the BamHI site interrupts sacB expression expect to generate a P1 library with a much higher initial and permits growth of plasmid-containing cells in the presence percentage of clones without inserts than was the case in our of sucrose. We have also bordered the BamHI site with unique original library. Finally, since there was no easy way of rare-cutting restriction sites Not I, Sal I, and Sfi I and with T7 preparing probes from the ends of the cloned insert in the and Sp6 promoter sequences to facilitate characterization and original vector, even those clones with inserts were difficult analysis ofP1 clones. We describe here the use ofNotI digestion to use for mapping studies. to size the cloned DNA fragments and RNA probes to identify To overcome these problems, we have constructed a the ends of those fragments. The positive selection P1 vector positive selection P1 vector (pAdlOsacBII) containing the provides a 65- to 75-fold discrimination of P1 clones that Bacillus amyloliquefaciens sacB gene that greatly minimizes contain inserts from those that do not. It therefore permits the recovery of clones without inserts and that permits the generation of genomic libraries that are much easier to use for simple analysis of the ends of the insert DNA by RNA probe gene isolation and genome mapping than are our previous techniques. The positive selection permits one to easily libraries. Also, the new vector makes it feasible to generate P1 evaluate the quality of the vector DNA and the results of libraries from small amounts of genomic insert DNA, such as ligation reactions before extensive clone analysis is neces- from sorted chromosomes. sary. Moreover, the vector contains unique and rare restriction sites to help size the insert. This cloning system has been used to construct a complete Drosophila library and a com- The bacteriophage P1 cloning system permits in vitro pack- plete mouse library (ref. 3; unpublished data). aging of P1 vectors containing foreign DNA inserts that are as large as 95 kilobase pairs (kbp) (1). That DNA can be faithfully replicated as a low-copy plasmid in Escherichia MATERIALS AND METHODS coli, can be amplified to high-copy number by adding iso- Construction of the pAdlOsacBll Vector. Construction was propyl ,3-D-thiogalactopyranoside to the medium, and can be initiated by cutting the parent vector pNS582tetl4AdlO readily isolated as supercoiled circles by standard molecular (henceforth called pAdlO) (2) at unique Sal I and BamHI techniques (1, 2). The cloning efficiency with the P1 system restriction sites in the tetracycline gene. The 276-bp DNA (105 clones recovered per ug of vector) is intermediate fragment between these sites was removed and replaced with between those of the other two high molecular weight DNA a series of oligonucleotides to generate the sequence shown cloning systems-the A-cosmid system and the yeast artificial in Fig. 1. Starting from its 5' end, this sequence contains a chromosome (YAC) system. P1 clones can be more than SnaBI site, a Sfi I site, a Sal I site, a Sp6 promoter, a BamHI twice as large as cosmid clones, but they are significantly site, a T7 promoter, a Not I site, a P1 C1 repressor binding smaller than YAC clones. However, the fact that it is difficult site (4), and a near-consensus E. coli promoter. The E. coli to isolate more than several micrograms of YAC DNA from promoter and C1 binding sites overlap. All of the restriction YAC clones, while such amounts of DNA are easily obtain- sites except Sft I are unique to the vector, and Sf1 I is unique able from P1 clones, suggests that the P1 system may fill an to that portion ofthe vector that is recovered with the cloned important niche in genome mapping and sequencing strate- insert in E. coli after phage P1 packaging (2). To insert the B. gies. To address this issue a 50,000-member human DNA amyloliquefaciens sacB gene, we started with a 1.6-kb EcoRI library consisting of 26 pools of 2000 clones each was fragment from plasmid pBE501 (5) that contains the entire constructed (2). Abbreviations: kanR, kanamycin resistance; sucR, sucrose resis- The publication costs of this article were defrayed in part by page charge tance; CIP, calf intestinal alkaline phosphatase; BAP, bacterial payment. This article must therefore be hereby marked "advertisement" alkaline phosphate; FIGE, field-inversion gel electrophoresis; YAC, in accordance with 18 U.S.C. §1734 solely to indicate this fact. yeast artificial chromosome.

