Spinal!Muscular!Atrophy!Motor!Neurons!

Aberrant microRNA Expression in Spinal Muscular Atrophy Motor Neurons

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Wertz, Mary Helene. 2015. Aberrant microRNA Expression in Spinal Muscular Atrophy Motor Neurons. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences.

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:17464519

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Aberrant!microRNA!Expression!in!Spinal!Muscular!Atrophy!Motor!Neurons!

A!dissertation!presented!

by!

Mary!Helene!Wertz!

to!

The!Division!of!Medical!Sciences!

In!partial!fulfillment!of!the!requirements!

for!the!degree!of!

Doctor!of!Philosophy!

in!the!subject!of!

Neurobiology!

Harvard!University!

Cambridge,!Massachusetts!

April!2015!

! !

©!2015!'!Mary!Helene!Wertz!

All!rights!reserved.

! Dissertation!Advisor:!Mustafa!Sahin!! ! ! ! Mary!Helene!Wertz!

! Aberrant!microRNA!Expression!in!Spinal!Muscular!Atrophy!Motor!Neurons!

! Abstract!

! Spinal! Muscular! Atrophy! (SMA)! is! a! devastating! autosomalMrecessive! pediatric!neurodegenerative!disease!characterized!by!loss!of!spinal!motor!neurons.!

It!is!caused!by!mutation!in!the!survival!of!motor!neuron!1,!SMN1,!gene!and!leads!to! loss! of! function! of! the! fullMlength! SMN! protein.! SMN! has! a! number! of! functions! related! to! RNA! processing! in! neurons,! including! RNA! trafficking! in! neurites,! and!

RNA!splicing!and!snRNP!biogenesis!in!the!nucleus.!While!previous!work!has!focused! on!the!alternative!splicing!and!expression!of!traditional!mRNAs,!our!lab!has!focused! on! the! contribution! of! another! RNA! species,! microRNAs! (miRNAs),! to! the! SMA! phenotype.!!

miRNAs! are! ~22! nucleotide! small! RNAs! that! are! involved! in! postM transcriptional! regulation! of! gene! expression.! They! function! by! translational! repression! or! mRNA! decay! of! target! RNAs.! Interestingly,! dysregulation! of! RNA! processing! and! miRNA! expression! has! been! identified! in! motor! neuron! diseases! including!SMA!and!Amyotrophic!Lateral!Sclerosis.!Our!lab!previously!discovered!a! miRNA,! miRM183,! that! is! dysregulated! in! SMA! and! impacts! its! targets! in! cortical! neurons!and!SMA!mouse!spinal!cords.!!

However,!spinal!motor!neurons!are!the!cell!type!most!affected!by!SMN!loss.!

We!hypothesized!that!motor!neuron!specific!miRNA!changes!are!involved!selective!

! iii! vulnerability!in!SMA.!Therefore,!we!sought!to!determine!the!effect!of!loss!of!SMN!on! spinal!motor!neurons.!To!accomplish!this,!I!used!microarray!and!RNAseq!to!profile! both! miRNA! and! mRNA! expression! in! primary! spinal! motor! neurons! after! acute!

SMN! knockdown.! By! integrating! the! miRNA:mRNA! profiles! we! identified! dysregulated!miRNAs!with!enrichment!in!differentially!expressed!putative!targets.! miRM431!was!the!most!substantially!increased!miRNA!and!a!number!of!its!putative! targets!were!downregulated!after!SMN!loss.!Further,!I!confirm!that!miRM431!directly! regulates!its!target!chondrolectin!and!impacts!neurite!length.!

This!work!is!critical!to!understanding!the!cellMtype!specific!effect!of!aberrant! miRNA! expression! in! SMN! knockdown! motor! neurons.! It! demonstrates! the! contribution! of! dysregulated! RNA! processing! in! motor! neurons! to! neurodegeneration.! Furthermore,! this! work! highlights! the! impact! of! nonMcoding!

RNAs! in! human! disease! and! points! to! specific! miRNA! whose! dysregulation! potentially!impacts!motor!neuron!health.!

! !

! iv! Table!of!Contents! Abstract!...... !iii! Table!of!Figures!...... !vi! Table!of!Tables!...... !vi! Acknowledgements!...... !vii! Chapter!1!Introduction!to!Spinal!Muscular!Atrophy!and!microRNAs!...... !1! Spinal!Muscular!Atrophy!a!clinical!perspective!...... !2! Multifaceted!functions!of!SMN!in!RNA!processing!...... !5! In!vitro!and!in!vivo!models!of!SMA!...... !8! Development!of!therapies!for!SMA!...... !11! Commonalities!of!SMA!with!other!motor!neuron!diseases!...... !15! microRNA!...... !16! miRNA!in!spinal!motor!neurons!...... !25! Neurodegenerative!diseases!and!miRNA!expression!...... !27! The!intersection!of!SMA!and!miRNAs!...... !27! Chapter!2!Methods!...... !30! In!vitro!acute!shSMN!knockdown!model!...... !31! Exiqon!LNA!miRNA!microarray!data!analysis!...... !39! mRNA!expression!profiling!by!RNAseq!...... !40! Identification!of!putative!miRNA!target!mRNA!interactions!...... !43! Characterization!of!miRNA!target!interaction!...... !46! SMA!patient!samples!...... !49! Chapter!3!Integration!of!miRNA:mRNA!profiling!reveals!the!impact!of!miRNA! dysregulation!on!SMA!motor!neurons!...... !51! Introduction!...... !52! Results!...... !53! Discussion!...... !79! Chapter!4!miRN431!targeting!of!Chondrolectin!is!dysregulated!in!SMA!...... !85! Introduction!...... !86! Results!...... !89! Discussion!...... !96! Chapter!5!Discussion!...... !100! Chapter!6!References!...... !109! Appendix!1!...... !129! Appendix!2!...... !135! Appendix!3!...... !150! Appendix!4!...... !157! Appendix!5!...... !168! Appendix!6...... 180!

! ! !

! v! Table!of!Figures!

Figure!1.1!Schematic!of!SMA!Genetics!...... !4! Figure!1.2!Subcellular!localization!and!functions!of!the!SMN!protein!...... !6! Figure!1.3!Schematic!of!microRNA!biogenesis!...... !19! Figure!2.1!Schematic!of!in!vitro!motor!neuron!model!...... !31! Figure!2.2!Immunofluorescent!staining!of!cultured!motor!neurons!...... !33! Figure!3.1!shRNAMmediated!SMN!knockdown!...... !54! Figure!3.2!miRNA!profiling!in!SMN!knockdown!spinal!motor!neurons!...... !56! Figure!3.3!Selection!of!normalization!control!...... !60! Figure!3.4!RNAMSeq!identification!of!differentially!expressed!genes!...... !63! Figure!3.5!Analysis!of!differential!expression!using!the!DAVID!bioinformatics!tool!.!66! Figure!3.6!Gene!Set!Enrichment!of!miRNA:mRNA!interactions!...... !68! Figure!3.7!WGCNA!analysis!of!putative!enrichment!for!miR:mRNA!interactions!...... !71! Figure!3.8!miRM431!expression!changes!are!not!an!offMtarget!effect!of!shSMN!...... !74! Figure!3.9!priMmiRM431!expression!in!SMN!knockdown!motor!neurons!...... !75! Figure!3.10!miRM431!expression!changes!are!motor!neuron!specific!...... !76! Figure!3.11!miRM431!targets!are!differentially!expressed!in!the!SMA!model!...... !79! Figure!4.1!Chondrolectin!is!decreased!in!motor!neurons!lacking!SMN!...... !90! Figure!4.2!Chodl!expression!is!unchanged!in!cortical!neurons!lacking!SMN!...... !91! Figure!4.3!Chondrolectin!is!a!target!of!miRM431!...... !92! Figure!4.4!Chodl!3'UTR!is!regulated!by!miRM431!...... !93! Figure!4.5!Neurite!Length!...... !95! ! Table!of!Tables!

Table!1.1!Current!SMA!Therapeutic!Strategies!...... !12! Table!1.2!miRNA!expression!studies!in!motor!neuron!disease!...... !28! Table!2.1!qRTMPCR!primers!for!mRNA!expression!...... !36! Table!2.2!miRNA!expression!assays!miRNAMmimics!and!antiMmiR!inhibitors!...... !37! Table!3.1!Top!differentially!expressed!miRNAs!...... !58! Table!3.2!RNAMSeq!read!counts!and!mapping!rate!...... !61! Table!3.3!miRM431!targets!identified!by!differential!expression!and!WGCNA!...... !78! ! !

! vi! Acknowledgements!

I! would! like! to! thank! my! advisor,! Dr.! Mustafa! Sahin,! for! his! support! and! guidance! that! shaped! my! future! as! a! scientist! and! made! this! research! possible.!

Thanks!to!all!of!the!members!of!the!Sahin!lab!who!have!been!so!helpful!and!made! my!time!in!lab!memorable.!In!particular,!I!would!like!to!thank!Dr.!Min!Kye!for!her! excellent!scientific!mentorship!and!for!encouraging!my!initial!interest!in!miRNAs!by! laying! the! foundation! for! this! work.! Thank! you! so! much! to! Peter! Tsai! and! Emily!

Niederst!for!their!constant!encouragement,!helpful!advice,!and!maintaining!sanity!in! the!lab.!

Thank! you! to! the! faculty! and! staff! in! the! Program! in! Neuroscience,! Rachel!

Wilson,!Rick!Born,!and!Karen!Harmin!for!fostering!a!fantastic!scientific!community.!

Additionally,! thank! you! to! all! of! the! members! of! my! dissertation! advisory! committee,! Drs.! Rosalind! Segal,! Clifford! Woolf,! Larry! Benowitz,! and! Anna!

Kirchevsky.! It! was! a! privilege! to! share! my! research! progress! with! you.! Your! scientific! insights! and! advice! both! inside! and! outside! of! the! DAC! meetings! were! greatly!appreciated.!!

Thank!you!to!my!amazing!friends!and!family!particularly!my!Mom!for!always! supporting!and!encouraging!me!and!my!Dad!for!introducing!me!to!Boston.!!Thanks! to! Annie,! my! perfectly! cromulant! sister,! for! inspiring! me! and! setting! a! shining! example!of!the!type!of!scientist!I!want!to!be.!!Most!importantly,!thank!you!so!much! to! my! husband! Kyle! Usbeck! for! your! unfailing! patience,! strength,! and! love.! Your! support!means!the!world!to!me!and!I!could!not!have!done!this!without!you!!!!!

!!! !

! vii! !

Chapter!1 !

Introduction!to!Spinal!Muscular!Atrophy!and!microRNAs!

Selected!text!from!this!chapter!is!modified!from!a!review!accepted!for!publication!to! the!Annals!of!the!New!York!Academy!of!Sciences!Year!in!Neurology!and!Psychiatry!

MH!Wertz!and!M!Sahin!“Developing!Therapies!for!Spinal!Muscular!Atrophy”!2015!

M.H.W.!completed!the!primary!research!and!writing.!M.S.!contributed!to!editing!and! refining!text.!!

! !

! 1! Spinal!Muscular!Atrophy!a!clinical!perspective!

Spinal! Muscular! Atrophy! (SMA)! is! a! severe! neurodegenerative! disease! that! results!in!degeneration!and!cell!death!of!lower!motor!neurons!in!the!spinal!cord!and! is! the! leading! genetic! cause! of! infant! mortality.! It! is! an! autosomalMrecessive! inherited!disorder!with!an!incidence!of!1:11,000!live!births!and!a!carrier!frequency! of! 1! in! 50! (Sugarman! et! al.,! 2012).! SMA! was! first! described! in! 1890! and! 1891! respectively!by!Werdnig!and!Hoffman,!who!identified!cases!of!an!infantile!form!of! muscular!dystrophy.!Since!that!time!researchers!have!described!several!clinical!SMA! subMtypes,! identified! the! genetic! basis! of! the! disease,! gained! insights! into! dysregulated! molecular! pathways,! and! have! made! increasing! strides! towards! the! development!of!viable!therapeutics.!!

There! are! five! clinical! types! of! SMA! defined! by! disease! severity! and! age! of! onset,!although!the!various!types!represent!a!continuum!of!severity!with!indistinct! borders.! Type! I,! WerdnigMHoffmann! disease,! is! a! severe! infantile! form! of! SMA! diagnosed! prior! to! six! months! of! age,! often! with! mortality! occurring! before! two! years! of! age.! Type! I! SMA! patients! are! severely! hypotonic,! have! denervation! of! muscles,!and!are!never!able!to!sit!up!unaided.!Type!II,!Dubowitz!disease,!diagnosed! between!6M18!months!of!age!is!less!severe.!Type!II!patients!can!progress!to!sitting! unsupported!at!some!point!but!they!never!gain!the!ability!to!walk!unassisted!and! have! a! shortened! lifespan.! Type! III,! KugelbergMWelander,! is! diagnosed! after! 18! months!of!age.!Patients!are!able!to!stand!and!walk!unassisted!but!lose!this!ability! later!in!life.!Lifespan!is!generally!not!reduced!in!this!population.!Type!0!and!type!IV! are! rare! variants.! Type! 0! is! the! most! severe! form! of! SMA! and! is! characterized! by!

! 2! prenatal!onset!as!determined!by!reduced!fetal!movement!and!arthrogryposis,!joint! contractures,!at!birth,!and!mortality!before!6!months!of!age.!Type!IV!SMA!is!similar! to!type!III,!but!with!onset!in!adulthood!and!milder!symptoms.!!

The!genetic!basis!of!SMA!

SMA!is!caused!by!homozygous!deletions!or!mutations!involving!the!survival! of! motor! neuron! 1! (SMN1)! gene! that! encodes! the! SMN! protein! (Lefebvre! et! al.,!

1995).! Humans! possess! an! additional! gene,! SMN2,! which! is! almost! identical! to!

SMN1,!but!produces!only!10%!of!functional!fullMlength!SMN!protein!(Monani!et!al.,!

1999).!This!is!because!SMN2!has!a!CMT!substitution!in!exon7!that!weakens!an!exonic! splice!enhancer!(ESE)!site!for!binding!the!splicing!activator!SF2/ASF(Cartegni!and!

Krainer,!2002).!Loss!of!SF2/ASF!binding!leads!to!exclusion!of!exon7!and!formation! of!a!truncated,!unstable!mRNA!and!SMNΔ7!protein!that!is!rapidly!degraded!(Figure!

1.1).!Furthermore,!this!CMT!change!creates!am!exonic!splice!silencer!(ESS)!site!for!

HNRNPA1!binding!in!SMN2!that!leads!to!the!decreased!splicing!of!exon7(Kashima!et! al.,!2007).!

In!SMA!patients,!SMN2!is!the!primary!modifier!of!the!disease!phenotype;!the! number! of! copies! of! SMN2! a! patient! carries! is! inversely! correlated! with! disease! severity.! ! SMA! type! I! patients! typically! carry! only! 1M2! copies! of! SMN2! while! SMA! type!II!and!III!patients!carry!between!two!and!four!copies!of!SMN2!(Mailman!et!al.,!

2002).! Each! additional! copy! of! SMN2! produces! around! 10%! more! functional! fullM length! SMN! protein,! and! therefore! the! SMA! patient! phenotype! is! less! severe.! A! second!genetic!modifier!of!SMA!in!humans!is!plastin3!(PLS3),!an!actinMbinding!and!!

! 3! SMN1 6 7 8 FL-SMN

SF2/ASF

Exon 6 A Exon 7 Exon 8

SMN2 6 7 8 10% FL-SMN

Exon 6 C Exon 7 ISS-N1 Exon 8 HNRNPA1 90% SMNΔ7

6 8

Degraded !

Figure!1.1!Schematic!of!SMA!Genetics! SMN1! and! SMN2! are! identical! except! for! a! CMT! substitution! in! exon! 7.! This! substitution!leads!to!the!loss!of!a!splice!enhancer!SF2!binding!site,!and!creation!of!a! HNRNP!A1!binding!site!and!the!exclusion!of!exon!7.!Only!10%!is!correctly!spliced! and!translated!into!full!length!SMN!(FLMSMN).!The!remaining!90%!does!not!include! SMN!Exon!7,!and!the!truncated!SMNΔ7!product!is!unstable!and!quickly!degraded.! ! ! ! bundling! protein! involved! in! cytoskeletal! organization.! PLS3! was! identified! in!

unaffected!females!from!SMA!families!with!SMN1!mutations!that!would!otherwise!

lead! to! disease! (Oprea! et! al.,! 2008).! ! In! animal! models! of! SMA,! PLS3! was! able! to!

rescue! defects! in! motor! neuron! axons! (Oprea! et! al.,! 2008)! as! well! as! ameliorate!

motor!function!deficits!and!synapse!morphology!(Dimitriadi!et!al.,!2010;!Hao!le!et!

al.,!2012).!In!a!mouse!model!of!SMA,!increasing!PLS3!was!able!to!not!only!improve!

synaptic! transmission! at! the! NMJ,! but! also! increase! survival! (Ackermann! et! al.,!

2013).! The! mechanism! by! which! PLS3! rescues! the! SMA! phenotype! is! unknown;!

! 4! however,! recent! evidence! suggests! that! it! is! related! to! the! regulation! of! actin! dynamics! by! profillin2a! (Bowerman! et! al.,! 2009;! Bowerman! et! al.,! 2014),! and! calcium!signaling!in!the!motor!neurons!(Lyon!et!al.,!2014)!

Multifaceted!functions!of!SMN!in!RNA!processing!

!Nuclear!role!of!SMN!in!the!SMN!complex!

SMN!protein!is!ubiquitously!expressed!in!all!cells!of!the!body!very!early!in! development.!In!neurons,!SMN!has!been!found!to!play!diverse!roles!related!to!RNA! processing!and!trafficking!depending!on!its!subMcellular!localization!(Figure!1.2).!In! the!cell!body,!SMN!can!be!found!in!the!cytoplasm!and!in!nuclear!gems.!SMN!protein! forms!the!SMN!complex!with!eight!other!proteins:!gemins!2M8!and!Unrip!(reviewed! in! Gubitz! et! al.,! 2004).! This! complex! plays! a! role! in! biogenesis! of! small! nuclear! ribonucleoproteins!(snRNPs)!via!recruitment!and!binding!of!the!seven!Sm!protein! core!to!snRNA!(Meister!et!al.,!2002).!SMN!complex!binding!of!Sm!proteins!confers! specificity! and! efficiency! of! the! Sm! proteins! to! accurately! bind! specific! snRNAs!

(Pellizzoni!et!al.,!2002).!SMN!bound!snRNPs!localize!to!Cajal!bodies!where!they!are! incorporated!into!the!spliceosomal!machinery.!!

The!SMN!complex!is!also!integral!to!U7!snRNP!function!and!histone!mRNA! processing!via!interaction!with!a!different!subset!of!Sm!proteins!(Pillai!et!al.,!2003;!

Tisdale!et!al.,!2013).!Furthermore,!there!is!evidence!that!SMN!expression!levels!are! regulated!in!part!by!components!of!the!spliceosome.!UA1!protein,!a!component!of! the!U1!snRNP!complex,!regulates!SMN!expression!by!binding!to!the!3’MUTR!of!SMN!

! 5! mRNA!to!inhibit!polyadenylation!and!decrease!SMN!protein!levels!(Workman!et!al.,!

2014).!

Phenotypically,!loss!of!SMN!in!the!nucleus!and!cell!body!leads!to!depletion!of! nuclear!gems,!which!is!a!pathological!hallmark!of!SMA.!Another!disease!hallmark!is! that!loss!of!SMN!complex!function!leads!to!widespread!abnormalities!in!alternative! splicing!of!a!subset!of!mRNA!transcripts.!Early!in!disease!pathogenesis!the!number! of! transcripts! affected! is! low,! but! the! aberrant! alternate! splicing! increases! in!

SMN DAPI

Cell Body Neurites (Axon/Dendrites) Functions Functions • Forms SMN-complex with • Binding RNA-binding proteins gemins and sm core proteins • Trafficking axonal mRNA • snRNP biogenesis • Interacting with COPI vesicles • Splicing and alternative splicing

Phenotypes Phenotypes • Aberrant mRNA splicing • Impaired neurite outgrowth/ • Cellular stress morphology • Motor neuron cell death • Altered growth cone dynamics • Aberrant local translation ! ! Figure!1.2!Subcellular!localization!and!functions!of!the!SMN!protein! Immunostaining! of! a! primary! rat! motor! neuron! for! SMN! protein! expressed! throughout! the! cell! body! and! processes.! The! schematic! below! corresponds! to! subcellular!functions!of!the!SMN!protein!and!corresponding!SMA!phenotypes!in!the! cell!body!versus!axons!or!dendrites!of!spinal!motor!neurons.! !

! 6! severity!until!at!late!stages!a!large!number!of!transcripts!are!affected!(Baumer!et!al.,!

2009;! Liu! et! al.,! 2010).! In! addition! to! alternative! splicing! there! is! also! a! body! of! evidence! from! recent! transcriptome! studies! that! overall! expression! of! a! subset! of! genes!is!significantly!altered!by!SMN!deficiency!(Zhang!et!al.,!2013a;!Maeda!et!al.,!

2014).! These! expression! changes! reflect! a! more! general! dysregulation! of! gene! expression!that!is!not!directly!related!to!snRNP!biogenesis.!

SMN!in!Neuronal!Processes!

An!additional!role!for!SMN!was!first!reported!by!Bassell!and!colleagues,!who! described!the!presence!and!trafficking!of!SMN!protein,!in!association!with!Gemin2! or!Gemin3,!in!motor!neuron!axons!and!dendrites!(Zhang!et!al.,!2006).!In!neuronal! processes! SMN! regulates! RNA! via! direct! interaction! with! several! RNA! binding! proteins! including! FMRP! (Piazzon! et! al.,! 2008),! KSRP! (Tadesse! et! al.,! 2008),! HuD!

(Akten!et!al.,!2011;!Fallini!et!al.,!2011;!Hubers!et!al.,!2011),!and!Imp1!(Fallini!et!al.,!

2014).!Loss!of!SMN!in!neurons!affects!trafficking!of!SMN!binding!partners!and!target! mRNAs!(Saal!et!al.,!2014).!This!leads!to!changes!in!axon!and!dendrite!outgrowth!and! morphology,! aberrant! growth! cone! dynamics,! and! disrupted! local! translation! of! a! number!of!axonal!RNAs!(Akten!et!al.,!2011;!Rathod!et!al.,!2012;!Kye!et!al.,!2014).!!

In!motor!neuron!axons,!SMNMcontaining!granules!interact!with!the!coatamer! complex! of! coat! protein! I! (COPI)! vesicle! family! member,! αMCOP,! linking! SMN! function!to!the!Golgi!network!(Peter!et!al.,!2011).!Disruption!of!this!interaction!by! knockdown! of! αMCOP! or! inhibition! of! GolgiMmediated! granule! secretion! decreases!

SMN! in! the! cellular! processes! resulting! in! aberrant! neurite! outgrowth! and!

! 7! morphology!(Ting!et!al.,!2012;!Custer!et!al.,!2013).!The!relative!contribution!of!each! distinct! role! for! SMA! throughout! the! nucleus,! cell! body,! and! processes! of! motor! neurons! to! the! SMA! phenotype! is! not! yet! known.! However,! understanding! SMN! protein!functions!and!mechanisms!of!action!in!a!subcellular!context!could!shed!light! on! pathways! involved! in! disease! progression! and! identify! targets! for! therapeutic! intervention.!!

In#vitro!and!in#vivo!models!of!SMA!!

In!vitro!primary!culture!model!of!SMA!

! In!vitro!models!of!SMN!deficient!motor!neurons!have!been!used!extensively! in!the!past.!Neurite!outgrowth!assays!in!both!NSCM34!(Kwon!et!al.,!2011)!and!PC12!

(van!Bergeijk!et!al.,!2007)!cells!have!shown!altered!neurite!growth!induction!after! transfection!with!an!shRNA!specific!to!SMN.!In!both!cell!lines,!this!phenotype!can!be! rescued! by! exogenous! expression! of! SMN.! Cultured! motor! neurons! from! SMN! knockout!mouse!models!have!also!been!used!in!a!number!of!studies.!These!neurons! show!a!significant!deficit!in!neurite!outgrowth!and!viability!with!a!loss!of!50%!of! neurons!by!3DIV!(Rossoll!et!al.,!2003;!Jablonka!et!al.,!2007;!Ning!et!al.,!2010).!The! loss!of!motor!neuron!viability!makes!it!difficult!to!study!the!effect!of!SMN!knockout! on! specific! pathways! separate! from! the! early! induction! of! cell! death! in! vitro.!

Therefore,! the! utility! of! cultured! knockout! mouse! spinal! motor! neurons! is! somewhat!limited.!

Our!lab!and!others!have!used!shRNAMmediated!knockdown!of!SMN!to!look!at! the!effect!of!acute!loss!of!SMN!expression!on!cortical!and!motor!neurons!(Akten!et!

! 8! al.,!2011;!Kye!et!al.,!2014;!Saal!et!al.,!2014).!This!system!is!useful!because!it!allows! separation! of! intrinsic! neuronal! defects! from! nonMcell! autonomous! effects! of! surrounding! cell! types.! Additionally! the! cells! are! viable! until! later! time! points! in! culture,! and! acute! knockdown! allows! us! to! isolate! immediate! effects! of! SMN! loss! separate!from!development,!differentiation,!or!death.!

In!vitro!human!SMA!stem'cell!model!

Induced! pluripotent! stem! cells! (iPSCs)! are! increasingly! used! to! model! CNS! diseases! including! Alzheimer’s! disease,! Parkinson’s! disease,! and! ALS! (reviewed! in!

Feng! and! Gao,! 2012).! iPSCs! derived! from! SMA! patient! fibroblasts! can! be! differentiated!into!neural!lineage!cells!and!have!low!SMN!expression!and!decreased! nuclear!gems!(Ebert!et!al.,!2009).!iPSCs,!and!the!motor!neurons!derived!from!them,! are!an!in!vitro!model!of!SMN!loss!that!can!be!used!to!study!cellular!phenotypes!and! potential! treatment! compounds! (Ebert! et! al.,! 2009;! Ebert! et! al.,! 2013).! The! iPSCM derived! motor! neurons! from! SMA! patients! have! a! neurite! outgrowth! abnormality! that!is!comparable!to!those!in!motor!neurons!from!other!in!vitro!models!that!can!be! rescued!by!ectopic!SMN!expression!(Chang!et!al.,!2011).!Interestingly,!SMA!patient! iPSCs!retain!the!ability!to!form!motor!neurons!indicating!that!pathways!involved!in! differentiation!are!relatively!normal!in!cells!with!SMN!deficiency.!SMA!iPSCMderived! motor! neurons! have! decreased! viability,! and! the! number! of! mature! neurons! is! significantly!decreased!after!several!weeks!in!culture!(Ebert!et!al.,!2009;!Sareen!et! al.,! 2012).! This! may! have! broader! implications! in! development! and! survival! of! neuronal!subtypes!in!SMA!model!organisms.!!

! 9! Animal!models!of!SMA!

Complete!loss!of!SMN!expression!is!lethal!very!early!in!gestation!(Schrank!et! al.,! 1997),! and! therefore! Smn! knockout! mice! are! not! a! viable! SMA! model.! While! humans! with! SMA! have! at! least! one! copy! of! the! disease! modifying! SMN2! gene,! animal! models! do! not! possess! the! SMN2!gene.!As! a! result,! mouse! models! of! SMA! often!include!human!SMN2!transgenes!or!modifications!to!the!mouse!Smn!to!mimic!

SMN2! exon7! splicing.! To! date,! a! number! of! mouse! models! of! SMA! have! been! described!that!cover!the!spectrum!of!disease!phenotypes!from!severe!infantile!onset! to! milder! type! III! (reviewed! in! Bebee! et! al.,! 2012).! Of! these! models,! two! have! emerged!as!the!most!widely!used.!The!Taiwanese!model,!(Smnhung'/';SMN2Hungtg/')! which!expresses!a!transgene!with!two!copies!of!human!SMN2!(HsiehMLi!et!al.,!2000),! and!SMNΔ7(Smn'/';SMN2tg/tg;SMNΔ7tg/tg)!which!is!homozygous!for!human!SMN2!and!

SMNΔ7!(Le!et!al.,!2005).!Both!exhibit!a!severe!motor!phenotype,!significant!motor! neuron!loss!and!lifespan!of!less!than!two!weeks!on!average.!These!models!allow!for! investigation!of!the!biological!processes!that!underlie!SMA!pathogenesis.!

Invertebrate! models! of! SMA! are! integral! to! understanding! aberrant! development,!axon!outgrowth,!and!splicing.!C.!elegans!have!been!used!in!RNAi!based! screens!for!Smn!modifier!genes!(Dimitriadi!et!al.,!2010).!Drosophila!are!genetically! tractable,! and! are! a! good! system! for! investigating! NMJ! morphology! (Chang! et! al.,!

2008).!In!zebrafish,!the!SMA!axonal!phenotype!is!recapitulated!by!administration!of! an! antisense! morpholino! that! knocks! down! Smn1! expression! (McWhorter! et! al.,!

2003).! Zebrafish! genetic! models! of! SMA! also! have! severe! motor! axon! defects! and!

! 10! can! be! used! for! rescue! experiments! to! look! at! temporal! effects! of! Smn1! loss! on! motor!axons!(Hao!le!et!al.,!2011;!Hao!le!et!al.,!2013).!!

Development!of!therapies!for!SMA!

To!date!there!is!no!FDAMapproved!treatment!for!SMA,!and!only!respiratory! and!palliative!therapies!are!available!to!patients.!In!recent!years,!several!promising! treatments! have! entered! advanced! clinical! trials.! The! therapeutic! aim! in! the! majority! of! these! trials! is! to! increase! the! amount! of! functional! fullMlength! SMN! protein! expressed.! There! are! three! strategies! to! achieve! this:! antisense! oligonucleotide! (ASO)Mmediated! exon7! inclusion! at! the! SMN2! locus,! exogenous! expression! of! SMN1! by! viralMmediated! gene! therapy! vectors,! or! targeting! by! endogenous!SMN!modulators!(Table!1.1).!!

Antisense!Oligonucleotides!

ASOs!are!singleMstrand,!DNAMlike!molecules!15M35!nucleotides!long!that!can! modulate! target! gene! expression! by! hybridization! to! the! preMmRNA.! SMN! is! an! attractive! candidate! for! ASO! therapy,! as! patients! have! a! functional! copy! of! SMN2! that!is!an!ideal!target!for!modulation!of!exon!exclusion.!The!intronic!splicing!silencer!

N1!(ISSMN1)!site!in!SMN2!exon7!is!a!particularly!potent!target!for!ASO!binding.!ISSM

N1!is!adjacent!to!the!exon7!5’Msplice!site!(Figure!1.1)!and!contains!a!binding!site!for!! and!A1Mdependent!ISS,!hnRNPA1,!that!decreases!exon!7!inclusion.!ASO’s!targeted!to! the!ISSMN1!sequence!competitively!bind!the!mRNA!and!prevent!repressor!binding! by!hnRNPA1!to!increase!exon7Mcontaining!full!length!SMN2!expression!in!vitro!and!!

! 11! Table!1.1!Current!SMA!Therapeutic!Strategies!

Name% Mechanism%of%action% SMN%Expression%

Antisense' ! Exon'7'inclusion'in' ! Full7length'SMN' Oligonucleotide' '''''''SMN2! '''''''from'SMN2! '''''''AAV'delivery'for'' Gene'Therapy' !''SMN'expression' '''''''exogenous'SMN'

Olesoxime' ''''''Cell'death' N/A'

''''''DcpS'' ! Full7length'SMN'' Quinazoline' "''RNA'turnover' '''''''from'SMN2! ! Promotor'acetylation' HDAC' ! Full7length'SMN'' ! SF2/ASF' Inhibitors' '''''''expression' "''hnRNPA1' " Motor'neuron'cell'' IGF71' N/A' ''''''death'

mTOR' !''Protein'Synthesis' N/A'

Stem'Cell' ! Wildtype'motor'' ! Full7length'SMN'' Replacement' ''''''neuron'number'' '''''''expression' ! SMA!therapies!work!by!a!number!of!different!mechanisms!of!action!and!generally! result!in!differential!expression!of!SMN!protein.!In!addition!to!direct!overexpression! and!splice!modification!other!indirect!modulators!of!SMN!expression!and!cell!health! are!attractive!therapeutic!candidates.! ! ! in!vivo!in!mouse!models!of!SMA!(Singh,!2007;!Hua!et!al.,!2008;!Singh!et!al.,!2009).!In!

Phase!1!and!II!clinical!trials!ASO,!ISISMSMNRx!(Biogen!ISIS)!showed!improvements! in!the!Expanded!Hammersmith!Functional!Motor!Scale!(HFMSE)!scores!in!type!II/III!

SMA!patients!(NTC01703988).!Two!double!blind!shamMcontrolled!Phase!III!clinical! trials!for!both!type!I!(NCT02193074)!and!type!II!(NCT02292537)!SMA!patients!by! intrathecal!administration!of!ISISMSMNRx!will!run!through!2017.!

! 12! Gene!Therapy!

!! Gene! therapy! rescues! the! SMA! phenotype! by! exogenous! expression! of! fullM length!SMN!protein!from!SMN1,!packaged!into!a!carrier!vector.!For!CNS!targeting,! adenoMassociated!viral!(AAV)!vectors,!specifically!AAV9,!are!most!common!as!they! are! able! to! transduce! nonMdividing! cells! like! neurons! without! integrating! into! the! host! genome! (Karda! et! al.,! 2014),! cross! the! BBB! (Zhang! et! al.,! 2011),! and! can! be! administered! intravenously.! SMA! model! mouse! studies! showed! that! systemic! administration!of!scAAV9!leads!to!widespread!motor!neuron!transduction!and!SMN! expression!(Duque!et!al.,!2009),!and!this!significantly!rescues!the!SMNΔ7!phenotype! and! increases! lifespan! (Foust! et! al.,! 2010;! Valori! et! al.,! 2010;! Dominguez! et! al.,!

2011).! The! first! Phase! I! clinical! trial! for! safety! and! efficacy! of! gene! therapy! using! scAAV9.CB.SMN!in!SMA!type!I!infants!is!ongoing!(NCT02122952).!

SMN!modulators!

Olesoxime!(TRO19622)!from!Trophos!is!a!cholesterolMlike!molecule!that!acts! on!mitochondria!to!inhibit!cell!death,!rescue!neurite!outgrowth!(Bordet!et!al.,!2007),! and! prevent! astrogliosis! (Sunyach! et! al.,! 2012).! Additionally! Olesoxime! treatment! accelerated! myelination! in! response! to! injury! (Magalon! et! al.,! 2012).! A! twoMyear!

Phase!II/III!clinical!trial!of!Olesoxime!in!SMA!type!II/III!patients!showed!that!oral! dosing! prevented! loss! of! motor! function! on! the! Motor! Function! Measure! Scale!

(MFMS)!and!diseaseMrelated!adverse!events.!If!approved!by!the!FDA,!Olesoxime!will! be!the!first!neuroprotective!treatment!for!SMA.!

