A Role for ASIC3 in the Modulation of High-Intensity Pain Stimuli

A role for ASIC3 in the modulation of high-intensity pain stimuli

Chih-Cheng Chen*, Anne Zimmer*†, Wei-Hsin Sun*, Jennifer Hall*, Michael J. Brownstein*, and Andreas Zimmer*†‡

*Laboratory of Genetics, National Institute of Mental Health, 36 Convent Drive 3D06, Bethesda, MD 20892; and †Laboratory of Molecular Neurobiology, Department of Psychiatry, University of Bonn, Sigmund-Freud-Strasse 25, 53105 Bonn, Germany

Communicated by Jean-Pierre Changeux, Institute Pasteur, France, April 24, 2002 (received for review February 18, 2002) Acid-sensing ion channel 3 (ASIC3), a proton-gated ion channel of neurons such as a reduced sensitivity of some mechanoreceptors the degenerins͞epithelial sodium channel (DEG͞ENaC) receptor to noxious pinch and an enhanced sensitivity to light touch (6). family is expressed predominantly in sensory neurons including However, the contribution of ASIC3 to pain signaling remains nociceptive neurons responding to protons. To study the role of unclear. In this study we show that ASIC3Ϫ͞Ϫ animals display ASIC3 in pain signaling, we generated ASIC3 knockout mice. enhanced behavioral responses to high-intensity nociceptive Mutant animals were healthy and responded normally to most stimuli regardless of their modality. These results reveal a role sensory stimuli. However, in behavioral assays for pain responses, for ASIC3 in the tonic inhibition of high-intensity pain signals. ASIC3 null mutant mice displayed a reduced latency to the onset of pain responses, or more pain-related behaviors, when stimuli of Materials and Methods -moderate to high intensity were used. This unexpected effect Generation and Breeding of ASIC3؊͞؊ Mice. Genomic clones con seemed independent of the modality of the stimulus and was taining the mouse ASIC3 gene were screened from a 129͞Sv observed in the acetic acid-induced writhing test (0.6 vs. 0.1–0.5%), mouse genomic library by using a 710-bp (nucleotides 1–710) in the hot-plate test (52.5 and 55 vs. 50°C), and in tests for fragment from the rat ASIC3 cDNA (10). ␭ phage clones mechanically induced pain (tail-pinch vs. von Frey ﬁlaments). We containing the entire coding region were isolated, and the inserts postulate that ASIC3 is involved in modulating moderate- to were subcloned into pBluescript II KS(ϩ) (Stratagene). The high-intensity pain sensation. targeting vector was constructed by replacing a 2.5-kb BsrGI fragment (containing exons 2–11) with a lacZ-neo cassette. This ation channels of the degenerin͞epithelial sodium channel targeting construct was introduced into embryonic stem cells by family (DEG͞ENaC) have been proposed as transducers of homologous recombination using standard protocols (16). Mu- C ͞ somatosensory stimuli in several species (1). The structural tant embryonic stem cell lines were injected into C57BL 6J hallmarks of these proteins are two hydrophobic transmembrane blastocysts, and chimeras were backcrossed to CD-1 mice. In domains, with short N and C termini and a large extracellular most behavioral assays, F2 offspring (8–12 weeks) were tested. F4 loop. In vertebrates, the DEG͞ENaC family includes several mice with a CD-1 background were used in the von Frey fiber, ϩ ͞ tail-pressure, and carrageenan tests. related subunits of Na -selective (PNA PK, 8–40) acid-sensing ion channels (ASIC1a, ASIC1b, ASIC2a, ASC2b, ASIC3, and ␣͞ ␤ ͞ Mouse Genotyping. The ASIC3 mutation was confirmed by