2056 Downloaded by guest on September 30, 2021 Biochemistry: Pierce et al. Proc. Natl. Acad. Sci. USA 89 (1992) 2057 SnaBI SfiI SalI Sp6 of the plasmid in bacterial strains without the repressor tends 5'TACGTAGGCCTAATTGGCCGTCGACATTTAGGTG to select for rearrangements that inactivate sacB and/or its E. ATGCATCCGGATTAACCGGCAGCTGTAAATCCAC coli promoter. NS3607 is a derivative of E. coli recA strain promoter BamHI DH~alacjq (6) that contains a resident Aimm21 prophage ACACTATAGAAGGATCCTCTCCCTATAGTGAGTC (Aimm21-P1:7A5b) that constitutively expresses the P1 C1 TGTGATATCTTCCTAGGAGAGGGATATCACTCAG repressor (7). NS3607 also contains a AimmALP1 prophage N T7 promoter (obtained from A. Wright, Tufts University Medical School) NotI cl binding site that constitutively expresses the laCjq repressor. This re- GTATTAGCGGCCGCAAATTTATTAGAGCAATATA pressor blocks replication of the P1 lytic replicon on the CATAATCGCCGGCGTTTAAATAATCTCGTTATAT vector (1, 2). Plasmid DNA was prepared from strain NS3607 E. coli promoter (pAdlOsacBII) as described by Pierce and Sternberg (8). GTCCTACAATGTCAAGCTCGA3' Standard DNA Methods. Restriction enzymes and T7 DNA CAGGATGTTACAGTTCGAGCT ligase were purchased from New England Biolabs. Calf intestinal alkaline phosphatase (CIP) was purchased from FIG. 1. Sequence of the promoter multiple cloning site region New England Nuclear. Bacterial alkaline phosphatase (BAP) upstream of the sacB gene in pAdlOsacBII. This sequence was was purchased from Bethesda Research Laboratories. The constructed by annealing two double-stranded oligonucleotides. restriction enzymes and the DNA ligase were used as spec- ified by the vendors. The phosphatases were used as de- sacB structural gene and ribosome binding site but lacks a scribed by Pierce and Sternberg (8). P1 plasmid DNA was promoter element. We blunt ended this fragment by anneal- isolated by the alkaline lysis method of Birnboim and Doly ing it to an EcoRI adapter that also contains an internal Spe (9). For Not I digests, the plasmid DNA was treated first with I restriction site and then inserted the entire construct into the proteinase K (100 ,ug/ml) (Boehringer Mannheim) and 0.1% SnaBI-cut pAdlO vector that had been modified as described SDS for 1 hr at 37°C, then extracted with phenol and above. This process destroys the vector SnaBI site. A chloroform, and finally dialyzed against TE buffer (10 mM construct was isolated in which the beginning of sacB was Tris HCI, pH 8.0/1 mM EDTA) for 1-2 hr (8). DNA frag- adjacent to the vector Sal I site (Fig. 2) and was designated ments that are <20 kb were fractionated by standard agarose pAdlOsacBII. gel electrophoresis in lx TBE buffer (10). Larger DNA Preparation of soeBiH Vector DNA. The pAdlOsacBII plas- fragments were fractionated by field-inversion gel electro- mid must be grown in a bacterial strain (NS3607) containing phoresis (FIGE) in 0.5x TBE buffer at 4°C. Samples were the P1 C1 repressor. The repressor binds to its operator site first electrophoresed in the gel for 1 hr at 3 V/cm and then in the E. coli promoter that regulates sacB expression in subjected to a switching regimen of 0.3 sec forward/0.1 sec pAdlOsacBII and prevents the expression of that gene. This backward with a ramp factor of 15 at 6 V/cm using a PC750 is necessary because of the sacB (Hoefer) FIGE apparatus for 5-6 hr at room temperature. synthesis gene product, Gels were stained with ethidium bromide and the DNA was levansucrase, interferes with cell growth to some degree, visualized by UV fluorescence. even in the absence of sucrose. Consequently, amplification Transformation and Packaging of pAdlOsacBII DNA. E. IoxP coli strain NS3145 (2) was transformed with plasmid DNA as described by Sambrook et al. (10). In vitro packaging of vector DNA and vector DNA with inserts was carried out as described by Sternberg et al. (2) and by Pierce and Sternberg (8). The strain used to recover kanamycin-resistant (kanR) transformants after infection with packaged phage is NS3529. This strain is recAmcrAA(mcrB, mrr, hsdR, hsdM) and carries two A prophages, Aimm434nin5X1-cre (11) and AimmALP1. The former constitutively expresses the Cre recombinase. Transformants containing the sacBII plasmid