! 13! ! The!quinazoline!family!of!compounds!increases!SMN!mRNA!and!protein!as! well! as! nuclear! Cajal! bodies! in! SMA! patient! fibroblasts! (Jarecki! et! al.,! 2005)! by! binding!and!inactivating!DcpS,!a!decapping!enzyme,!thereby!stabilizing!the!mRNA!

(Singh! et! al.,! 2008).! Oral! treatment! of! neonatal! SMNΔ7! mice! with! quinazoline! compounds! increased! Smn! promoter! activity,! ameliorated! the! neuromuscular! phenotype,!and!increased!lifespan!by!up!to!30%!(Butchbach!et!al.,!2010).!RG3039!

(Repligen/Pfizer)!is!a!potent!inhibitor!of!DcpS,!has!good!CNS!distribution,!improved! survival! and! motor! function! in! multiple! severe! mouse! models! and! has! entered! clinical!trials!(Gogliotti!et!al.,!2013;!Van!Meerbeke!et!al.,!2013).!

Histone! deacetylase! (HDAC)! inhibitors! are! a! class! of! compounds! that! are! epigenetic! regulators! transcriptional! activation! via! hyperacetylation! of! a! gene’s! promoter.!In!vitro!studies!of!HDAC!inhibitor!treatment!with!valproic!acid!(VPA)!or! phenylbuterate!(PB)!in!SMA!patientMderived!fibroblasts!show!a!significant!increase! in!fullMlength!SMN!levels!(Brichta!et!al.,!2003;!Sumner!et!al.,!2003;!Andreassi!et!al.,!

2004).!VPA!treatment!has!also!been!shown!to!modulate!SMN!splicing!by!increasing! expression! of! splicing! factors! SF2/ASF! and! decreasing! hnRNPA1! (Harahap! et! al.,!

2012).! While! clinical! trials! of! VPA! and! PB! have! shown! only! mild,! inconsistent! benefits!to!patients,!Trichostatin!A!(TSA),!LBH589!and!suberoylanilide!hydroxamic! acid!(SAHA)!are!potent!new!generation!inhibitors!that!act!on!a!broader!spectrum!of!

HDACs!(Hahnen!et!al.,!2006)!and!significantly!increase!fullMlength!SMN!expression!

(Hahnen!et!al.,!2006;!Riessland!et!al.,!2006;!Avila!et!al.,!2007;!Garbes!et!al.,!2009).!!

Several!studies!have!implicated!the!PTEN/mTOR/Akt!pathway!in!SMA.!Loss! of! PTEN! by! shRNA! injection! in! SMNΔ7! mouse! muscle! rescues! neuromuscular!

! 14! junction! (NMJ)! morphology! while! systemic! administration! of! an! AAV9! expressing!

PTEN! knockdown! construct! increases! lifespan! and! rescues! motor! function! in! the! same!mouse!model!(Little!et!al.,!2014).!Our!lab!recently!demonstrated!that!a!specific! miRNA,! miRM183,! is! increased! in! SMA! models! and! directly! leads! to! altered! expression! of! mTOR! pathway! components! as! well! as! aberrant! axonal! local! translation! (Kye! et! al.,! 2014).! Repressed! mTOR! activity! and! protein! synthesis! in!

SMNMdeficient!cells!suggest!that!increasing!fullMlength!SMN!transcript!alone!may!not! be!sufficient!because!protein!synthesis!machinery!may!still!be!suppressed!in!SMA.!!

Commonalities!of!SMA!with!other!motor!neuron!diseases!!

Interestingly,! aberrant! RNA! splicing! and! metabolism! is! common! to! other! motor! neuron! diseases,! in! particular! Amyotrophic! Lateral! Sclerosis! (ALS).! New! evidence!of!a!direct!interaction!between!the!SMN!complex!and!FUS,!an!RNA!binding! protein!mutated!in!familial!ALS,!is!a!functional!link!between!the!two!disorders.!Loss! of!nuclear!FUS!due!to!ALSMassociated!mutations!leads!to!decreased!levels!of!nuclear! gems! and! cytoplasmic! localization! of! SMN! (Yamazaki! et! al.,! 2012).! As! a! result,! snRNPs! are! unable! to! reenter! the! nucleus,! thus! leading! to! aberrant! spliceosomal! function! (Gerbino! et! al.,! 2013).! In! ALS! neurons,! localization! of! SMN! within! cytoplasmic!FUS!granules!leads!to!axonal!SMN!reduction,!which!can!be!rescued!by!

SMN!overexpression!(Groen!et!al.,!2013).!Several!other!lines!of!evidence!link!these! two! diseases.! Depletion! of! another! ALS! associated! protein,! TDPM43,! can! increase!

SMN! alternative! splicing! and! decrease! its! expression! (Ishihara! et! al.,! 2013)! in! addition!TDPM43!may!contribute!to!U12!minor!spliceosome!function!(Onodera!et!al.,!

! 15! 2014).! Overexpression! of! SMN! in! a! mutant! SOD1! mouse! model! of! ALS! alleviated! motor!deficits!and!inhibited!neuron!death!providing!further!evidence!for!SMN!as!a! modifier!of!ALS!phenotypes!(Turner!et!al.,!2014).!!

One!intriguing!genetic!intersection!between!SMA!and!ALS!was!discovered!in! a! cohort! of! seven! families! with! a! common! Portuguese! ancestor! and! a! history! of! motor! neuron! disease.! The! affected! family! members! have! a! missense! mutation! in! the! vesicleMassociated! protein! VAPB! that! leads! to! a! heterogeneous! motor! neuron! disease! phenotype! in! affected! patients! that! ranges! from! lateMonset! mild! SMA! to! typical!ALS!(Nishimura!et!al.,!2004;!Marques!et!al.,!2006).!VAPB!is!an!endoplasmic! reticulum!(ER)Massociated!protein!that!serves!as!a!dock!for!cytoplasmic!proteins!on! the! ER! (Soussan! et! al.,! 1999;! Skehel! et! al.,! 2000).! When! mutated,! VAPB! forms! aggregates! that! disrupt! ER! structure! and! the! ERMstress! response! pathway! via! interaction! with! the! transcription! factor! ATF6! (Gkogkas! et! al.,! 2008).! It! remains! unclear!how!mutations!in!VAPB!cause!SMA!and!ALS,!but!highlights!the!importance! of! a! functional! ER! stress! response! in! cell! health! and! motor! neuron! disease.!

Interactions! between! ALS! and! SMA! disease! pathways! are! indicative! of! common! molecular! mechanisms! in! motor! neuron! loss! and! may! inform! studies! for! other! degenerative!motor!neuron!diseases.!

! microRNA!

microRNAs!(miRNAs)!are!a!class!of!small!nonMcoding!RNA!~22!nucleotides!in! length!that!are!endogenous!mediators!of!RNA!silencing!in!somatic!tissues.!The!first! miRNA,!linM4,!was!discovered!in!1993!in!C.!elegans!and!found!to!have!an!inhibitory!

! 16! effect!on!linM14!expression!(Lee!et!al.,!1993;!Wightman!et!al.,!1993).!Since!that!time! miRNA! regulation! of! translational! repression! of! target! RNAs! has! be! implicated! in! processes! ranging! from! development! and! patterning! to! disease.! Currently,! 1881! miRNAs! have! been! identified! in! the! human! genome! as! annotated! by! miRBase! version21! (http://www.mirbase.org/)! (Kozomara! and! GriffithsMJones,! 2014)! and! only!a!small!number!of!these!miRNAs!have!been!functionally!verified!and!studied!in! detail.!!

! miRNA!Biogenesis!

miRNA!biogenesis!is!a!complex!process!involving!a!number!of!coordinated! steps!and!requires!interactions!with!several!different!protein!complexes.!While!this! process!is!well!conserved!evolutionarily,!there!are!a!number!of!specific!differences! between! organisms.! Here! we! limit! our! description! to! the! general! mechanisms! underlying!miRNA!biogenesis!with!specific!references!to!interactions!discovered!in! the!human!or!mouse!models!as!noted.!!

miRNAs!are!transcribed!by!RNA!polymerase!II!(Lee!et!al.,!2004)!and!undergo! several! steps! of! enzymatic! cleavage! to! form! mature! miRNAs! (Figure! 1.3).! Most! miRNAs!are!transcribed!from!their!own!genes,!or!are!located!within!introns!of!other! genes,! and! are! therefore! intergenic.! Only! a! small! number! of! miRNAs! are! encoded! within!exons!of!other!genes,!exonic!miRNAs.!The!primary!miRNA!transcript,!or!priM miRNA,! forms! a! double! stranded! RNA! stemMloop! structure! with! imperfect! base! pairing.! The! priMmiR! transcript! is! processed! via! binding! by! DiGeorge! syndrome! critical!region!gene!8!(DGCR8)!and!endonuclease!cleavage!by!the!RNAse!IIII!enzyme!

! 17! Drosha!in!what!is!called!the!‘microprocessor!complex’!(Denli!et!al.,!2004;!Gregory!et! al.,!2004).!The!result!of!this!cleavage!is!a!60M70!nucleotide!preMmiRNA!that!is!bound! by!exportin5!and!transported!out!of!the!nucleus!into!the!cytoplasm!(Yi!et!al.,!2003).!

Once! in! the! cytoplasm! the! preMmiR! is! further! cleaved! by! dicer,! another! RNaseIII! endonuclease,!which!creates!a!short!22M33!nucleotide!dsRNA!duplex!(Bernstein!et! al.,! 2001).! In! humans,! dicer! cleavage! is! regulated! by! binding! to! TAR! RNAMbinding! protein!(TRBP),!which!controls!cleavage!efficiency!in!addition!to!the!final!length!of! the!mature!miRNA!duplex!(Chakravarthy!et!al.,!2010;!Lee!and!Doudna,!2012).!

RNA!Induced!Silencing!Complex!!

Once! the! mature! miRNA! duplex! has! been! generated! it! is! loaded! onto! argonaute!(AGO)!in!the!RNAMinduced!silencing!complex!(RISC).!Humans!have!four!

AGO!proteins,!AGO1M4,!that!associate!with!overlapping!pools!of!miRNAs!(Liu!et!al.,!

2004;!AzumaMMukai!et!al.,!2008).!During!RISC!loading!only!one!strand!of!the!duplex! is!chosen,!called!the!guide!strand.!Meanwhile!the!other!passenger!strand,!designated! miRNA*,! is! discarded! and! degraded.! The! selection! of! one! of! the! strands! over! the! other!is!heavily!reliant!on!the!thermodynamic!properties!of!the!miRNA!duplex!and! its!interaction!with!the!RISC!(Khvorova!et!al.,!2003;!Schwarz!et!al.,!2003).!In!humans!

TRBP!functions!as!the!asymmetry!sensor.!The!process!of!loading!of!the!guide!strand! onto!AGO!requires!unwinding!of!the!miRNA!duplex.!In!humans!this!process!is!aided! by!the!mismatch!of!nucleotides!in!the!guide!strand,!but!still!requires!ATP!hydrolysis! by!Heat!shock!protein!90!(HSP90).!HSP90!then!mediates!a!conformational!change!in!

AGO!opening!it!to!bind!to!the!dsRNA!(Iwasaki!et!al.,!2010;!Miyoshi!et!al.,!2010).!It!is!!

! 18! !

Nucleus Cytoplasm miRNA Gene/Intron

RNA Pol II Transcription

Microprocessor cleavage Dicer Drosha TRBP DGCR8 Cleavage

Pre-miRNA AGO Loading Exportin5 Ran GTP Dicer

TRBP AGO AGO

HSP90 RISC

Figure!1.3!Schematic!of!microRNA!biogenesis! miRNA! biogenesis! begins! with! RNApol! IIMmediated! transcription! of! the! priMmiR! hairpin! structure! from! the! miRNA! gene.! Next,! it! is! cleaved! by! the! microprocessor! complex! in! the! nucleus,! and! then! exported! as! a! preMmiR! to! the! cytoplasm! via! exportin5.!In!the!cytoplasm,!the!preMmiR!is!cleaved!into!a!mature!miRNA!duplex!by! dicer! in! a! complex! with! TRBP.! The! ATP! hydrolysis! by! HSP90! mediates! a! conformational! change! in! AGO! that! allows! loading! of! the! miRNA! duplex.! As! AGO! returns!to!a!closed!conformation,!the!guide!strand!is!positioned!for!interaction!with! mRNA! targets! while! the! passenger! strand! is! degraded.! The! minimal! mature! RISC! consists!of!the!guide!strand!bound!by!AGO.! ! ! ! !!

! 19! believed!that!release!of!AGO!from!this!open!confirmation!provides!enough!energy! for! unwinding! of! the! passenger! strand.! The! minimal! mature! RISC! consists! of! the! miRNA!guide!strand!bound!to!the!AGO!protein.!

Non'canonical!miRNA!biogenesis!

Not!all!miRNAs!are!produced!by!the!canonical!biogenesis!pathway.!In!fact,!a! number!of!studies!have!shown!that!even!with!total!knockout!of!Drosha!a!number!of! miRNAs! can! still! be! produced.! One! such! subMgroup! of! miRNAs! are! referred! to! as! mirtrons.! These! mirtrons! are! miRNAs! that! are! directly! transcribed! from! short! introns!and!are!not!processed!by!Drosha!cleavage.!Instead!they!utilize!the!splicing! machinery! to! become! preMmiRs,! and! once! exported! from! the! nucleus! are! cleaved! into!mature!miRNA!by!dicer!(Berezikov!et!al.,!2007;!Okamura!et!al.,!2007;!Ruby!et! al.,! 2007).! Thus! far! a! single! miRNA,! miRM451,! was! identified! that! bypasses! Dicer! cleavage!in!humans.!Instead,!it!is!cleaved!by!the!only!catalytically!active!human!AGO,!

AGO2(Cheloufi!et!al.,!2010;!Cifuentes!et!al.,!2010).!Even!though!the!vast!majority!of! miRNAs! utilize! the! canonical! pathway! these! alternative! pathways! provide! key! insights!in!to!miRNA!biology.!

! miRNA'!target!interactions!

Mature!miRNAs!are!positioned!stereotypically!within!the!AGO!protein!such! that! they! are! in! an! optimal! position! for! target! interaction! (Wang! et! al.,! 2008).! In! mammals! miRNAs! bind! the! 3’UTR! of! their! target! mRNAs! via! nucleotides! 2M8,! referred!to!as!the!‘seed!sequence’!(Lai,!2002;!Lewis!et!al.,!2003).!miRNAs!that!have!

! 20! identical! sequences! in! nucleotides! 2M8! are! in! the! same! ‘family’! and! because! their! seed! sequences! are! the! same,! they! are! thought! to! regulate! similar! mRNA! targets!

(Friedman! et! al.,! 2009).! Canonical! target! sites! for! miRNA! binding! are! defined! by! their!complementarity!to!the!miRNA!seed!sequence!(Lewis!et!al.,!2005).!They!are! generally!7M8!nucleotides!in!length,!with!the!8th!nucleotide!being!an!‘A’!at!position!1.!

One! to! two! nucleotide! mismatches! can! be! tolerated,! but! sites! with! only! six! nucleotide!complementarity!are!thought!to!be!weaker,!and!have!a!smaller!effect!on! target! repression.! Target! mRNAs! can! have! sites! for! a! number! of! miRNAs! in! their!

3’UTRs!and!therefore!be!regulated!by!several!miRNAs!simultaneously.!!

‘NonMcanonical’! target! sites! are! those! with! either! different! miRNA! binding! interactions! or! location! outside! of! the! traditional! 3’UTR! boundaries.! Mounting! evidence! in! large! scale! profiling! studies! using! variations! of! crosslinking! and! immunoprecipitation! (CLIP)! has! shown! widespread! use! of! nonMcanonical! miRNA! binding!sites!by!the!translational!silencing!machinery!(Hafner!et!al.,!2010;!Loeb!et! al.,!2012;!Helwak!et!al.,!2013).!It!remains!to!be!seen!what!role!these!nonMcanonical! interactions!play!in!mRNA!regulation.!Therefore,!it!is!important!to!consider!these! types!of!interactions!in!miRNA!studies.!

The! functional! outcome! of! miRNA! RISC! target! binding! is! translational! repression!and!mRNA!degradation.!Degradation!of!the!target!mRNA!is!regulated!by! glycineMtryptophan! protein! of! 182kDa! (GW182)! known! as! TNRC6MA! in! humans.!

GW182!interacts!with!AGO!and!poly(A)binding!protein!(PABP)!(Eulalio!et!al.,!2009).!

This!leads!to!recruitment!of!CCR4!and!CAF1,!which!deadenylate!the!mRNA!and!lead! to! decapping! and! decay! (Zekri! et! al.,! 2009;! Fabian! et! al.,! 2010).! A! second!

! 21! deadenylation!complex,!Pan2MPan3,!has!been!implicated!in!degradation!of!a!select! group!of!mRNAs!(Braun!et!al.,!2011).!Evidence!suggests!that!not!all!mRNA!bound!by! the! RISC! are! degraded,! but! the! mechanism! underlying! translational! repression! without! degradation! is! less! well! understood.! RISC! binding! interferes! with! recruitment!of!the!translation!initiation!complex.!Several!studies!show!translational! inhibition!by!miRNAs!occurs!at!capped!mRNAs!only!(Humphreys!et!al.,!2005;!Pillai! et!al.,!2005).!!

The! relative! contribution! of! translational! repression! versus! mRNA! degradation! to! miRNA! target! regulation! in! humans! is! unclear.! An! early! study! comparing!mRNA,!miRNA,!and!protein!expression!showed!that!mRNA!degradation! was!the!main!outcome!of!RISC!binding!(Selbach!et!al.,!2008),!but!followMup!studies! have! shown! it! is! not! this! straight! forward.! The! current! model! suggests! that! translational!silencing!by!inhibition!of!cap!binding!proteins!(Meijer!et!al.,!2013)!is!a! potentially! reversible! process! (Mathonnet! et! al.,! 2007)! followed! by! deadenylation! and!decay.!

Regulation!of!miRNA!stability!and!turnover!

miRNA!expression!is!regulated!not!only!by!transcription,!but!also!by!decay.! miRNAs!are!inherently!stable!as!compared!to!many!other!RNA!species.!A!number!of! studies!have!shown!very!long!halfMlives!of!up!to!several!days!depending!on!the!cellM type.! ActivityMdependent! neuronal! miRNAs! are! one! notable! exception! to! this,! and! are!rapidly!turned!over!in!response!to!a!stimulus!(Krol!et!al.,!2010).!Several!proteins! have!been!proposed!as!general!regulators!of!miRNA!degradation.!In!C.!elegans,!XRNM

! 22! 1! and! XRN2,! two! related! 5’M3’! exoribonucleases! that! degrade! mature! miRNAs!

(Chatterjee! and! Grosshans,! 2009).! In! humans! several! miRNAs! are! degraded! by! polynucleotide!phosphorylase!PNPase!oldM35!(PNPT1).!Evidence!also!suggests!that! the! endoplasmic! reticulum! (ER)! stress! pathway! can! lead! to! degradation! of! select! mature! miRNAs! to! induce! apoptosis! (Upton! et! al.,! 2012).! Interestingly,! miRNA! binding! to! target! mRNAs! seem! to! protect! them! from! degradation,! as! they! are! inaccessible! to! exonuclease! cleavage.! To! date,! the! specific! mechanisms! that! determine!the!selectivity!and!activity!of!these!exonucleases!remains!an!unanswered! question.!!

Target!Prediction!Algorithms!

There! are! a! number! of! available! tools! which! use! different! targeting! algorithms! to! predict! putative! miRNA! target! RNAs! based! on! a! combination! of! different! factors! including! sequence,! site! number,! stability! of! the! interaction,! and! evolutionary!conservation!of!the!target!sequence.!Perhaps!the!most!widely!utilized! of! these! is! TargetScan,! an! algorithm! developed! in! the! Bartel! lab! that! combines! evolutionary! conservation! with! a! context! score! for! each! site! to! predict! targets!

(Lewis!et!al.,!2005;!Friedman!et!al.,!2009).!Other!algorithms!rely!more!heavily!on!the! thermodynamics!of!seed!pairing!and!site!type!instead!of!evolutionary!conservation.!

One! such! algorithm,! PITA,! prioritizes! the! target! site! availability! based! on! the! free! energy!of!miRNA!binding!to!identify!putative!mRNA!targets!(Kertesz!et!al.,!2007).!

Even! though! these! computational! tools! continue! to! improve,! their! predictions! are!

! 23! not! proof! of! a! miRNAMtarget! interaction,! and! additional! studies! are! necessary! to! prove!functional!targeting!of!particular!mRNAs.!!

Integration!of!miRNA:mRNA!profiling!

! While! individual! miRNA:target! interactions! have! been! implicated! in! a! number!of!specific!biological!processes,!it!is!important!to!remember!that!miRNAs! regulate!more!than!one!target!RNA.!They!are!able!to!regulate!a!number!of!targets! simultaneously! and! may! work! on! whole! networks! of! genes! to! modify! protein! expression! (Bartel! and! Chen,! 2004).! In! the! past,! studies! of! miRNA! target! identification!have!relied!solely!on!computational!prediction!of!putative!targets!and! have!been!plagued!by!large!amounts!of!false!positives.!The!advent!of!inexpensive! highMthroughput!sequencing!technology!has!allowed!for!experimental!investigation! of!miRNA!target!regulation!on!a!genomeMwide!scale.!miRNA!regulation!works!both! at!the!level!of!RNA!degradation!and!translational!silencing!so!some!effects!of!miRNA! binding! may! not! be! identifiable! at! the! mRNA! level.! Therefore,! some! studies! have! even!added!a!third!component,!proteomic!screening!to!quantify!expression!changes! in!target!proteins!(Clarke!et!al.,!2012).!To!date!there!is!not!a!consensus!on!the!best! way! to! integrate! these! profiles,! and! the! choice! of! method! relies! heavily! on! the! experimental! design.! Several! different! types! of! correlation! and! regression! algorithms! have! been! used! to! integrate! miRNA! and! mRNA! expression! data!

(reviewed!in!Muniategui!et!al.,!2013).!They!improve!reliability!target!prediction!and! are! a! powerful! tool! for! identifying! miRNA:target! pairs! for! downstream! validation! studies.!

! 24! miRNA!in!spinal!motor!neurons!

! While!significant!research!has!focused!on!the!expression!profile!of!miRNAs!in! dividing!cells!and!cancer,!miRNAs!have!also!been!identified!as!modulators!of!a!host! of! different! neuronal! functions.! In! spinal! motor! neurons,! a! growing! body! of! literature! suggests! miRNAs! are! required! for! a! wide! range! of! processes! including! neuron!development,!synapse!formation,!neurotransmitter!release,!and!axon!health!

(reviewed!in!Kye!and!Goncalves!Ido,!2014).!The!first!report!of!a!role!for!miRNA!in! regulation!of!motor!neuron!development!found!that!miRM196!interacts!with!Hoxb8,! a!protein!that!is!involved!in!patterning!of!the!neural!tube!in!the!embryonic!spinal! cord! (Asli! and! Kessel,! 2010).! Neuronal! patterning! is! further! influenced! by! miRM9,! which,! by! its! interaction! with! FoxP1,! regulates! motor! neuron! specification! in! the! lateral! motor! column! (Otaegi! et! al.,! 2011).! miRM9! is! also! important! for! the! motor! neuron! subtype! specification! through! its! interaction! with! the! transcription! factor!

OC1!(Luxenhofer!et!al.,!2014).!!

miRNAs! play! a! role! in! neurite! outgrowth! and! synaptogenesis! in! motor! neurons,! this! is! particularly! evident! at! the! NMJ! synapse.! Specifically,! in! zebrafish,! miRM155!has!been!shown!to!regulate!synaptic!activity!at!the!NMJ!by!its!regulations! of!SNAPM25,!a!component!of!the!SNARE!complex!involved!in!synaptic!vesicle!release!

(Wei!et!al.,!2013).!There!is!also!evidence!that!a!panel!of!activityMdependent!miRNAs! mediate!axon!growth!and!axon!terminal!development!at!the!drosophila!NMJ.!Ectopic! downregulation! of! three! of! these! miRNAs! miRM8,! miRM289! and! miRM958! leads! to! suppression!of!axon!growth!and!improper!synaptogenesis!(Nesler!et!al.,!2013).!The! altered!synaptic!morphology!is!in!part!due!to!miRM8!regulation!of!postsynaptic!actin!

! 25! in!the!muscle!cells!via!its!targeting!of!Ena!(Loya!et!al.,!2014).!Taken!together,!these! reports! suggest! important! roles! for! miRNAs! not! only! in! spinal! motor! neuron! specification!and!development,!but!also!in!synaptic!patterning!and!activity.!!

Ablation!of!miRNAs!in!motor!neurons!using!dicer!knockout!

One!model!to!look!at!the!effect!of!miRNA!dysregulation!in!specific!tissues!or! cell! types! is! to! ablate! dicer! expression.! Loss! of! dicer! leads! to! global! alterations! in! miRNA! expression! due! to! impaired! miRNA! biogenesis.! This! has! been! applied! to! several!different!mouse!models!by!expression!of!a!floxed!dicer!allele!in!different!creM driver!lines.!Dicer!knockout!in!the!ventral!spinal!cord!with!an!Olig2cre:Dicerflox/flox! has!shown!that!miRNAs!are!not!necessary!for!initial!neurogenesis!and!gross!dorsalM ventral!patterning!(Zheng!et!al.,!2010).!However,!they!are!necessary!for!the!switch! from! neurogenesis! to! oligodendrogenesis! and! specification! of! neuronal! cell! types!

(Chen! and! Wichterle,! 2012).! Olig2cre:Dicerflox/flox! mice! have! severe! motor! and! breathing!issues!and!die!immediately!after!birth.!Therefore,!these!development!and! patterning!abnormalities!can!have!functional!consequences!that!impact!an!animal’s! overall!survival.!Interestingly,!later!knockout!of!dicer!in!postMmitotic!spinal!motor! neurons!by!VAChTMcre!led!to!an!SMAMlike!neurodegenerative!phenotype!and!caused!

MN!dysfunction!and!cell!death!(Haramati!et!al.,!2010).!This!indicates!that!miRNAs!in! post!mitotic!motor!neurons!are!necessary!for!cell!health!and!survival.!This!lead!us!to! hypothesize!that!alteration!in!miRNA!expression!in!motor!neurons!might!play!a!role! in!susceptibility!to!degeneration!and!cell!death!in!motor!neuron!disease.!

! 26! Neurodegenerative!diseases!and!miRNA!expression!

In!many!neurodegenerative!diseases,!work!has!been!done!to!identify!panels! of!circulating!miRNAs!as!biomarkers,!which!is!indicative!of!dysregulation!of!miRNA! profiles!as!a!common!feature!of!the!symptomatic!phases!of!these!diseases!(Grasso!et! al.,! 2014).! To! date,! dysregulation! of! specific! miRNAs! has! been! described! in! degenerative!diseases!including!Alzheimer’s,!Parkinson’s,!and!Huntington’s!and!ALS!

(reviewed!in!Tan!et!al.,!2014).!For!example,!in!Alzheimer’s!disease,!the!upregulation! of!miRM26b!leads!to!abnormal!expression!and!phosphorylation!of!Tau!(Absalon!et! al.,!2013)!while!miRM384!regulates!APP!and!BACE1!levels!through!direct!interaction! with!3’UTR!binding!sites!(Liu!et!al.,!2014).!In!Parkinson’s!disease,!downregulation!of! miRM34b/c! leads! to! mitochondrial! dysregulation! (MinonesMMoyano! et! al.,! 2011).!

Alterations!in!miRNAs!have!also!been!reported!in!ALS!and!SMA!(Table!1.2).!In!SMA! specifically,! a! screen! for! dysregulated! miRNA! using! mutant! iPSCMderived! motor! neurons!revealed!downregulation!of!miRM9!(Haramati!et!al.,!2010).!Work!from!our! lab! has! also! shown! dysregulation! of! a! number! of! miRNAs! in! cortical! neurons! following!SMN!knockdown(Kye!et!al.,!2014).!

The!intersection!of!SMA!and!miRNAs!

! No! direct! evidence! ties! SMN! function! to! miRNA! biogenesis! or! turnover.!

However,!there!are!many!molecules!and!processes!that!serve!as!potential!links.!One! such!SMNMinteracting!protein!is!KHMtype!splicing!regulatory!protein!(KSRP),!which! has! roles! in! RNA! decay! and! splicing! and! is! misregulated! in! a! SMA! mouse! model!

(Tadesse!et!al.,!2008).!KSRP!has!also!been!shown!to!influence!processing!of!a!set!of!

! 27! priMmiRNA! transcripts! by! drosha! (Trabucchi! et! al.,! 2009).! SMN! coMlocalizes! with!

fragileMX!mental!retardation!protein!(FMRP)!in!RNA!granules!of!neuronal!processes!

(Piazzon!et!al.,!2008),!and!in!Cajal!bodies!in!the!nucleus!(Dury!et!al.,!2013).!FMRP!

has!also!been!shown!to!interact!with!AGO!and!Dicer!in!the!RISC!(Jin!et!al.,!2004).!

Perhaps! the! most! relevant! interaction! between! these! SMN! and! miRNA! biogenesis!

molecules! is! that! two! members! of! the! SMN! complex,! GEMN3! and! GEMIN4! are!

associated!with!the!RISC!(Mourelatos!et!al.,!2002;!Murashov!et!al.,!2007).!Further,!!

! Table!1.2!miRNA!expression!studies!in!motor!neuron!disease!

miRNA! Disease! Model! Target/Interaction! Publication! miRN9! SMA! Mouse!ESCMderived! Inc.!in!motor!neurons.!! (Haramati!et!al.,! motor!neurons! 2010)! miRN9! FTD/ALS! PatientMderived!IPS! Dec.!in!patient!IPS!derived! (Zhang!et!al.,! cells! motor!neurons! 2013b)! miRN9! ALS! SOD1(G93A)!mouse! Inc.!in!spinal!cord! (Zhou!et!al.,!2013)! miRN23a!! ALS! SOD1(G93A)!mouse! Inc.!in!muscle.!Targets!PGC1a! (Russell!et!al.,! ! to!disrupt!mitochondria! 2013)! genes! miRN29a! ALS! SOD1(G93A)!mouse! Inc.!in!lumbar!spinal!cord.! (Nolan!et!al.,! Acts!as!an!ER!stress!marker.! 2014)! miRN132! ALS/FTD! TDPM43!shRNA! Dysregulated!expression!due! (Kawahara!and! miRN143! knockdown! to!TDP43!interaction!with! MiedaMSato,!2012)! miRN558! dicer! miRN155! ALS! ALS!Patients! Inc.!in!spinal!cords.! (Koval!et!al.,!2013;! Inhibition!rescues!phenotype! Butovsky!et!al.,! 2015)! miRN183! SMA! SMN!knockdown!in! Inc.!Modifies!local!mTOR! (Kye!et!al.,!2014)! cortical!neurons!and! translation!in!axons! mouse!models! miRN206! ALS! SOD1(G93A)!mouse! Inc.!in!muscle.!Role!in!NMJ! (Williams!et!al.,! response!to!injury.! 2009)! miRN338N ALS! ALS!patients! Inc.!in!CSF,!serum,!blood!and! (De!Felice!et!al.,! 3p! spinal!cord! 2014)! miRN451! ALS! SOD1(G93A)!mouse! Dysregulated!expression! (Butovsky!et!al.,! and! Patient!peripheral! 2012)! others! monocytes!

! 28! they! have! been! shown! to! bind! AGO2! and! target! it! for! turnover! by! autophagy!

(Gibbings!et!al.,!2012).!This!interaction!is!believed!to!play!a!role!in!overall!miRNA! homeostasis.!Recently,!it!has!also!been!suggested!that!AGO!actually!interacts!with! splicing!factors!by!recruiting!members!of!spliceosome!to!the!appropriate!splice!sites!

(AmeyarMZazoua!et!al.,!2012;!Taliaferro!et!al.,!2013).!The!consequences!of!each!of! these!interactions!are!not!well!understood,!and!how!they!are!affected!by!SMN!loss!is! as! yet! unknown.! However,! taken! together,! this! evidence! supports! an! interaction! between! the! miRNA! biogenesis! pathway! and! SMN! function! that! could! have! functional!consequences!if!disrupted!in!SMA.!!

In! our! previous! study! in! SMN! knockdown! cortical! neurons,! we! identified! a! number!of!differentially!expressed!miRNAs,!in!particular!miRM183!(Appendix!2,!Kye! et!al.,!2014).!This!was!indicative!of!dysregulation!of!miRNA!expression!in!SMA!and! prompted!us!to!investigate!the!importance!of!these!miRNA!changes!on!downstream! targets.!We!discovered!that!expression!of!one!of!these!miRNAs,!miRM138!was!only! dysregulated! in! cortical! neurons! but! not! in! motor! neurons.! We! hypothesized! that! there!are!cellMtype!specific!differences!in!miRNA!expression!after!SMN!knockdown.!

Motor! neurons! are! the! cells! most! affected! by! SMN! loss! therefore,! we! sought! to! examine!miRNA!dysregulation!in!SMA!motor!neurons.!

! !

! 29! !

Chapter!2 !

Methods!

Contributions!

This!chapter!contains!all!experimental!methods!and!reagents!used!in!chapters!3!and!

4.! Mary! Wertz! wrote! all! experimental! methods! with! the! following! exceptions.! Dr.!

Pierre! Neveu! contributed! to! the! section! ‘Bioinformatic! analysis! of! miRNA! microarray’.!Dr.!Kellen!Winden!contributed!to!the!section!‘Identification!of!putative! miRNA!target!mRNA!interactions’.!The!Harvard!Biopolymers!Core!Facility!provided! methods! relating! to! quality! control,! library! preparation,! and! sequencing! for! the!

RNAseq!profiling!experiments.! !

! 30! In#vitro!acute!shSMN!knockdown!model!

! To! identify! miRNA! changes! associated! with! loss! of! SMN! expression,! we! utilized!an!in!vitro!model!where!SMN!expression!is!knocked!down!acutely!by!shRNA! specific!to!the!SMN!sequence.!This!knockdown!strategy!allows!us!to!focus!on!SMN! function!within!the!cell!type!of!interest,!primary!spinal!motor!neurons,!without!the! influence! of! SMN! deletion! on! development.! Additionally,! this! model! isolates! cellM autonomous!motor!neuron!expression!changes!and!phenotypes!from!abnormalities!

Dissect Embryo E13.5

shCtl shSMN shCtl shSMN Infect 1 DIV

7 DIV Protein mirVANA

Western cDNA TaqMan SMN KD mRNA Exp miRNA Exp !

Figure!2.1!Schematic!of!in!vitro!motor!neuron!model! The! schematic! shows! the! basic! experimental! paradigm! for! all! knockdown! experiments! in! our! study.! Wildtype! primary! motor! neurons! were! dissected! and! cultured!as!described.!shRNAMmediated!SMN!knockdown!was!performed,!followed! by!immunostaining!or!extraction!of!protein!and!RNA!for!downstream!analysis.! !