South- ASIC4; previously named ASIC- BNC2, ASIC- , MDEG1 ͞ BNC1, MDEG2, DRASIC, and SPASIC, respectively) (2–4). ern blotting with a 1.8-kb external SpeI SacI DNA fragment ASIC proteins associate as homo- or heteromultimers to form from the genomic clone. Subsequent genotypings were performed by PCR. A genomic 5Ј primer, TGTGGTCCCAG- functional receptors. Because these receptors are gated by Ј protons, it has been suggested that they might be involved in the GACTTGGTA, and a 3 primer, ATACTTGCTGTTGCTG- perception of pain during tissue acidosis (5). However, there is GCAG, were used to identify the wild-type allele (0.7 kb). The DRASIC knockout allele was identified with the same 5Ј primer evidence also that they are involved in mechanosensation; many Ј DEG͞ENaC proteins are localized to mechanosensitive cells in anda3 lacZ primer, ATTCAGGCTGCGCAACTGTT (0.5 kb). Caenorhabditis elegans, Drosophila melanogaster, rat, and mouse (1, 6, 7). In C. elegans, mutations in DEG͞ENaC proteins such Northern Analysis. RNA was isolated from tissues by using TRIzol as MEC-4 and MEC-10 lead to impaired touch responses (8, 9), (Invitrogen). Total RNA (5–10 mg) was loaded in each lane in a formaldehyde agarose gel. Gel electrophoresis and Northern and the targeted deletion of ASIC2 in mice resulted in a reduced 32 sensitivity of low-threshold mechanoreceptors (7). blotting were performed by using a standard method. P-labeled One member of the ASIC family, ASIC3, seems to be a cDNA probes were hybridized with blots in 5 ml of ExpressHyb solution (CLONTECH) at 68°C for 1 h. Blots were washed in particularly good candidate for the transduction of proton and ϫ ϫ ϭ ͞ mechanical stimuli, because ASIC3 is expressed predominantly 0.2 SSC (1 SSC 0.15 M sodium chloride 0.015 M sodium citrate, pH 7.0)͞0.5% SDS for 40 min. For ASIC3 expression, a in dorsal root ganglia neurons (10) including large-diameter ͞ mechanoreceptors and unmyelinated small-diameter peptidergic 650-bp EcoRI BsrGI DNA fragment (nucleotides 1–650) cor- nociceptors (3, 6, 11). In addition, ASIC3 protein was found to responding to the first exon was used as probe. For other be present in sensory nerve terminals in Meissner corpuscles members of the ASIC family, the similar region of exon 1 was chosen. For vanilloid receptor (VR)1, the blots were probed with lanceolate fibers, which correspond to rapidly adapting low- Ј threshold mechanoreceptors, as well as in free nerve endings, a 400-bp PCR fragment amplified by using the primers 5 - AGACAGACAGCCTGAAGCAGTTT-3Ј and 5Ј-CTTGT- which may correspond to nociceptors (6). Ј Previous studies have shown that ASIC3 can be activated by CACGAACTTGGTGTTGTC-3 . For VRL1, the blots were protons and generate biphasic inward currents when it was probed with a 430-bp PCR fragment corresponding to amino acids 78–220. For cyclophilin, the probe was a 300-bp PCR DNA expressed in heterologous cells (12). A transient inward current Ј can be induced when extracellular pH falls to 7.0, which is well fragment that was amplified by using the primers 5 - within the physiological range. In these same cells, a further pH drop to 5.0 also can induce a sustained current (13–15). Abbreviations: DEG͞ENaC, degenerins͞epithelial sodium channel; ASIC, acid-sensing ion A recent physiological analysis of ASIC3-deficient mouse channel; VR, vanilloid receptor. mutants has revealed alterations in mechano- and acid-sensitive ‡To whom reprint requests should be addressed. E-mail: [email protected].