were selected on LB agar plates with 25 ,g of kanamycin per ml, and those containing cloned DNA inserts were selected on LB agar plates containing 25 jig of kanamycin per ml and 5% sucrose. In Vitro Transcription of pAdlOsacBII DNA from T7 and Sp6 Promoters. T7 and Sp6 RNA polymerase and tobacco acid pyrophosphatase were purchased from Promega. Uri- dine 5'-[a-[35S]thio]triphosphate UTP[a-35S] (1200 Ci/mmol; 1 Ci = 37 GBq) was purchased from New England Nuclear. Plasmid DNA from P1 clones that contained mouse genomic inserts was isolated by the alkaline lysis method and further purified by pZ523 column chromotagraphy as described by r* cq~qo r27 -F the vendor (5 Prime -* 3 Prime, Inc.). Plasmid DNA was digested with the restriction enzyme Taq I, then extracted /X- re=;ress:r 7 C- S--- N- with phenol and chloroform, ethanol precipitated, and finally -a.'ZZ M, resuspended in water at a concentration of 0.15 ,g/ml. In vitro transcription reaction mixtures supplemented with tobacco acid pyrophosphatase were as described by the vendor FIG. 2. P1 positive selection cloning vector pAdlOsacBII. The of the polymerase (Promega). Unincorporated UTP[a-355] major portion of the vector is derived from the original pAdlO was in the plasmid and has been described (1, 2). The sacB cassette was cloned removed by three sequential ethanol precipitations between the unique BamHI and Sal I sites of the tetracycline gene presence of 0.1 M sodium acetate. The RNA products of the (stippled bar) of pAdlO. This cassette contains the promoter multiple reaction were resuspended in 20 1.l of water with 1 unit per cloning site shown in Fig. 1 and the sacB gene. The location of the ,l of RNasin (Promega) to give 105_106 dpm per A.l of unique Sca I site is also shown. [355]RNA. Southern blot hybridization was as described by Downloaded by guest on September 30, 2021 2058 Biochemistry: Pierce et al. Proc. Natl. Acad. Sci. USA 89 (1992)

Table 1. Transformation efficiencies with pAdlOsacBII DNA synthetic E. coli promoter and, consequently, E. coli con- NS3145 (Cre') DH~alaclq (Cre-) taining this plasmid cannot grow in medium containing sucrose (see below). The unique BamHI cloning site of the sucR, sucR, vector is located between the promoter and sacB. Cloning kanR kanR Eff kanR kanR Eff large inserts at the BamHI site separates the promoter from DNA (1) (2) (2/1) (3) (4) (4/3) sacB and permits growth on medium containing kanamycin Uncut >104 6 <0.06 >104 2 <0.02 and sucrose. Pooled libraries generated with the BamHI pAdlOsacBII vector contain few clones without inserts even cut 135 6 4 90 5 6 when amplified and are easily screened for unique genomic Sal I sequences (unpublished results; see also Discussion). cut 246 5 2 222 3 1 Use of the pAdlOsacBHI Vector in Genomic Cloning Exper- In experiment 1 (uncut), 200 ng of pAdlOsacBII DNA was trans- iments. We first determined whether the number of vector formed into Hanahan-competent (14) E. coli strains NS3145 and copies in cells affects sacB selection. kanR transformants of DH5alacPq. In experiments 2 and 3 (BamHI cut and Sal I cut), 100 DH5alaclq (Cre-) generated with pAdlOsacBII DNA have a ng of digested vector DNA was ligated in vitro with 400 units of T4 plasmid copy number of 10-20 due to the presence of the DNA ligase (New England Biolabs) and the products were then pBR322 replicon in the vector. kanR transformants ofNS3145 transformed into the two E. coli strains. Eff, efficiency (%). (Cre+) have a low copy number because Cre-mediated re- Sambrook et al. (10) and autoradiography was performed combination at the loxP sites of the vector separates the with Kodak X-Omat film at room temperature. domain containing the kanR gene, the sacB gene, and low- copy P1 plasmid replicon from that containing the multicopy pBR322 replicon (Fig. 2). In both cases, <1% of all kanR RESULTS transformants also grow on kanamycin agar plates with The P1 Positive Selection Cloning Vector pAdlOsacBll. The sucrose (Table 1, line 1). Thus, the sacB vector is lethal to E. pAdlOsacBII cloning vector is shown in Fig. 2. It was coli in the presence of sucrose at either single or multiple constructed to simplify the P1 cloning process, to facilitate copy. When