! 31! that!have!been!reported!in!a!number!of!nonMneuronal!cell!types!in!SMA!models.!The! in!vitro!motor!neuron!system!(Figure!2.1)!was!established!in!the!lab!and!reported!in! our!earlier!publications!(Akten!et!al.,!2011;!Kye!et!al.,!2014).!

Spinal!motor!neuron!culture!

All!experimental!procedures!were!performed!in!compliance!with!the!Boston!

Children’s! Hospital! IACUC! animal! protocol! #1207227R.! Motor! neurons! were! prepared! as! previously! described! in! (Akten! et! al.,! 2011).! Briefly,! wildtype! E13.5!

Long!Evans!rat!embryos!(Charles!River)!were!dissected!and!placed!in!ice!cold!PBS.!

After! removal! of! the! head! and! tail,! embryos! were! placed! ventral! side! down,! the! spinal!cord!was!exposed!and!removed!carefully!with!a!forceps.!Spinal!cords!were! placed! in! a! fresh! petri! dish! and! any! remaining! dorsal! root! ganglia! and! meninges! were! stripped.! The! ventral! spinal! cords! were! dissected! and! placed! in! cold! PBS.!

Following! a! 10Mminute! incubation! in! trypsin! at! 37°C,! cells! were! dissociated! via! mechanical! trituration! three! times! in! 1mL! Neurobasal! (NB)! media! (Life!

Technologies)! with! DNAse! and! 0.4%! BSA! then! passed! through! a! 100um! filter! to! remove! any! remaining! debris.! Cells! were! suspended! in! NB! media! supplemented! with! B27! (Life! Technologies),! LMglutamine,! and! penicillin/streptomycin! (NB/B27),! and!placed!in!an!uncoated!plastic!25cm!dish!to!recover!and!remove!nonMneuronal! cells! in! the! incubator! for! 60! minutes! before! being! spun! down! at! 800rpm! for! five! minutes!on!a!4%!BSA!cushion.!Pelleted!neurons!were!resuspended!in!motor!neuron! media!comprised!of!NB/B27!media!with!additional!growth!factors!CNTF!(50ng/ul),!

BDNF!(50ng/ul),!and!GDNF!(25ng/ul)!(Peprotech).!Neurons!were!then!plated!on!6!!

! 32! ! Motor Neuron Marker Merge with DAPI A

C HB9 (20X) Islet1/2 (20X) ChAT (10X) ChAT (20X) Islet1/2 (20X) HB9

Figure!2.2!Immunofluorescent!staining!of!cultured!motor!neurons! Cultured!motor!neurons!were!fixed!and!stained!at!5DIV!for!motor!neuron!markers! including!ChAT,!Islet1/2!and!HB9!to!confirm!motor!neuron!identity.!The!majority!of! MNs!are!A.!ChAT!positive,!and!a!subset!of!neurons!is!positive!for!B.!Islet1/2!or!C.! HB9.! ! !

! 33! or!12Mwell!plastic!TC!dishes!coated!with!PDL!or!on!glass!coverslips!in!24Mwell!dishes!! coated!overnight!with!PDL!and!laminin!depending!on!downstream!analysis.!Motor! neuron! identity! was! confirmed! by! immunostaining! for! motor! neuron! markers.!

Approximately!90%!of!cells!in!the!cultures!are!positive!for!the!motor!neuron!marker! choline! acetyltransferase! (ChAT)! (Figure! 2.2A)! as! well! as! a! marker! for! neuronal! nuclei!(NeuN).!Glial!fibrillary!acidic!protein!(GFAP)!staining!for!nonMneuronal!cells! was!positive!in!a!small!number!(5M10%)!of!cells!in!the!cultures!easily!distinguished! from! neurons! by! morphology! (data! not! shown).! More! specific! markers! of! motor! neuron!identity,!Islet1/2!and!HB9,!were!also!used!(Figure!2.2B!and!C).!The!available! antibodies! were! both! raised! mouse! and! thus! we! could! not! perform! coMstaining! experiments.!However,!a!significant!subset!of!the!neuronal!population!was!positive! for!at!least!one!of!these!motor!neuron!markers.!!

Primary!cortical!neuron!culture!

Primary! cortical! neurons! were! isolated! as! previously! described! (Nie! et! al.,!

2010).! Briefly,! cortices! of! E17! rats! are! isolated! in! HBSS! with! 10mM! Hepes! 10mM!

MgCl2,!and!1mM!kynurenic!acid.!Cells!are!dissociated!for!5Mmin!at!37°C!in!Papain!

(30U/mL)!and!mechanical!trituration.!Neurons!were!plated!in!NB/B27.!!

! shRNA!knockdown!

Lentiviral! infection! of! short! hairpin! RNA! (shRNA)! was! used! to! knockdown!

SMN! expression.! Briefly,! four! lentiviral! packaging! vectors! TET! (1ug),! REV! (1ug),!

Gag/Pol! (1ug)! and! VSV! (2ug)! were! coMtransfected! with! 10ug! of! shSMN! or! shCtl!

! 34! plasmid! into! HEK293! cells! using! Lipofectamine! 2000! (LF2000)! according! to! the! manufacturer’s!protocol.!Conditioned!media!from!HEK293!cells!containing!lentiviral! particles!was!harvested!48!and!72!hours!after!transfection,!combined,!and!passed! through! a! 45um! filter.! At! 1DIV! primary! cortical! or! primary! motor! neurons! were! infected!with!a!1:1!ratio!of!NB/B27!and!virus!with!Polybrene!(0.6!ug/ml)!for!five! hours.!Neurons!were!washed!once!with!NB,!the!media!replaced!with!fresh!NB/B27! media! or! motor! neuron! media,! and! then! incubated! at! 37°C! in! 5%! CO2! for! 6! days!

(motor! neurons)! or! 8! days! (cortical! neurons).! Knockdown! was! confirmed! by! western!blot!and!qRTMPCR!for!SMN.!The!shCtl!and!shSMN!vectors!have!previously! been!described!(Zou!et!al.,!2011).!The!targeting!sequences!are!as!follows!for!Smn,! shSMN!5’MCCT!TTA!AGC!ATG!CTG!CTC!TAA!AGA!ACG!GM3’!and!the!control,!shCtl!5’M

CGT!AAG!GTA!CGT!AAT!CGA!ATC!GAT!CM3’.!Additional!shSMN!sequences!used!for! further!validation!were!obtained!from!Sigma!shSMN4!5’MCTG!TGA!AGT!AGC!TAA!TM3’!

(TRCN00302265)!and!shSMN5!5’MCTC!TTG!GTA!CAT!GAG!TGM3’!(TRCN000302192),! which!target!different!regions!of!the!Smn!gene.!!

RNA!Isolation!and!qRT'PCR!!

RNA!was!isolated!with!Trizol!(Life!Technologies)!for!mRNA!analysis!or!the! mirVANA!miRNA!isolation!kit!with!phenol!(Life!Technologies)!for!miRNA!analysis,! both! according! to! the! manufacturer’s! protocol.! For! cDNA! synthesis,! the! HighM

Capacity!cDNA!Reverse!Transcription!Kit!(Applied!Biosystems)!was!used!according! to!the!manufacture’s!protocol!with!1ug!of!total!RNA!input.!qRTMPCR!reactions!were! performed!in!duplicate!using!2X!SYBR!green!(Applied!Biosciences)!and!run!in!96M

! 35! well!plates!on!the!Applied!Biosystems!7300!system.!The!reaction!conditions!were!at!

95°C! for! 10min! followed! by! 40! cycles! of! 95°C! for! 15sec! and! 60°C! for! 1min.!

Transcripts! were! normalized! against! glyceraldehydeM3Mphosphate! dehydrogenase!

(GAPDH)! as! an! endogenous! control.! A! comprehensive! list! of! all! primers! used! for! qRTMPCR!can!be!found!in!Table!2.1!below.!

! Table!2.1!qRTNPCR!primers!for!mRNA!expression!

Gene!Name! Forward! Reverse! rGAPDH! TGTGTCCGTCGTGGATCTGA! CCTGCTTCACCACCTTCTTGA! rSMN! ACTCCTCCAGATCGCTCAGA! AGGGGGTGGAGGAATTATTG! CHAT! TGCCAGTCAACTCTAGCCCT! CTGCAAACCTTAGCTGGTCATT! Chodl! GGTCAGTGGTCAAAAGGTGTGTT! AAGCTCACCCGGCTAGACAGT! ChodlNV1! GATTCCGCTGCTTTTGCTGA! AGGGGGAGCTTACAGTTCATC! ChodlNV2! CCTTGATCAGTGTAAGGAATGGC! TGACATTTGCCTCAAGGGGG! huGAPDH! CAGCGACACCCACTCCTC! TGAGGTCCACCACCCTGT! huSMN! CAAAAAGAAGGAAGGTGCTCA! TGGTGTCATTTAGTGCTGCTC! NSF! GATCGGCGGTCTGGATAAGG! GTCTTACCACAACCAGGGGG! Sema5a! CCCCGTCGTCTCCTACAAAG! TCATCACACTCCCACTGCAC! NKAP! TCTGTTACCTGGTGAAGGCG! CTTTCCGAAGTCGAACAGCC! RYR2! ACCGAGGAGGAAGTACGTGA! GATGTTCCACCTGCTCAAGG! TNFAIP1! GGTCGTAAGCTGGCAGAAGT! AGATACGGGCCTCTGGGAAT! JAK1! GGAATGTACTGGGCGTCTT! CATGGCATTGCAGTCCTCTTT! Kiff3B! GGGAATGGCTGAGCCCG! TCCTTGCCATTCATAGGCCG! CLCN5! AAGAATGAAGCCAAGCGCAG! GGAACGCCACAGTGTTTTGA! RTL1! CTCCTCGCTCTCGACATCAC! TCCGGGGTCTGATCTACTGG! CHOP! GTCAGTTATCTTGAGCCTAACACG! TGTGGTGGTGTATGAAGATGC! !!!

! !miRNA!expression!studies!!

TaqMan! individual! miRNA! expression! assays! (Life! Technologies/Applied!

Biosystems)! were! performed! according! to! the! manufacturer’s! protocol.! See! Table!

2.2!below!for!assay!ID!numbers!of!all!miRNA!assays!used!for!this!analysis.!50ng!of! total!RNA!was!used!for!reverse!transcription!followed!by!qPCR!amplification!with!

! 36! Fast! Universal! Master! Mix! no! AmpErase! (Life! Technologies/Applied! Biosystems)! and! run! on! the! 7300! system! as! described! above.! miRNA! expression! levels! were! normalized!to!miRM191,!which!was!identified!as!a!stable!miRNA!with!(stability!value! of!0.032!±!0.010)!in!the!miRNA!microarray!using!the!NormFinder!addMon!in!Excel!

(Andersen!et!al.,!2004).!miRM191!was!also!stable!in!additional!validation!studies!in! different!cell!types!(data!not!shown).!

Table!2.2!miRNA!expression!assays!miRNANmimics!and!antiNmiR!inhibitors!

miRNA! Cat.! Assay!ID! Type! rnoNmiRN204! 4427975! 000508! TaqMan!Expression! rnoNmiRN708! 4427975! 002341! TaqMan!Expression! rnoNmiRN129! 4427975! 000590! TaqMan!Expression! rnoNmiRN214! 4427975! 000517! TaqMan!Expression! rnoNmiRN7! 4427975! 000268! TaqMan!Expression! rnoNmiRN370! 4427975! 002275! TaqMan!Expression! rnoNmiRN431! 4427975! 001979! TaqMan!Expression! rnoNmiRN146a! 4427975! 000468! TaqMan!Expression! rnoNmiRN374! 4427975! 001319! TaqMan!Expression! rnoNmiRN379! 4427975! 001138! TaqMan!Expression! rnoNmiRN376bN3p! 4427975! 002452! TaqMan!Expression! rnoNmiRN130b! 4427975! 000456! TaqMan!Expression! rnoNmiRN219N2N3p! 4427975! 002390! TaqMan!Expression! rnoNmiRN219! 4427975! 000522! TaqMan!Expression! rnoNmiRN191! 4427975! 002299! TaqMan!Expression! rnoNmiRN183! 4427975! 002269! TaqMan!Expression! rnoNmiRN30d! 4427975! 000420! TaqMan!Expression! rnoNmiRN434! 4427975! 002604! TaqMan!Expression! RnuN6b! 4427975! 001093! TaqMan!Expression! rnoNmiRN431! 4464066! MC10091! mirVANA!mimic! rnoNmiRN431! 4464066! AM10091! antiMmiR!inhibitor! ctlNmiR! 4464058! n/a! mirVANA!mimic! ctlNinhibitor! AM17010! n/a! antiMmiR!inhibitor! miRN431!PriNmiR! 4427012! Rn03466602pri! PriMmiR!Assay!

! 37! Data! analysis! for! both! mRNA! and! miRNA! was! completed! in! Excel.! Relative! expression! of! transcripts! was! determined! using! the! ΔΔCt! method! (Livak! and!

Schmittgen,!2001)!and!imported!into!GraphPad!Prism!6!for!statistical!analysis.!The! data! were! expressed! as! the! mean! and! standard! error! of! two! to! three! biological! replicates! per! condition! from! at! least! three! experiments.! Statistical! analysis! was! performed! in! Prism! using! an! unpaired! twoMtailed! Student’s! tMtest! and! deemed! significant!at!pMvalue!

Western!blot!analysis!of!protein!expression!

For! protein! expression! analysis,! cells! were! lysed! in! 1XSDS! sample! buffer!

(22mM! TrisMHCl! pH! 6.8,! 4%! Glycerol,! 0.8%! SDS,! 1.6%! βMmercaptoethanol,! bromophenol!blue).!Equal!protein!loading!was!verified!by!coomassie!staining,!and! samples!were!subjected!to!SDS–PAGE,!transferred!to!ImmobilonMP!(Millipore),!and! incubated!in!a!blocking!solution!of!5%!BSA!or!milk!for!two!hours.!Membranes!were! probed!with!primary!antibody!overnight!at!4°C!and!secondary!antibodies!for!two! hours!at!room!temperature!then!developed!using!an!ECL!system!(Pierce)!followed! by! imaging! on! ImageQuant! LAS! 4000.! Images! were! analyzed! using! ImageJ! to! quantify! relative! protein! expression! with! GAPDH! used! as! the! loading! control! for! normalization.!!

Antibodies:!mouse!anti!TauM1!(mab3420;!Millipore),!rabbit!anti!GAPDH!(D16H11,!

5174BC;!Cell!Signaling),!Hoechst,!rabbit!anti!Chodl!(ab134925,!Abcam),!mouse!anti!

TGN46! (ab2809,! Abcam),! rabbit! anti! Cleaved! Caspase3! (CC3)! (DM175,! 9661S;! Cell!

! 38! Signaling),! mouse! anti! SMN! (HM195,! sc15320),! mouse! anti! SMN! (610647,! BD! transduction! laboratories)! mouse! anti! ChAT! (28C4,! ab78023;! Abcam),! mouse! anti!

Islet1/2!(1:50,!DSHB),!mouse!anti!HB9!(1:50,!DSHB).!

Exiqon!LNA!miRNA!microarray!data!analysis! miRNA!sample!submission!and!array!!

1ug! of! total! RNA! isolated! using! the! mirVANA! kit! was! sent! to! Exiqon! for! analysis!using!the!7th!generation!miRCURY!LNA!miRNA!Array!#208500.!Four!shCtl! and! four! shSMN! knockdown! samples! were! used! for! the! miRNA! microarray.! RNA! quality!was!assessed!on!a!Bioanalyzer!and!the!RIN!numbers!of!all!eight!samples!was! greater! than! 8.8.! Samples! were! run! according! to! the! standard! Exiqon! protocol.! miRNAs! were! labeled! with! miRCURY! LNA! HiMPower! Labeling! Kit! (Hy3/Hy5)! and! hybridized! to! the! array,! scanned,! and! the! data! returned! after! quality! control! and! filtering!based!on!spike!in!controls!and!background!intensity!levels.!!

Bioinformatic!analysis!of!miRNA!microarray!

Analysis!of!the!miRNA!microarray!was!performed!in!collaboration!with!Dr.!

Pierre!Neveu!at!European!Molecular!Biology!Laboratory!in!Heidelberg.!Briefly,!log2M transformed! data! was! normalized! across! samples! by! a! scaling! factor! and! the! addition!of!a!constant!on!medianMfiltered!data!to!remove!outliers.!One!of!the!shCtl! samples! was! found! to! have! overall! decreased! hybridization! quality! and! was! thus! removed! for! the! rest! of! the! analysis.! Any! of! the! miRNA! passenger! strands! and! all! miRNAs!with!expression!levels!inferior!to!five!were!filtered!from!the!probe!list.!This!

! 39! left! a! list! of! 250! miRNAs! detected! in! the! array! above! this! threshold.! Changes! in! miRNA!expression!were!identified!by!the!twoMsided!tMtest!and!BenjaminiMHochberg! multiple!hypothesis!correction.!!

! mRNA!expression!profiling!by!RNAseq!

RNAseq!library!prep!and!quality!control!

For!library!construction,!500ng!isolated!mRNA!was!placed!into!the!Wafergen!

Apollo,!and!the!PrepX!Complete!ILMN!DNA!Library!Kit!(Wafergen!Cat!400039)!was! used! according! to! the! manufacturer’s! protocol.! Samples! were! run! on! the! PCR! machine! with! indexed! primers,! and! then! cleaned! using! the! ‘PCR! clean’! on! the!

Wafergen! Apollo! according! to! the! manufacture’s! instructions.! Quality! control! was! performed!by!both!Tape!Station!and!qPCR!analysis.!Samples!were!run!on!an!Agilent!

2200! Tape! Station! on! a! D1000! High! Sensitivity! Tape! with! ladder! provided.! From! this! analysis,! morphology! and! overall! concentration! was! assessed.! Samples! with! sufficient! concentration! were! then! passed! to! qPCR! analysis.! The! qPCR! assay! was! performed!using!the!SYBR!green!KAPA!SYBR®!FAST!Universal!2X!qPCR!Master!Mix!

(Kapa! Biosystems,! Cat#KK4602)! and! primers! to! the! P5! and! P7! regions! of! the!

Illumina!adapters.!Diluted!PhiX!was!used!to!generate!a!standard!curve!to!determine! concentration.!

RNAseq!on!HiSeq!2500!

Once! samples! passed! both! quality! control! steps,! samples! were! clustered! and! sequenced!on!a!single!lane!of!an!Illumina!HiSeq2500!for!a!50Mcycle!50bp!single!end!

! 40! run!using!protocols!HCS!1.5.15.1!M!RTA!1.13.48.!The!RNAseq!reads!were!assessed!at! the!Harvard!Biopolymers!Core!using!CASAVA!1.8.2!(Illumina)!for!demultiplexing!the! indexed!samples!and!quality!control!with!FastQC.!Finally,!the!data!was!analyzed!on! the!Harvard!Orchestra!cluster.!!

Bioinformatic!analysis!of!mRNA!expression!data!!

RNAseq! alignment,! assembly,! and! differential! analysis! were! performed! on! the!Harvard!Orchestra!high!performanceMcomputing!cluster.!The!data!was!analyzed! with!the!Tuxedo!suite!of!tools!using!the!protocol!described!in!(Trapnell!et!al.,!2012)! with! modifications! as! shown! in! the! commands! below.! Rat! reference! sequence! information! and! annotation! was! obtained! from! the! Illumina! iGenomes! website!

(http://support.illumina.com/sequencing/sequencing_software/igenome.html)! using!the!most!recent!Rattus!norvegicus!assembly,!Rn5.!Because!we!were!not!aiming! to! discover! new! transcripts,! and! to! eliminate! any! reads! coming! from! DNA! or! ribosomal!RNA!contamination,!we!aligned!only!to!the!rat!transcriptome.!Removal!of! any! sequences! outside! of! the! transcriptome! was! confirmed! by! visualization! with!

Integrated!Genome!Viewer,!IGV.!The!replicates!of!shCtl!or!shSMN!are!represented!as!

[shCtlN]!and![shSmnN]!respectively.!

1.!RNAseq!reads!are!aligned!to!the!rat!genome!with!tophat.!! tophat --GTF igenome-rn5/genes.gtf --transcriptome-only --library-type fr-unstranded --output-dir tophat_out_[shCtlN] --no-coverage-search -- num-threads 8 igenome-rn5/genome sample_[shCtlN].fastq! !

! 41! tophat --GTF igenome-rn5/genes.gtf --transcriptome-only --library-type fr-unstranded --output-dir tophat_out_[shSmnN] --no-coverage-search -- num-threads 8 igenome-rn5/genome sample_[shSmnN].fastq! !

2.!Expressed!transcripts!were!assembled!with!cufflinks.! cufflinks -p 8 -o cufflinks_out tophat_out_[shCtlN]/accepted_hits.bam! cufflinks -p 8 -o cufflinks_out tophat_out_[shSmnN]/accepted_hits.bam! !

3.!An!assemblies.txt!file!was!created!to!merge!all!assemblies!in!cuffmerge.! find . -name “transcripts.gtf” > assemblies.txt!

! 4.! A! single! annotated! transcriptome! was! compiled! by! running! cuffmerge! on! all! assemblies!and!creating!a!merged_asm!directory.! ! cuffmerge -g igenome-rn5/genes.gtf -s igenome-rn5/genome.fa -p 8 assemblies.txt! !

5.!Cuffdiff!was!run!for!identification!of!differentially!expressed!transcripts.! cuffdiff -o diff_out -b igenome-rn5/genome.fa -p 8 -u -L shCtl,shSmn cuffmerge/merged_asm/merged.gtf \ tophat_out_[shCtl1]/accepted_hits.bam,tophat_out_[shCtl2]/accepted_hits .bam,tophat_out_[shCtl3]/accepted_hits.bam,tophat_out_[shCtl4]/accepted _hits.bam \ tophat_out_[shSmn1]/accepted_hits.bam,tophat_out_[shSmn2]/accepted_hits .bam,tophat_out_[shSmn3]/accepted_hits.bam! !

6.!Cuffnorm!was!used!to!analyze!data!after!appropriate!normalization!for!library! size!and!for!generating!a!database!for!downstream!analysis.! ! cuffnorm -o norm_out_merged -L shCtl,shSMN -p 8 cuffmerge/merged_asm/merged.gtf \ tophat_out_[shCtl1]/accepted_hits.bam,tophat_out_[shCtl2]/accepted_hits .bam,tophat_out_[shCtl3]/accepted_hits.bam,tophat_out_[shCtl4]/accepted _hits.bam \ tophat_out_[shSmn1]/accepted_hits.bam,tophat_out_[shSmn2]/accepted_hits .bam,tophat_out_[shSmn3]/accepted_hits.bam!

! 42! 7.!Data!was!imported!into!R!and!the!cummeRbund!library!was!utilized!for!additional! downstream!analysis!and!visualization.! ! Software!versions!used!for!analysis! • Tophat!M!2.0.10! • Bowtie!M!2.1.0.0! • Cufflinks!M!2.2.1!(cuffMerge,!cuffDiff,!cuffNorm)! • R!–!3.1.3!(Bioconductor,!cummeRbund,!gplots)! • Samtools!M!0.1.19.0! • iGenomes!M!Rat!rn5! !

Identification!of!putative!miRNA!target!mRNA!interactions!

Target!prediction!

We! first! used! TargetScan! Release! 6.2! to! obtain! lists! of! target! genes! with! conserved! miRNA! binding! sites! for! 17! dysregulated! miRNA! identified! previously!

(http://www.targetscan.org/cgiMbin/targetscan/data_download.cgi?db=vert_61)!

(Friedman!et!al.,!2009).!To!identify!miRNA!targets!with!binding!sites!that!are!not! conserved! or! might! be! located! in! transcript! regions! that! were! not! evaluated! by!

Targetscan,!we!also!decided!to!use!the!miRNA!target!prediction!algorithm!PITA!to! evaluate!for!putative!targets!(http://genie.weizmann.ac.il/pubs/mir07/index.html)!

(Kertesz! et! al.,! 2007).! This! algorithm! relies! on! the! binding! energy! and! the! accessibility! of! miRNA! binding! site! to! predict! miRNA! targets.! The! transcriptome! data!was!filtered!with!a!threshold!of!average!expression!>15!across!all!samples!and! a! coefficient! of! variation! >13,! resulting! in! the! selection! of! 9,163! genes.! Exact! transcript! boundaries! for! these! genes! were! determined,! and! we! obtained! corresponding!sequences!for!all!of!these!transcripts!from!the!rn5!genome.!We!then! utilized!the!PITA!prediction!algorithm!on!the!entire!mRNA!sequence!to!determine!

! 43! whether! that! sequence! was! predicted! to! be! a! target! of! any! of! the! differentially! expressed! miRNAs.! We! used! a! Δ-Δ! G! score! of! less! than! M10! as! a! threshold! for! putative!targets.!

Correlation!Analyses!of!miRNA:mRNA!target!interactions!

To! determine! whether! the! predicted! Targetscan! targets! were! enriched! among! the! differentially! expressed! genes,! we! identified! the! overlap! between! predicted! targets! and! differentially! expressed! genes! identified! previously.!

Hypergeometric!probability!was!utilized!to!calculate!the!significance!of!the!overlap.!

The!gene!set!enrichment!algorithm!(Subramanian!et!al.,!2005)!was!used!to! determine!whether!the!predicted!PITA!targets!of!a!specific!miRNA!were!enriched!in! genes! that! were! regulated! in! the! opposite! direction! to! the! miRNA! of! interest.! We! utilized! a! different! approach! than! that! used! above! for! the! Targetscan! targets! because! of! the! larger! number! of! targets! identified.! We! calculated! the! Pearson! correlation! between! mRNA! expression! and! a! binary! vector! corresponding! to! knockdown.!The!genes!were!ordered!based!on!their!correlation!with!knockdown!in! the! opposite! direction! to! the! miRNA! of! interest.! Putative! mRNA! targets! of! the! specific!miRNA!were!identified!within!this!list!and!assigned!a!positive!value!(stepM up),!while!the!other!genes!were!assigned!a!negative!value!(stepMdown).!The!stepMup! and!stepMdown!values!are!determined!so!that!the!sum!total!of!the!vector!is!zero.!A! running!sum!of!the!vector!was!determined,!and!the!maximum!value!of!this!vector! was! identified.! Significance! was! determined! by! calculating! a! null! distribution! of! maximum! running! sum! values! using! 1,000! randomly! ordered! vectors.! This!

! 44! distribution! was! fit! with! a! skewed! normal! distribution,! and! the! pMvalue! for! the! maximum!value!of!the!running!sum!for!a!specific!miRNA!was!calculated!based!on! this!distribution.!

Co'expression!network!analysis!

The! coMexpression! analysis! was! performed! using! the! weighted! gene! coM expression!network!analysis!(WGCNA)!methods!as!described!previously!(Zhang!and!

Horvath,! 2005).! Briefly,! normalized! data! was! obtained! from! Cufflinks,! and! genes! were! filtered! out! for! low! expression! levels! (mean! expression! <15)! and! low! variability! (coefficient! of! variation! <13),! which! resulted! in! the! selection! of! 9,163! genes.! Correlation! analyses! demonstrated! that! the! two! sample! types! (shSMN! and! shCtl)!were!separated!using!hierarchical!clustering!but!there!were!no!clear!outlier! samples.! We! then! generated! an! adjacency! matrix! by! calculating! the! Pearson! correlation! between! all! genes,! and! it! was! scaled! using! a! beta! value! of! 8! to! approximate!scale!free!topology.!A!topological!overlap!matrix!was!calculated!using! the! adjacency! matrix! (Ravasz! et! al.,! 2002),! and! genes! were! clustered! using! the! average! hierarchical! clustering! algorithm.! Modules! were! obtained! from! these! clusters!using!the!dynamic!treeMcutting!algorithm!(Langfelder!et!al.,!2008).!

Comparison!between!co'expression!modules!and!miRNA!targets!

Transcript!boundaries!for!all!genes!within!all!modules!were!determined!and! sequences!for!the!corresponding!transcripts!were!obtained.!The!PITA!algorithm!was! used! to! predict! whether! these! sequences! were! targets! of! the! 17! differentially!

! 45! expressed!miRNAs,!as!determined!previously.!The!number!of!targets!for!a!specific! miRNA!within!a!specific!module!was!determined.!A!null!distribution!was!generated! by!determining!the!number!of!targets!within!a!random!set!of!mRNAs!that!was!the! same!size!as!the!specific!module.!A!ZMscore!was!calculated!by!comparing!the!number! of! targets! within! a! module! to! the! null! distribution.! This! was! repeated! for! all! combinations!of!miRNAs!and!modules.!

Pathway!and!Gene!Ontology!analysis!with!DAVID!

! The!Database!for!Annotation!Visualization!and!Integrated!Discovery!(DAVID)!

Functional! Annotation! tool! (http://david.abcc.ncifcrf.gov/home.jsp)! (Huang! da! et! al.,! 2009a,! b)! was! used! to! identify! biological! pathways! and! processes! that! were! significantly! enriched! in! the! gene! sets! identified! by! miRNA! target! prediction,! differential!transcription!analysis,!and!coMexpression!analysis.!For!all!analyses,!we! used!a!background!gene!list!composed!of!all!genes!expressed!over!a!threshold!of!15! in!the!RNAseq!analysis!because!it!limits!the!background!from!all!possible!genes!in! the!rat!genome!to!those!expressed!specifically!in!our!cell!type!of!interest.!Pathways! and!processes!were!identified!as!significant!using!DAVID!default!settings!with!p!

0.05.!

Characterization!of!miRNA!target!interaction!

Exogenous!modulation!of!miRNA!expression!

mirVANA! miRNAMmimics! (Life! Technologies)! were! used! for! miRNA! overexpression!experiments,!while!mirVANA!miRNAMinhibitors!(Life!Technologies)!

! 46! were!used!for!miRNA!knockdown!experiments.!50ng!mirVANA!mimic!or!antiMmiR! inhibitors! for! miRM431! and! the! corresponding! negative! controls! were! transfected! into! primary! motor! neuron! cultures! at! 1! DIV! with! LF2000! according! to! the! manufacture’s!protocol.!Complexes!were!incubated!with!the!cells!for!90!minutes!to! avoid!toxicity!from!the!LF2000!on!the!motor!neurons.!48!hours!after!transfection!

RNA! or! protein! was! extracted! from! the! cells! as! described! above! for! analysis! of! expression! changes.! 72! hours! after! transfection,! cells! in! 24Mwell! dishes! on! glass! coverslips! were! fixed! with! 4%! PFA! as! described! above! and! stained! for! cellMtype! specific!markers!like!ChAT!for!motor!neurons,!Tau!to!observe!at!axon!morphology,! or!cleaved!caspaseM3!to!observe!levels!of!cellMdeath!and!the!nuclear!marker!DAPI.!!

Cloning!chondrolectin!3’UTR!into!Psi'check2!

We!cloned!into!the!Not1/Xho1!site!of!the!Promega!PsiMcheck2!dual!luciferase! vector.!This!vector!has!a!Renilla!luciferase!reporter!fused!to!a!multiple!cloning!site! where!the!3’UTR!of!the!gene!of!interest!is!inserted.!Inhibition!of!the!gene!of!interest! leads! to! decreased! Renilla! luciferase! activity.! Firefly! luciferase! acts! as! a! normalization! control! for! expression! of! the! plasmid.! The! fullMlength! rat! chondrolectin!3’UTR!was!amplified!from!wildtype!rat!total!RNA!using!the!primers:!

Fwd!3’MGTCTCGAGGTTGTTATTCCAATTTACAGTGM5’!and!Rev!3’M!GTGCGGCCGCAGAA!

ACAAGAACTCTTTATTTGGM5’.! The! vector! and! insert! were! digested! with! Not1! and!

Xho1!(New!England!Biolabs)!in!NEB!buffer!3!for!two!hours!at!37°C.!Cut!vector!and! insert!were!run!on!a!1%!agarose!gel,!purified!by!gel!purification!kit!(Qiagen),!and! ligated! at! 4°C! overnight! with! T4! Ligase! Buffer! (NEB).! Bacteria! were! transformed!

! 47! with!the!ligated!plasmids!and!sent!for!sequencing!at!the!Boston!Children’s!Hospital!

IDDRC!Molecular!Genetics!core.!!

Site!directed!mutagenesis!of!chodl!3’UTR!miR'431!site!

Mutagenesis!was!performed!on!the!putative!miRM431!site!in!the!chodl!3’UTR! to! alter! the! 7! nucleotide! binding! site! and! inhibit! miRM431! interaction! using! the!

Quickchange! II! siteMdirected! mutagenesis! kit! (Agilent)! according! to! the! manufacture’s!protocol.!Briefly,!primers!were!designed!with!two!mismatches!at!the! putative! miRM431! site! 5’MTCTAACTTCAATTGTGCAAagCATGTGCCTTACAATTAM3’!

Rev!5’M!TAATTGTAAGGCACATGctTTGCACAATTGAAGTTAGAM3’.!The!Chodl!3’UTR!in! the! psicheck2! vector! was! used! for! amplification! by! pfuTurbo! DNA! polymerase!

(2.5U/ul)!and!run!on!a!PCR!machine!at!98°C!for!30!seconds,!55°C!for!1.5!minutes,! and!68°C!for!2!minutes!for!18!cycles.!DPN1!digestion!for!1hour!at!37°C!was!used!to! eliminate! the! parental! plasmid.! The! remaining! product! was! transformed! and! resulting!plasmid!DNA!sent!for!sequencing!to!confirm!successful!mutagenesis!of!the! miRM431!site.!

Dual!luciferase!assays!

To!establish!direct!miRNAMtargeting!of!the!3’UTR,!we!used!the!Promega!Dual!

Luciferase!assay!(E1910)!according!to!the!manufacture’s!protocol.!Briefly,!HEK293T! cells! were! plated! in! 24Mwell! dishes! at! 80%! confluence.! After! one! DIV,! cells! were! transfected!with!the!chodl3’UTR!or!chodl3’UTRmut!plasmid!as!well!as!30nM!of!miRM

431!mimic!construct!or!control!mimic!construct.!24!hours!after!transfection,!cells!

! 48! were! lysed! for! 20! minutes! at! room! temperature! in! passive! lysis! buffer! and! spun! down!to!remove!cell!debris.!10ul!of!cell!lysate!were!added!per!well!of!a!96Mwell!plate! in! triplicate,! and! the! plate! was! read! on! the! Victor2! plate! reader.! 50ul! of! the!

LARII/well!was!used!to!measure!firefly!luciferase!activity,!followed!by!the!addition! of!50uL!of!the!stop!and!glo!reagent!and!measurement!of!Renilla!luciferase!activity.!

Relative!Renilla!expression!was!determined!by!normalization!to!firefly!activity!for! analysis.!

Neurite!length!measurement!in!primary!motor!neuron!cultures!

To!quantify!morphological!phenotypes!cells!were!stained!with!Tau!and!DAPI! to!identify!neurites!and!healthy!nuclei!respectively.!Slides!were!imaged!on!the!Zeiss!

Imager.Z2! with! the! CoolSnap! HQ2! camera! and! Axiovision! 4.8.2! software! in! the!