8992–8997 ͉ PNAS ͉ June 25, 2002 ͉ vol. 99 ͉ no. 13 www.pnas.org͞cgi͞doi͞10.1073͞pnas.122245999 Downloaded by guest on September 24, 2021 (light on at 0700 Eastern standard time). Animals had free access to food and water. Male animals, 8–12-weeks old, were used for behavioral studies. All experiments were approved by local ethical committees. For the acetic acid-induced writhing test, mice (n ϭ 8–13 per group) were injected i.p. with 10 ml͞kg 0.1–0.6% acetic acid (pH 2.8) and separated into individual cages. A few minutes after the injection, animals showed abdominal constrictions and length- wise stretches of the torso with a concomitant concave arching of the back. The number of abdominal constrictions was counted for 20 min after the injection. The onset time of the first constriction was recorded also. The tail-flick assay was performed by using an automated tail-flick apparatus (Columbus Instruments, Columbus, OH) by standard procedures (17, 18). The cut-off time was 12 sec. The number of animals was 10 per group. The hot-plate test was performed with an electronically controlled hotplate analgesia meter (Columbus Instruments) at 5, 52.5, and 55°C. The latency until mice showed first signs of discomfort (hind-paw lifting, licking, or shaking, and jumping) was recorded. The number of animals was 10 per group. To determine mechanical pain sensation and hyperalgesia, a von Frey filament test was used. Briefly, mice were placed on a Fig. 1. Generation of ASIC3-deficient mice. (a) Restriction map of the murine wire mesh platform in a transparent Plexiglas chamber (7 ϫ 11 ϫ wild-type ASIC3 locus, the targeting vector, and the mutant ASIC3 locus. The 12 cm). Mice (n ϭ 10 per group) were allowed to habituate for targeting vector was generated by replacing a 2.5-kb BsrGI fragment, containing exons 2–11, with lacZ-neo. Correctly targeted clones were identified 30 min before the test. A series of von Frey fibers (0.23–3.63 g) by Southern blotting using 5Ј and 3Ј outside probes as indicated. (b) Southern were applied through the wire mesh onto the plantar surface of blot analysis of tail biopsies after digestion with KpnI. The wild-type and both hind paws in ascending order beginning with the finest fiber. mutant ASIC3 alleles can be identified as 14- or 16-kb fragments, respectively. A withdrawal response was considered valid only if the hind paw X, XmaI; K, KpnI; B, BamHI; BG, BsrGI; S, SpeI; E, EcoRI. was removed completely from the platform. If the paw withdrawal response was ambiguous, the application was repeated. Ј Ј For each paw, a von Frey hair was applied five times at 5-sec ACCCCACCGTGTTCTTCGGAC-3 and 5 -CATTTGCCAT- intervals. The threshold was determined when paw withdrawal Ј GGACAAGATG-3 . was observed in more than three of five applications. Immunohistochemistry. Immunostaining was performed as de- For the tail-pressure test, an analgesia meter (Ugo Basile, scribed (10). Primary antibodies against peripherin, N52, sub- Comerio, Italy) was used. The tail was placed on a small plinth stance P (dilutions of 1:500, 1:500, and 1:100 respectively, under a cone-shaped pusher. The force applied to the tail by the ϫ Chemicon) were diluted in blocking solution comprising 1 plinth increases at a constant rate. We determined the force at PBS, 1% BSA, and 0.5% Triton X-100. Secondary antibodies the moment of tail flick. The number of animals was 20 per conjugated with Alexa Fluor 488 or Alexa Fluor 594 (Molecular group. Probes) were used at a 1:500 dilution in blocking solution. Hargreave’s test was performed basically as described (19). isolectin B4-fluorescein isothiocyanate (4 ␮g͞ml) was diluted in Briefly, each mouse was placed on a 3͞16th-inch-thick glass floor PBS containing 0.1 mM CaCl2, MgCl2, MnCl2, and 0.2% Triton and restrained in a glass jar (6.5 ϫ 7.5 ϫ 9.5 cm). Mice (n ϭ 10 X-100. per group) were allowed to habituate for at least 2 h before Behavioral experiments. Mice were housed in a temperature- testing. The plantar surface of mouse hind paws was stimulated and humidity-controlled vivarium kept on a 12-h dark͞light cycle by a high-intensity beam (45 W) from a projector lamp bulb

Fig. 2. Northern blot analysis of neonatal (day 4) and adult mouse tissues with probes for ASIC1–ASIC4 and VR1 and VRL1. Cyclophilin served as a control. WB, NEUROBIOLOGY whole brain; DG, dorsal root ganglia; SC, spinal cord; BS, brainstem.