the vector DNA is digested with a restriction characterization of cloned inserts, and, perhaps most impor- enzyme that cleaves between the synthetic E. coli promoter tantly, to avoid generating clones without inserts. With the and the sacB gene (e.g., at Sal I or BamHI sites), and then original P1 cloning vector, pAdlO (2), it was impossible to ligated in vitro, the resulting DNA exhibits a higher sucrose- avoid recovering a modest percentage (10-20%) of clones resistance (sucR) background than the untreated vector DNA without inserts, even under ligation conditions that favored (Table 1, lines 2 and 3). Up to 6% of the kanR transformants the insertion of genomic fragments into the vector DNA. can be sucR. Since cells containing these clones grew faster than those Similar experiments were performed with vector DNA with inserts (data not shown), pools ofP1 clones were rapidly packaged in vitro and transferred into bacteria by phage overgrown by clones without inserts as the library was infection. As in the transformation experiments, the fraction amplified. The positive selection pAd1OsacBII vector over- of sucR colonies was very low using uncut vector DNA but comes this problem by providing a direct selection for cloned was much higher when the DNA was digested with BamHI, inserts. The sacB gene encodes an enzyme, levansucrase, both with and without subsequent religation (Table 2, lines that catalyzes the hydrolysis of sucrose to products lethal to 1-3). Surprisingly, both uncut and singly cut vector DNA was E. coli (5, 12, 13). In pAdlOsacBII, sacB is expressed from a packaged at 5-10% the efficiency (Table 2, lines 1 and 2) of Table 2. DNA packaging of pAdlOsacBII DNA NS3529 (Cre+) SucR, Insert T4 DNA kanR kanR Eff Exp. Vector DNA DNA ligase (1) (2) (2/l) 1 Uncut None - 620 1 0.2 2 BamHI cut None - 340 8 2.0 3 BamHI cut None + >5000 75 >1.5 4 Sca I cut (BAP) None + 800 8 1.0 BamHI cut (CIP) 5 Sca I cut (BAP) Fraction 1 + 686 516 75 BamHI cut (CIP) 6 Sca I cut (BAP) Fraction 2 + 518 328 63 BamHI cut (CIP) 7 Sca I cut (BAP) Fraction 3 + 574 418 72 BamHI cut (CIP) In experiments 1-3, we used 200 ng of vector DNA that was either uncut or cut with BamHI. The DNA in experiment 3 was then ligated with 400 units of T4 DNA ligase and all three of the DNAs were packaged in vitro. In experiments 4-7, 200 ng of vector DNA was first digested with Sca I and then treated with BAP. It was then extracted with phenol/chloroform and ethanol precipitated. After resuspension in TE buffer, the DNA was digested with BamHI and then treated with CIP. The DNA was again extracted with phenol/chloroform and ethanol precipitated. In experiment 4, this DNA was ligated and packaged as described above. In experiments 5-7, the digested vector DNA was mixed with 500 ng of human DNA that had been partially digested with Sau3AI and fractionated on a sucrose gradient before being ligated and packaged. Gradient fractions 1, 2, and 3 contain Sau3AI fragments that range in size from 80 to 120, 70 to 100, and 50 to 80 kb, respectively. The numbers of kanR or sucR, kanR colonies shown represent results obtained when 10%o of the packaging reaction was used to infect bacterial strain NS3529. Details of the methods used to digest, ligate, and fractionate the DNAs are described by Pierce and Sternberg (8). Eff, efficiency (%). Downloaded by guest on September 30, 2021 Biochemistry: Pierce et al. Proc. Natl. Acad. Sci. USA 89 (1992) 2059

concatemerized vector DNA (Table 2, line 3). Since P1 PI clones normally packages a headful (-110 kb) of DNA (2, 15, 16), substrates as small as the vector itself (-32 kb) are not 1 3 4 5 6 7 8 9 10 111213 1516 1718 expected to be recovered efficiently by in vitro packaging compared to a large concatemer. A possible explanation for these results is presented in the Discussion. For the actual cloning of genomic DNA, the vector is cleaved at both the Sca I and BamHI sites to generate two arms. The Sca I ends ofthe arms are treated extensively with BAP and the BamHI ends are treated mildly with CIP (8). 