Boston! Children’s! Hospital! IDDRC! Cellular! Imaging! Core.! Image! analysis! was! completed!in!ImageJ.!For!neurite!length!measurements!the!NeuronJ!plugin!was!used! for! neurite! tracing! and! quantification.! Neurites! greater! than! three! times! the! cell! body!(100uM)!that!initiated!at!the!cell!body!were!designated!as!‘primary’.!Branches! originating!from!the!other!neurites!greater!than!50uM!were!measured!and!counted! as!secondary!or!tertiary!neurites.!NeuronJ!measurements!were!imported!into!Excel! for!data!analysis!and!processing.!

SMA!patient!samples!

! Dr.!Shi!Yan!Ng!in!the!Rubin!lab!at!Harvard!generously!provided!RNA!from! mixed! cultures! of! differentiated! human! spinal! motor! neurons! from! SMA! patient! iPSCs.!The!specific!cell!lines!used!were!Wildtype!–!BG!SEV,!SMA!type!I!–!38G,!SMA!

! 49! type! II! 151N.! SMA! patient! fibroblasts! were! obtained! from! the! Pediatric!

Neuromuscular!Clinical!Research!Network.!The!cell!lines!used!were!SMN!type!I!1M24! and!SMA!type!I!3M11.!Both!of!these!patient!cell!lines!carry!2!copies!of!SMN2.!!

! !

! 50! !

Chapter!3 !

Integration!of!miRNA:mRNA!profiling!reveals!the!impact!of!

miRNA!dysregulation!on!SMA!motor!neurons!

Contributions!

Mary! Wertz! and! Dr.! Mustafa! Sahin! designed! all! experiments.! Dr.! Pierre!

Neveu! (EMBL)! analyzed! the! miRNA! microarray! data.! Dr.! Kellen! Winden! (Boston!

Children’s! Hospital)! performed! analyses! integrating! miRNA! and! mRNA! profiling! data! including! PITA! target! prediction,! hypergeometric! probability! and! GSEA! of! miRNA!targets,!and!WGCNA.!All!other!experiments!were!designed,!completed,!and! analyzed!by!Mary!Wertz.!

! 51! Introduction!

There!is!an!increasing!body!of!literature!that!identifies!miRNAs!expressed!in! spinal! motor! neurons! as! essential! regulators! of! facets! of! development,! differentiation,!axonal!outgrowth!and!viability!(reviewed!in!Kye!and!Goncalves!Ido,!

2014).!Dysregulation!of!RNA!processing!is!emerging!as!a!common!feature!of!motor! neuron! diseases! (Yamazaki! et! al.,! 2012).! Recent! work! in! ALS! has! shown! that! aberrant!miRNA!expression!contributes!to!disease!pathophysiology!and!can!be!an! important! target! for! intervention! (Parisi! et! al.,! 2013;! Ishtiaq! et! al.,! 2014;! Kye! and!

Goncalves!Ido,!2014).!These!ties!between!miRNAs!and!motor!neurons!sparked!our! interest!in!investigating!dysregulated!of!miRNAs!in!SMA.!

To!date,!only!two!studies!have!looked!at!miRNA!expression!in!SMA.!The!first,! a!study!profiling!miRNA!expression!changes!in!SMA!patientMderived!IPS!cells!found! that! only! miRM9! increased! significantly! in! SMA! cells! as! compared! to! controls!

(Haramati!et!al.,!2010).!More!recently,!work!from!our!lab!identified!several!miRNAs! that! are! differentially! expressed! in! a! primary! cortical! neuron! model! of! SMA!

(Appendix!2,!Kye!et!al.,!2014).!We!identified!a!specific!upregulated!miRNA,!miRM183,! whose! expression! is! increased! in! cortical! and! motor! neurons,! as! well! as! patient! fibroblasts!and!whole!spinal!cords!from!SMAΔ7!mice.!Further,!we!described!miRM

183!regulation!of!local!axonal!translation!and!interaction!with!its!target!mTor.!This! was!the!first!evidence!that!direct!target!modulation!of!dysregulated!miRNAs!in!SMA! axons.!

Interestingly,! in! followMup! studies! of! a! specific! miRNA,! miRM138,! we! discovered! that! while! miRM138! is! significantly! downregulated! following! SMN!

! 52! knockdown!in!cortical!neurons,!it!remains!unchanged!in!motor!neurons!(Appendix!

1).! Therefore,! we! hypothesized! that! the! cellMtype! specific! expression! patterns! of! miRNAs! in! motor! neurons,! the! cell! type! most! affected! by! SMN! loss,! play! an! important!role!in!cellular!morphology!and!viability!of!motor!neurons!in!SMA.!

Here,! we! profile! motorMneuron! specific! miRNA! dysregulation! in! an! in!vitro! model!of!SMA.!Using!transcriptome!profiling!by!RNAMSeq!we!determine!the!relative! impact! of! these! miRNA! changes! on! their! putative! target! genes! and! confirm! the! regulation!of!biological!pathways!perturbed!in!SMA.!Finally,!we!characterize!a!single! miRNA,! miRM431,! which! is! highly! upregulated! in! SMN! knockdown! motor! neurons! and!whose!putative!targets!are!enriched!in!differential!and!coMexpression!analyses.!

This! study! uncovers! aberrant! miRNA! expression! and! identifies! miRM431! and! its! mRNAs!targets!specifically!as!candidates!for!modulation!in!SMA!motor!neurons.!

! ! Results!

In!vitro!primary!motor!neuron!model!of!SMN!loss!

! We!chose!an!in!vitro!primary!spinal!motor!neuron!system!to!measure!miRNA! expression!because!it!allowed!us!to!isolate!the!cell!type!of!interest!in!SMA!for!RNA! profiling! and! biochemical! studies! (Figure! 2.1! experimental! design).! Wildtype! embryonic!rat!spinal!motor!neurons!were!cultured!and!infected!with!shRNA!specific! to!SMN!(shSMN)!or!a!control!(shCtl)!hairpin!sequence!on!day!one!in!vitro!(1DIV).!

SMN! knockdown! was! assessed! by! both! Western! blot! and! qRTMPCR! six! days! after! viral! infection! (at! 7DIV).! These! studies! revealed! a! 75! and! 80%! reduction! in! SMN! protein!and!mRNA!levels,!respectively!(Figure!3.1AMB).!Variations!in!SMN!level!are!a! confounding! factor;! therefore! experiments! in! which! knockdown! of! Smn! mRNA! as!

! 53! measured!by!qRTMPCR!was!not!decreased!by!greater!than!65%!were!not!included!in! the!analysis.!!

Loss!of!SMN!in!these!cultures!does!not!significantly!affect!the!RNA!levels!of! the!motor!neuron!marker!choline!acetyltransferase,!ChAT!(Figure!3.1C)!or!a!marker! of! endoplasmic! reticulum! stressMinduction,! C/EBP! homologous! protein! (CHOP),! at!

A B 1.5 1.5 *** shCtl shSMNshCtl shSMN *** 1.0 SMN 1.0

GAPDH 0.5 0.5 SMN/GAPDH SMN Protein/GAPDH SMN 0.0 0.0

shCtl shCtl shSMN shSMN C D 1.5 NS 1.5 NS

1.0 1.0

0.5 0.5 CHAT/GAPDH CHOP/GAPDH

0.0 0.0

shCtl shCtl shSMN shSMN !

Figure!3.1!shRNANmediated!SMN!knockdown! shRNAMmediated!knockdown!significantly!decreases!A.!SMN!mRNA!and!B.!protein! after!six!days!of!infection!with!shSMN!or!shCtl!normalized!to!Gapdh!expression.!C.! qRTMPCR!for!the!motor!neuron!marker!ChAT!and!D.!ER!stress!marker!CHOP.!N=8! from! 4! biological! replicates,! significance! was! determined! by! unpaired! twoMtailed! student’s!tMtest.!*!=!pMvalue!

! 54! 7DIV!(Figure!3.1D).!These!data!suggest!that!we!are!not!just!measuring!responses!to! cell!stress!and!motor!neuron!death.!As!loss!of!SMN!is!detrimental!to!cell!survival,!we! measured!apoptosis!by!cleaved!caspase!3!(CC3)!on!Western!blots!(data!not!shown)! from! lysates! of! SMN! knockdown! motor! neurons.! Samples! were! taken! every! two! days!until!9DIV!when!we!observed!an!increase!in!CC3!staining.!In!vivo!studies!have! shown! that! the! abnormal! RNA! expression! and! alternative! splicing! that! are! hallmarks!of!SMN!loss!worsen!as!the!disease!progresses!(Baumer!et!al.,!2009).!We! chose!the!7DIV!time!point!to!avoid!confounding!factors!such!as!cell!death!and!late! stage! phenotypes! of! SMA! motor! neurons.! This! allowed! us! to! focus! on! identifying! earlier!drivers!of!morphological!phenotypes!and!expression!changes!independent!of! cell!death.!

! miRNA!expression!profiling!!

! Our! earlier! data! in! cortical! neurons! showed! significant! dysregulation! of! miRNA!expression!after!SMN!loss.!We!were!interested!in!the!increased!expression! of! one! of! these! miRNAs,! miRM138,! because! it! was! highly! upregulated! and! has! previously!been!shown!to!play!a!role!in!both!dendritic!spine!morphogenesis!(Siegel! et!al.,!2009)!and!axon!regeneration!(Liu!et!al.,!2013).!We!attempted!to!corroborate! this!data!in!motor!neurons.!In!contrast!to!our!results!from!cortical!neurons,!miRM138! expression! did! not! change! with! loss! of! SMN! in! motor! neurons! (Appendix! 1).!

Therefore,!we!hypothesized!that!there!may!be!motor!neuronMspecific!changes!in!the! miRNA! expression! which! could! contribute! to! SMA! disease! pathogenesis.! Exiqon!

LNAMbased!miRNA!microarray!analysis!was!used!to!measure!miRNA!expression!! !

! 55! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! ! Figure!3.2!miRNA!profiling!in!SMN!knockdown!spinal!motor!neurons! A.!LNAMbased!miRNA!microarray!identified!56!significantly!differentially!expressed! miRNAs!ranked!by!hierarchical!clustering!following!loss!of!SMN!expression.!B.!qRTM PCR!with!TaqMan!individual!miRNA!expression!assays!validate!expression!changes! of!the!top!10!miRNAs!identified!by!microarray.!Expression!was!normalized!to!the! stable! miRM191! and! to! shCtl! expression.! N=6! from! 4! different! experiments.! Significance! was! determined! by! unpaired! twoMtailed! student’s! tMtest! *! =! pMvalue!

! 56! Figure!3.2!Continued! A

-0.5 0 0.5

shSMN shCtl B 2.5 *** *** 2.0

NS 1.5 * * 1.0 *** *** *** *** 0.5 ***

Normalized to shCtl Expression shCtl to Normalized 0.0

miR-7a miR-431 miR-129miR-124miR-214miR-374miR-379 miR-370miR-708 miR-146a !

! 57! Table!3.1!Top!differentially!expressed!miRNAs! pMvalue!!1.25!fold!change!

miRNA! Log2(FoldChange)! p"value! rno!miR!708" !0.679" 1.03E!06" rno!miR!214" 0.670" 2.75E!04" rno!miR!7a" 0.651" 1.52E!05" rno!miR!370" !0.549" 1.73E!03" rno!miR!431" 0.548" 2.32E!04" rno!miR!146a" !0.547" 1.96E!02" rno!miR!374" !0.481" 5.52E!07" rno!miR!124" 0.456" 1.89E!02" rno!miR!379" !0.453" 7.99E!05" rno!miR!129" 0.444" 2.04E!04" rno!miR!376b!3p" 0.418" 4.02E!05" rno!miR!130b" 0.415" 1.39E!03" rno!miR!204" !0.398" 6.98E!04" rno!miR!219!2!3p" 0.384" 5.34E!03" rno!miR!219!5p" 0.377" 9.50E!03" rno!miR!540" 0.365" 2.59E!03" rno!miR!331" !0.323" 2.03E!03" " ! " !

profiles! in! control! versus! SMN! knockdown! primary! motor! neurons.! After!

normalization!by!a!constant!scaling!factor,!both!passengerMstrands!and!miRNAs!with!

low! hybridization! to! the! array! were! filtered! leaving! 250! miRNAs! detected! above!

threshold.!Of!these!miRNAs,!54!were!identified!as!differentially!expressed!using!a!

twoMsided!Student’s!tMtest!and!BenjaminiMHochberg!multiple!hypothesis!correction!

(Figure!3.2A,!Appendix!6!M!Supplementary!Table!1).!There!was!an!even!distribution!

between! miRNAs! that! were! upregulated! and! downregulated,! which! indicated! that!

only!specific!miRNAs!were!impacted!and!there!was!no!alteration!in!overall!miRNA!

biogenesis!or!stability!in!this!model.!Table!3.1! shows!the!fold!change,!adjusted!pM

value!and!expression!for!the!17!miRNAs!that!had!a!greater!than!1.25!fold!change.!

! 58! To!validate!the!results!of!the!microarray,!we!performed!qRTMPCR!assays!for! individual! miRNAs.! qRTMPCR! revealed! that! nine! of! the! top! ten! differentially! expressed! miRNAs! identified! in! the! sequencing! were! altered! in! the! expected! direction!with!a!magnitude!comparable!to!the!microarray!results!(Figure!3.2B).!The! microarray!confirmed!our!finding!that!miRM138!was!indeed!not!upregulated!in!SMN! knockdown!motor!neurons.!Interestingly,!miRM9,!which!was!reported!to!be!the!most! differentially! expressed! miRNA! in! SMA! IPS! cells! (Haramati! et! al.,! 2010),! was! detected!in!our!array,!but!did!not!change!significantly.!miRM9!has!been!reported!to! be!involved!in!neuronal!cell!type!specification!and!differentiation(Tan!et!al.,!2012),! so!perhaps!this!is!a!reflection!of!the!impairments!in!differentiation!reported!in!this!

SMA! IPS! cell! model.! The! array! failed! to! detect! miRM183! above! the! threshold.! This! inability! likely! results! from! low! overall! expression,! as! we! have! previously! demonstrated!that!expression!values!of!miRM183!were!lower!in!motor!neurons!than! cortical! neurons! (unpublished! data,! Sahin! Lab).! We! also! did! not! detect! its! family! members!miRM96!and!miRM182,!which!could!indicate!a!lack!of!sensitivity!in!the!array! to!these!closely!related!miRNAs.!Nonetheless,!we!were!able!to!confirm!our!earlier! result! (Kye! et! al.,! 2014)! that! miRM183! expression! is! significantly! increased! by! quantitative!RTMPCR!in!SMA!knockdown!motor!neurons.!

While! RNU6B! is! commonly! used! as! a! normalization! control! for! miRNA! expression! assays,! it! has! been! reported! that! components! of! the! U6! snRNP! are! significantly!increased!in!spinal!motor!neurons!in!a!mouse!model!of!SMA!(Zhang!et! al.,! 2013a).! Further,! while! RNU6B! is! stable! in! SMN! knockdown! primary! cortical! neurons,! it! was! increased! and! variable! in! the! primary! motor! neuron! cultures.! To!

! 59! determine!an!appropriate!normalization!control!for!these!assays,!the!NormFinder!

Excel! plugin! (Andersen! et! al.,! 2004)! was! used! to! find! miRNAs! with! best! stability! values! in! the! microarray! (Figure! 3.3A).! We! identified! miRM30d! and! miRM191! as! candidates,!and!we!tested!their!stability!in!the!qRTMPCR!system!(Figure!3.3B).!While! both!were!more!stable!than!RNU6B,!we!found!that!miRM191!was!the!best!candidate! for!normalization!and!confirmed!its!stability!after!knockdown!in!other!models!used! in!this!study.!!

A miRNA name Stability value Std Error rno-miR-30d 0.027 0.009 rno-miR-191 0.029 0.009 B 2.0 shCtl shSMN 1.5

1.0

0.5 Relative abundance Relative 0.0

RNU6B miR-191 miR-30d GAPDH !

Figure!3.3!Selection!of!normalization!control! A.!NormFinder!values!for!most!stable!controls!tested!from!the!array.!B.!Stability!of! RNU6B,!miRM30d!and!miRM191!in!TaqMan!expression!analysis!of!array!samples!by! qRTMPCR!N=6!from!3!Experiments.! ! !

! 60! mRNA!expression!profiling!with!RNA'Seq!

! We! further! hypothesized! that! miRNA! changes! that! impact! motor! neuron! phenotypes!would!be!reflected!in!target!gene!expression.!The!most!common!effect! of! miRNA! binding! to! a! target! mRNA! is! deadenylation! and! decay;! therefore,! we! investigated! transcriptional! changes! by! RNAMSeq! profiling! of! mRNA! expression! in! the!in!vitro!motor!neuron!model.!RNA!from!four!biological!replicates!each!of!shCtl! and!shSMN!infected!primary!motor!neurons!were!sequenced!using!single!end!50bp! reads.!The!total!raw!read!count!between!20M30!million!reads!per!sample!(Table!3.2),! which! is! sufficient! for! differential! analysis.! One! sample! (shSMNM3)! was! excluded! from! further! analysis! due! to! low! sequencing! depth! (

Table!3.2!RNANSeq!read!counts!and!mapping!rate!

Sample'Type' Sample'#' Raw'Reads' Aligned'Reads' Mapping'Rate' shCtl70' TRA00025969) 24,539,484) 14,914,000) 60.8) shCtl71' TRA00025970) 20,793,577) 12,087,028) 58.1%) shCtl72' TRA00025971) 32,921,225) 19,608,159) 59.6%) shCtl73' TRA00025972) 40,220,480) 23,268,682) 57.9) shSMN70' TRA00025973) 29,142,030) 16,459,768) 56.5%) shSMN71' TRA00025974) 22,081,445) 13,373,894) 60.6%) shSMN72' TRA00025975) 23,217,851) 13,716,841) 59.1) shSMN73' TRA00025976) 2,361,646) 1,298,572) 55.0) ) ! !

! 61! Mapping!and!differential!analysis!were!performed!using!the!Tuxedo!suite!of! tools!(Trapnell!et!al.,!2012)!as!described!previously!(Chapter!2).!The!Tuxedo!suite!is! an! RNAMSeq! analysis! pipeline! that! covers! all! steps! of! data! analysis! from! mapping! raw! reads! to! differential! expression! analysis! and! can! be! customized! for! specific! analytic! needs.! Reads! were! mapped! to! the! rat! reference! genome! using! build! Rn5! from!iGenomes!(Illumina).!An!average!of!60%!of!reads!per!sample!mapped!to!the!rat! transcriptome.! Transcripts! were! assembled! and! the! abundance! measured! in! fragments! per! kilobase! of! exon! per! million! of! fragments! mapped! (FPKM).! Overall! mRNA! expression! and! density! of! reads! was! not! significantly! altered! between! the! shSMN!and!shCtl!conditions!(Figure!3.4).!After!filtering!low!expression!transcripts! with!fewer!than!10!reads,!13,943!genes!were!detected.!Differential!analysis!of!these! genes!was!performed!with!Cufflinks.!748!transcripts!were!differentially!expressed! in! shSMN! motor! neurons! versus! controls! with! a! corrected! pMvalue!

Pathway! analysis! of! the! set! of! the! differentially! expressed! transcripts! revealed! enrichment! in! a! number! of! biological! pathways! that! have! potential! implications! in! SMA! (Figure! 3.5).! In! particular,! genes! in! the! KEGG! pathways! of!

‘Neuroactive! LigandMReceptor! Interaction’,! ‘Axon! Guidance’! and! ‘Calcium! Signaling!

Pathway’! may! relate! to! the! altered! excitability! and! neurite! morphology! found! in!

SMA!motor!neurons!(Jablonka!et!al.,!2007)!Figure!3.5AMB).!Gene!Ontology!(GO)!

! 62! ! ! ! ! ! ! ! ! ! ! Figure!3.4!RNANSeq!identification!of!differentially!expressed!genes! A.!Density!plot!of!the!total!distribution!of!FPKM!values!for!all!transcripts!detected! above! the! default! threshold! (10)! in! all! replicates! of! the! shCtl! (blue)! and! shSMN!

(orange)!samples.!B.!Volcano!plot!of!log2(fold!change)!versus!–log10(pMvalue)!of!all! 13,943! genes! detected! above! threshold! shows! a! subset! of! differentially! expressed! genes,!but!no!change!in!overall!gene!expression.!Significant!differentially!expressed! transcripts! are! indicated! in! red! dots.! The! cutoff! was! determined! by! corrected! pM value!

! 63! Figure!3.4!Continued!

A B Genes shSMN/shCtl 0.5 Condition 4 shCtl shSMN 0.4

3 0.3 (p-value) 10

Density 2 log

0.2 −

0.1 1

0.0 0 −20 2 4 6 −40 4 log10(FPKM) log2(Fold Change)

-1

-2 shCtl-1 shCtl-2 shCtl-0 shCtl-3 shSMN-1 shSMN-2 shSMN-0 !

! 64! analysis!revealed!upregulation!of!a!number!of!genes!related!to!RNA!metabolism!and! transcription!(Figure!3.5C),!which!is!consistent!with!the!role!of!the!SMN!complex!in!

RNA! processing.! Conversely,! GO! analysis! of! the! downregulated! genes! identified! a! number! of! cellular! components! and! molecular! functions! related! to! neurite! development!and!synaptic!transmission!(Figure!3.5D).!!

Comparison! of! the! differentially! expressed! transcripts! shows! overlap! of! several!GO!categories,!as!well!as!a!number!of!specific!genes!found!in!transcriptome! profiling!of!other!SMA!models!(Zhang!et!al.,!2013a;!Maeda!et!al.,!2014).!We!believe! that! the! differentially! expressed! genes! that! are! common! to! these! transcriptome! studies!are!likely!to!be!reliable!indicators!of!SMNMrelated!dysfunction.!Further!their! known!functions/interactors!may!help!identify!cellular!mechanisms!common!to!the! in! vitro! and! in! vivo! models! that! are! relevant! to! SMA! pathophysiology.! The! most! common! GO! terms! and! pathways! with! altered! expression! in! the! spinal! motor! neurons! model! were! related! to! transcription,! synapses,! cellular! morphology! and! neuronal! excitability.! These! are! consistent! with! those! identified! in! previous! SMA! transcriptome! studies! mentioned! above.! Therefore,! the! shSMN! knockdown! model! represents! a! powerful! tool! for! investigation! of! the! loss! of! SMN! on! different! RNA! species!in!motor!neurons.!!

Integration!of!miRNA:!mRNA!expression!data!

! We!next!sought!to!integrate!the!gene!and!miRNA!expression!data!to!identify! the! potential! effects! of! miRNA! dysregulation! on! the! transcriptome.! First,! we! identified!putative!targets!of!the!differentially!expressed!miRNAs!using!TargetScan.!

! 65! A B Top KEGG Pathways in Upregulated mRNA Top KEGG Pathways in Downregulated mRNA

MAPK signaling pathway Neuroactive ligand-receptor interaction Pathways in cancer Calcium signaling pathway Adherens junction Pathways in cancer Bladder cancer PPAR signaling pathway Wnt signaling pathway Cardiac muscle contraction Colorectal cancer Axon guidance Neuroactive ligand-receptor interaction ECM-receptor interaction Cell cycle ARVC Pancreatic cancer Gap junction Focal adhesion Endocytosis RNA degradation Focal adhesion Endometrial cancer Jak-STAT signaling pathway Acute myeloid leukemia Hypertrophic cardiomyopathy (HCM) p53 signaling pathway Adipocytokine signaling pathway TGF-beta signaling pathway Huntington's disease

0 2 4 6 8 0 5 10 10 15 20 -log10(p-value) -log10(p-value)

C GO Analysis Upregulated Genes D GO Analysis Downregulated Genes

Response to Organic Substance Response to Organic Substance Reg of Transcription from RNA pol II Promoter GPCR Protein Signaling Pathway Regulation of Transcription Receptor-linked Signal Transduction Reg of RNA Metabolic Process Regulation of System Process Pos Reg of Macromolecule Metabolic Process Neurological System Process Nuclear Lumen Plasma Membrane Plasma Membrane Neuron Projection Cell Surface Synapse Part Intracellular Organelle Lumen Chloride Channel Complex Membrane-Enclosed Lumen Cell Soma Transcription Regulator Activity Neurotransmitter Receptor Activity Sequence-Specific DNA Binding Neurotransmitter Binding Transcription Factor Activity GABA-A Receptor Activity DNA binding GABA Receptor Activity Transcription Repressor Activity Chloride Ion Binding

0 2 4 6 8 0 2 4 6 8 10 10 -log10(p-value) -log10(p-value) GO Biological Process GO Cellular Component GO Molecular Function !

Figure!3.5!Analysis!of!differential!expression!using!the!DAVID!bioinformatics!tool! The!DAVID!bioinformatics!tool!was!used!to!complete!Pathway!and!Gene!Ontology!(GO)! analysis!of!differentially!expressed!genes.!The!background!used!for!analysis!was!the!total! set!of!13,943!genes!detected!above!threshold!by!RNAMSeq.!KEGG!pathway!analysis!shows! the! most! significant! biological! pathways! enriched! in! the! A.! upregulated! and! B.! downregulated! genes.! C.! GO! analysis! of! enriched! terms! in! upregulated! and! D.! down! regulated!genes.!Significance!was!determined!using!a!minimum!number!of!hits!=!2!and! Bonferroni!pMvalue!of!

! 66! This!algorithm!identifies!potential!miRNA!binding!sites!within!transcripts!and!then! filters! these! sites! based! on! their! evolutionary! conservation.! We! compared! these! potential! targets! for! each! differentially! expressed! miRNA! to! the! differentially! expressed! transcripts! using! a! Hypergeometric! Probability! test.! Because! miRNA! regulation! of! target! mRNAs! is! primarily! inhibitory,! we! focused! on! the! transcripts! that!had!an!opposite!directional!change!to!the!specific!miRNA.!We!did!not!identify! any!significant!overlap!between!the!differentially!expressed!genes!and!the!predicted!

Targetscan!targets!after!multiple!corrections!(pMvalue!

Given! that! the! Targetscan! algorithm! focuses! on! evolutionarily! conserved! miRNA!binding!sites!within!previously!annotated!transcripts,!we!hypothesized!that! there! may! be! miRNA! sites! that! were! not! conserved! or! present! within! previously! unannotated! regions! of! the! transcripts.! Therefore,! we! took! advantage! of! our! sequencing! paradigm! and! obtained! transcript! sequences! for! genes! that! passed! thresholds! for! expression! and! variability! (n=9,163).! We! then! utilized! the! PITA! algorithm! (Kertesz! et! al.,! 2007)! to! identify! putative! binding! sites! within! these! transcripts! and! predict! whether! they! would! be! targets! of! the! 17! differentially! expressed! miRNAs.! This! method! identified! substantially! more! predicted! target! genes!than!the!Targetscan!algorithm.!Therefore,!we!used!the!Gene!Set!Enrichment!!

! 67! A 2.5

2.0

1.5 (p-value)

10 1.0

-log 0.5

0.0

miR-7a miR-431miR-124miR-129miR-540 miR-379miR-708miR-374miR-370miR-214miR-204miR-331 miR-219b miR-130bmiR-376bmiR-219a miR-146a

B 8

4 (p-value) 10

-log 2

miR-7a miR-431miR-124miR-129miR-540 miR-379miR-708miR-374miR-370miR-214miR-204miR-331 miR-219b miR-130bmiR-376bmiR-219a miR-146a !

Figure!3.6!Gene!Set!Enrichment!of!miRNA:mRNA!interactions! Bar!plots!demonstrating!the!pMvalues!of!overlap!and!enrichment!among!the!targets! of! the! differentially! expressed! miRNAs! within! genes! demonstrating! the! opposite! fold! change! to! the! miRNA.! A.! Bar! plot! of! pMvalues! demonstrating! the! overlap! between! Targetscan! targets! and! differentially! expressed! genes.! PMvalues! were! determined! using! hypergeometric! probability! (significant! =! pMvalue!

! 68! Algorithm! (GSEA)! (Subramanian! et! al.,! 2005)! to! evaluate! whether! these! putative! target!genes!would!be!enriched!among!genes!whose!expression!changed!opposite!to! that!of!the!miRNA!of!interest.!GSEA!analysis!showed!that,!of!the!top!17!differentially! expressed! miRNAs,! eight! of! them! show! significant! enrichment! in! putative! mRNA! targets! after! multiple! corrections! (miRM376b,! miRM431,! miRM124,! miRM219b,! miRM

129,!miRM540,!miRM214,!miRM130b)!with!the!top!three!miRNAs!being!miRM431,!miRM

376b!and!miRM219b!(Figure!3.6B).!GSEA!analysis!of!miRNAs!with!targets!changing! in!the!same!direction!did!not!show!any!enrichment!for!these!eight!miRNAs!(data!not! shown),! supporting! the! specificity! of! the! interaction.! Three! miRNAs! did! have! significant!enrichment!in!targets!that!changed!in!the!same!direction!as!the!miRNA,! miRM331,!miRM370!and!miRM7a.!This!indicates!that!the!targets!of!these!three!miRNAs! may! be! regulated! by! a! different! miRNA,! transcription! factor,! or! feedback! mechanism.!!

Co'expression!network!analysis!of!miRNA!targets!

! The! GSEA! suggested! a! connection! between! miRNA! expression! and! mRNA! changes.! Therefore,! we! decided! to! evaluate! gene! expression! from! a! network! perspective!to!gain!further!insight!into!the!mechanisms!by!which!miRNA!changes! might!be!influencing!gene!expression.!We!performed!Weighted!Gene!CoMexpression!

Network!Analysis!(WGCNA)!with!the!9,163!genes!that!had!been!previously!filtered! for!low!expression!or!low!variance.!We!identified!34!modules!of!coMexpressed!genes.!

CoMexpression! analysis! provides! additional! confirmation! of! the! impact! of! specific!

! 69! miRNA!changes!on!the!RNAMSeq!profile!that!is!not!based!on!differential!expression! thresholds.!!

To! assess! the! correlation! of! each! module! to! the! miRNA! expression! profile,! putative! targets! were! predicted! by! the! PITA! algorithm! for! each! of! the! top! 17! differentially! expressed! miRNAs! as! described! above.! ZMscores! were! calculated! to! highlight!significant!interactions!between!a!number!of!miRNAs!and!a!subset!of!the! coMexpression! modules! (Figure! 3.7A).! Interestingly,! the! targets! of! the! most! highly! upregulated! miRNA,! miRM431,! were! also! the! most! significantly! enriched! in! downregulated! modules,! MM2,! MM9,! MM29! and! MM11.! ModuleM11! was! of! particular! interest!because!it!contained!a!set!of!231!genes!that!were!consistently!decreased!in! the!shSMN!samples!as!compared!to!controls!(Figure!3.7B).!GO!analysis!of!ModuleM11! revealed! enrichment! in! targets! involved! in! cellular! components! related! to! morphology!including!Actin!Cytoskeleton!Organization,!as!well!as!Neuronal!and!Cell!

Projections!(Figure!3.7C).!Disruptions!in!motor!neuron!axon!and!neurite!outgrowth! are!a!hallmark!of!a!number!of!SMA!models!(Rossoll!et!al.,!2003;!Jablonka!et!al.,!2007;! van!Bergeijk!et!al.,!2007;!Dimitriadi!et!al.,!2010;!Kwon!et!al.,!2011).!This!phenotype! is! caused! in! part! by! increased! profillin2a! deregulating! activity! of! the! Rho/ROCK! pathway!and!altering!cytoskeleton!dynamics!(Bowerman!et!al.,!2007).!GO!analysis! also! revealed! enrichment! in! several! molecular! function! categories! related! to!

Channel!Activity.!Interestingly,!neuronal!excitability!is!also!perturbed!in!SMA!in!part! due! to! of! abnormal! expression! of! axonal! calcium! channels! (Jablonka! et! al.,! 2007).!

The!GO!results!provide!evidence!that!the!network!of!genes!coMexpressed!in!ModuleM

11!are!highly!relevant!to!SMA!phenotypes.!Therefore,!the!interaction!of!miRM431!

! 70! ! ! ! ! ! ! ! Figure!3.7!WGCNA!analysis!of!putative!enrichment!for!miR:mRNA!interactions! A.! Heatmap! of! zMscores! for! miRNA! target! enrichment! in! the! mRNA! coMexpression! modules! from! WGCNA.! YellowMBlue! Heatmap! indicates! magnitude! of! overall! gene! expression!in!shCtl!versus!shSMN!in!each!module.!Interactions!with!modules!were! significant! at! zMscore! >! 3.6! corresponding! to! pMvalue!

! 71! Figure!3.7!Continued! Figure X Co-expression analysis of miRNA:mRNA interactions! ! A Z-Score

0 24681012

Module Expression miR−129 miR−370 miR−204 miR−130b miR−331 miR−124 miR−431 miR−708 miR−540 miR−219b miR−146a miR−7a miR−219a miR−379 miR−214 miR−374 miR−376b M_12 M_22 M_24 M_4 M_19 M_27 M_10 M_31 M_8 M_18 M_23 M_3 M_32 M_11 M_29 M_9 M_2

B Module-11 C Cell Motion Membrane Organization Response to Organic Substance Cell Projection Organization

shCtl-0 shCtl-1 shCtl-2 shCtl-3 shSMN-0 shSMN-1 shSMN-2 Regulation of Secretion Plasma Membrane Golgi Apparatus Neuron Projection Golgi Apparatus Part Cell Projection Part Gated Channel Activity Channel Activity Passive Transmem Transporter Activity Cation Channel Activity Metal Ion Transmem Transporter Activity

0 1 2 3 4 5 -log10(p-value) Cyan3 ! !

! 72! ! with! specific! target! genes! in! ModuleM11! may! underlie! dysregulation! of! these! pathways.!

! miR'431!dysregulation!is!not!due!to!off!target!effects!of!the!shSMN!hairpin!

! miRM431! is! a! CNS! miRNA! expressed! early! in! development! (Wheeler! et! al.,!

2006).!In!both!the!differential!expression!analysis!and!coMexpression!analysis,!there! was!significant!enrichment!in!mRNA!targets!associated!with!miRM431.!Further,!miRM

431! was! the! most! highly! upregulated! miRNA! in! the! screen! (Figure! 3.2B),! and! the! magnitude!of!this!differential!expression!is!highly!consistent!from!sample!to!sample.!

To!confirm!these!changes!were!not!due!to!an!offMtarget!effect!of!the!shRNA!hairpin,! two! additional! shSMN! hairpins! that! target! different! regions! of! the! Smn! transcript! and!result!in!an!80%!loss!of!Smn!mRNA!and!protein!were!tested!(Figure3.8A).!We! confirmed!miRM431!expression!increases!significantly!in!knockdown!motor!neurons! using!both!additional!SMN!shRNA!hairpins!(Figure!3.8B).!!

Primary!transcription!of!miR'431!is!increased!by!SMN!loss!