Chen et al. PNAS ͉ June 25, 2002 ͉ vol. 99 ͉ no. 13 ͉ 8993 Downloaded by guest on September 24, 2021 Table 1. Neuronal cell composition of dorsal root ganglia from test. For capsaicin hypersensitivity, capsaicin (0.1 ␮g͞␮linan ,ASIC3؉͞؉ and ASIC3؊͞؊ mice isotonic saline containing 10% ethanol and 0.5% Tween 80 ASIC3 Positive Sigma) was injected into the plantar surface of the right hind paw ␮ Marker genotype Total cells cells Percentage in a volume of 20 l. After 4 h, thermal and mechanical sensitivity was tested as described above. N52 ϩ͞ϩ 2689 1206 44.9 Data were analyzed by one- or two-way ANOVA followed by ϩ͞ϩ Peripherin 2689 1623 60.4 post hoc tests when appropriate with the STATVIEW 5.0 program N52͞peripherin ϩ͞ϩ 2689 142 5.3 (SAS Institute, Cary, NC). N52 Ϫ͞Ϫ 3364 1416 42.1 Peripherin Ϫ͞Ϫ 3364 2117 63.0 Results ͞ Ϫ͞Ϫ N52 peripherin 3364 169 5.0 To inactivate the ASIC3 gene, we replaced exons 2–11 with a ϩ͞ϩ IB4 879 309 35.2 lacZ-neo cassette by homologous recombination in embryonic Ϫ͞Ϫ IB4 607 221 36.4 stem cells (Fig. 1). This deletion removes the second transmem- ϩ͞ϩ Substance P 1258 129 10.3 brane domain and most of the extracellular domain. Homozy- Ϫ͞Ϫ Substance P 1553 199 12.8 gous ASIC3Ϫ͞Ϫ mice were obtained with almost the expected ϩ͞ϩ ϩ͞Ϫ Sections (10 ␮M) from dorsal root ganglia of ASIC3ϩ͞ϩ and ASIC3Ϫ͞Ϫ mice Mendelian frequency (ASIC3 , 336 animals, 27%; ASIC 3 , Ϫ͞Ϫ were stained immunoﬂuorescently for the indicated cell markers. IB4, isolectin 591 animals, 49%; ASIC3 , 286 animals, 24%). They were B4; N52, 200-kDa neuroﬁlmentprotein. healthy and fertile and cared for their offspring. The absence of ASIC3 expression in homozygous mutant mice was confirmed by Northern blot analysis using an exon 1-specific probe. ASIC3 is located 6 cm below the glass floor. The paw-withdrawal latency expressed as a single transcript in dorsal root ganglion cells of was measured. wild-type animals, whereas no expression can be detected in For carrageenan hypersensitivity, ␭ carrageenan (20 mg͞ml, homozygous ASIC3Ϫ͞Ϫ mice. We also probed Northern blots Sigma) was suspended in an isotonic saline solution and injected with ASIC1a-, ASIC1b-, ASIC2-, ASIC4-, VR1-, and VRL1- into the plantar surface of the right hind paw in a volume of 20 specific probes to determine whether the ASIC3 mutation ␮l by using a 27-gauge needle. After 4 h, mice (n ϭ 10 per group) interferes with the expression of other members of the ASIC were tested either for thermal sensitivity of both hind paws by the gene family. As shown in Fig. 2, the expression levels of these Hargreave’s test or mechanical sensitivity by the von Frey fiber genes were not altered in dorsal root ganglia, spinal cord,

Fig. 3. Analysis of nociceptive responses in ASIC3ϩ͞ϩ and ASIC3Ϫ͞Ϫ mice. (a) The number of writhing bouts was increased significantly and their onset was reduced significantly in ASIC3-deficient mice after i.p. injection of 0.6% acetic acid (10 ml͞kg). (b) Injection of different acetic acid concentrations showed that the hyperalgesic phenotype of ASIC3Ϫ͞Ϫ mice is observed only at high but not at low acid concentrations. (c) ASIC3-deficient mice have reduced response latencies in the hot-plate test at high- but not low-temperature settings. (d) The pain thresholds in the tail-pressure assay also were reduced significantly in ASIC3Ϫ͞Ϫ mice. *, P Յ 0.05; **, P Յ 0. 01; ***, P Յ 0.005.