65kb1 This minimizes the ligation of spurious fragments to the Sca I1 Okb I ends, reduces the ligation ofBamHI ends to each other, but still allows efficient ligation of the BamHI ends to Sau3AI --o- 70kb partially digested genomic DNA fragments. Genomic DNA inserted between the two vector arms (2) creates the appro- --W- 40kb priate substrate for the subsequent in vitro packaging reaction. Experiments were performed with three different genome fragment preparations (fractions of sucrose gradients that were used to size select Sau3AI-digested human DNA). Addition of the insert DNA to the ligation reaction mixture increases the proportion of sucR, kanR colonies recovered after in vitro packaging -70-fold (Table 2, lines 4-7). Restriction Digestion Analysis of Plasmid DNA from FIG. 3. Not I digestion of pAdlOsacBII mouse clones. P1 clones pAdlOsacBII Clones. Plasmid DNA was isolated from 64 were isolated by in vitro packaging of DNA from ligation reaction colonies produced on the kanamycin plates containing su- mixtures containing pAdlOsacBII vector DNA and Sau3AI partially crose digested, sucrose-fractionated mouse DNA. These reactions were and 12 colonies produced on the kanamycin plates similar to those shown in Table 2 (lines 5-7). Plasmid DNA was without sucrose (Table 2, line 5). The DNAs were digested isolated from several of the kanR, sucR clones, digested with Not I, with Bgl II and Xho I and fractionated on 1% agarose gels. All and fractionated by FIGE (lanes 6-13). Lane 3, pAdlOsacBII vector 64 of the DNAs from colonies produced on plates with DNA digested with Not I. Lanes 4 and 5, Not I-digested plasmid sucrose contained genomic DNA inserts. Only 50o of the DNA from two different kanR sucrose-sensitive colonies produced DNAs in colonies produced on plates lacking sucrose contain by packaging pAdlOsacBII DNA and using those phage to infect cloned inserts (data not shown). To determine the sizes ofthe Cre' strain NS3529. Lanes 15-18, size markers. 17 DNA is 40 kb cloned inserts, we isolated plasmid DNA from 26 sucR (lane 15), P1 mouse clone 20 is 70 kb (lane 16), P1 DNA is 110 kb (lane colonies from a cloning reaction similar to that in Table 2 17), and T4 DNA is 165 kb (lane 18). (lines 4-7) but using fractionated Sau3AI-digested mouse genomic DNA. Those DNAs were digested with Not I and 4B) and transferred to nitrocellulose filters. The clone 1 T7 fractionated by FIGE. Fig. 3 illustrates results with 8 repre- RNA probe hybridizes to a single EcoRI fragment from the sentative examples of the 26 clones. Lane 3 contains clone 1 EcoRI digest (Fig. 4C). This is presumably the EcoRI pAdlOsacBII DNA, which is 32 kbp. Lanes 4 and 5 contain fragment generated from the T7 end of the 70-kb insert in this a plasmid with the 18-kb kanR domain of the pAdlOsacBII clone. It also hybridizes to two BgI II fragments from this vector (Fig. 2). Lanes 6-13 contain plasmids from sucR DNA. The detection of two fragments indicates that there is colonies with genomic inserts ranging in size from 30 to 85 kb a Bgl II restriction site between the T7 promoter and the (total plasmid DNA is insert plus 18 kb). The clones con- closest Taq I site in the insert. As expected, the clone 1 probe taining the smaller inserts (30-60 kb) can be eliminated by a does not hybridize to any ofthe fragments produced by either more careful fractionation of digested DNA to eliminate the EcoRI or Bgl II digest of the clone 14 DNA. Moreover, fragments in the lower size range (2) and by taking greater as it fails to hybridize to a BgI II digest of either human or care to completely digest and dephosphorylate the vector mouse DNA, it probably has no repetitive DNA sequences. DNA. Failure to do the latter allows concatemers of vector Single copy genomic sequences in these DNAs could not be DNA to form and permits the packaging and recovery of visualized in the short exposure times used in this experi- smaller inserts in phage containing a headful of DNA (2, 15). ment. The clone 14 RNA probe hybridizes extensively to BgI The Use of T7 and Sp6 Promoters for Generating Probes II-digested mouse DNA, indicating that it contains repetitive from the Ends of the Cloned Inserts. One important use of DNA (Fig. 4D). Despite this, it could be used to detect unique genomic libraries is for chromosome mapping and involves end fragments from clone 14 DNA but not from clone 