To!begin!uncovering!why!miRM431!expression!is!increased!in!our!model,!we! examined!its!primary!transcript,!priMmiRM431,!prior!to!microprocessor!cleavage!and! maturation.!In!the!rat!genome,!the!miR'431!gene!is!located!on!chromosome!6!antiM sense!to!the!retrotransposonMlike!1!(RTL1)!gene.!This!locus!is!part!of!a!larger!cluster! of!miRNAs,!the!DLK1MDIO3!cluster,!dysregulation!of!which!has!been!implicated!in! cancer!(Benetatos!et!al.,!2013).!We!assayed!priMmiRM431!expression!and!found!that! it! is! increased! by! 45%! in! SMN! knockdown! motor! neurons! (Figure! 3.9A).! The! priM

! 73! A B 1.5 3 * *** *** * 1.0 2

0.5 1 SMN/GAPDH miR-431/miR-191 0.0 0

shCtl shCtl shSS4 shSS5 shSS4 shSS5 !

Figure!3.8!miRN431!expression!changes!are!not!an!offNtarget!effect!of!shSMN! A.! Quantitative! RTMPCR! of! SMN! and! B.! miRM431! following! shRNAMmediated! SMN! knockdown! with! two! additional! shRNA! hairpins! that! target! different! parts! of! the! Smn!gene.!N=!6!from!3!experiments!*!=!pMvalue!

miRM431!increase!is!not!as!high!as!the!greater!than!twoMfold!increase!in!the!mature!

miRM431! (Figure! 3.9).! However,! the! increase! in! mature! miRM431! expression! is! at!

least!in!part!due!to!increased!primary!transcription!of!priMmiRM431.!!

! miR'431!expression!changes!are!motor!neuron!specific!

To! determine! the! extent! of! miRM431! dysregulation! in! SMA,! we! measured!

miRM431!expression!in!other!cell!types!including!SMN!knockdown!primary!cortical!

neurons,! SMA! patient! fibroblasts! and! SMA! iPSCMderived! motor! neurons.! SMN!

knockdown!in!cortical!neurons!(Figure!3.10A)!does!not!show!significant!changes!in!

a!number!of!the!miRNAs!identified!in!the!motor!neuron!screen,!including!miRM431!

! 74! A B 2.5 2.5 *** ** 2.0 2.0

1.5 1.5

1.0 1.0

0.5 0.5 Pri-miR-431/GAPDH

0.0 MaturemiR-431/miR-191 0.0

shCtl shCtl shSMN shSMN !

Figure!3.9!priNmiRN431!expression!in!SMN!knockdown!motor!neurons! A.! qRTMPCR! of! priMmiRM431! expression! normalized! to! GAPDH! control! in! SMN! knockdown! motor! neurons! B.! qRT=PCR! of! mature! miRM431! expression! normalized!to!miRM191!(data!from!figure!3.2!above).!(N=6!from!4!experiments)!*! =!pMvalue!

Finally,! miRM431! expression! does! not! increase! in! human! SMA! type! I! patient! fibroblasts! as! compared! to! control! fibroblasts! (Figure! 3.10C),! which! is! consistent! with!cell!type!specificity.!Together!these!findings!suggest!that!the!increase!in!miRM

431!expression!in!response!to!SMN!deficiency!is!motor!neuronsMspecific.!!

! 75! !

! A B 2.5 *** 1.5 2.0 1.0 1.5

1.0 0.5 0.5 Normalized to miR-191 to Normalized Normalized to miR-191 to Normalized 0.0 0.0

shCtl shCtl shSMN shSMN C D 1.5 1.5 *

1.0 1.0

0.5 0.5 Normalized to miR-191 to Normalized 0.0 miR-191 to Normalized 0.0

Ctl Ctl

SMA Type I SMA Type I !

Figure!3.10!miRN431!expression!changes!are!motor!neuron!specific! A.!qRTMPCR!of!miRM431!in!motor!neurons!(N=8!from!4!experiments)!and!B.!cortical! neurons! (N=6! from! 3! experiments)! following! shSMN! knockdown.! C.! qRTMPCR! of! miRM431!in!human!patient!fibroblasts!(N=6!from!2!control!and!2!SMA!patient!cell! lines).!D.!qRTMPCR!of!miRM431!in!IPSCMderived!motor!neurons!(N=4!from!2!separate! differentiations)!*!=!pMvalue!

! 76! miR'431!is!increased!in!human!SMA!patient!motor!neurons!

While! miRM431! expression! was! not! altered! in! patient! fibroblasts,! we! asked! whether! its! expression! is! changed! in! motor! neurons! derived! from! SMAMpatient! iPSCs.! Interestingly,! in! unsorted! type! I! SMA! patient! IPSCMderived! motor! neurons! there! is! a! small! but! significant! increase! in! miRM431! (Figure! 3.10D).! These! motor! neurons!only!account!for!20M30%!of!the!total!cells!in!culture!after!differentiation,!so! this!small!magnitude!of!change!in!the!mixed!culture!could!reflect!a!larger!change!in! the!human!SMA!motor!neurons.!

Expression!of!miR'431!target!mRNAs!are!decreased!by!SMN!loss!

Of!the!231!genes!in!ModuleM11,!the!PITA!algorithm!identified!70!as!putative! targets!of!miRM431.!32!of!these!targets!were!also!significantly!down!regulated!in!the!

RNAMSeq! differential! analysis! (Table! 3.3).! Using! the! results! of! the! GO! analysis! of!

ModuleM11! (Figure! 3.7C),! we! selected! a! number! of! genes! related! to! neurite! outgrowth!and!neuronal!excitability!including!TNFAIP1,!CLCN5,!Kif3B,!Sema5A,!NSF!

NKAP!and!RYR2.!We!confirmed!that!6!of!the!7!genes!we!selected!were!significantly! down! regulated! in! SMN! knockdown! motor! neurons! by! qRTMPCR! (Figure! 3.11).!

Additionally,!we!identified!a!putative!miRM431!target,!chondrolectin!(Chodl),!which! was!highly!correlated!with!moduleM11.!Chodl!mRNA!has!been!previously!shown!to! be!reduced!in!mouse!models!of!SMA!in!addition!to!having!roles!in!axon!development!

(Zhong!et!al.,!2012;!Sleigh!et!al.,!2014).!We!asked!if!this!might!be!related!to!miRM431! expression!as!well!and!validated!that!chodl!expression!is!indeed!decreased!in!our!

SMN!knockdown!model!(Figure!3.11).!

! 77! ! ! Table!3.3!miRN431!targets!identified!by!differential!expression!and!WGCNA!

Gene!Name! Fold!Change! P0value! ! TNFAIP1! 04.58! 5.00E005! SLC16A7! 03.51! 5.00E005! MORF4L1! 03.04! 5.00E005! TMX4! 03.02! 5.00E005! CALB1! 03.00! 5.00E005! NIPAL3! 02.71! 2.00E004! PTGES3! 02.70! 5.00E005! UHMK1! 02.67! 5.00E005! RGS7BP! 02.56! 2.15E003! HMGCR! 02.54! 5.00E005! CLCN5! 02.34! 5.00E005! DGKK! 02.34! 5.00E005! B3GNT5! 02.27! 5.00E005! JAK1! 02.21! 5.00E005! KIF3B! 02.18! 5.00E005! SEMA5A! 02.17! 5.00E005! SYT16! 02.13! 4.50E004! PAPPA! 02.03! 1.00E004! YES1! 01.94! 1.55E003! NSF! 01.78! 5.00E005! SELT! 01.78! 5.00E004! TXNDC5! 01.78! 1.50E004! APLP2! 01.77! 1.50E004! LYSMD1! 01.76! 1.90E003! NKAP! 01.71! 1.10E003! TRIM33! 01.71! 2.45E003! TBC1D24! 01.70! 4.00E004! RYR2! 01.63! 2.05E003! OPA1! 01.63! 8.00E004! GAPVD1! 01.63! 1.00E003! C530008M17RIK! 01.61! 1.00E003! TFRC! 01.58! 1.10E003! ! ! !

! 78! !

! 1.0

0.8 NS ** 0.6 *** * ** ** **** 0.4

0.2 *** Ratio shSMN/shCtl Ratio 0.0

NSF Kif3B NKAPRYR2Chodl CLCN5 TNFAIP1 Sema5A !

Figure!3.11!miRN431!targets!are!differentially!expressed!in!the!SMA!model! qRTMPCR! of! relative! mRNA! expression! of! 9! putative! miRM431! targets! in! shCtl! vs.! shSMN! (N=4! from! 4! Experiments).! Significance! was! determined! by! unpaired! students!test!*!=!p!

! The!aim!of!this!study!was!to!characterize!miRNA!expression!changes!in!an!in!

vitro! primary! spinal! motor! neuron! model! of! SMA! and! to! correlate! these! changes!

with! their! targetMmRNA! transcript! levels! to! understand! the! relative! impact! of!

miRNA! changes! in! SMA! motor! neurons.! In! our! miRNA! data,! not! only! do! we! see! a!

significant! dysregulation! in! miRNA! expression! with! SMN! knockdown,! but! we! also!

see! expression! changes! specific! to! motor! neurons.! RNAMSeq! for! transcriptional!

changes!in!this!primary!motor!neuron!model!identified!756!differentially!regulated!

genes.!Integration!of!miRNA!with!mRNA!expression!profiles!identified!enrichment!

in! the! differential! expression! of! a! number! of! putative! targets! of! the! dysregulated!

! 79! miRNAs.! Further,! these! targets! were! regulated! in! the! opposite! direction! of! their! associated! miRNAs.! From! this! study,! we! were! able! to! identify! 8! miRNAs! with! significant!interaction!in!mRNA!targets!in!SMA!motor!neurons.!!

Using!integrated!miRNA:mRNA!profiling!to!identify!significant!interactions!

! Integration!of!miRNA!and!mRNA!profiles!is!a!powerful!technique!to!identify! the! impacts! of! miRNA! changes! on! specific! putative! targets! as! well! as! larger! gene! networks! containing! multiple! targets! of! the! same! miRNA.! We! sought! to! take! advantage! of! the! advent! of! highMthroughput! deep! sequencing! methods! to! understand!the!transcriptional!effect!of!miRNA!changes!in!SMA.!While!alternative! splicing! is! dysregulated! in! SMA,! miRNA! regulation! of! mRNA! targets! is! primarily! through! RNA! turnover.! Alternative! splicing! of! miRNAs! has! been! shown! to! effect! biogenesis! of! a! small! subset! of! miRNAs! at! exon! junctions! (Melamed! et! al.,! 2013);! however,! this! pertains! only! to! a! small! population! of! miRNAs! that! were! not! dysregulated!in!our!profiling!data.!Therefore,!we!chose!to!focus!on!overall!changes! in!gene!expression.!!

Several!different!algorithms!have!been!proposed!as!the!best!way!to!integrate! miRNA! and! mRNA! expression! data! as! reviewed! in! (Muniategui! et! al.,! 2013).! The! implementation!of!these!different!algorithms!is!highly!dependent!on!the!type!and! depth!of!sequencing!data!available!as!well!as!the!number!and!relation!of!samples!to! be! compared.! To! date,! human! and! mouse! models! are! the! most! widely! used! for! studies! of! miRNA! targeting.! Additionally,! the! annotation! of! the! rat! genome! is! not! nearly!as!detailed!as!that!of!the!mouse!or!human!genome.!Because!of!this,!we!were!

! 80! unable!to!take!advantage!of!some!of!the!available!datasets!and!tools!pertaining!to! miRNA! targeting! in! our! rat! model.! Therefore,! we! chose! to! use! a! straightforward! approach! of! hypergeometric! probability! testing! and! GSEA! analysis! to! identify! putative!miRNA!target!enrichment.!These!tests!were!appropriate!given!the!number! and!types!of!samples!provided!in!the!analysis!and!were!able!to!identify!8!miRNAs! that!may!contribute!to!the!SMN!knockdown!transcriptome!profile.!!

Generation!of!WGCNA!modules!highlights!miRNA!regulation!of!gene!networks!

GO!analysis!was!used!to!identify!cellular!and!biological!processes!targeted!by! the!gene!networks!created!by!WGCNA.!We!chose!to!focus!on!ModuleM11!because!it! was!most!highly!correlated!with!SMN!knockdown,!and!had!the!highest!zMscore!for!its! interaction!with!miRM431.!Of!the!miRM431!targets!in!this!module,!over!half!of!them! were! significantly! downregulated! in! the! differential! expression! analysis.! Several! other!miRNAs!have!significant!enrichment!particularly!in!down!regulated!modules! as!evidenced!by!their!zMscores!(Figure!3.7).!Our!analysis!primarily!focused!on!miRM

431! as! its! interaction! was! most! significant;! however,! these! other! miRNAs! may! regulate!similar!modules!or!genes!in!tandem!and!contribute!to!SMA!pathogenesis.!

Further! investigation! of! these! additional! miRNAs! and! their! targets! may! help! us! understand!the!dysregulation!of!these!gene!networks!in!SMA.!!

Identification!of!miR'431!

Both!GSEA!and!WGANA!identified!putative!miRM431!targets!as!significantly! downregulated.! This! indicates! a! role! for! miRM431! in! regulation! of! aberrantly!

! 81! downregulated!target!mRNAs!in!our!SMN!knockdown!model.!miRM431!is!interesting! because!it!has!been!reported!to!have!high!CNS!expression!in!the!brain!and!spinal! cord! (Wheeler! et! al.,! 2006).! Here! we! report! that! miRM431! is! the! most! highly! dysregulated,!and!increased!more!than!two!fold!in!SMN!knockdown!motor!neurons.!

Primary! transcription! of! the! priMmiRM431! gene! is! upregulated! in! the! SMN! knockdown! motor! neurons,! which! contributes! to! the! increase! in! mature! miRM431! expression.! Previous! work! on! dysregulation! of! miRM183! in! our! cortical! neuron! model!did!not!reveal!a!transcription!change!(Kye!et!al.,!2014).!Therefore!we!believe! dysregulation! of! miRNA! expression! in! SMA! may! be! influenced! by! both! miRNA! transcription!and!stability.!!

! miR'431!targets!are!decreased!by!SMN!knockdown!

We! identified! a! set! of! miRM431! putative! targets! whose! expression! was! significantly! decreased! in! SMN! knockdown! neurons.! Additionally,! we! validated! decreased! expression! of! 7! of! these! genes! all! of! which! have! previously! been! identified! as! involved! in! axon! projection! or! synaptic! activity.! Specifically,! tumor! necrosis! factor! alphaMinduced! protein! 1! (TNFAIP1)! regulates! RhoA! stability! and! turnover!important!for!axon!morphology!(Sailland!et!al.,!2014),!and!TNFAIP1!loss! induces! apoptosis! in! dividing! cells! and! could! contribute! to! neuronal! apoptosis!

(Zhang! et! al.,! 2014).! Semaphorin! 5a! (Sema5a)! is! an! important! axon! guidance! cue! that!is!involved!in!motor!neuron!axon!extension!and!targeting!(Hilario!et!al.,!2009).!

We!also!identified!decreased!expression!of!another!putative!miRM431!target,!Chodl,! which!plays!a!role!in!motor!neuron!axon!development!(Zhong!et!al.,!2012).!Here!we!

! 82! do!not!report!a!direct!interaction!between!miRM431!and!the!3’UTR!of!these!targets.!

However,!we!believe,!investigation!of!direct!miRM431!targeting!and!the!downstream! effect!of!dysregulation!of!these!targets!are!important!areas!for!future!studies.!

Motor!neuron!specific!miRNA!expression!

The! motor! neuronMspecific! miRNA! change! in! miRM431! expression! is! of! particular! interest! in! SMA! because! motor! neurons! are! most! vulnerable! to! cellular! stress!and!eventual!death.!While!our!previous!screen!in!cortical!neurons!identified!a! number! of! differentially! expressed! miRNAs,! followMup! analysis! showed! cellMtype! specific! differences! in! miRNA! expression! in! our! in! vitro! SMA! model.! Here,! our! analysis!has!identified!17!miRNAs!whose!expression!is!significantly!different!in!SMN! deficient!spinal!motor!neurons.!Analysis!of!miRNA!expression!of!RNA!isolated!from!

P4! lumbar! spinal! cords! of! the! SMNΔ7! mouse! model! of! SMA! did! not! show! overall! expression! changes! in! miRM431! (data! not! shown).! This! model! does,! however,! recapitulate!increased!expression!of!miRM183,!a!miRNA!dysregulated!in!a!variety!of! neuronal!and!nonMneuronal!cell!types,!as!described!in!our!previous!publication!(Kye! et.!al).!We!believe!the!relatively!small!contribution!of!motor!neurons!in!the!whole! spinal! cord! does! not! allow! for! identification! of! these! cellMtype! specific! changes! within!a!mixed!population!of!cells.!Importantly,!we!found!a!significant!increase!in! miRM431! expression! in! type! I! SMA! patient! IPSCMderived! motor! neurons.! This! indicates!that!dysregulated!miRM431!expression!is!a!common!feature!of!both!rodent! and! human! models.! Consequently,! miRM431! loss! may! be! important! for! the! progression!of!human!disease!in!motor!neurons.!

! 83! Broader!implications!!

Analysis!of!putative!miRM431!targets!has!identified!a!number!of!genes!related! to!axonal!cytoskeletal!organization!that!could!contribute!to!the!axonal!phenotype!in!

SMA! motor! neurons.! In! future! experiments,! validation! of! specific! miRM431! target! mRNAs! will! be! necessary! to! determine! their! impact! on! SMA! phenotypes.! In! our! previous! study! on! miRM183,! we! showed! that! early! administration! of! a! miRM183! sponge!in!an!SMA!mouse!model!decreased!miRM183!expression,!and!this!treatment! was!sufficient!to!improve!motor!phenotype!and!increase!lifespan!by!several!days.!

This!finding!provides!proof!of!principle!that!therapeutic!targeting!of!dysregulated! miRNAs,!in!particular!miRM431,!could!be!used!in!future!experiments!to!ameliorate! the! SMA! phenotype! and! rescue! viability! in! an! animal! model.! Our! current! work! described! in! detail! in! Chapter! 4! aims! to! address! the! specifics! of! the! functional! impact!of!the!miRM431!changes!on!a!specific!target!mRNA.!!

! !

! 84! ! ! ! ! ! Chapter!4 !

! miRN431!targeting!of!Chondrolectin!is!dysregulated!in!SMA!!

Contributions!

Mary! Wertz! and! Dr.! Mustafa! Sahin! designed! all! experiments.! Mary! Wertz! completed!and!analyzed!all!experiments.!

! !

! 85! Introduction!

Correlation!between!the!miRNA!and!mRNA!transcriptional!profiles!of!an!in! vitro! spinal! motor! neuron! SMA! model! enabled! the! identification! of! miRNAs! with! enrichment!in!differentially!expressed!putative!targets!following!loss!of!SMN.!Of!the! eight! miRNAs! identified! by! this! approach,! miRM431! showed! the! strongest,! most! consistent! dysregulation! in! validation! studies.! It! also! had! the! most! significant! interaction! with! downregulated! mRNAs! in! a! coMexpression! module! enriched! in! a! class!of!targets!associated!with!SMA!phenotypes!as!demonstrated!by!GO!analysis.!

! miR'431!a!CNS'specific!miRNA!

miRM431! was! first! characterized! in! a! screen! for! CNSMspecific! miRNA! expression! (Wheeler! et! al.,! 2006).! It! is! expressed! in! mouse! development! by! embryonic!day!13!(E13)!throughout!the!brain!and!spinal!cord,!and!its!expression! was!detected!by!northern!blot!at!postMnatal!day!10!(P10)!with!an!expression!profile! that! decreases! into! adulthood.! In! cultured! neurons,! miRM431! can! be! detected! by! qRTMPCR!in!both!embryonic!cortical!and!motor!neurons.!The!function!of!miRM431!in! neurons!is!unknown,!although!it!is!detected!in!pancreatic!(Schultz!et!al.,!2012)!and! colorectal!cancers!(Kanaan!et!al.,!2013),!as!well!as!in!schwannomas!(TorresMMartin! et! al.,! 2013).! Recently,! a! rodent! nerve! injury! model! found! that! miRM431! was! increased!and!targeted!Kremen1!mRNA!to!affect!axon!regeneration!and!outgrowth! in! sensory! neurons! (Wu! and! Murashov,! 2013).! This! indicated! that! miRM431! expression! can! alter! sensory! axon! injury! phenotypes.! Therefore,! we! hypothesized! that!it!is!involved!in!axonal!growth!regulation!in!motor!neurons!as!well.!!

! 86! Chondrolectin!and!motor!neuron!axonal!health!

A! list! of! putative! miRM431! target! RNAs! (Chapter! 3! Table! 3.3)! differentially! downregulated! in! the! SMN! knockdown! motor! neurons! contained! a! number! of! interesting!targets!involved!in!synaptic!transmission,!Golgi!apparatus!function,!and! neuronal! projection! development.! Of! the! putative! miRM431! targets! chondrolectin!

(Chodl)!is!of!particular!interest!in!SMA.!Chodl!is!a!type!1!transmembrane!protein! and!is!a!member!of!the!cMtype!lectin!domainMcontaining!family!(Weng!et!al.,!2002),! but!little!is!known!about!its!function.!Chodl!expression!is!detected!as!early!as!E7!in! mouse! embryonic! development,! and! in! adult! animals! it! is! primarily! expressed! in! skeletal! muscle,! heart,! and! brain! (Weng! et! al.,! 2003b).! In! the! ventral! spinal! cord,!

Chodl! has! been! identified! as! a! specific! marker! for! a! subMpopulation! of! large! fastM spiking! alpha! motor! neurons! and! can! be! detected! early! in! motor! neuron! development!at!E10.5!(Enjin!et!al.,!2010).!This!subpopulation!of!neurons!has!been! shown!to!respond!differently!in!an!ALS!model!expressing!the!Sod1(G93A)!mutation! where! neuronal! expression! of! Chodl! and! NeuN! is! decreased! early! in! disease! progression!as!compared!to!another!fastMspiking!motor!neuron!marker,!calca,!which! is!decreased!later!(Wootz!et!al.,!2013).!!

Functionally,! Chodl! is! a! modifier! of! axon! growth.! In! an! in! vivo! zebrafish! model,! expression! of! a! Chodl! morpholino! decreased! axon! length! and! reduced! innervation! of! myotomes! but! did! not! induce! cell! death! (Zhong! et! al.,! 2012).!

Interestingly,! exogenous! overexpression! of! Chodl! in! wildtype! cells! stunts! axon! growth,! while! overexpressing! Chodl! in! a! smn! morpholino! background! rescues! the!

! 87! axonal!phenotype.!These!data!indicate!Chodl!expression!must!be!tightly!regulated! with!abnormal!expression!in!either!direction!negatively!impacting!axon!growth.!!

Implications!of!miR'431!regulation!of!Chodl!in!SMA!

One!of!the!prominent!features!of!neurons!from!animal!models!of!SMA!is!the! abnormal!axon!morphology!due!to!impairments!in!axon!outgrowth!(Rossoll!et!al.,!

2003;!Jablonka!et!al.,!2007;!Ning!et!al.,!2010).!Importantly,!dysregulation!of!Chodl! mRNA!in!SMA!transcriptome!studies!in!lumbar!spinal!cords!and!motor!neurons!of!

SMA! model! mice! has! been! described! (Baumer! et! al.,! 2009;! Zhang! et! al.,! 2013a).!

Recently,! the! Talbot! lab! reported! validation! that! Chodl,! particularly! the! transcriptional!variant!1!(chodl'001),!is!decreased!in!vivo!in!the!motor!neurons!of! the!SmnΔ7!mouse!model!(Sleigh!et!al.,!2014).!Interestingly,!in!both!the!mouse!and! zebrafish!SMA!models,!both!loss!of!function!and!overexpression!of!Chodl!or!Chodl'

001! lead! to! axonal! outgrowth! phenotypes! and! negatively! affect! cell! viability.!

Therefore,!the!exact!titration!of!Chodl!expression!may!be!important!for!maintenance! of! healthy! motor! neuron! axons.! Subtle! miRNA! regulation! of! targets! represents! an! attractive!potential!regulator!for!Chodl!expression.!!

Here,! we! confirm! that! Chodl! mRNA! expression! is! decreased! in! an! in! vitro! motor!neuron!shSMN!knockdown!model.!We!identify!a!seven!nucleotide!binding!site! in! the! chodl! 3’UTR! as! a! direct! target! of! miRM431! regulation! and! verify! that! manipulation! of! miRM431! can! be! used! to! modulate! chodl! expression.! Additionally,! we! show! that! over! expression! of! miRM431! decreased! neurite! length! in! wildtype! primary!motor!neurons.!This!suggests!that!motor!neuron!specific!dysregulation!of!

! 88! chodl! expression! by! miRM431! overexpression! may! be! involved! in! the! SMA! axon! phenotype.! Thus,! Chodl! may! represent! an! important! target! for! investigation! of! modulation!my!miRM431!to!rescue!these!axon!deficits.!!

Results!

Chondrolectin!is!decreased!by!shSMN!in!primary!motor!neurons!

GSEA! and! coMexpression! module! analysis! identified! miRM431! as! a! potential! contributor! to! the! SMA! phenotype! by! aberrantly! affecting! its! target! mRNAs! in! primary! spinal! motor! neuron! cultures.! While! a! number! of! putative! targets! were! dysregulated! following! SMN! knockdown,! we! chose! Chodl! due! to! its! previous! associations! with! SMA,! and! target! prediction! by! two! different! algorithms.! In! the!

RNAseq!transcriptome!profile,!expression!of!chodl!was!decreased!by!2.29!fold!with!a! corrected! pMvalue! of! 0.003! and! validated! by! qRTMPCR! (Figure! 3.11).!

Immunofluorescent!staining!in!motor!neurons!revealed!perinuclear!localization!of!

CHODL! (Figure! 4.1A),! which! supports! a! report! in! nonMneuronal! cells! that! it! is! localized! to! the! ER! and! Golgi! (Weng! et! al.,! 2003a).! CoMstaining! with! transMgolgi! network! protein! 2! (TGN46)! did! not! specifically! confirm! coMlocalization;! therefore! coMstaining!with!other!markers!is!needed!to!systematically!validate!its!subcellular! localization.!We!used!qRTMPCR!validation!studies!in!SMN!knockdown!motor!neurons!

(Figure! 4.1B)! and! found! that! chodl! expression! decreased! by! 53%! compared! to! control!(Figure!4.1C).!We!used!primers!specific!to!chodl!variants!1!and!2!(chodl'001! and! chodl'002)! and! found! that! both! chodl! variants! were! decreased! stably! and! significantly,!but!chodl'002!decreased!by!a!lower!magnitude!(Figure!4.1DME).!!

! 89! !

A Chodl TGN46 Merge

B C D E 1.5 1.5 1.5 1.5 *** *** *** * 1.0 1.0 1.0 1.0

0.5 0.5 0.5 0.5 SMN/GAPDH Chodl / GAPDH / Chodl Chodl-001 / GAPDH / Chodl-001 Chodl-002 / GAPDH / Chodl-002 0.0 0.0 0.0 0.0

shCtl shCtl shCtl shCtl shSMN shSMN shSMN shSMN !

Figure!4.1!Chondrolectin!is!decreased!in!motor!neurons!lacking!SMN! A.! Immunofluorescent! staining! for! chodl! in! primary! spinal! motor! neurons! is! perinuclear.! TGN46! is! used! as! a! control! transMGolgi! marker! and! DAPI! for! nuclei.! B.! qRTMPCR! of! SMN! confirms! expression! in! knockdown! motor! neurons.! C.! qRTMPCR! of! Chodl!D.!Chodl'001!and!E.!Chodl'002!following!shSMN!mediated!knockdown!of!SMN!in! motor!neurons!N=!8!from!4!experiments.!*!=!pMvalue!

! 90! Decreased!Chodl!expression!is!specific!to!spinal!motor!neurons!

!We! previously! found! that! miRM431! is! upregulated! specifically! in! spinal!

motor!neurons!(Figure!3.10).!To!determine!whether!the!reduction!in!Chodl!was!a!

general!effect!of!SMN!loss!or!if!it!is!motor!neuron!specific,!Chodl!expression!after!

acute!shSMN!infection!in!primary!cortical!neurons!was!also!measured.!The!cultured!

cells!were!infected!with!the!same!shRNA!for!SMN!at!1DIV!and!RNA!collected!at!9DIV!

after!8!days!of!knockdown!(Figure!4.2A).!While!we!detected!expression!of!both!miRM

431! and! Chodl,! neither! total! chodl! nor! either! transcript! variant! was! decreased! in!

cortical! neurons! (Figure! 4.2BMD).! This! finding! indicates! that! the! loss! of! chodl!

expression!was!not!a!general!feature!of!SMN!knockdown!in!all!neuronal!subtypes.!

A B C D 1.5 1.5 1.5 1.5 *** 1.0 1.0 1.0 1.0

0.5 0.5 0.5 0.5 SMN / GAPDH Chodl / GAPDH / Chodl Chodl-001 / GAPDH / Chodl-001 Chodl-002 / GAPDH / Chodl-002 0.0 0.0 0.0 0.0

shCtl shCtl shCtl shCtl shSMN shSMN shSMN shSMN !

Figure!4.2!Chodl!expression!is!unchanged!in!cortical!neurons!lacking!SMN! A.!qRTMPCR!of!SMN!knockdown!in!cortical!neurons!shows!significant!downregulation! *! =! pMvalue!

! 91! !Modulation!of!miR'431!expression!affects!chodl!expression!

!Chodl! was! identified! as! a! putative! miRM431! target! by! both! the! TargetScan!

and!PITA!prediction!algorithms.!It!has!a!canonical!eight!nucleotide!binding!site!in!

the! 3’UTR! (Figure! 4.3A).! To! confirm! that! this! interaction! has! functional!

consequences! in! cells,! we! first! transfected! wildtype! primary! motor! neurons! with!

30ng! of! a! control! mimic! or! miRM431! mimic! for! 48! hours! and! measured! Chodl!

expression.!We!found!that!Chodl!is!significantly!decreased!in!response!to!miRM431!

Figure!4.3!Chondrolectin!is!a!target!of!miRN431! A.!Schematic!depiction!of!the!miRM431!binding!site!in!the!chondrolectin!3’UTR.!This! site! is! highly! evolutionarily! conserved! and! predicted! by! TargetScan! and! PITA! as! shown! by! the! scores.! B.! qRTMPCR! shows! transfection! of! the! miRM431! mimic! decreases!expression!of!Chodl,!C.!Chodl'001!and!D.!Chodl'002!*!=!P!

! 92! mimic! transfection! (Figure! 4.3B).! This! modulation! is! not! specific! to! the! transcript!

variants!as!they!share!the!3’UTR!binding!site,!therefore!both!Chodl'001!and!Chodl'

002!are!reduced!by!miRM431!expression!(Figure!4.3CMD).!Further,!we!transfected!the!

wildtype! motor! neurons! with! an! antiMmiR! to! inhibit! miRM431! expression.! In! the!

presence!of!antiMmiRM431,!Chodl!showed! a! nonMsignificant! (pMvalue!=!0.053)!trend!

towards!increased!expression!as!compared!to!control!(Figure! 4.3E);!this!could!be!

due!in!part!to!modest!variability!of!the!magnitude!of!the!effect.!

Renilla Luc Chodl 3’UTR miR-431 site

Ctl-UTR UGCAAGAC Mut-UTR UGCAAAGC

B miR-ctl 1.0 miR-431 ***

0.5 RLU (Renilla/Firefly) RLU 0.0

Chodl3'UTR mutChodl3'UTR !

Figure!4.4!Chodl!3'UTR!is!regulated!by!miRN431! A.!Schematic!of!control!and!mutated!luciferase!constructs!of!the!binding!site!in!the! chodl! 3’UTR.! B.! Relative! Renilla/firefly! luciferase! expression! following! miRM431! mimic! expression! in! chodl! 3’UTR! and! Chodl3’UTRmut! psicheckM2! transfected! Hek! cells!at!24!hours.!Wildtype!Chodl3’UTR!N=!7!from!3!experiments.!Chodl3’UTRmut! N=5!from!2!experiments.!Significance!was!determined!by!two!way!anova!***!=!pM value!

! 93! Chodl!is!a!direct!target!of!miR'431!

To! confirm! direct! targeting! of! chodl! via! the! predicted! binding! site! in! the!

3’UTR!we!cloned!the!fullMlength!3’UTR!sequence!into!a!PsiMcheck2!vector!(Promega)! with! a! Renilla! luciferase! reporter! to! measure! 3’UTR! activity! (Figure! 4.4A).! We! transfected!either!control!vector,!or!vector!with!the!Chodl!3’UTR!into!HEK!cells!with! either!a!control!mimic!or!miRM431!mimic!for!24!hours!and!measured!the!luciferase! activity.!Overexpression!of!the!miRM431!mimic!decreased!the!Chodl3’UTR!luciferase! activity!to!0.71!±!0.058!of!the!control.!This!reduction!was!abolished!by!mutating!two! nucleotides!in!the!seed!region!of!the!3’UTR!binding!site!(Figure!4.4B).!Together,!this! data! indicates! that! there! is! a! direct! interaction! between! miRM431! and! the! chodl3’UTR!at!this!site.!

! Phenotypic!consequences!of!miR'431!expression!changes!in!motor!neurons!

! To!understand!if!the!miRM431!expression!changes!and!Chodl!regulation!could! be! related! to! the! axon! outgrowth! phenotype! observed! in! SMA! models,! we! overexpressed!miRM431!mimic!in!primary!motor!neuron!cultures.!Wildtype!motor! neurons!were!transfected!at!1DIV!for!72!hours,!fixed!at!4DIV,!and!stained!with!tau! to!observe!neurite!outgrowth!and!morphology!(Figure!4.5A).!At!this!early!time!point! in! culture,! axons! have! not! been! fully! specified;! therefore,! we! measured! primary! neurites! longer! than! three! times! the! width! of! the! motor! neuron! cell! body.!

Measurement!of!neurite!outgrowth!with!NeuronJ!shows!significant!decrease!in!tau! positive!neurite!length!after!transfection!of!a!miRM431!mimic.!Previous!work!by!our! lab!showed!that!loss!of!SMN!by!transfection!of!a!siRNA!against!SMN!(siSMN)!inhibits! the!total!neurite!outgrowth!by!40%!and!the!length!of!the!longest!neurite!by!30%!!

! 94! A mimic-Ctl mimic-431

B Total Axon Length C Longest Axon Length

250 **** 250 ****

200 200

150 150

100 100

50 50 Percent Length Relative to Control to Relative Length Percent

0 Control to Relative Length Percent 0

mimic-Ctl mimic-Ctl mimic-431 mimic-431 !

Figure!4.5!Neurite!Length! A.!Two!representative!images!of!Tau!staining!of!neurite!outgrowth!in!low!density! cultured!wildtype!spinal!motor!neurons!transfected!with!30ng!mimicMCtl!or!mimicM 431! for! 72! hours! and! fixed! at! 4DIV.! Neurite! tracing! of! B.! the! total! neurite! and! C.! longest! primary! neurite! was! completed! manually! using! the! NeuronJ! plugin! for! ImageJ!on!TauMstained!neurons!with!a!minimum!cutoff!of!3X!the!length!of!the!cell! body! for! primary! neurites.! Graphs! show! dots! representing! individual! neurite! lengths,! columns! represent! median! neurite! length! with! the! full! range! of! values! indicated! by! black! bars.! (N! >! 50! per! condition! from! 2! coverslips! each! in! 2! experiments).! Significance! was! determined! by! Mann! Whitney! ****! =! pMvalue!