8994 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.122245999 Chen et al. Downloaded by guest on September 24, 2021 brainstem, and brain. These results indicate that no compensatory up-regulation of other ASIC genes occurred in ASIC3Ϫ͞Ϫ knockout mice. To examine whether the absence of ASIC3 affects the development of sensory neurons, serial sections of dorsal root ganglia from ASIC3ϩ͞ϩ and ASIC3Ϫ͞Ϫ mice were stained with cell-specific markers and counted. As shown in Table 1, the numbers of large- (N52-positive) and small- (peripherin-positive) diameter neurons were similar in both genotypes. Among small-diameter (nociceptive) neurons, the ratios of peptidergic (substance P-positive) and nonpeptidergic (isolectin B4-positive) cells also were similar. Thus, the ASIC3 mutation did not result in any gross developmental alterations of the dorsal root ganglia. To examine acid-evoked pain responses, we used the acetic acid-induced writhing test. Unexpectedly, ASIC3Ϫ͞Ϫ mice showed more writhings and had an earlier response onset than ASIC3ϩ͞ϩ animals (Fig. 3a). Thus, ASIC3Ϫ͞Ϫ animals appeared to be more pain-sensitive in this test. Because this result was surprising, we wished to establish a dose-response curve for the acetic acid effect by using concentrations ranging from 0.1 to 0.6%. We found that the writhing response was similar in wild-type and knockout mice below a concentration of 0.4%. At higher concentrations there was no further increase in the writhing response of wild-type mice, but there was in knockout animals (Fig. 3b). Interestingly, we found that all ASIC3Ϫ͞Ϫ mice showed an immediate pain response (vocalization) during the acetic acid injection. This response was not observed in any of the wild-type mice tested, further suggesting that ASIC3Ϫ͞Ϫ mice are more sensitive to acid-evoked pain. To determine whether other acute pain responses were affected also by the ASIC3 mutation, we assessed thermal pain sensitivity by using the tail-flick and hot-plate tests. Mutant mice displayed normal responses in the tail-flick test (data not shown), but had significantly lower response latencies in the hot-plate test (Fig. 3c). Mechano-nociception was evaluated by the tail- pressure and von Frey fiber tests. We found that knockout mice were more sensitive to tail pressure than wild-type animals (Fig. 3d), whereas there was no significant difference between two genotypes in the von Frey fiber test (Fig. 4 b and c). It should be noted that the pain stimuli in the von Frey fiber test are much milder than that applied in the tail-pressure test. The dose- response analyses of the acetic acid-induced writhing and hot- plate tests suggested that genotype differences in nociception correlated with the intensity of the pain stimuli. To confirm this inference, we performed two-way ANOVA. In the writhing test, ϭ ϭ we found significant genotype (F1,106 5.425, P 0.0217) and ϭ Ͻ concentration (F5,106 47.5, P 0.0001) effects and a significant ϭ ϭ interaction (F5,106 4.288, P 0.0014). Post hoc analysis showed that the genotype effect was significant (P Ͻ 0.005) only at the highest concentration tested. For the hot-plate test, we found ϭ significant genotype (F1,66 12.747, P 0.0007) and temperature ϭ ϭ (F2,66 16.36, P 0.0001) effects but no interaction. Paired comparisons (t test), however, showed a significant difference in the response latency between knockout and wild-type mice only Fig. 4. Normal inﬂammation-induced hyperalgesia and allodynia in at 52.5 and 55 but not at 50°C. Together, these results indicate ASIC3ϩ͞ϩ and ASIC3Ϫ͞Ϫ mice. Thermal