1 DNA. the linkage of individual clones into contiguous segments of A longer exposure of this gel results in the appearance of DNA that span a portion of the cloned genome, a process other in both the clone 14 and clone 1 called chromosome walking. The pAdlOsacBII vector facil- fragments lanes, itates this process by using T7 and Sp6 promoters (14) to presumably due to their hybridization with the repetitive generate RNA probes from the ends of the cloned DNA. sequences in the probe. End fragments could also be detected End-specific probes can be used to determine whether both with RNA probes generated from the Sp6 promoter of clone ends of a cloned DNA segment come from the same contig- 1 and clone 14 DNA (data not shown). uous region of the genome, to identify the next clone along the contiguous sequence, and to facilitate restriction mapping DISCUSSION of the insert. To demonstrate the use of RNA probes in identifying end fragments, DNA from P1 clones containing The essential feature of the P1 cloning vector pAdlOsacBII is either 70- (clone 1) or 50-kb (clone 14) mouse genomic inserts the sacB gene. It permits one to discriminate between clones were digested with Taq I, a restriction enzyme that recog- containing inserts and those that do not by a factor of nizes a 4-bp site, and were then incubated with either T7 or -70-fold (Table 2). The effect of that discrimination on P1 Sp6 polymerase (Fig. 4A). The resulting RNA probes were cloning is 2-fold: it allows one to generate P1 libraries by hybridized to EcoRI or Bgl II digests of clone 1 or clone 14 pooling strategies and it makes practical the cloning of inserts DNAs that had been fractionated in a 0.8% agarose gel (Fig. under less than optimal ligation conditions. Downloaded by guest on September 30, 2021 2060 Biochemistry: Pierce et al. Proc. Natl. Acad. Sci. USA 89 (1992) A Mouse genomic and the adjacent sacB sequences (data not shown). We DNA insert assume that they are generated by aberrant digestion and/or ligation reactions. Elimination of these reactions should increase the discrimination level of the vector. One ofthe surprising observations made in these studies is the high efficiency (5-10% compared to concatemerized vector DNA) with which the in vitro packaging system recovers both uncut vector DNA or singly cut, BamHI- B An. C digested vector DNA as kanR clones (Table 2, lines 1-3). ! D Since the P1 packaging system should only be able to ; .. encapsidate a headful of DNA (%s110 kb of DNA for normal ,_ A L::1 L; -Li 'II P1 heads and 45 kb for small P1 heads) (2, 16), we expect neither of these DNAs to be an efficient substrate for the P. '. s

.. ,-' system (pAdlOsacBII vector DNA is 32 kb). Typically, P1 packaging lysates contain 10-15% small heads (ref. 16; ._ unpublished data). To further investigate the packaging ofcut and uncut 32-kb vector DNA, we analyzed the product of ..i. w .: "'O those reactions by CsCl equilibrium density gradients. That M. analysis indicates that the resulting kanR-producing phage have the same density as P1 plaque-forming particles and P1 small-headed phage and, hence, a normal headful of DNA. Thus, the DNAs must be packaged from headful-sized concatemers. How these concatemers are generated is still unclear, but they are probably not due to ligation of DNA in one of the packaging reactions since no evidence of ligation is detectable in reconstruction experiments (data not shown). Besides the positive selection system, another advantage FIG. 4. Using RNA probes to localize end fragments of cloned P1 of the pAdlOsacBII vector over our previous P1 cloning inserts. (A) Diagram of a pAdlOsacBII mouse clone. Various ele- vector is the incorporation of several features that facilitate ments of the clone are designated in the figure. (B) Fractionation of the characterization of the insert DNA. First, the presence of Bgl II or EcoRI digests of DNA derived from two P1 mouse clones (clones 1 and 14) by electrophoresis in 0.8% agarose gels. Also shown unique and rare restriction sites (Not I, Sal I, Sfi I) flanking are Bgl II digests of mouse and human DNA that were fractionated the BamHI cloning site permits one to easily size and isolate on the same gel. (C) Southern