! 95! (Kye!et!al.,!2014).!Here!we!see!a!27%!decrease!in!both!total!neurite!length!and!in! longest!primary!neurite!length!as!compared!to!the!control!neurites.!(Figure!4.5CMD).!

The! current! preliminary! data! enforces! the! idea! that! exogenously! increasing! miRM

431! expression! can! result! in! the! SMAMlike! axonal! phenotype.! Additional! rescue! experiments! decreasing! miRM431! expression! in! the! SMN! knockdown! context! are! needed!to!fully!understand!the!impact!and!mechanism!of!this!interaction.!!

Discussion!

Our! previously! described! work! has! shown! that! differential! expression! of! miRM431! has! an! impact! on! target! mRNA! expression! (Chapter! 3).! We! identified! several!putative!miRM431!targets!by!integration!of!miRNA!and!mRNA!profiling!data! and! identified! that! neuronal! projection! genes! are! modulated! in! our! SMA! model.!

Additionally,! we! illustrated! the! motor! neuronMspecificity! of! these! miRM431! expression!changes.!Here,!we!show!that!miRM431!directly!regulates!its!target,!Chodl,! specifically! in! primary! motor! neurons! and! provide! evidence! that! this! interaction! could!contribute!to!the!axonal!phenotype!of!SMA.!

Expression!of!Chodl!in!spinal!motor!neurons!

In!the!ventral!spinal!cord,!Chodl!is!a!specific!marker!for!a!subMpopulation!of! large!fastMspiking!alpha!motor!neurons.!In!ALS!there!is!a!clear!correlation!between! large!fastMspiking!alpha!motor!neurons!and!cell!death!(Kanning!et!al.,!2010).!While! there! is! evidence! from! an! early! study! of! muscle! biopsies! of! SMA! patients! that! showed!loss!of!innervation!by!fast!alpha!motor!neurons!during!disease!progression!

! 96! (Dubowitz,! 1978),! the! subMtype! specific! motor! neuron! vulnerability! to! SMN! loss! remains! unclear.! Here! we! show! that! dysregulation! of! Chodl! is! specific! to! motor! neurons.!While!we!can!detect!total!Chodl!and!isoforms!Chodl'001!and!Chodl'002!in! cortical! neurons! there! is! no! change! in! their! expression! after! SMN! knockdown! therefore! the! changes! in! Chodl! do! not! appear! to! be! due! to! alternative! splicing! deficits.!

Interestingly,! in! dividing! cells,! a! knockdown! of! Chodl! with! a! specific! siRNA! decreased!cell!viability!(Masuda!et!al.,!2011).!The!mechanism!of!this!effect!on!cell! death!is!unknown;!however,!this!observation!indicates!that!Chodl!expression!could! directly!impact!neuronal!viability!in!the!motor!neurons.!We!do!not!know!the!exact! percentage! of! motor! neurons! in! our! cultures! that! are! Chodl! positive,! although! it! appears!to!be!the!majority.!Moreover,!we!specifically!chose!to!examine!expression! at!an!acute!stage!prior!to!cell!death.!Additional!immunostaining!and!imaging!studies! of!Chodl!and!other!motor!neuron!or!cell!death!markers!are!needed!to!provide!a!full! picture!of!differential!Chodl!expression!following!SMN!knockdown.!Due!to!low!total! expression! of! Chodl! we! were! unable! to! clearly! resolve! it! by! Western! blot,! but! confirmation! of! changes! in! protein! expression! is! integral! to! our! understanding! of!

Chodl!expression!in!these!motor!neurons.!

Dysregulated!Chodl!expression!in!SMA!models!

Decreased!expression!of!Chodl!was!reported!in!SMNΔ7!mouse!laser!capture! motor! neuron! RNA! (Zhang! et! al.,! 2013a),! embryonic! stem! cell! derived! motor! neurons! (Maeda! et! al.,! 2014),! and! spinal! cords! (Baumer! et! al.,! 2009).! While! an!

! 97! isoform!specific!difference!in!the!Chodl!expression!pattern!in!an!SMA!mouse!model!

(Sleigh! et! al.,! 2014)! has! been! described,! neither! the! RNAseq! nor! qRTMPCR! expression! detected! a! significant! difference! between! these! variants! in! our! model.!

Chodl'001! and! Chodl'002! expression! decreased! by! 45%! and! 35%! respectively,! indicating! no! significant! change! in! alternative! splicing! of! these! isoforms! in! the! knockdown!motor!neurons.!This!could!be!due!to!the!acute!nature!of!the!loss!of!SMN! in!this!model!or!that!we!looked!prior!to!late!stage!phenotypes.!The!Chodl!3’UTR!site! for! miRM431! is! not! specific! to! either! of! the! transcript! variants;! therefore,! miRNA! regulation! of! its! expression! would! not! be! isoformMspecific,! as! we! have! demonstrated.! Taken! together,! these! results! indicate! that! early! changes! in! Chodl! expression! are! mediated! independently! of! potential! late! stage! splicing! abnormalities.!

Consequences!of!miR'431!and!Chodl!interaction!on!motor!neuron!axons!

We!have!shown!that!miRM431!overexpression!significantly!decreases!motor! neuron! neurite! length! by! 27%,! a! magnitude! similar! to! that! of! SMN! loss.! We! also! provide!evidence!of!a!direct!interaction!between!miRM431!and!the!Chodl3’UTR.!The! potential!rescue!of!Chodl!expression!by!miRM431!modulation,!and!how!this!impacts! axon!morphology!and!neuronal!survival!remain!to!be!investigated.!To!accomplish! this,!we!will!inhibit!miRM431!expression!in!the!SMN!knockdown!motor!neurons!by! the! use! of! antimiRs! and! measure! Chodl! as! well! as! markers! of! cell! stress! and! apoptosis! including! CHOP! and! CC3.! Additionally,! we! will! examine! the! effect! on! neurite!length!by!transfecting!the!motor!neurons!with!a!siRNA!against!SMN!along!

! 98! with! the! antiMmiRM431! and! measure! axon! length.! The! Talbot! lab! has! shown! that! aberrant!overexpression!of!Chodl!is!also!detrimental!to!motor!neuron!survival.!We! believe!that!titration!of!the!expression!level!by!miRM431!represents!a!way!to!induce! moderate! changes! in! Chodl! expression! that! may! aid! in! promoting! cell! health! and! normal!neurite!morphology.!Further,!inhibition!of!miRM431!expression!would!have! an!impact!not!only!on!Chodl,!but!other!dysregulated!putative!targets!including!those! identified!in!Chapter!3.!Modulation!of!several!of!these!targets!by!a!single!molecule! could!have!a!profound!impact!on!motor!neuron!axons!and!cell!health!that!can!not!be! achieved!by!rescue!of!a!single!gene.!

! !

! 99! !

Chapter!5 !

Discussion!

! !

! 100! We! hypothesized! that! spinal! motor! neuron! specific! alterations! in! miRNA! expression! underlie! dysfunction! in! SMA! motor! neurons.! Therefore,! we! profiled! miRNA! and! mRNA! expression! in! these! cells.! Integration! of! these! profiles! enabled! identification!of!aberrantly!expressed!miRNAs!and!correlation!to!their!dysregulated! target! RNAs.! Construction! of! gene! coMexpression! modules! by! WGCNA! facilitated! refinement! of! selection! of! relevant! miRNA! interactions! with! putative! targets! and! provided! evidence! for! regulation! of! specific! biological! processes! and! pathways! related! to! SMA.! Finally,! we! describe! a! single! miRNA,! miRM431,! which! has! 2Mfold! increased! expression! after! SMN! knockdown,! and! begin! to! uncover! its! targets! and! how!its!dysregulation!influences!SMA!pathology!in!spinal!motor!neurons.!Together! these! studies! reveal! a! fundamental! contribution! of! nonMcoding! RNAs! to! motor! neuron! disease! and! provide! preliminary! evidence! for! the! role! of! miRM431! in! SMA! pathogenesis.!

! Impact!of!miRNA!expression!on!target!genes!in!SMA!

SMN!has!a!number!of!cellular!functions!related!to!RNA!processing,!perhaps! the!best!characterized!of!which!is!its!role!in!the!SMN!complex!regulating!alternative! splicing.! Several! studies! have! described! transcriptional! changes! in! different! SMA! models!(Baumer!et!al.,!2009;!Zhang!et!al.,!2013a;!Maeda!et!al.,!2014).!In!agreement! with! the! current! study,! these! studies! report! substantial! changes! in! mRNA! expression! independent! of! alternative! splicing.! It! is! unreasonable! to! assume! all! transcriptional!changes!identified!in!these!models!are!as!a!direct!result!of!aberrantly! expressed! miRNAs.! However,! we! believe! that! miRNAs! directly! contribute! to! dysregulation!of!a!number!of!mRNA!targets;!therefore,!in!Chapter!3!we!describe!the!

! 101! transcriptomeMwide!relationship!between!miRNA!and!mRNA!expression!profiles!in! our!in!vitro!model.!

The! addition! of! mRNA! profiling! information! is! a! valuable! tool! to! aid! in! identification!of!these!target!interactions!in!our!model.!This!approach!relies!heavily! on! the! understanding! that! miRNA! binding! to! a! target! 3’UTR! site! results! in! mRNA! deadenylation!and!decay,!and!therefore!decreased!overall!target!mRNA.!One!pitfall! to! this! approach! is! that! it! only! identifies! miRNA! targets! whose! mRNA! have! significantly! reduced! expression.! It! would! not! be! able! to! detect! miRNAs! whose! protein! translation! is! decreased! due! to! translational! silencing! decoupled! from! mRNA!decay.!Evidence!suggests!that!in!a!steady!state!system!a!70M90%!of!miRNA! regulation!results!in!decreased!mRNA!in!animals;!however,!the!exact!contribution!of! silencing! without! decay! is! unknown! (Selbach! et! al.,! 2008;! Meijer! et! al.,! 2013;!

Eichhorn!et!al.,!2014).!Additionally,!feedback!loops!have!been!discovered!between! individual!miRNAs!and!their!targets!that!would!be!lost!in!the!global!transcriptome! profile.! Despite! these! caveats,! we! believe! that! our! method! is! the! most! straightforward! way! to! screen! for! important! dysregulated! miRNAs! and! analyze! their!downstream!effect!on!the!SMA!phenotype!in!the!primary!spinal!motor!neuron! model.!!

In! the! current! study,! the! combination! of! the! miRNA! and! mRNA! expression! profiles! with! computational! prediction! of! miRNA! targets! was! utilized! to! discover! potential! interactions! and! further! infer! functional! consequences! of! these! interactions.! Relevant! miRNA! binding! sites! were! predicted! using! two! different! algorithms!TargetScan!and!PITA.!While!target!prediction!algorithms!are!useful!for!

! 102! identification!of!putative!binding!sites,!direct!target!validation!is!required!to!confirm! direct! interactions! between! a! miRNA! and! the! target! mRNA! site.! Therefore,! we! combined!the!miRNA,!mRNA!and!target!data!to!identify!the!miRNAs!with!the!most! significant!impacts!on!its!target!genes.!Hypergeometric!probability!analysis!of!the! subset! of! differentially! expressed! genes! showed! enrichment! of! several! miRNAs! whose! targets! were! modulated! in! the! opposite! direction! that! did! not! reach! statistical!significance.!GSEA!of!all!genes!detected!by!RNAMSeq!above!the!threshold! was!able!to!refine!the!list!of!17!differentially!expressed!miRNAs!to!eight!that!had! target!enrichment!in!differentially!expressed!genes.!

One! mechanism! by! which! miRNAs! are! reported! to! act! is! by! fineMtuning! expression!of!a!number!of!genes!in!the!same!biological!network!or!pathway!(Bartel! and! Chen,! 2004).! In! our! study,! generation! of! coMexpression! modules! by! WGCNA!

(Zhang!and!Horvath,!2005)!provided!additional!insight!into!the!relationship!of!the! miRNAs! and! mRNA! target! gene! networks.! This! model! allowed! us! to! generate! coM expressed! networks! from! our! RNAMSeq! data! independent! of! differential! gene! expression.!Correlation!of!the!genes!in!these!modules!with!putative!miRNA!targets! identified! significant! interactions! of! specific! modules! with! individual! miRNAs.!

Interestingly,! we! saw! striking! enrichment! in! miRM431! putative! targets! in! four! modules! with! overall! downregulation! of! expression.! Therefore,! we! selected! this! single!miRNA!for!additional!analyses!of!target!expression!and!biological!significance! in!the!SMN!knockdown!model.!These!studies!show!the!general!utility!of!combining! different! types! of! profiling! data! and! analysis! tools.! This! enabled! us! to! simultaneously! identify! broad! miRNA! dysregulation! in! SMN! deficient! motor!

! 103! neurons! while! also! selecting! an! individual! miRNA,! miRM431,! and! several! specific! putative!targets!for!downstream!analysis.!

Importance!of!motor!neuron!specificity!

miRNAs! are! expressed! differently! in! distinct! cell! types,! which! leads! to! differential! target! regulation! in! these! cells.! Additionally,! cellular! context! is! important! and! can! affect! miRNA! target! interactions! in! several! ways! including! differential! availability! of! 3’UTR! sites,! altered! expression! of! RNA! binding! proteins! aiding!or!inhibiting!miRNA!repression,!and!alternative!polyadenylation!(Nam!et!al.,!

2014).!There!are!a!number!of!miRNAs!that!are!highly!expressed!in!neurons!and!in! the! CNS! including! miRM124! and! miRM9! that! have! been! implicated! in! a! range! of! neuronal! processes.! miRM431! is! one! such! CNSMspecific! miRNA.! While! its! neuronal! subMtype! specific! expression! pattern! is! unknown,! it! is! detected! with! moderate! expression!levels!in!primary!motor!neuron!cultures.!Here!we!provide!evidence!that! miRM431! plays! a! role! in! wild! type! motor! neuron! morphology! and! neurite! length.!

Interestingly,!we!have!identified!a!miRM431!target!whose!expression!is!limited!to!a! single!motor!neuron!cell!type!in!the!spinal!cord.!Therefore,!in!the!spinal!cord!the! interaction! between! the! two! is! limited! to! fast! spiking! motor! neurons,! which! are! vulnerable!to!cell!death!in!SMA.!

While! both! chodl! and! miRM431! are! expressed! in! cortical! neurons,! dysregulation!of!their!expression!is!confined!motor!neurons!in!the!SMN!knockdown! model.!We!show!that!miRM431!is!increased!in!iPSCMderived!patient!motor!neurons,! which!gives!us!confidence!that!this!miRNA!is!dysregulated!and!may!be!involved!in!

! 104! SMA! pathogenesis! in! human! patients.! Further,! Chodl! dysregulation! has! been! observed!in!vivo!in!the!SMNΔ7!mouse!(Zhang!et!al.,!2013a),!suggesting!this!maybe! common!to!several!SMA!models.!!

The!current!study!was!limited!to!an!in!vitro!model!of!SMA.!The!purpose!of! this! approach! was! to! isolate! motor! neuron! specific! expression! changes;! however,! these!changes!should!be!verified!in!vivo.!Because!we!are!interested!in!only!a!small! population! of! motor! neurons! in! the! spinal! cord,! we! need! to! confirm! in! vivo! coM expression!of!miRM431!and!Chodl!in!the!same!cells!by!in!situ!hybridization.!Further,! in!vivo!rescue!experiments!by!mirM431!inhibition!by!injection!of!a!sponge!construct! could! be! performed! to! ask! whether! miRM431! suppression! could! improve! the! SMA! phenotype.!

! Functional!Consequences!of!miR'431!and!Chodl!Interaction!

Together,!data!from!our!lab!and!the!Talbot!lab!suggest!miRM431!and!Chodl! are!involved!in!deficits!of!motor!neuron!neurite!length.!Currently,!our!study!is!not! able!to!address!the!functional!consequences!of!this!interaction.!A!critical!experiment! that! would! clarify! this! is! the! effect! of! inhibition! of! miRM431! in! SMN! knockdown! motor! neurons.! In! the! current! study,! we! show! that! inhibition! of! miRM431! by! an! antimiR! increases! chodl! expression! in! wildtype! motor! neurons.! We! anticipate! a! compensatory! increase! chodl! after! miRM431! inhibition! in! the! SMN! knockdown! model.! Our! data! suggests! a! direct! role! of! miRM431! in! motor! neuron! morphology;! therefore,!we!hypothesize!that!neurite!length!phenotype!would!be!rescued!by!miRM

! 105! 431! antimiR.! Together! these! experiments! would! provide! evidence! that! miRM431! impacts!the!SMA!phenotype!directly!via!its!regulation!of!Chodl.!!

! How!does!SMN!loss!alter!miRNA!expression?!

Two! important! questions! that! remain! to! be! addressed! are! what! is! the! biological!mechanism!driving!miRNA!expression!changes!after!loss!of!SMN!and!are! the!miRNA!changes!compensatory!or!causal?!While!the!answer!to!these!question!are! largely!outside!of!the!scope!of!this!thesis,!there!are!some!insights!to!be!gained!into! how!these!changes!are!taking!place.!While!a!number!of!proteins!involved!in!miRNA! biogenesis! including! FMRP! (Piazzon! et! al.,! 2008),! KSRP! (Tadesse! et! al.,! 2008),!

GEMIN3!and!GEMIN4!(Murashov!et!al.,!2007)!interact!with!SMN,!we!do!not!detect! an!overall!change!in!the!abundance!of!mature!miRNAs.!Our!screen!uncovered!both! upM! and! downMregulated! miRNAs! indicating! there! is! not! a! global! change! in! microRNA!biogenesis!or!decay.!This!suggests!that!only!a!select!subset!of!miRNAs!is! being!dysregulated!by!SMN!knockdown.!In!the!case!of!miRM431,!expression!of!the! priMmiRM431! is! upregulated! by! 45%! in! SMN! knockdown! motor! neurons,! which! is! indicative! of! differential! transcription.! Interestingly,! in! our! previous! publication!

(Kye!et!al.,!2014)!we!demonstrated!that!transcription!of!priMmiRM183!is!unchanged.!

Therefore,!multiple!mechanisms!appear!to!mediate!aberrant!miRNA!expression!in!

SMN!deficient!cells.!We!have!not!broadly!measured!primary!transcripts!of!the!whole! panel!of!significantly!regulated!miRNAs!in!either!of!our!studies,!but!this!would!shed! light! on! the! relative! contribution! of! transcription! versus! biogenesis! or! stability! to! miRNA!dysregulation.!!

! 106! Many!miRNAs!are!relatively!stable!RNAs!with!halfMlives!lasting!up!to!several! days.!Their!turnover!is!not!well!understood,!but!is!believed!to!be!regulated!in!part! by! exonuclease! cleavage! by! XRN1! and! XRN2! (Chatterjee! and! Grosshans,! 2009).!

Preliminary! unpublished! work! on! microRNA! turnover! in! our! lab! has! shown! that! miRNA! decay! of! specific! miRNAs! maybe! dysregulated! by! SMN! knockdown.! In! particular! miRM183! shows! increased! stability! after! 4! and! 8Mhour! treatment! with! a!

RNAploymerase! II/III! inhibitor,! actinomycin! D,! in! SMN! knockdown! neurons! as! compared!to!controls.!Impaired!miRNA!decay!leads!to!longer!mature!miRNA!halfM life! and! higher! stability! and! increased! miRNA! expression.! In! contrast,! a! control! miRNA!was!not!more!stable!after!8!hours!indicating!that!the!regulation!of!turnover! is! specific! to! miRM183! or! a! subset! of! dysregulated! miRNAs! in! this! model.! Thus,! a! decrease!in!miRNA!decay!may!contribute!to!the!2Mfold!increase!in!mature!miRM431! expression!even!though!the!primary!transcript!only!increases!by!1.4!fold!in!the!SMN! knockdown!model.!The!potential!mechanism!that!would!mediate!this!specificity!is! unknown,! but! could! be! investigated! by! comparison! of! XRNMmediated! turnover! of! miRM431!in!the!motor!neurons!versus!the!cortical!neurons.!

! miRNAs!as!therapeutic!targets!in!motor!neuron!disease!

! The! current! therapeutic! goals! of! SMN! treatment! trials! primarily! rely! upon! increasing! SMN! expression! either! by! modulation! of! endogenous! SMN2! splicing! or! exogenous! expression! of! SMN! from! viral! vectors! as! discussed! in! Chapter! 1.! While! these! studies! have! shown! promise! in! clinical! trials,! they! have! not! yet! yielded! a! successful!SMA!therapeutic.!Confounds!including!the!timing,!cost,!and!accessibility!

! 107! of!the!motor!neuron!population!to!treatment!negatively!impact!efficacy.!The!use!of! miRNA! modulation! is! emerging! as! a! therapeutic! strategy! in! cancer! and! cardiovascular!disease!(Schulte!and!Zeller,!2015;!Tong!et!al.,!2015).!Previously!we! showed! that! use! of! a! miRNA! sponge! to! inhibit! miRM183! expression! was! able! to! partially! rescue! the! SMNΔ7! mouse! model! of! SMA! (Kye! et! al.,! 2014).! Our! current! study! provides! evidence! that! miRNA! regulation! could! be! considered! for! development!as!a!therapeutic!in!SMA,!perhaps!in!combination!with!traditional!SMN! modulation.!

! !

! 108! ! ! ! ! ! ! Chapter!6 !

References!

! !

! 109! ! Absalon!S,!Kochanek!DM,!Raghavan!V,!Krichevsky!AM!(2013)!MiRM26b,!upregulated! in!Alzheimer's!disease,!activates!cell!cycle!entry,!tauMphosphorylation,!and! apoptosis!in!postmitotic!neurons.!J!Neurosci!33:14645M14659.!

Ackermann!B,!Krober!S,!TorresMBenito!L,!Borgmann!A,!Peters!M,!Hosseini!Barkooie! SM,!Tejero!R,!Jakubik!M,!Schreml!J,!Milbradt!J,!Wunderlich!TF,!Riessland!M,! Tabares!L,!Wirth!B!(2013)!Plastin!3!ameliorates!spinal!muscular!atrophy!via! delayed!axon!pruning!and!improves!neuromuscular!junction!functionality.! Hum!Mol!Genet!22:1328M1347.!

Akten!B,!Kye!MJ,!Hao!le!T,!Wertz!MH,!Singh!S,!Nie!D,!Huang!J,!Merianda!TT,!Twiss!JL,! Beattie!CE,!Steen!JA,!Sahin!M!(2011)!Interaction!of!survival!of!motor!neuron! (SMN)!and!HuD!proteins!with!mRNA!cpg15!rescues!motor!neuron!axonal! deficits.!Proc!Natl!Acad!Sci!U!S!A!108:10337M10342.!

AmeyarMZazoua!M,!Rachez!C,!Souidi!M,!Robin!P,!Fritsch!L,!Young!R,!Morozova!N,! Fenouil!R,!Descostes!N,!Andrau!JC,!Mathieu!J,!Hamiche!A,!AitMSiMAli!S,! Muchardt!C,!Batsche!E,!HarelMBellan!A!(2012)!Argonaute!proteins!couple! chromatin!silencing!to!alternative!splicing.!Nat!Struct!Mol!Biol!19:998M1004.!

Andersen!CL,!Jensen!JL,!Orntoft!TF!(2004)!Normalization!of!realMtime!quantitative! reverse!transcriptionMPCR!data:!a!modelMbased!variance!estimation!approach! to!identify!genes!suited!for!normalization,!applied!to!bladder!and!colon! cancer!data!sets.!Cancer!Res!64:5245M5250.!

Andreassi!C,!Angelozzi!C,!Tiziano!FD,!Vitali!T,!De!Vincenzi!E,!Boninsegna!A,!Villanova! M,!Bertini!E,!Pini!A,!Neri!G,!Brahe!C!(2004)!Phenylbutyrate!increases!SMN! expression!in!vitro:!relevance!for!treatment!of!spinal!muscular!atrophy.!Eur!J! Hum!Genet!12:59M65.!

Asli!NS,!Kessel!M!(2010)!Spatiotemporally!restricted!regulation!of!generic!motor! neuron!programs!by!miRM196Mmediated!repression!of!Hoxb8.!Dev!Biol! 344:857M868.!

Avila!AM,!Burnett!BG,!Taye!AA,!Gabanella!F,!Knight!MA,!Hartenstein!P,!Cizman!Z,!Di! Prospero!NA,!Pellizzoni!L,!Fischbeck!KH,!Sumner!CJ!(2007)!Trichostatin!A! increases!SMN!expression!and!survival!in!a!mouse!model!of!spinal!muscular! atrophy.!J!Clin!Invest!117:659M671.!

AzumaMMukai!A,!Oguri!H,!Mituyama!T,!Qian!ZR,!Asai!K,!Siomi!H,!Siomi!MC!(2008)! Characterization!of!endogenous!human!Argonautes!and!their!miRNA! partners!in!RNA!silencing.!Proc!Natl!Acad!Sci!U!S!A!105:7964M7969.!

Bartel!DP,!Chen!CZ!(2004)!Micromanagers!of!gene!expression:!the!potentially! widespread!influence!of!metazoan!microRNAs.!Nat!Rev!Genet!5:396M400.!

! 110! Baumer!D,!Lee!S,!Nicholson!G,!Davies!JL,!Parkinson!NJ,!Murray!LM,!Gillingwater!TH,! Ansorge!O,!Davies!KE,!Talbot!K!(2009)!Alternative!splicing!events!are!a!late! feature!of!pathology!in!a!mouse!model!of!spinal!muscular!atrophy.!PLoS! Genet!5:e1000773.!

Bebee!TW,!Dominguez!CE,!Chandler!DS!(2012)!Mouse!models!of!SMA:!tools!for! disease!characterization!and!therapeutic!development.!Hum!Genet! 131:1277M1293.!

Benetatos!L,!Hatzimichael!E,!Londin!E,!Vartholomatos!G,!Loher!P,!Rigoutsos!I,! Briasoulis!E!(2013)!The!microRNAs!within!the!DLK1MDIO3!genomic!region:! involvement!in!disease!pathogenesis.!Cell!Mol!Life!Sci!70:795M814.!

Berezikov!E,!Chung!WJ,!Willis!J,!Cuppen!E,!Lai!EC!(2007)!Mammalian!mirtron!genes.! Mol!Cell!28:328M336.!

Bernstein!E,!Caudy!AA,!Hammond!SM,!Hannon!GJ!(2001)!Role!for!a!bidentate! ribonuclease!in!the!initiation!step!of!RNA!interference.!Nature!409:363M366.!

Bordet!T,!Buisson!B,!Michaud!M,!Drouot!C,!Galea!P,!Delaage!P,!Akentieva!NP,!Evers! AS,!Covey!DF,!Ostuni!MA,!Lacapere!JJ,!Massaad!C,!Schumacher!M,!Steidl!EM,! Maux!D,!Delaage!M,!Henderson!CE,!Pruss!RM!(2007)!Identification!and! characterization!of!cholestM4MenM3Mone,!oxime!(TRO19622),!a!novel!drug! candidate!for!amyotrophic!lateral!sclerosis.!J!Pharmacol!Exp!Ther!322:709M 720.!

Bowerman!M,!Shafey!D,!Kothary!R!(2007)!Smn!depletion!alters!profilin!II!expression! and!leads!to!upregulation!of!the!RhoA/ROCK!pathway!and!defects!in! neuronal!integrity.!J!Mol!Neurosci!32:120M131.!

Bowerman!M,!Anderson!CL,!Beauvais!A,!Boyl!PP,!Witke!W,!Kothary!R!(2009)!SMN,! profilin!IIa!and!plastin!3:!a!link!between!the!deregulation!of!actin!dynamics! and!SMA!pathogenesis.!Mol!Cell!Neurosci!42:66M74.!

Bowerman!M,!Michalski!JP,!Beauvais!A,!Murray!LM,!DeRepentigny!Y,!Kothary!R! (2014)!Defects!in!pancreatic!development!and!glucose!metabolism!in!SMNM depleted!mice!independent!of!canonical!spinal!muscular!atrophy! neuromuscular!pathology.!Hum!Mol!Genet!23:3432M3444.!

Braun!JE,!Huntzinger!E,!Fauser!M,!Izaurralde!E!(2011)!GW182!proteins!directly! recruit!cytoplasmic!deadenylase!complexes!to!miRNA!targets.!Mol!Cell! 44:120M133.!

Brichta!L,!Hofmann!Y,!Hahnen!E,!Siebzehnrubl!FA,!Raschke!H,!Blumcke!I,!Eyupoglu! IY,!Wirth!B!(2003)!Valproic!acid!increases!the!SMN2!protein!level:!a!wellM known!drug!as!a!potential!therapy!for!spinal!muscular!atrophy.!Hum!Mol! Genet!12:2481M2489.!

! 111! Butchbach!ME,!Singh!J,!Thorsteinsdottir!M,!Saieva!L,!Slominski!E,!Thurmond!J,! Andresson!T,!Zhang!J,!Edwards!JD,!Simard!LR,!Pellizzoni!L,!Jarecki!J,!Burghes! AH,!Gurney!ME!(2010)!Effects!of!2,4Mdiaminoquinazoline!derivatives!on!SMN! expression!and!phenotype!in!a!mouse!model!for!spinal!muscular!atrophy.! Hum!Mol!Genet!19:454M467.!

Butovsky!O,!Siddiqui!S,!Gabriely!G,!Lanser!AJ,!Dake!B,!Murugaiyan!G,!Doykan!CE,!Wu! PM,!Gali!RR,!Iyer!LK,!Lawson!R,!Berry!J,!Krichevsky!AM,!Cudkowicz!ME,! Weiner!HL!(2012)!Modulating!inflammatory!monocytes!with!a!unique! microRNA!gene!signature!ameliorates!murine!ALS.!J!Clin!Invest!122:3063M 3087.!

Butovsky!O,!Jedrychowski!MP,!Cialic!R,!Krasemann!S,!Murugaiyan!G,!Fanek!Z,!Greco! DJ,!Wu!PM,!Doykan!CE,!Kiner!O,!Lawson!RJ,!Frosch!MP,!Pochet!N,!Fatimy!RE,! Krichevsky!AM,!Gygi!SP,!Lassmann!H,!Berry!J,!Cudkowicz!ME,!Weiner!HL! (2015)!Targeting!miRM155!restores!abnormal!microglia!and!attenuates! disease!in!SOD1!mice.!Ann!Neurol!77:75M99.!

Cartegni!L,!Krainer!AR!(2002)!Disruption!of!an!SF2/ASFMdependent!exonic!splicing! enhancer!in!SMN2!causes!spinal!muscular!atrophy!in!the!absence!of!SMN1.! Nat!Genet!30:377M384.!

Chakravarthy!S,!Sternberg!SH,!Kellenberger!CA,!Doudna!JA!(2010)!SubstrateMspecific! kinetics!of!DicerMcatalyzed!RNA!processing.!J!Mol!Biol!404:392M402.!

Chang!HC,!Dimlich!DN,!Yokokura!T,!Mukherjee!A,!Kankel!MW,!Sen!A,!Sridhar!V,! Fulga!TA,!Hart!AC,!Van!Vactor!D,!ArtavanisMTsakonas!S!(2008)!Modeling! spinal!muscular!atrophy!in!Drosophila.!PLoS!One!3:e3209.!

Chang!T,!Zheng!W,!Tsark!W,!Bates!S,!Huang!H,!Lin!RJ,!Yee!JK!(2011)!Brief!report:! phenotypic!rescue!of!induced!pluripotent!stem!cellMderived!motoneurons!of!a! spinal!muscular!atrophy!patient.!Stem!Cells!29:2090M2093.!

Chatterjee!S,!Grosshans!H!(2009)!Active!turnover!modulates!mature!microRNA! activity!in!Caenorhabditis!elegans.!Nature!461:546M549.!

Cheloufi!S,!Dos!Santos!CO,!Chong!MM,!Hannon!GJ!(2010)!A!dicerMindependent! miRNA!biogenesis!pathway!that!requires!Ago!catalysis.!Nature!465:584M589.!

Chen!JA,!Wichterle!H!(2012)!Apoptosis!of!limb!innervating!motor!neurons!and! erosion!of!motor!pool!identity!upon!lineage!specific!dicer!inactivation.!Front! Neurosci!6:69.!

Cifuentes!D,!Xue!H,!Taylor!DW,!Patnode!H,!Mishima!Y,!Cheloufi!S,!Ma!E,!Mane!S,! Hannon!GJ,!Lawson!ND,!Wolfe!SA,!Giraldez!AJ!(2010)!A!novel!miRNA! processing!pathway!independent!of!Dicer!requires!Argonaute2!catalytic! activity.!Science!328:1694M1698.!

! 112! Clarke!C,!Henry!M,!Doolan!P,!Kelly!S,!Aherne!S,!Sanchez!N,!Kelly!P,!Kinsella!P,!Breen! L,!Madden!SF,!Zhang!L,!Leonard!M,!Clynes!M,!Meleady!P,!Barron!N!(2012)! Integrated!miRNA,!mRNA!and!protein!expression!analysis!reveals!the!role!of! postMtranscriptional!regulation!in!controlling!CHO!cell!growth!rate.!BMC! Genomics!13:656.!

Custer!SK,!Todd!AG,!Singh!NN,!Androphy!EJ!(2013)!Dilysine!motifs!in!exon!2b!of! SMN!protein!mediate!binding!to!the!COPI!vesicle!protein!alphaMCOP!and! neurite!outgrowth!in!a!cell!culture!model!of!spinal!muscular!atrophy.!Hum! Mol!Genet!22:4043M4052.!

De!Felice!B,!Annunziata!A,!Fiorentino!G,!Borra!M,!Biffali!E,!Coppola!C,!Cotrufo!R,! Brettschneider!J,!Giordana!ML,!Dalmay!T,!Wheeler!G,!D'Alessandro!R!(2014)! miRM338M3p!is!overMexpressed!in!blood,!CFS,!serum!and!spinal!cord!from! sporadic!amyotrophic!lateral!sclerosis!patients.!Neurogenetics!15:243M253.!

Denli!AM,!Tops!BB,!Plasterk!RH,!Ketting!RF,!Hannon!GJ!(2004)!Processing!of! primary!microRNAs!by!the!Microprocessor!complex.!Nature!432:231M235.!

Dimitriadi!M,!Sleigh!JN,!Walker!A,!Chang!HC,!Sen!A,!Kalloo!G,!Harris!J,!Barsby!T,! Walsh!MB,!Satterlee!JS,!Li!C,!Van!Vactor!D,!ArtavanisMTsakonas!S,!Hart!AC! (2010)!Conserved!genes!act!as!modifiers!of!invertebrate!SMN!loss!of!function! defects.!PLoS!Genet!6:e1001172.!

Dominguez!E,!Marais!T,!Chatauret!N,!BenkhelifaMZiyyat!S,!Duque!S,!Ravassard!P,! Carcenac!R,!Astord!S,!Pereira!de!Moura!A,!Voit!T,!Barkats!M!(2011)! Intravenous!scAAV9!delivery!of!a!codonMoptimized!SMN1!sequence!rescues! SMA!mice.!Hum!Mol!Genet!20:681M693.!