hyperalgesia as determined with the that the ASIC3 mutation affected nociceptive responses only at Hargreave’s test (a) and mechanical allodynia as measured with von Frey high stimulus intensities. ﬁlaments (b) were similar in mutant and wild-type animals after s.c. injection Finally, we tested the effects of the ASIC3 deletion on animal of carrageenan. (c) Capsaicin injection also produced similar levels of mechan- ϩ͞ϩ Ϫ͞Ϫ models of inflammation-induced hyperalgesia and allodynia. ical allodynia in ASIC3 and ASIC3 mice. Thermal hyperalgesia and mechanical allodynia were assessed with the Hargreave’s and von Frey fiber tests, respectively. Four ϩ͞ϩ Ϫ͞Ϫ ϭ ϭ ϭ hours after carrageenan injection, both ASIC3 and ASIC3 P 0.509; 72 h: F1,17 3.04, P 0.100), suggesting that ASIC3 mice showed mechanical allodynia and thermal hyperalgesia, but does not contribute to inflammation-induced changes in these there was no difference between the two genotypes (Fig. 4 a and nociceptive responses. b). A similar result was found in mice injected with capsaicin (Fig. 4c). We still found a significant mechanical allodynia 24 Discussion

ϭ ϭ ϭ ϭ NEUROBIOLOGY (F1,17 7.28, P 0.015) and 72 h (F1,17 5.50, P 0.032) after We have generated mice with targeted disruptions of the ASIC3 ϭ carrageenan injection but no genotype effect (24 h: F1,17 0.46, gene and studied their responses to acid injections and other

Chen et al. PNAS ͉ June 25, 2002 ͉ vol. 99 ͉ no. 13 ͉ 8995 Downloaded by guest on September 24, 2021 painful stimuli. ASIC3Ϫ͞Ϫ mice have no obvious developmental Furthermore, alterations in thermal responses were seen only effects. Their dorsal root ganglia appear to have normal numbers with low-intensity stimuli, when the stimulating temperatures of neurons and neuronal subtypes. Northern blot analysis did not were lower than 52°C. It thus seems that the loss of ASIC3 would reveal any compensatory changes in RNA levels of other ASIC increase rather than decrease the threshold of nociceptive gene family members or VR1 and VRL1. C-fibers. ASIC3 is highly sensitive to extracellular protons (pH0.5 acti- Alternatively, the loss of ASIC3 may alter behavioral noci- vation ϭ 6.7). It has a steep activation curve with a Hill ceptive responses by changing the balance of dorsal horn inputs coefficient of 4.3 and shows a rapid recovery from desensitiza- from various sensory afferents. The importance of this balance tion after prolonged exposure to pH Յ 6.0 (14). These properties on the spinal processing of nociceptive signals was conceptual- convinced earlier workers that ASIC3 channels may be used by ized first in Melzak and Wall’s 1965 gate-control theory (25). sensory neurons to detect tissue acidosis. In this way, they could Although many aspects of the original theory could not be participate in mediating acid-evoked behavioral responses. How- sustained, its central concept, the inhibitory effect of A fiber ever, recent physiological studies by Price et al. (6) showed that input on C fiber evoked activity, has been confirmed in many the loss of ASIC3 in mice has only subtle effects on proton- studies (26). This effect is thought to be a key element in the induced currents in C fibers. These subtle changes did not result segmental inhibition of pain signaling through transcutaneous in a loss of acid-induced behavioral responses, because recuper- electrical nerve stimulation (TENS) and vibration (27, 28). In ative behaviors were not changed in these animals after subder- good agreement with this hypothesis is the recent demonstration mal injections of acetic acid. It seems likely