hybridization of a filter generated from the insert DNA (Fig. 3). Moreover, since Not I and Sfi I sites the gel in B with an RNA probe prepared with T7 polymerase from are not likely to be present in most of the cloned fragments, Taq I-digested clone 1 DNA. The minor band in the lane containing these sites can be end labeled after digestion and that DNA the EcoRI digest of clone 1 DNA is presumably due to incomplete can be used to map the location of other restriction sites Taq I digestion of that DNA. (D) Same as C except the probe was within the insert DNA by partial enzyme digestion. The prepared from Taq I-digested clone 14 DNA. presence of T7 and Sp6 promoters flanking the BamHI cloning site permits the production of RNA probes from both In the original cloning vector (2), there is a preferred ends of the insert (Fig. 4). This should make it easier to amplification of clones lacking inserts. In pooled populations, evaluate the fidelity of the cloning process and should facil- this can create a large enough bias to interfere with the itate the use of the clones in chromosome walking strategies. isolation and characterization of individual clones. We have recently constructed a mouse library in the pAdlOsacBII We would like to thank Dr. Vansantha Nagarajan for the pBE501 vector that consists of 300 pools of 400 clones each (data not plasmid. This work was supported by National Institutes of Health shown). Less than 1% of the clones lack an insert. We have Grant R01-HG00339-02. had little trouble to using PCR techniques isolate clones with 1. Sternberg, N. (1990) Proc. Natl. Acad. Sci. USA 87, 103-107. unique sequences from this library. 2. Sternberg, N., Ruether, J. & DeRiel, K. (1990) The New Biol. 2, It is usually the practice to clone large inserts under 151-162. conditions in which the ends of the vector DNA are treated 3. Smoller, D., Petrov, D. & Hartd, D. (1991) Chromosoma 100, with alkaline phosphatase and are in slight excess over insert 487-494. ends, the 4. Eliason, J. L. & Sternberg, N. (1987) J. Mol. Biol. 198, 281-292. conditions used in Table 2. These conditions permit 5. Tang, L. B., Lenstra, R., Borchert, T. V. & Nagarajan, V. (1990) efficient cloning of insert DNA and minimize the possibility Gene 96, 89-92. of cloning two genomic fragments in the same vector mole- 6. Kaiger, B. D. & Jessie, J. (1990) Focus 12, 28. cule. Unfortunately, the ratio of vector to insert DNA is often 7. Sternberg, N., Sauer, B., Hoess, R. & Abremski, K. (1986) J. Mol. very high when only small amounts of insert DNA are Biol. 187, 197-212. 8. Pierce, J. C. & Sternberg, N. (1991) Methods Enzymol., in press. available. This is the case when sorted chromosomes or 9. Birnboim, H. C. & Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523. gel-purified fragments ofchromosomal DNA are used. Under 10. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular these conditions, most of the clones will have no inserts. Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold Positive selection with the pAdlOsacBII vector eliminates the Spring Harbor, NY), 2nd Ed. majority of these clones and selects the rarer insert- 11. Sauer, B. & Henderson, N. (1988) Gene 70, 331-338. 12. Gay, P., Le Coq, D., Steinmetz, M., Ferrari, E. & Hoch, J. A. containing clones. (1983) J. Bacteriol. 153, 1424-1431. When the pAdlOsacBII vector is cleaved at the BamHI 13. Gay, P., Le Coq, D., Steinmetz, M., Berkelman, T. & Kado, C. I. cloning site and then ligated in vitro, the ability of the vector (1985) J. Bacteriol. 164, 918-921. to discriminate between clones with or without inserts is 14. Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zinn, compromised, as evidenced by an increased recovery ofsucR K. & Green, M. R. (1984) Nucleic Acids Res. 12, 7035-7054. 15. Streisinger, G., Emrich, J. & Stahl, M. M. (1967) Proc. Natl. Acad. clones in the absence of added insert DNA (Tables 1 and 2). Sci., USA 57, 292-295. Analysis of these clones showed that the majority contained 16. Yarmolinsky, M. & Sternberg, N. (1988) Bacteriophage PI, ed. small deletions of vector DNA that included the BamHI site Calender, R. (Plenum, New York), pp. 291-438. Downloaded by guest on September 30, 2021