Dubowitz!V!(1978)!Muscle!disorders!in!childhood.!Major!Probl!Clin!Pediatr!16:iiiM xiii,!1M282.!

Duque!S,!Joussemet!B,!Riviere!C,!Marais!T,!Dubreil!L,!Douar!AM,!Fyfe!J,!Moullier!P,! Colle!MA,!Barkats!M!(2009)!Intravenous!administration!of!selfM complementary!AAV9!enables!transgene!delivery!to!adult!motor!neurons.! Mol!Ther!17:1187M1196.!

Dury!AY,!El!Fatimy!R,!Tremblay!S,!Rose!TM,!Cote!J,!De!Koninck!P,!Khandjian!EW! (2013)!Nuclear!Fragile!X!Mental!Retardation!Protein!is!localized!to!Cajal! bodies.!PLoS!Genet!9:e1003890.!

Ebert!AD,!Yu!J,!Rose!FF,!Jr.,!Mattis!VB,!Lorson!CL,!Thomson!JA,!Svendsen!CN!(2009)! Induced!pluripotent!stem!cells!from!a!spinal!muscular!atrophy!patient.! Nature!457:277M280.!

Ebert!AD,!Shelley!BC,!Hurley!AM,!Onorati!M,!Castiglioni!V,!Patitucci!TN,!Svendsen!SP,! Mattis!VB,!McGivern!JV,!Schwab!AJ,!Sareen!D,!Kim!HW,!Cattaneo!E,!Svendsen!

! 113! CN!(2013)!EZ!spheres:!a!stable!and!expandable!culture!system!for!the! generation!of!preMrosette!multipotent!stem!cells!from!human!ESCs!and!iPSCs.! Stem!Cell!Res!10:417M427.!

Eichhorn!SW,!Guo!H,!McGeary!SE,!RodriguezMMias!RA,!Shin!C,!Baek!D,!Hsu!SH,! Ghoshal!K,!Villen!J,!Bartel!DP!(2014)!mRNA!destabilization!is!the!dominant! effect!of!mammalian!microRNAs!by!the!time!substantial!repression!ensues.! Mol!Cell!56:104M115.!

Enjin!A,!Rabe!N,!Nakanishi!ST,!Vallstedt!A,!Gezelius!H,!Memic!F,!Lind!M,!Hjalt!T,! Tourtellotte!WG,!Bruder!C,!Eichele!G,!Whelan!PJ,!Kullander!K!(2010)! Identification!of!novel!spinal!cholinergic!genetic!subtypes!disclose!Chodl!and! Pitx2!as!markers!for!fast!motor!neurons!and!partition!cells.!J!Comp!Neurol! 518:2284M2304.!

Eulalio!A,!Tritschler!F,!Izaurralde!E!(2009)!The!GW182!protein!family!in!animal! cells:!new!insights!into!domains!required!for!miRNAMmediated!gene! silencing.!RNA!15:1433M1442.!

Fabian!MR,!Sonenberg!N,!Filipowicz!W!(2010)!Regulation!of!mRNA!translation!and! stability!by!microRNAs.!Annu!Rev!Biochem!79:351M379.!

Fallini!C,!Zhang!H,!Su!Y,!Silani!V,!Singer!RH,!Rossoll!W,!Bassell!GJ!(2011)!The!survival! of!motor!neuron!(SMN)!protein!interacts!with!the!mRNAMbinding!protein! HuD!and!regulates!localization!of!poly(A)!mRNA!in!primary!motor!neuron! axons.!J!Neurosci!31:3914M3925.!

Fallini!C,!Rouanet!JP,!DonlinMAsp!PG,!Guo!P,!Zhang!H,!Singer!RH,!Rossoll!W,!Bassell!GJ! (2014)!Dynamics!of!survival!of!motor!neuron!(SMN)!protein!interaction!with! the!mRNAMbinding!protein!IMP1!facilitates!its!trafficking!into!motor!neuron! axons.!Dev!Neurobiol!74:319M332.!

Feng!Z,!Gao!F!(2012)!Stem!cell!challenges!in!the!treatment!of!neurodegenerative! disease.!CNS!Neurosci!Ther!18:142M148.!

Foust!KD,!Wang!X,!McGovern!VL,!Braun!L,!Bevan!AK,!Haidet!AM,!Le!TT,!Morales!PR,! Rich!MM,!Burghes!AH,!Kaspar!BK!(2010)!Rescue!of!the!spinal!muscular! atrophy!phenotype!in!a!mouse!model!by!early!postnatal!delivery!of!SMN.!Nat! Biotechnol!28:271M274.!

Friedman!RC,!Farh!KK,!Burge!CB,!Bartel!DP!(2009)!Most!mammalian!mRNAs!are! conserved!targets!of!microRNAs.!Genome!Res!19:92M105.!

Garbes!L,!Riessland!M,!Holker!I,!Heller!R,!Hauke!J,!Trankle!C,!Coras!R,!Blumcke!I,! Hahnen!E,!Wirth!B!(2009)!LBH589!induces!up!to!10Mfold!SMN!protein!levels! by!several!independent!mechanisms!and!is!effective!even!in!cells!from!SMA! patients!nonMresponsive!to!valproate.!Hum!Mol!Genet!18:3645M3658.!

! 114! Gerbino!V,!Carri!MT,!Cozzolino!M,!Achsel!T!(2013)!Mislocalised!FUS!mutants!stall! spliceosomal!snRNPs!in!the!cytoplasm.!Neurobiol!Dis!55:120M128.!

Gibbings!D,!Mostowy!S,!Jay!F,!Schwab!Y,!Cossart!P,!Voinnet!O!(2012)!Selective! autophagy!degrades!DICER!and!AGO2!and!regulates!miRNA!activity.!Nat!Cell! Biol!14:1314M1321.!

Gkogkas!C,!Middleton!S,!Kremer!AM,!Wardrope!C,!Hannah!M,!Gillingwater!TH,! Skehel!P!(2008)!VAPB!interacts!with!and!modulates!the!activity!of!ATF6.! Hum!Mol!Genet!17:1517M1526.!

Gogliotti!RG,!Cardona!H,!Singh!J,!Bail!S,!Emery!C,!Kuntz!N,!Jorgensen!M,!Durens!M,! Xia!B,!Barlow!C,!Heier!CR,!Plasterer!HL,!Jacques!V,!Kiledjian!M,!Jarecki!J,! Rusche!J,!DiDonato!CJ!(2013)!The!DcpS!inhibitor!RG3039!improves!survival,! function!and!motor!unit!pathologies!in!two!SMA!mouse!models.!Hum!Mol! Genet!22:4084M4101.!

Grasso!M,!Piscopo!P,!Confaloni!A,!Denti!MA!(2014)!Circulating!miRNAs!as! biomarkers!for!neurodegenerative!disorders.!Molecules!19:6891M6910.!

Gregory!RI,!Yan!KP,!Amuthan!G,!Chendrimada!T,!Doratotaj!B,!Cooch!N,!Shiekhattar!R! (2004)!The!Microprocessor!complex!mediates!the!genesis!of!microRNAs.! Nature!432:235M240.!

Groen!EJ,!Fumoto!K,!Blokhuis!AM,!EngelenMLee!J,!Zhou!Y,!van!den!Heuvel!DM,! Koppers!M,!van!Diggelen!F,!van!Heest!J,!Demmers!JA,!Kirby!J,!Shaw!PJ,! Aronica!E,!Spliet!WG,!Veldink!JH,!van!den!Berg!LH,!Pasterkamp!RJ!(2013)! ALSMassociated!mutations!in!FUS!disrupt!the!axonal!distribution!and!function! of!SMN.!Hum!Mol!Genet!22:3690M3704.!

Gubitz!AK,!Feng!W,!Dreyfuss!G!(2004)!The!SMN!complex.!Exp!Cell!Res!296:51M56.!

Hafner!M,!Landthaler!M,!Burger!L,!Khorshid!M,!Hausser!J,!Berninger!P,!Rothballer!A,! Ascano!M,!Jr.,!Jungkamp!AC,!Munschauer!M,!Ulrich!A,!Wardle!GS,!Dewell!S,! Zavolan!M,!Tuschl!T!(2010)!TranscriptomeMwide!identification!of!RNAM binding!protein!and!microRNA!target!sites!by!PARMCLIP.!Cell!141:129M141.!

Hahnen!E,!Eyupoglu!IY,!Brichta!L,!Haastert!K,!Trankle!C,!Siebzehnrubl!FA,!Riessland! M,!Holker!I,!Claus!P,!Romstock!J,!Buslei!R,!Wirth!B,!Blumcke!I!(2006)!In!vitro! and!ex!vivo!evaluation!of!secondMgeneration!histone!deacetylase!inhibitors! for!the!treatment!of!spinal!muscular!atrophy.!J!Neurochem!98:193M202.!

Hao!le!T,!Burghes!AH,!Beattie!CE!(2011)!Generation!and!Characterization!of!a! genetic!zebrafish!model!of!SMA!carrying!the!human!SMN2!gene.!Mol! Neurodegener!6:24.!

! 115! Hao!le!T,!Wolman!M,!Granato!M,!Beattie!CE!(2012)!Survival!motor!neuron!affects! plastin!3!protein!levels!leading!to!motor!defects.!J!Neurosci!32:5074M5084.!

Hao!le!T,!Duy!PQ,!Jontes!JD,!Wolman!M,!Granato!M,!Beattie!CE!(2013)!Temporal! requirement!for!SMN!in!motoneuron!development.!Hum!Mol!Genet!22:2612M 2625.!

Harahap!IS,!Saito!T,!San!LP,!Sasaki!N,!Gunadi,!Nurputra!DK,!Yusoff!S,!Yamamoto!T,! Morikawa!S,!Nishimura!N,!Lee!MJ,!Takeshima!Y,!Matsuo!M,!Nishio!H!(2012)! Valproic!acid!increases!SMN2!expression!and!modulates!SF2/ASF!and! hnRNPA1!expression!in!SMA!fibroblast!cell!lines.!Brain!Dev!34:213M222.!

Haramati!S,!Chapnik!E,!Sztainberg!Y,!Eilam!R,!Zwang!R,!Gershoni!N,!McGlinn!E,! Heiser!PW,!Wills!AM,!Wirguin!I,!Rubin!LL,!Misawa!H,!Tabin!CJ,!Brown!R,!Jr.,! Chen!A,!Hornstein!E!(2010)!miRNA!malfunction!causes!spinal!motor!neuron! disease.!Proc!Natl!Acad!Sci!U!S!A!107:13111M13116.!

Helwak!A,!Kudla!G,!Dudnakova!T,!Tollervey!D!(2013)!Mapping!the!human!miRNA! interactome!by!CLASH!reveals!frequent!noncanonical!binding.!Cell!153:654M 665.!

Hilario!JD,!RodinoMKlapac!LR,!Wang!C,!Beattie!CE!(2009)!Semaphorin!5A!is!a! bifunctional!axon!guidance!cue!for!axial!motoneurons!in!vivo.!Dev!Biol! 326:190M200.!

HsiehMLi!HM,!Chang!JG,!Jong!YJ,!Wu!MH,!Wang!NM,!Tsai!CH,!Li!H!(2000)!A!mouse! model!for!spinal!muscular!atrophy.!Nat!Genet!24:66M70.!

Hua!Y,!Vickers!TA,!Okunola!HL,!Bennett!CF,!Krainer!AR!(2008)!Antisense!masking!of! an!hnRNP!A1/A2!intronic!splicing!silencer!corrects!SMN2!splicing!in! transgenic!mice.!Am!J!Hum!Genet!82:834M848.!

Huang!da!W,!Sherman!BT,!Lempicki!RA!(2009a)!Systematic!and!integrative!analysis! of!large!gene!lists!using!DAVID!bioinformatics!resources.!Nat!Protoc!4:44M57.!

Huang!da!W,!Sherman!BT,!Lempicki!RA!(2009b)!Bioinformatics!enrichment!tools:! paths!toward!the!comprehensive!functional!analysis!of!large!gene!lists.! Nucleic!Acids!Res!37:1M13.!

Hubers!L,!ValderramaMCarvajal!H,!Laframboise!J,!Timbers!J,!Sanchez!G,!Cote!J!(2011)! HuD!interacts!with!survival!motor!neuron!protein!and!can!rescue!spinal! muscular!atrophyMlike!neuronal!defects.!Hum!Mol!Genet!20:553M579.!

Humphreys!DT,!Westman!BJ,!Martin!DI,!Preiss!T!(2005)!MicroRNAs!control! translation!initiation!by!inhibiting!eukaryotic!initiation!factor!4E/cap!and! poly(A)!tail!function.!Proc!Natl!Acad!Sci!U!S!A!102:16961M16966.!

! 116! Ishihara!T,!Ariizumi!Y,!Shiga!A,!Kato!T,!Tan!CF,!Sato!T,!Miki!Y,!Yokoo!M,!Fujino!T,! Koyama!A,!Yokoseki!A,!Nishizawa!M,!Kakita!A,!Takahashi!H,!Onodera!O! (2013)!Decreased!number!of!Gemini!of!coiled!bodies!and!U12!snRNA!level!in! amyotrophic!lateral!sclerosis.!Hum!Mol!Genet!22:4136M4147.!

Ishtiaq!M,!CamposMMelo!D,!Volkening!K,!Strong!MJ!(2014)!Analysis!of!novel!NEFL! mRNA!targeting!microRNAs!in!amyotrophic!lateral!sclerosis.!PLoS!One! 9:e85653.!

Iwasaki!S,!Kobayashi!M,!Yoda!M,!Sakaguchi!Y,!Katsuma!S,!Suzuki!T,!Tomari!Y!(2010)! Hsc70/Hsp90!chaperone!machinery!mediates!ATPMdependent!RISC!loading! of!small!RNA!duplexes.!Mol!Cell!39:292M299.!

Jablonka!S,!Beck!M,!Lechner!BD,!Mayer!C,!Sendtner!M!(2007)!Defective!Ca2+!channel! clustering!in!axon!terminals!disturbs!excitability!in!motoneurons!in!spinal! muscular!atrophy.!J!Cell!Biol!179:139M149.!

Jarecki!J,!Chen!X,!Bernardino!A,!Coovert!DD,!Whitney!M,!Burghes!A,!Stack!J,!Pollok! BA!(2005)!Diverse!smallMmolecule!modulators!of!SMN!expression!found!by! highMthroughput!compound!screening:!early!leads!towards!a!therapeutic!for! spinal!muscular!atrophy.!Hum!Mol!Genet!14:2003M2018.!

Jin!P,!Zarnescu!DC,!Ceman!S,!Nakamoto!M,!Mowrey!J,!Jongens!TA,!Nelson!DL,!Moses! K,!Warren!ST!(2004)!Biochemical!and!genetic!interaction!between!the!fragile! X!mental!retardation!protein!and!the!microRNA!pathway.!Nat!Neurosci! 7:113M117.!

Kanaan!Z,!Roberts!H,!Eichenberger!MR,!Billeter!A,!Ocheretner!G,!Pan!J,!Rai!SN,! Jorden!J,!Williford!A,!Galandiuk!S!(2013)!A!plasma!microRNA!panel!for! detection!of!colorectal!adenomas:!a!step!toward!more!precise!screening!for! colorectal!cancer.!Ann!Surg!258:400M408.!

Kanning!KC,!Kaplan!A,!Henderson!CE!(2010)!Motor!neuron!diversity!in!development! and!disease.!Annu!Rev!Neurosci!33:409M440.!

Karda!R,!Buckley!SM,!Mattar!CN,!Ng!J,!Massaro!G,!Hughes!MP,!Kurian!MA,!Baruteau!J,! Gissen!P,!Chan!JK,!Bacchelli!C,!Waddington!SN,!Rahim!AA!(2014)!Perinatal! systemic!gene!delivery!using!adenoMassociated!viral!vectors.!Front!Mol! Neurosci!7:89.!

Kashima!T,!Rao!N,!David!CJ,!Manley!JL!(2007)!hnRNP!A1!functions!with!specificity!in! repression!of!SMN2!exon!7!splicing.!Hum!Mol!Genet!16:3149M3159.!

Kawahara!Y,!MiedaMSato!A!(2012)!TDPM43!promotes!microRNA!biogenesis!as!a! component!of!the!Drosha!and!Dicer!complexes.!Proc!Natl!Acad!Sci!U!S!A! 109:3347M3352.!

! 117! Kertesz!M,!Iovino!N,!Unnerstall!U,!Gaul!U,!Segal!E!(2007)!The!role!of!site!accessibility! in!microRNA!target!recognition.!Nat!Genet!39:1278M1284.!

Khvorova!A,!Reynolds!A,!Jayasena!SD!(2003)!Functional!siRNAs!and!miRNAs!exhibit! strand!bias.!Cell!115:209M216.!

Koval!ED,!Shaner!C,!Zhang!P,!du!Maine!X,!Fischer!K,!Tay!J,!Chau!BN,!Wu!GF,!Miller!TM! (2013)!Method!for!widespread!microRNAM155!inhibition!prolongs!survival!in! ALSMmodel!mice.!Hum!Mol!Genet!22:4127M4135.!

Kozomara!A,!GriffithsMJones!S!(2014)!miRBase:!annotating!high!confidence! microRNAs!using!deep!sequencing!data.!Nucleic!Acids!Res!42:D68M73.!

Krol!J,!Busskamp!V,!Markiewicz!I,!Stadler!MB,!Ribi!S,!Richter!J,!Duebel!J,!Bicker!S,! Fehling!HJ,!Schubeler!D,!Oertner!TG,!Schratt!G,!Bibel!M,!Roska!B,!Filipowicz!W! (2010)!Characterizing!lightMregulated!retinal!microRNAs!reveals!rapid! turnover!as!a!common!property!of!neuronal!microRNAs.!Cell!141:618M631.!

Kwon!JE,!Kim!EK,!Choi!EJ!(2011)!Stabilization!of!the!survival!motor!neuron!protein! by!ASK1.!FEBS!Lett!585:1287M1292.!

Kye!MJ,!Goncalves!Ido!C!(2014)!The!role!of!miRNA!in!motor!neuron!disease.!Front! Cell!Neurosci!8:15.!

Kye!MJ,!Niederst!ED,!Wertz!MH,!Goncalves!Ido!C,!Akten!B,!Dover!KZ,!Peters!M,! Riessland!M,!Neveu!P,!Wirth!B,!Kosik!KS,!Sardi!SP,!Monani!UR,!Passini!MA,! Sahin!M!(2014)!SMN!regulates!axonal!local!translation!via!miRM183/mTOR! pathway.!Hum!Mol!Genet!23:6318M6331.!

Lai!EC!(2002)!Micro!RNAs!are!complementary!to!3'!UTR!sequence!motifs!that! mediate!negative!postMtranscriptional!regulation.!Nat!Genet!30:363M364.!

Langfelder!P,!Zhang!B,!Horvath!S!(2008)!Defining!clusters!from!a!hierarchical! cluster!tree:!the!Dynamic!Tree!Cut!package!for!R.!Bioinformatics!24:719M720.!

Le!TT,!Pham!LT,!Butchbach!ME,!Zhang!HL,!Monani!UR,!Coovert!DD,!Gavrilina!TO,! Xing!L,!Bassell!GJ,!Burghes!AH!(2005)!SMNDelta7,!the!major!product!of!the! centromeric!survival!motor!neuron!(SMN2)!gene,!extends!survival!in!mice! with!spinal!muscular!atrophy!and!associates!with!fullMlength!SMN.!Hum!Mol! Genet!14:845M857.!

Lee!HY,!Doudna!JA!(2012)!TRBP!alters!human!precursor!microRNA!processing!in! vitro.!RNA!18:2012M2019.!

Lee!RC,!Feinbaum!RL,!Ambros!V!(1993)!The!C.!elegans!heterochronic!gene!linM4! encodes!small!RNAs!with!antisense!complementarity!to!linM14.!Cell!75:843M 854.!

! 118! Lee!Y,!Kim!M,!Han!J,!Yeom!KH,!Lee!S,!Baek!SH,!Kim!VN!(2004)!MicroRNA!genes!are! transcribed!by!RNA!polymerase!II.!EMBO!J!23:4051M4060.!

Lefebvre!S,!Burglen!L,!Reboullet!S,!Clermont!O,!Burlet!P,!Viollet!L,!Benichou!B,! Cruaud!C,!Millasseau!P,!Zeviani!M,!et!al.!(1995)!Identification!and! characterization!of!a!spinal!muscular!atrophyMdetermining!gene.!Cell!80:155M 165.!

Lewis!BP,!Burge!CB,!Bartel!DP!(2005)!Conserved!seed!pairing,!often!flanked!by! adenosines,!indicates!that!thousands!of!human!genes!are!microRNA!targets.! Cell!120:15M20.!

Lewis!BP,!Shih!IH,!JonesMRhoades!MW,!Bartel!DP,!Burge!CB!(2003)!Prediction!of! mammalian!microRNA!targets.!Cell!115:787M798.!

Little!D,!Valori!CF,!Mutsaers!CA,!Bennett!EJ,!Wyles!M,!Sharrack!B,!Shaw!PJ,! Gillingwater!TH,!Azzouz!M,!Ning!K!(2014)!PTEN!Depletion!Decreases!Disease! Severity!and!Modestly!Prolongs!Survival!in!a!Mouse!Model!of!Spinal! Muscular!Atrophy.!Mol!Ther.!

Liu!CG,!Wang!JL,!Li!L,!Wang!PC!(2014)!MicroRNAM384!regulates!both!amyloid! precursor!protein!and!betaMsecretase!expression!and!is!a!potential!biomarker! for!Alzheimer's!disease.!Int!J!Mol!Med!34:160M166.!

Liu!CM,!Wang!RY,!Saijilafu,!Jiao!ZX,!Zhang!BY,!Zhou!FQ!(2013)!MicroRNAM138!and! SIRT1!form!a!mutual!negative!feedback!loop!to!regulate!mammalian!axon! regeneration.!Genes!Dev!27:1473M1483.!

Liu!H,!Shafey!D,!Moores!JN,!Kothary!R!(2010)!Neurodevelopmental!consequences!of! Smn!depletion!in!a!mouse!model!of!spinal!muscular!atrophy.!J!Neurosci!Res! 88:111M122.!

Liu!J,!Carmell!MA,!Rivas!FV,!Marsden!CG,!Thomson!JM,!Song!JJ,!Hammond!SM,! JoshuaMTor!L,!Hannon!GJ!(2004)!Argonaute2!is!the!catalytic!engine!of! mammalian!RNAi.!Science!305:1437M1441.!

Livak!KJ,!Schmittgen!TD!(2001)!Analysis!of!relative!gene!expression!data!using!realM time!quantitative!PCR!and!the!2(MDelta!Delta!C(T))!Method.!Methods!25:402M 408.!

Loeb!GB,!Khan!AA,!Canner!D,!Hiatt!JB,!Shendure!J,!Darnell!RB,!Leslie!CS,!Rudensky! AY!(2012)!TranscriptomeMwide!miRM155!binding!map!reveals!widespread! noncanonical!microRNA!targeting.!Mol!Cell!48:760M770.!

Loya!CM,!McNeill!EM,!Bao!H,!Zhang!B,!Van!Vactor!D!(2014)!miRM8!controls!synapse! structure!by!repression!of!the!actin!regulator!enabled.!Development! 141:1864M1874.!

! 119! Luxenhofer!G,!Helmbrecht!MS,!Langhoff!J,!Giusti!SA,!Refojo!D,!Huber!AB!(2014)! MicroRNAM9!promotes!the!switch!from!earlyMborn!to!lateMborn!motor!neuron! populations!by!regulating!Onecut!transcription!factor!expression.!Dev!Biol! 386:358M370.!

Lyon!AN,!Pineda!RH,!Hao!le!T,!Kudryashova!E,!Kudryashov!DS,!Beattie!CE!(2014)! Calcium!binding!is!essential!for!plastin!3!function!in!SmnMdeficient! motoneurons.!Hum!Mol!Genet!23:1990M2004.!

Maeda!M,!Harris!AW,!Kingham!BF,!Lumpkin!CJ,!Opdenaker!LM,!McCahan!SM,!Wang! W,!Butchbach!ME!(2014)!Transcriptome!profiling!of!spinal!muscular!atrophy! motor!neurons!derived!from!mouse!embryonic!stem!cells.!PLoS!One! 9:e106818.!

Magalon!K,!Zimmer!C,!Cayre!M,!Khaldi!J,!Bourbon!C,!Robles!I,!Tardif!G,!Viola!A,!Pruss! RM,!Bordet!T,!Durbec!P!(2012)!Olesoxime!accelerates!myelination!and! promotes!repair!in!models!of!demyelination.!Ann!Neurol!71:213M226.!

Mailman!MD,!Heinz!JW,!Papp!AC,!Snyder!PJ,!Sedra!MS,!Wirth!B,!Burghes!AH,!Prior! TW!(2002)!Molecular!analysis!of!spinal!muscular!atrophy!and!modification! of!the!phenotype!by!SMN2.!Genet!Med!4:20M26.!

Marques!VD,!Barreira!AA,!Davis!MB,!AbouMSleiman!PM,!Silva!WA,!Jr.,!Zago!MA,! Sobreira!C,!Fazan!V,!Marques!W,!Jr.!(2006)!Expanding!the!phenotypes!of!the! Pro56Ser!VAPB!mutation:!proximal!SMA!with!dysautonomia.!Muscle!Nerve! 34:731M739.!

Masuda!K,!Takano!A,!Oshita!H,!Akiyama!H,!Tsuchiya!E,!Kohno!N,!Nakamura!Y,!Daigo! Y!(2011)!Chondrolectin!is!a!novel!diagnostic!biomarker!and!a!therapeutic! target!for!lung!cancer.!Clin!Cancer!Res!17:7712M7722.!

Mathonnet!G,!Fabian!MR,!Svitkin!YV,!Parsyan!A,!Huck!L,!Murata!T,!Biffo!S,!Merrick! WC,!Darzynkiewicz!E,!Pillai!RS,!Filipowicz!W,!Duchaine!TF,!Sonenberg!N! (2007)!MicroRNA!inhibition!of!translation!initiation!in!vitro!by!targeting!the! capMbinding!complex!eIF4F.!Science!317:1764M1767.!

McWhorter!ML,!Monani!UR,!Burghes!AH,!Beattie!CE!(2003)!Knockdown!of!the! survival!motor!neuron!(Smn)!protein!in!zebrafish!causes!defects!in!motor! axon!outgrowth!and!pathfinding.!J!Cell!Biol!162:919M931.!

Meijer!HA,!Kong!YW,!Lu!WT,!Wilczynska!A,!Spriggs!RV,!Robinson!SW,!Godfrey!JD,! Willis!AE,!Bushell!M!(2013)!Translational!repression!and!eIF4A2!activity!are! critical!for!microRNAMmediated!gene!regulation.!Science!340:82M85.!

Meister!G,!Eggert!C,!Fischer!U!(2002)!SMNMmediated!assembly!of!RNPs:!a!complex! story.!Trends!Cell!Biol!12:472M478.!

! 120! Melamed!Z,!Levy!A,!AshwalMFluss!R,!LevMMaor!G,!Mekahel!K,!Atias!N,!Gilad!S,!Sharan! R,!Levy!C,!Kadener!S,!Ast!G!(2013)!Alternative!splicing!regulates!biogenesis!of! miRNAs!located!across!exonMintron!junctions.!Mol!Cell!50:869M881.!

MinonesMMoyano!E,!Porta!S,!Escaramis!G,!Rabionet!R,!Iraola!S,!Kagerbauer!B,! EspinosaMParrilla!Y,!Ferrer!I,!Estivill!X,!Marti!E!(2011)!MicroRNA!profiling!of! Parkinson's!disease!brains!identifies!early!downregulation!of!miRM34b/c! which!modulate!mitochondrial!function.!Hum!Mol!Genet!20:3067M3078.!

Miyoshi!K,!Miyoshi!T,!Hartig!JV,!Siomi!H,!Siomi!MC!(2010)!Molecular!mechanisms! that!funnel!RNA!precursors!into!endogenous!smallMinterfering!RNA!and! microRNA!biogenesis!pathways!in!Drosophila.!RNA!16:506M515.!

Monani!UR,!Lorson!CL,!Parsons!DW,!Prior!TW,!Androphy!EJ,!Burghes!AH,! McPherson!JD!(1999)!A!single!nucleotide!difference!that!alters!splicing! patterns!distinguishes!the!SMA!gene!SMN1!from!the!copy!gene!SMN2.!Hum! Mol!Genet!8:1177M1183.!

Mourelatos!Z,!Dostie!J,!Paushkin!S,!Sharma!A,!Charroux!B,!Abel!L,!Rappsilber!J,!Mann! M,!Dreyfuss!G!(2002)!miRNPs:!a!novel!class!of!ribonucleoproteins!containing! numerous!microRNAs.!Genes!Dev!16:720M728.!

Muniategui!A,!Pey!J,!Planes!FJ,!Rubio!A!(2013)!Joint!analysis!of!miRNA!and!mRNA! expression!data.!Brief!Bioinform!14:263M278.!

Murashov!AK,!Chintalgattu!V,!Islamov!RR,!Lever!TE,!Pak!ES,!Sierpinski!PL,!Katwa!LC,! Van!Scott!MR!(2007)!RNAi!pathway!is!functional!in!peripheral!nerve!axons.! FASEB!J!21:656M670.!

Nam!JW,!Rissland!OS,!Koppstein!D,!AbreuMGoodger!C,!Jan!CH,!Agarwal!V,!Yildirim! MA,!Rodriguez!A,!Bartel!DP!(2014)!Global!analyses!of!the!effect!of!different! cellular!contexts!on!microRNA!targeting.!Mol!Cell!53:1031M1043.!

Nesler!KR,!Sand!RI,!Symmes!BA,!Pradhan!SJ,!Boin!NG,!Laun!AE,!Barbee!SA!(2013)! The!miRNA!pathway!controls!rapid!changes!in!activityMdependent!synaptic! structure!at!the!Drosophila!melanogaster!neuromuscular!junction.!PLoS!One! 8:e68385.!

Nie!D,!Di!Nardo!A,!Han!JM,!Baharanyi!H,!Kramvis!I,!Huynh!T,!Dabora!S,!Codeluppi!S,! Pandolfi!PP,!Pasquale!EB,!Sahin!M!(2010)!Tsc2MRheb!signaling!regulates! EphAMmediated!axon!guidance.!Nat!Neurosci!13:163M172.!

Ning!K,!Drepper!C,!Valori!CF,!Ahsan!M,!Wyles!M,!Higginbottom!A,!Herrmann!T,!Shaw! P,!Azzouz!M,!Sendtner!M!(2010)!PTEN!depletion!rescues!axonal!growth! defect!and!improves!survival!in!SMNMdeficient!motor!neurons.!Hum!Mol! Genet!19:3159M3168.!

! 121! Nishimura!AL,!MitneMNeto!M,!Silva!HC,!RichieriMCosta!A,!Middleton!S,!Cascio!D,!Kok! F,!Oliveira!JR,!Gillingwater!T,!Webb!J,!Skehel!P,!Zatz!M!(2004)!A!mutation!in! the!vesicleMtrafficking!protein!VAPB!causes!lateMonset!spinal!muscular! atrophy!and!amyotrophic!lateral!sclerosis.!Am!J!Hum!Genet!75:822M831.!

Nolan!K,!Mitchem!MR,!JimenezMMateos!EM,!Henshall!DC,!Concannon!CG,!Prehn!JH! (2014)!Increased!expression!of!microRNAM29a!in!ALS!mice:!functional! analysis!of!its!inhibition.!J!Mol!Neurosci!53:231M241.!

Okamura!K,!Hagen!JW,!Duan!H,!Tyler!DM,!Lai!EC!(2007)!The!mirtron!pathway! generates!microRNAMclass!regulatory!RNAs!in!Drosophila.!Cell!130:89M100.!

Onodera!O,!Ishihara!T,!Shiga!A,!Ariizumi!Y,!Yokoseki!A,!Nishizawa!M!(2014)!Minor! splicing!pathway!is!not!minor!any!more:!implications!for!the!pathogenesis!of! motor!neuron!diseases.!Neuropathology!34:99M107.!

Oprea!GE,!Krober!S,!McWhorter!ML,!Rossoll!W,!Muller!S,!Krawczak!M,!Bassell!GJ,! Beattie!CE,!Wirth!B!(2008)!Plastin!3!is!a!protective!modifier!of!autosomal! recessive!spinal!muscular!atrophy.!Science!320:524M527.!

Otaegi!G,!Pollock!A,!Hong!J,!Sun!T!(2011)!MicroRNA!miRM9!modifies!motor!neuron! columns!by!a!tuning!regulation!of!FoxP1!levels!in!developing!spinal!cords.!J! Neurosci!31:809M818.!

Parisi!C,!Arisi!I,!D'Ambrosi!N,!Storti!AE,!Brandi!R,!D'Onofrio!M,!Volonte!C!(2013)! Dysregulated!microRNAs!in!amyotrophic!lateral!sclerosis!microglia!modulate! genes!linked!to!neuroinflammation.!Cell!Death!Dis!4:e959.!

Pellizzoni!L,!Baccon!J,!Rappsilber!J,!Mann!M,!Dreyfuss!G!(2002)!Purification!of!native! survival!of!motor!neurons!complexes!and!identification!of!Gemin6!as!a!novel! component.!J!Biol!Chem!277:7540M7545.!

Peter!CJ,!Evans!M,!Thayanithy!V,!TaniguchiMIshigaki!N,!Bach!I,!Kolpak!A,!Bassell!GJ,! Rossoll!W,!Lorson!CL,!Bao!ZZ,!Androphy!EJ!(2011)!The!COPI!vesicle!complex! binds!and!moves!with!survival!motor!neuron!within!axons.!Hum!Mol!Genet! 20:1701M1711.!

Piazzon!N,!Rage!F,!Schlotter!F,!Moine!H,!Branlant!C,!Massenet!S!(2008)!In!vitro!and! in!cellulo!evidences!for!association!of!the!survival!of!motor!neuron!complex! with!the!fragile!X!mental!retardation!protein.!J!Biol!Chem!283:5598M5610.!

Pillai!RS,!Grimmler!M,!Meister!G,!Will!CL,!Luhrmann!R,!Fischer!U,!Schumperli!D! (2003)!Unique!Sm!core!structure!of!U7!snRNPs:!assembly!by!a!specialized! SMN!complex!and!the!role!of!a!new!component,!Lsm11,!in!histone!RNA! processing.!Genes!Dev!17:2321M2333.!

! 122! Pillai!RS,!Bhattacharyya!SN,!Artus!CG,!Zoller!T,!Cougot!N,!Basyuk!E,!Bertrand!E,! Filipowicz!W!(2005)!Inhibition!of!translational!initiation!by!LetM7!MicroRNA! in!human!cells.!Science!309:1573M1576.!

Rathod!R,!Havlicek!S,!Frank!N,!Blum!R,!Sendtner!M!(2012)!Laminin!induced!local! axonal!translation!of!betaMactin!mRNA!is!impaired!in!SMNMdeficient! motoneurons.!Histochem!Cell!Biol!138:737M748.!