that the majority of that the deletion of ASIC3 leads to changes in large-diameter proton-gated currents in these neurons are contributed by VR1 mechanoreceptor responses including an enhanced sensitivity of (20, 21). rapidly-adopting mechanoreceptors and a decreased sensitivity To determine how these cellular alterations would affect the of A fiber mechanonociceptors (6). Furthermore, several prop- Ϫ͞Ϫ animals’ responses to painful stimuli, we analyzed ASIC3 erties of proton-gated currents were altered in large-diameter mice in a variety of nociceptive tests. We were surprised to find mechanoreceptors in the absence of ASIC3. The significance of Ϫ͞Ϫ that in the acetic acid-induced writhing test, ASIC3 animals the latter finding is unclear at present, however, because pe- screamed while they were injected, had more writhing bouts, and ripheral fibers from these neurons do not respond to acid an earlier onset of pain responses. Clearly, these behavioral stimulation (29). responses suggest that the acid injection was more painful in the Because ASIC3 mRNA levels increase in inflamed tissues (11, absence of ASIC3. However, the enhanced responses of mutant 30), it has been suggested that ASIC3 may contribute to inflam- mice are not an indication for an increased sensitivity to protons. mation-induced mechanical allodynia and thermal hyperalgesia. On the contrary, we only observed these effects when a high acid However, we found similar levels of hyperalgesia and allodynia concentration (0.6%) was used but not at low acid concentra- ϩ͞ϩ Ϫ͞Ϫ after carrageenan or capsaicin injection into ASIC3 or tions. ASIC3 animals thus displayed exaggerated responses at ASIC3Ϫ͞Ϫ mice. Again, these results are consistent with the idea high stimulus intensities. Most strikingly, a similar intensity- that ASIC3 modulates the perception of high- but not low- response relationship was observed for a thermal pain stimulus intensity stimuli, which are important for the production of pain in the hot-plate test. Furthermore, with mechanical stimuli, we after tissue inflammation. also did not find any differences between ASIC3ϩ͞ϩ and Ϫ͞Ϫ In summary, we suggest that ASIC3 is not essential for ASIC3 for low-intensity stimuli (von Frey test), but we found acid-induced pain sensation, although it seems to be required for significantly enhanced pain responses in mutant mice when a full-blown responses to acids, but it rather plays an important high-intensity stimulus (tail pinch) was used. Together these role in modulating the perception of moderate- to high-intensity results provide strong evidence that ASIC3 modulates moderate- pain stimuli. It remains to be determined whether reduction in to high-intensity pain stimuli regardless of their modality. pain perception is because of effects of ASIC3 on nociceptive C The modulatory role of ASIC3 on high-intensity pain signaling fibers, mechanoreceptive A fibers, or both. Additional studies could be attributed to direct effects on the signaling properties with cell-specific ASIC3 deletions will be required to distinguish of polymodal nociceptive C fibers. This idea is supported by the between these possibilities. notion that ASIC3 can form heteromultimers with other ASIC proteins (5, 22–24). However, electrophysiological studies have This work was supported in part by grants from the Land Nordrhein- demonstrated that the loss of ASIC3 reduces responses of C Westphalen (Innovationsprogramm Forschung) and Deutsche For- fibers to noxious stimuli (pressure, heat, and protons; ref. 6). schungsgemeinschaft Grants SFB400 and FOR425.

1. Mano, I. & Driscoll, M. (1999) BioEssays 21, 568–578. 12. Waldmann, R., Bassilana, F., de Weille, J., Champigny, G., Heurteaux, C. & 2. Waldmann, R. & Lazdunski, M. (1998) Curr. Opin. Neurobiol. 8, 418– Lazdunski, M. (1997) J. Biol. Chem. 272, 20975–20978. 424. 13. Waldmann, R., Champigny, G., Bassilana, F., Heurteaux, C. & Lazdunski, M. 3. Akopian, A. N., Chen, C. C., Ding, Y., Cesare, P. & Wood, J. N. (2000) (1997) Nature (London) 386, 173–177. NeuroReport 11, 2217–2222. 14. Sutherland, S. P., Benson, C. J., Adelman, J. P. & McCleskey, E. W. (2001) 4. Garcia-Anoveros, J., Derfler, B., Neville-Golden, J., Hyman, B. T. & Corey, Proc. Natl. Acad. Sci. USA 98, 711–716. D. P. (1997) Proc. Natl. Acad. Sci. USA 94, 1459–1464. 15. de Weille, J. R., Bassilana, F., Lazdunski, M. & Waldmann, R. (1998) FEBS 5. Waldmann, R., Champigny, G., Lingueglia, E., De Weille, J. R., Heurteaux, C. Lett. 433, 257–260. & Lazdunski, M. (1999) Ann. N.Y. Acad. Sci. 868, 67–76. 16. Zimmer, A. (1992) Annu. Rev. Neurosci. 15, 115–137. 6. Price, M. P., McIlwrath, S. L., Xie, J., Cheng, C., Qiao, J., Tarr, D. E., 17. Konig, M., Zimmer, A. M., Steiner, H., Holmes, P. V., Crawley, J. N., Sluka, K. A., Brennan, T. J., Lewin, G. R. & Welsh, M. J. (2001) Neuron Brownstein, M. J. & Zimmer, A. (1996) Nature (London) 383, 535–538. 32, 1071–1083. 18. Zimmer, A., Zimmer, A. M., Baffi, J., Usdin, T., Reynolds, K., Konig, M., 7. Price, M. P., Lewin, G. R., McIlwrath, S. L., Cheng, C., Xie, J., Heppenstall, Palkovits, M. & Mezey, E. (1998) Proc. Natl. Acad. Sci. USA 95, 2630–2635. P. A., Stucky, C. L., Mannsfeldt, A. G., Brennan, T. J., Drummond, H. A., et 19. Mogil, J. S., Wilson, S. G., Bon, K., Lee, S. E., Chung, K., Raber, P., Pieper, al. (2000) Nature (London) 407, 1007–1011. J. O., Hain, H. S., Belknap, J. K., Hubert, L., et al. (1999) Pain 80, 67–82. 8. Hong, K. & Driscoll, M. (1994) Nature (London) 367, 470–473. 20. Caterina, M. J., Leffler, A., Malmberg, A. B., Martin, W. J., Trafton, J., 9. Huang, M. & Chalfie, M. (1994) Nature (London) 367, 467–470. Petersen-Zeitz, K. R., Koltzenburg, M., Basbaum, A. I. & Julius, D. (2000) 10. Chen, C. C., England, S., Akopian, A. N. & Wood, J. N. (1998) Proc. Natl. Acad. Science 288, 306–313. Sci. USA 95, 10240–10245. 21. Caterina, M. J. & Julius, D. (2001) Annu. Rev. Neurosci. 24, 487–517. 11. Voilley, N., de Weille, J., Mamet, J. & Lazdunski, M. (2001) J. Neurosci. 21, 22. Lingueglia, E., de Weille, J. R., Bassilana, F., Heurteaux, C., Sakai, H., Wald- 8026–8033. mann, R. & Lazdunski, M. (1997) J. Biol. Chem. 272, 29778–29783.

8996 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.122245999 Chen et al. Downloaded by guest on September 24, 2021 23. Bassilana, F., Champigny, G., Waldmann, R., de Weille, J. R., Heurteaux, C. Wall, P. D. & Melzack, R. (Churchill Livingstone, Edinburgh), pp. 1191– & Lazdunski, M. (1997) J. Biol. Chem. 272, 28819–28822. 1208. 24. Zhang, P. & Canessa, C. M. (2001) J. Gen. Physiol. 117, 563–572. 29. Steen, K. H., Reeh, P. W., Anton, F. & Handwerker, H. O. (1992) J. Neurosci. 25. Melzack, R. & Wall, P. D. (1965) Science 150, 971–979. 12, 86–95. 26. Melzack, R. (1993) Can. J. Exp. Psychol. 47, 615–629. 30. Yiangou, Y., Facer, P., Smith, J. A., Sangameswaran, L., Eglen, R., Birch, R., 27. Garrison, D. W. & Foreman, R. D. (1994) Pain 58, 309–315. Knowles, C., Williams, N. & Anand, P. (2001) Eur. J. Gastroenterol. Hepatol. 28. Woolf, C. J. & Thompson, J. W. (1994) in Textbook of Pain, eds. 13, 891–896. NEUROBIOLOGY

Chen et al. PNAS ͉ June 25, 2002 ͉ vol. 99 ͉ no. 13 ͉ 8997 Downloaded by guest on September 24, 2021