Ravasz!E,!Somera!AL,!Mongru!DA,!Oltvai!ZN,!Barabasi!AL!(2002)!Hierarchical! organization!of!modularity!in!metabolic!networks.!Science!297:1551M1555.!

Riessland!M,!Brichta!L,!Hahnen!E,!Wirth!B!(2006)!The!benzamide!M344,!a!novel! histone!deacetylase!inhibitor,!significantly!increases!SMN2!RNA/protein! levels!in!spinal!muscular!atrophy!cells.!Hum!Genet!120:101M110.!

Rossoll!W,!Jablonka!S,!Andreassi!C,!Kroning!AK,!Karle!K,!Monani!UR,!Sendtner!M! (2003)!Smn,!the!spinal!muscular!atrophyMdetermining!gene!product,! modulates!axon!growth!and!localization!of!betaMactin!mRNA!in!growth!cones! of!motoneurons.!J!Cell!Biol!163:801M812.!

Ruby!JG,!Jan!CH,!Bartel!DP!(2007)!Intronic!microRNA!precursors!that!bypass!Drosha! processing.!Nature!448:83M86.!

Russell!AP,!Wada!S,!Vergani!L,!Hock!MB,!Lamon!S,!Leger!B,!Ushida!T,!Cartoni!R,! Wadley!GD,!Hespel!P,!Kralli!A,!Soraru!G,!Angelini!C,!Akimoto!T!(2013)! Disruption!of!skeletal!muscle!mitochondrial!network!genes!and!miRNAs!in! amyotrophic!lateral!sclerosis.!Neurobiol!Dis!49:107M117.!

Saal!L,!Briese!M,!Kneitz!S,!Glinka!M,!Sendtner!M!(2014)!Subcellular!transcriptome! alterations!in!a!cell!culture!model!of!spinal!muscular!atrophy!point!to! widespread!defects!in!axonal!growth!and!presynaptic!differentiation.!RNA! 20:1789M1802.!

Sailland!J,!Tribollet!V,!Forcet!C,!Billon!C,!Barenton!B,!Carnesecchi!J,!Bachmann!A,! Gauthier!KC,!Yu!S,!Giguere!V,!Chan!FL,!Vanacker!JM!(2014)!EstrogenMrelated! receptor!alpha!decreases!RHOA!stability!to!induce!orientated!cell!migration.! Proc!Natl!Acad!Sci!U!S!A!111:15108M15113.!

Sareen!D,!Ebert!AD,!Heins!BM,!McGivern!JV,!Ornelas!L,!Svendsen!CN!(2012)! Inhibition!of!apoptosis!blocks!human!motor!neuron!cell!death!in!a!stem!cell! model!of!spinal!muscular!atrophy.!PLoS!One!7:e39113.!

Schrank!B,!Gotz!R,!Gunnersen!JM,!Ure!JM,!Toyka!KV,!Smith!AG,!Sendtner!M!(1997)! Inactivation!of!the!survival!motor!neuron!gene,!a!candidate!gene!for!human! spinal!muscular!atrophy,!leads!to!massive!cell!death!in!early!mouse!embryos.! Proc!Natl!Acad!Sci!U!S!A!94:9920M9925.!

! 123! Schulte!C,!Zeller!T!(2015)!microRNAMbased!diagnostics!and!therapy!in! cardiovascular!diseaseMSumming!up!the!facts.!Cardiovasc!Diagn!Ther!5:17M 36.!

Schultz!NA,!Andersen!KK,!Roslind!A,!Willenbrock!H,!Wojdemann!M,!Johansen!JS! (2012)!Prognostic!microRNAs!in!cancer!tissue!from!patients!operated!for! pancreatic!cancerMMfive!microRNAs!in!a!prognostic!index.!World!J!Surg! 36:2699M2707.!

Schwarz!DS,!Hutvagner!G,!Du!T,!Xu!Z,!Aronin!N,!Zamore!PD!(2003)!Asymmetry!in! the!assembly!of!the!RNAi!enzyme!complex.!Cell!115:199M208.!

Selbach!M,!Schwanhausser!B,!Thierfelder!N,!Fang!Z,!Khanin!R,!Rajewsky!N!(2008)! Widespread!changes!in!protein!synthesis!induced!by!microRNAs.!Nature! 455:58M63.!

Siegel!G!et!al.!(2009)!A!functional!screen!implicates!microRNAM138Mdependent! regulation!of!the!depalmitoylation!enzyme!APT1!in!dendritic!spine! morphogenesis.!Nat!Cell!Biol!11:705M716.!

Singh!J,!Salcius!M,!Liu!SW,!Staker!BL,!Mishra!R,!Thurmond!J,!Michaud!G,!Mattoon!DR,! Printen!J,!Christensen!J,!Bjornsson!JM,!Pollok!BA,!Kiledjian!M,!Stewart!L,! Jarecki!J,!Gurney!ME!(2008)!DcpS!as!a!therapeutic!target!for!spinal!muscular! atrophy.!ACS!Chem!Biol!3:711M722.!

Singh!NN,!Shishimorova!M,!Cao!LC,!Gangwani!L,!Singh!RN!(2009)!A!short!antisense! oligonucleotide!masking!a!unique!intronic!motif!prevents!skipping!of!a! critical!exon!in!spinal!muscular!atrophy.!RNA!Biol!6:341M350.!

Singh!RN!(2007)!Evolving!concepts!on!human!SMN!preMmRNA!splicing.!RNA!Biol! 4:7M10.!

Skehel!PA,!FabianMFine!R,!Kandel!ER!(2000)!Mouse!VAP33!is!associated!with!the! endoplasmic!reticulum!and!microtubules.!Proc!Natl!Acad!Sci!U!S!A!97:1101M 1106.!

Sleigh!JN,!BarreiroMIglesias!A,!Oliver!PL,!Biba!A,!Becker!T,!Davies!KE,!Becker!CG,! Talbot!K!(2014)!Chondrolectin!affects!cell!survival!and!neuronal!outgrowth! in!in!vitro!and!in!vivo!models!of!spinal!muscular!atrophy.!Hum!Mol!Genet! 23:855M869.!

Soussan!L,!Burakov!D,!Daniels!MP,!ToisterMAchituv!M,!Porat!A,!Yarden!Y,!Elazar!Z! (1999)!ERG30,!a!VAPM33Mrelated!protein,!functions!in!protein!transport! mediated!by!COPI!vesicles.!J!Cell!Biol!146:301M311.!

Subramanian!A,!Tamayo!P,!Mootha!VK,!Mukherjee!S,!Ebert!BL,!Gillette!MA,!Paulovich! A,!Pomeroy!SL,!Golub!TR,!Lander!ES,!Mesirov!JP!(2005)!Gene!set!enrichment!

! 124! analysis:!a!knowledgeMbased!approach!for!interpreting!genomeMwide! expression!profiles.!Proc!Natl!Acad!Sci!U!S!A!102:15545M15550.!

Sugarman!EA,!Nagan!N,!Zhu!H,!Akmaev!VR,!Zhou!Z,!Rohlfs!EM,!Flynn!K,!Hendrickson! BC,!Scholl!T,!SirkoMOsadsa!DA,!Allitto!BA!(2012)!PanMethnic!carrier!screening! and!prenatal!diagnosis!for!spinal!muscular!atrophy:!clinical!laboratory! analysis!of!>72,400!specimens.!Eur!J!Hum!Genet!20:27M32.!

Sumner!CJ,!Huynh!TN,!Markowitz!JA,!Perhac!JS,!Hill!B,!Coovert!DD,!Schussler!K,!Chen! X,!Jarecki!J,!Burghes!AH,!Taylor!JP,!Fischbeck!KH!(2003)!Valproic!acid! increases!SMN!levels!in!spinal!muscular!atrophy!patient!cells.!Ann!Neurol! 54:647M654.!

Sunyach!C,!Michaud!M,!Arnoux!T,!BernardMMarissal!N,!Aebischer!J,!Latyszenok!V,! Gouarne!C,!Raoul!C,!Pruss!RM,!Bordet!T,!Pettmann!B!(2012)!Olesoxime! delays!muscle!denervation,!astrogliosis,!microglial!activation!and! motoneuron!death!in!an!ALS!mouse!model.!Neuropharmacology!62:2346M 2352.!

Tadesse!H,!DeschenesMFurry!J,!Boisvenue!S,!Cote!J!(2008)!KHMtype!splicing! regulatory!protein!interacts!with!survival!motor!neuron!protein!and!is! misregulated!in!spinal!muscular!atrophy.!Hum!Mol!Genet!17:506M524.!

Taliaferro!JM,!Aspden!JL,!Bradley!T,!Marwha!D,!Blanchette!M,!Rio!DC!(2013)!Two! new!and!distinct!roles!for!Drosophila!ArgonauteM2!in!the!nucleus:!alternative! preMmRNA!splicing!and!transcriptional!repression.!Genes!Dev!27:378M389.!

Tan!L,!Yu!JT,!Tan!L!(2014)!Causes!and!Consequences!of!MicroRNA!Dysregulation!in! Neurodegenerative!Diseases.!Mol!Neurobiol.!

Tan!SL,!Ohtsuka!T,!Gonzalez!A,!Kageyama!R!(2012)!MicroRNA9!regulates!neural! stem!cell!differentiation!by!controlling!Hes1!expression!dynamics!in!the! developing!brain.!Genes!Cells!17:952M961.!

Ting!CH,!Wen!HL,!Liu!HC,!HsiehMLi!HM,!Li!H,!LinMChao!S!(2012)!The!spinal!muscular! atrophy!disease!protein!SMN!is!linked!to!the!Golgi!network.!PLoS!One! 7:e51826.!

Tisdale!S,!Lotti!F,!Saieva!L,!Van!Meerbeke!JP,!Crawford!TO,!Sumner!CJ,!Mentis!GZ,! Pellizzoni!L!(2013)!SMN!is!essential!for!the!biogenesis!of!U7!small!nuclear! ribonucleoprotein!and!3'Mend!formation!of!histone!mRNAs.!Cell!Rep!5:1187M 1195.!

Tong!L,!Yuan!Y,!Wu!S!(2015)!Therapeutic!microRNAs!targeting!the!NFMkappa!B! signaling!circuits!of!cancers.!Adv!Drug!Deliv!Rev!81:1M15.!

! 125! TorresMMartin!M,!Lassaletta!L,!de!Campos!JM,!Isla!A,!Gavilan!J,!Pinto!GR,!Burbano!RR,! Latif!F,!Melendez!B,!Castresana!JS,!Rey!JA!(2013)!Global!profiling!in! vestibular!schwannomas!shows!critical!deregulation!of!microRNAs!and! upregulation!in!those!included!in!chromosomal!region!14q32.!PLoS!One! 8:e65868.!

Trabucchi!M,!Briata!P,!GarciaMMayoral!M,!Haase!AD,!Filipowicz!W,!Ramos!A,!Gherzi! R,!Rosenfeld!MG!(2009)!The!RNAMbinding!protein!KSRP!promotes!the! biogenesis!of!a!subset!of!microRNAs.!Nature!459:1010M1014.!

Trapnell!C,!Roberts!A,!Goff!L,!Pertea!G,!Kim!D,!Kelley!DR,!Pimentel!H,!Salzberg!SL,! Rinn!JL,!Pachter!L!(2012)!Differential!gene!and!transcript!expression!analysis! of!RNAMseq!experiments!with!TopHat!and!Cufflinks.!Nat!Protoc!7:562M578.!

Turner!BJ,!Alfazema!N,!Sheean!RK,!Sleigh!JN,!Davies!KE,!Horne!MK,!Talbot!K!(2014)! Overexpression!of!survival!motor!neuron!improves!neuromuscular!function! and!motor!neuron!survival!in!mutant!SOD1!mice.!Neurobiol!Aging!35:906M 915.!

Upton!JP,!Wang!L,!Han!D,!Wang!ES,!Huskey!NE,!Lim!L,!Truitt!M,!McManus!MT,! Ruggero!D,!Goga!A,!Papa!FR,!Oakes!SA!(2012)!IRE1alpha!cleaves!select! microRNAs!during!ER!stress!to!derepress!translation!of!proapoptotic! CaspaseM2.!Science!338:818M822.!

Valori!CF,!Ning!K,!Wyles!M,!Mead!RJ,!Grierson!AJ,!Shaw!PJ,!Azzouz!M!(2010)! Systemic!delivery!of!scAAV9!expressing!SMN!prolongs!survival!in!a!model!of! spinal!muscular!atrophy.!Sci!Transl!Med!2:35ra42.! van!Bergeijk!J,!RydelMKonecke!K,!Grothe!C,!Claus!P!(2007)!The!spinal!muscular! atrophy!gene!product!regulates!neurite!outgrowth:!importance!of!the!C! terminus.!FASEB!J!21:1492M1502.!

Van!Meerbeke!JP,!Gibbs!RM,!Plasterer!HL,!Miao!W,!Feng!Z,!Lin!MY,!Rucki!AA,!Wee! CD,!Xia!B,!Sharma!S,!Jacques!V,!Li!DK,!Pellizzoni!L,!Rusche!JR,!Ko!CP,!Sumner! CJ!(2013)!The!DcpS!inhibitor!RG3039!improves!motor!function!in!SMA!mice.! Hum!Mol!Genet!22:4074M4083.!

Wang!Y,!Sheng!G,!Juranek!S,!Tuschl!T,!Patel!DJ!(2008)!Structure!of!the!guideMstrandM containing!argonaute!silencing!complex.!Nature!456:209M213.!

Wei!C,!Thatcher!EJ,!Olena!AF,!Cha!DJ,!Perdigoto!AL,!Marshall!AF,!Carter!BD,!Broadie! K,!Patton!JG!(2013)!miRM153!regulates!SNAPM25,!synaptic!transmission,!and! neuronal!development.!PLoS!One!8:e57080.!

Weng!L,!Smits!P,!Wauters!J,!Merregaert!J!(2002)!Molecular!cloning!and! characterization!of!human!chondrolectin,!a!novel!type!I!transmembrane! protein!homologous!to!CMtype!lectins.!Genomics!80:62M70.!

! 126! Weng!L,!Van!Bockstaele!DR,!Wauters!J,!Van!Marck!E,!Plum!J,!Berneman!ZN,! Merregaert!J!(2003a)!A!novel!alternative!spliced!chondrolectin!isoform! lacking!the!transmembrane!domain!is!expressed!during!T!cell!maturation.!J! Biol!Chem!278:19164M19170.!

Weng!L,!Hubner!R,!Claessens!A,!Smits!P,!Wauters!J,!Tylzanowski!P,!Van!Marck!E,! Merregaert!J!(2003b)!Isolation!and!characterization!of!chondrolectin! (Chodl),!a!novel!CMtype!lectin!predominantly!expressed!in!muscle!cells.!Gene! 308:21M29.!

Wheeler!G,!NtouniaMFousara!S,!Granda!B,!Rathjen!T,!Dalmay!T!(2006)!Identification! of!new!central!nervous!system!specific!mouse!microRNAs.!FEBS!Lett! 580:2195M2200.!

Wightman!B,!Ha!I,!Ruvkun!G!(1993)!Posttranscriptional!regulation!of!the! heterochronic!gene!linM14!by!linM4!mediates!temporal!pattern!formation!in!C.! elegans.!Cell!75:855M862.!

Williams!AH,!Valdez!G,!Moresi!V,!Qi!X,!McAnally!J,!Elliott!JL,!BasselMDuby!R,!Sanes!JR,! Olson!EN!(2009)!MicroRNAM206!delays!ALS!progression!and!promotes! regeneration!of!neuromuscular!synapses!in!mice.!Science!326:1549M1554.!

Wootz!H,!FitzsimonsMKantamneni!E,!Larhammar!M,!Rotterman!TM,!Enjin!A,!Patra!K,! Andre!E,!Van!Zundert!B,!Kullander!K,!Alvarez!FJ!(2013)!Alterations!in!the! motor!neuronMrenshaw!cell!circuit!in!the!Sod1(G93A)!mouse!model.!J!Comp! Neurol!521:1449M1469.!

Workman!E,!Veith!A,!Battle!DJ!(2014)!U1A!regulates!3'!processing!of!the!survival! motor!neuron!mRNA.!J!Biol!Chem!289:3703M3712.!

Wu!D,!Murashov!AK!(2013)!MicroRNAM431!regulates!axon!regeneration!in!mature! sensory!neurons!by!targeting!the!Wnt!antagonist!Kremen1.!Front!Mol! Neurosci!6:35.!

Yamazaki!T,!Chen!S,!Yu!Y,!Yan!B,!Haertlein!TC,!Carrasco!MA,!Tapia!JC,!Zhai!B,!Das!R,! LalancetteMHebert!M,!Sharma!A,!Chandran!S,!Sullivan!G,!Nishimura!AL,!Shaw! CE,!Gygi!SP,!Shneider!NA,!Maniatis!T,!Reed!R!(2012)!FUSMSMN!protein! interactions!link!the!motor!neuron!diseases!ALS!and!SMA.!Cell!Rep!2:799M 806.!

Yi!R,!Qin!Y,!Macara!IG,!Cullen!BR!(2003)!ExportinM5!mediates!the!nuclear!export!of! preMmicroRNAs!and!short!hairpin!RNAs.!Genes!Dev!17:3011M3016.!

Zekri!L,!Huntzinger!E,!Heimstadt!S,!Izaurralde!E!(2009)!The!silencing!domain!of! GW182!interacts!with!PABPC1!to!promote!translational!repression!and! degradation!of!microRNA!targets!and!is!required!for!target!release.!Mol!Cell! Biol!29:6220M6231.!

! 127! Zhang!B,!Horvath!S!(2005)!A!general!framework!for!weighted!gene!coMexpression! network!analysis.!Stat!Appl!Genet!Mol!Biol!4:Article17.!

Zhang!CL,!Wang!C,!Yan!WJ,!Gao!R,!Li!YH,!Zhou!XH!(2014)!Knockdown!of!TNFAIP1! inhibits!growth!and!induces!apoptosis!in!osteosarcoma!cells!through! inhibition!of!the!nuclear!factorMkappaB!pathway.!Oncol!Rep!32:1149M1155.!

Zhang!H,!Xing!L,!Rossoll!W,!Wichterle!H,!Singer!RH,!Bassell!GJ!(2006)!Multiprotein! complexes!of!the!survival!of!motor!neuron!protein!SMN!with!Gemins!traffic! to!neuronal!processes!and!growth!cones!of!motor!neurons.!J!Neurosci! 26:8622M8632.!

Zhang!H,!Yang!B,!Mu!X,!Ahmed!SS,!Su!Q,!He!R,!Wang!H,!Mueller!C,!SenaMEsteves!M,! Brown!R,!Xu!Z,!Gao!G!(2011)!Several!rAAV!vectors!efficiently!cross!the!bloodM brain!barrier!and!transduce!neurons!and!astrocytes!in!the!neonatal!mouse! central!nervous!system.!Mol!Ther!19:1440M1448.!

Zhang!Z,!Pinto!AM,!Wan!L,!Wang!W,!Berg!MG,!Oliva!I,!Singh!LN,!Dengler!C,!Wei!Z,! Dreyfuss!G!(2013a)!Dysregulation!of!synaptogenesis!genes!antecedes!motor! neuron!pathology!in!spinal!muscular!atrophy.!Proc!Natl!Acad!Sci!U!S!A! 110:19348M19353.!

Zhang!Z,!Almeida!S,!Lu!Y,!Nishimura!AL,!Peng!L,!Sun!D,!Wu!B,!Karydas!AM,!Tartaglia! MC,!Fong!JC,!Miller!BL,!Farese!RV,!Jr.,!Moore!MJ,!Shaw!CE,!Gao!FB!(2013b)! Downregulation!of!microRNAM9!in!iPSCMderived!neurons!of!FTD/ALS!patients! with!TDPM43!mutations.!PLoS!One!8:e76055.!

Zheng!K,!Li!H,!Zhu!Y,!Zhu!Q,!Qiu!M!(2010)!MicroRNAs!are!essential!for!the! developmental!switch!from!neurogenesis!to!gliogenesis!in!the!developing! spinal!cord.!J!Neurosci!30:8245M8250.!

Zhong!Z,!Ohnmacht!J,!Reimer!MM,!Bach!I,!Becker!T,!Becker!CG!(2012)!Chondrolectin! mediates!growth!cone!interactions!of!motor!axons!with!an!intermediate! target.!J!Neurosci!32:4426M4439.!

Zhou!F,!Guan!Y,!Chen!Y,!Zhang!C,!Yu!L,!Gao!H,!Du!H,!Liu!B,!Wang!X!(2013)!miRNAM9! expression!is!upregulated!in!the!spinal!cord!of!G93AMSOD1!transgenic!mice.! Int!J!Clin!Exp!Pathol!6:1826M1838.!

Zou!T,!Yang!X,!Pan!D,!Huang!J,!Sahin!M,!Zhou!J!(2011)!SMN!deficiency!reduces! cellular!ability!to!form!stress!granules,!sensitizing!cells!to!stress.!Cell!Mol! Neurobiol!31:541M550.! ! !

! 128! !

! !

! Appendix!1!

! ! ! ! ! ! “miR-138!Expression!in!an!in#vitro!SMN!knockdown!model!of! Spinal!Muscular!Atrophy”! ! ! ! ! ! ! ! ! Introduction! ! Spinal! Muscular! Atrophy! (SMA)! is! a! severe! neurodegenerative! disease! caused!by!loss!of!the!survival!of!motor!neuron!1!(SMN1)!protein.!!Consistent!with! another!motor!neurons!disease,!Amyotrophic!Lateral!Sclerosis!(ALS),!SMA!models! show! abnormalities! in! RNA! processing.! Loss! of! dicer! expression! in! spinal! motor! neurons! caused! a! motor! neuron! disease! phenotype! similar! to! SMA! in! a! mouse! model,!which!led!us!to!investigate!miRNA!expression!in!an!SMA!model!(Haramati!et! al.,! 2010).! To! accomplish! this,! our! lab! completed! a! multiplexed! microRNA! expression!array!to!examine!the!expression!profiles!of!a!number!of!mature!miRNAs!

! 129! in! neuronal! cell! bodies! versus! neurites! following! acute! knockdown! of! SMN! in! cultured!primary!motor!neurons!(Kye!et!al.,!2014).!This!screen!had!a!dual!purpose,! to!identify!subcellular!enrichment!of!particular!miRNAs!and!to!determine!how!this! was!altered!after!SMN!loss.!Interestingly,!it!identified!a!number!of!miRNAs!whose! overall!expression!as!well!as!subcellular!distribution!was!altered!by!loss!of!SMN.!!

Of! the! miRNAs! detected! in! this! screen,! miRO138! was! of! particular! interest! because!it!is!enriched!in!the!brain!(LagosOQuintana!et!al.,!2002)!and!has!known!roles! in! the! central! nervous! system.! In! particular,! miRO138! was! shown! to! regulate! synaptic! strength! (Banerjee! et! al.,! 2009)! and! spine! morphogenesis! (Siegel! et! al.,!

2009)! in! dendrites.! Interestingly,! in! dividing! cells! increased! miRO138! expression! was!associated!with!suppression!of!cell!invasion!and!induction!of!apoptosis!(Liu!et! al.,! 2009).! Together! these! studies! indicated! that! miRO138! could! be! an! intriguing! candidate! for! an! SMAOassociated! miRNA! as! it! is! involved! in! regulating! neuronal! morphology,!synaptic!activity,!and!cell!survival.!!To!determine!the!effect!of!SMN!loss! on!miRO138,!we!used!an!in#vitro!acute!knockdown!model!in!both!cultured!cortical! and!spinal!motor!neurons.!!

Results!

To! validate! the! results! of! the! miRNA! array,! we! used! individual! TaqMan! expression!assays!to!observe!miRO138!expression!normalized!to!the!small!nuclear!

RNA!RNU6B.!While!the!original!screen!sought!to!identify!changes!in!the!subcellular! localization!of!miRNAs!in!the!cell!body!versus!the!neurite!compartment,!the!current! study!used!RNA!extracted!from!whole!neuron!preparations.!Cortical!neurons!were!

! 130! infected!with!lentivirus!containing!an!shCtl!or!shSMN!hairpin!at!1DIV!and!harvested!

for!RNA!and!protein!at!9DIV!(as!described!in!chapter!2).!At!this!time!point,!there!is!a!

significant! decrease! in! SMN! expression! (Figure! S1A).! Further,! miRO138! is!

significantly! and! consistently! decreased! by! 2Ofold! in! the! cortical! neuron! cultures!

(Figure! S1B)! confirming! that! miRO138! is! dysregulated! in! the! cortical! SMN!

knockdown!model.!

Because! SMA! is! predominantly! a! motor! neuron! disease,! we! then! asked!

whether! this! change! in! miRO138! expression! also! occurred! in! SMN! knockdown!

primary!motor!neuron!cultures!(Chapter!2).!After!culturing!spinal!motor!neurons,!

we!infected!the!cells!with!the!same!shSMN!construct!at!1DIV!and!harvested!RNA!at!

A B 1.5 1.5 **** ** 1.0 1.0

0.5 0.5 SMN Norm GAPDH Norm SMN

0.0 miR-138 Norm miR-191 0.0

shCtl shCtl shSMN shSMN ! ! Figure!S1!miR-138!is!decreased!by!SMN!knockdown!in!cortical!neurons! A! qRTOPCR! of! SMN! knockdown! normalized! to! GAPDH! expression! in! cortical! neurons.!B!Mature!miRO138!expression!normalized!to!miRO191!in!SMN!knockdown! cortical! neurons! N! =8! from! 4! experiments! **! =! pOvalue!

! 131! 7DIV! after! six! days! of! infection.! This! time! point! is! earlier! in! the! motor! neuron! cultures!to!avoid!confounds!of!increased!cell!stress!and!death,!which!occur!by!8DIV;! nonetheless! there! is! significant! knockdown! of! SMN! expression! at! this! timepoint!

(Figure!S2A).!We!did!not!see!a!significant!change!in!miRO138!in!the!SMN!knockdown! motor! neurons! (Figure! S2B).! In! fact,! miRO138! expression! was! highly! stable! and! unchanged! following! SMN! knockdown.! Since! the! effect! of! SMN! loss! on! miRO138! expression!was!only!detected!in!cortical!neurons,!we!decided!not!to!pursue!changes! in!miRO138!expression!in!the!acute!motor!neuron!model!SMA.!

A B 1.5 1.5 **** NS 1.0 1.0

0.5 0.5 SMN Norm GAPDH Norm SMN

0.0 miR-138 Norm miR-191 0.0

shCtl shCtl shSMN shSMN !

Figure!S2!miR-138!is!unchanged!in!SMN!knockdown!motor!neurons.! A.!qRTOPCR!of!SMN!mRNA!normalized!to!GAPDH!in!knockdown!motor!neurons.!B.! Mature! miRO138! normalized! to! miRO191! expression! in! SMN! knockdown! motor! neurons.!N=9!from!4!experiments!****!=!pOvalue!

! 132! Discussion!

The!original!screen!of!miRNA!expression!(described!in!detail!in!Appendix!2)! in! SMN! knockdown! cortical! neurons! identified! a! number! of! miRNAs! that! were! differentially!expressed!in!both!the!cell!body!and!neurite!compartment.!Here,!I!used!

TaqMan! miRNA! assays! to! validate! the! expression! change! of! a! single! miRNA,! miRO

138,! in! the! SMN! knockdown! model.! Mature! miRO138! is! significantly! decreased! by!

50%! in! primary! cultured! cortical! neurons,! but! not! in! spinal! motor! neurons! after! acute! SMN! knockdown.! This! is! interesting! because! it! highlights! a! difference! in! miRNA!expression!profiles!between!neuronal!cell!types!in!an!in#vitro!model!of!SMA.!

Because! spinal! motor! neurons! are! the! cell! type! most! affected! by! SMN! loss,! we! determined!that!miRO138!is!not!a!good!candidate!for!additional!investigation.!

One! of! the! fundamental! questions! in! SMA! research! is! what! makes! motor! neurons! particularly! vulnerable! to! cell! death.! We! believe! the! discovery! of! a! difference! in! miRO138! expression! after! acute! SMN! knockdown! in! the! cortical! neurons! versus! the! spinal! motor! neurons! is! indicative! of! cellOtype! specific! differences!in!miRNA!dysregulation!in!SMA.!Therefore,!in!Chapters!2!through!4,!we! focused!on!elucidating!the!scope!and!effect!of!miRNA!changes!in!the!spinal!motor! neuron!model!in!an!attempt!to!uncover!motor!neuronOspecific!miRNA!changes!that! may!underlie!the!selective!vulnerability!to!SMN!deficiency!in!SMA.!

! 133! References!

Banerjee!S,!Neveu!P,!Kosik!KS!(2009)!A!coordinated!local!translational!control!point! at!the!synapse!involving!relief!from!silencing!and!MOV10!degradation.! Neuron!64:871O884.!

LagosOQuintana!M,!Rauhut!R,!Yalcin!A,!Meyer!J,!Lendeckel!W,!Tuschl!T!(2002)! Identification!of!tissueOspecific!microRNAs!from!mouse.!Curr!Biol!12:735O 739.!

Liu!X,!Jiang!L,!Wang!A,!Yu!J,!Shi!F,!Zhou!X!(2009)!MicroRNAO138!suppresses!invasion! and!promotes!apoptosis!in!head!and!neck!squamous!cell!carcinoma!cell!lines.! Cancer!Lett!286:217O222.!

Siegel!G!et!al.!(2009)!A!functional!screen!implicates!microRNAO138Odependent! regulation!of!the!depalmitoylation!enzyme!APT1!in!dendritic!spine! morphogenesis.!Nat!Cell!Biol!11:705O716.! !

! 134! $ ! ! Appendix!2!

! ! ! ! ! ! “SMN!regulates!axonal!local!translation!via!!

miR:183/mTOR!pathway”!

! ! ! ! $ Kye,$M.J.,$Niederst,$E.D.,$Wertz,!M.H.,$Goncalves$Ido,$C.,$Akten,$B.,$Dover,$K.Z.,$Peters,$ M.,$Riessland,$M.,$Neveu,$P.,$Wirth,$B.,"et"al.$(2014).$Human$molecular$genetics"23,$ 6318P6331$ $ $ $ $ This$study$was$the$first$to$identify$axon$microRNAs,$specifically$miRP183$as$ important$regulators$of$axon$morphology$and$local$translation$in$an$SMA$model.$As$ part$ of$ this$ study$ I$ worked$ closely$ with$ Dr.$ Min$ Jeong$ Kye$ to$ complete$ a$ several$ different$assays$throughout$the$paper.$I$generated$primary$motor$neuron$cultures$ from$rat$embryos,$prepared$RNA$from$SMA$patient$fibroblasts$as$well$as$untreated$ or$ SMN$ knockdown$ cortical$ and$ motor$ neurons,$ and$ ran$ TaqMan$ microRNA$ expression$assays$to$quantify$miRNA$expression.$I$also$contributed$to$revising$the$ manuscript$during$editing$and$resubmission.$

135$ Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 23 6318–6331 doi:10.1093/hmg/ddu350 Advance Access published on July 4, 2014 SMN regulates axonal local translation via miR-183/mTOR pathway

Min Jeong Kye1,2, Emily D. Niederst1, Mary H. Wertz1, Ineˆs do Carmo G. Gonc¸alves2, Bikem Akten1, Katarzyna Z. Dover4,5, Miriam Peters2,3, Markus Riessland2,3, Pierre Neveu7,8,9, Brunhilde Wirth2,3, 8 10 4,5,6 10 1, Kenneth S. Kosik , S. Pablo Sardi , Umrao R. Monani , Marco A. Passini and Mustafa Sahin ∗

1Department of Neurology, The F. M. Kirby Neurobiology Center, Boston Children’s Hospital, Harvard Medical School, Boston, MA, USA, 2Institute of Human Genetics, Institute for Genetics and, 3Center of Molecular Medicine Cologne, University of Cologne, Cologne, Germany, 4Center for Motor Neuron Biology and Disease, 5Department of Pathology and Cell Biology and, 6Department of Neurology, Columbia University Medical Center, New York, NY 10032, USA, 7Kavli Institute for Theoretical Physics and, 8Neuroscience Research Institute, University of California at Santa Barbara, Santa Downloaded from Barbara, CA 93106, USA, 9Cell Biology and Biophysics Unit, European Molecular Biology Laboratory, 69117, Heidelberg, Germany and 10Genzyme, a Sanoﬁ Company, Framingham, MA 01701, USA

Received April 18, 2014; Revised June 27, 2014; Accepted July 2, 2014 http://hmg.oxfordjournals.org/

Reduced expression of SMN protein causes spinal muscular atrophy (SMA), a neurodegenerative disorder leading to motor neuron dysfunction and loss. However, the molecular mechanisms by which SMN regulates neuronal dysfunction are not fully understood. Here, we report that reduced SMN protein level alters miRNA expression and distribution in neurons. In particular, miR-183 levels are increased in neurites of SMN-deficient neurons. We demonstrate that miR-183 regulates translation of mTor via direct binding to its 3′ UTR. Interestingly, local axonal translation of mTor is reduced in SMN-deficient neurons, and this can be recovered by miR-183 inhibition. Finally, inhibition of miR-183 expression in the spinal cord of an SMA mouse model pro- at Harvard Library on February 2, 2015 longs survival and improves motor function of Smn-mutant mice. Together, these observations suggest that axonal miRNAs and the mTOR pathway are previously unidentified molecular mechanisms contributing to SMA pathology.

INTRODUCTION strongly suggest that miRNAs act as important regulators of local axonal protein translation in neurons (10). MicroRNAs are molecular regulators of protein expression that Deficiency of SMN leads to spinal muscular atrophy (SMA), act by repressing translation or destabilizing mRNAs. Numerous an autosomal recessive disease characterized by spinal motor miRNAs have been described in many organisms and are neuron degeneration (11,12). Spinal muscular atrophy is reported to play significant roles in a broad range of cellular caused by homozygous deletion or mutation of SMN1 (survival and developmental processes, including cell cycle (1), neuronal motor neuron 1). SMN2, which is .99% identical to SMN1, con- development (2) and learning and memory (3,4). RISC (RNA- tains a single nucleotide change that produces aberrant splicing induced silencing complex) is a ribonucleoprotein complex lacking exon 7. Therefore, only 10% of SMN2 transcripts are comprised of targeting miRNAs and a number of associated pro- properly spliced and synthesize functional# full-length SMN proteins including Argonautes and GW182 proteins (5). Proteins teins. SMN2 can vary from 1 to 6 copies per genome and is the involved in miRNA function have been detected in axons of main modifier of SMA to influence SMA severity (11). SMN primary hippocampal and sympathetic neurons (6–8). Further- protein is ubiquitously expressed in all neuronal compartments more, Mov10, a component of the RISC complex, is also including the nucleus, soma, axon and dendrites (13,14). present at mammalian synaptic sites, where it regulates protein Within the nucleus, SMN is localized in subcellular structures translation in response to neuronal activity (9). These findings called gems, where it interacts with a number of proteins essential

∗To whom correspondence should be addressed at: F. M. Kirby Neurobiology Center, Children’s Hospital, 300 Longwood Avenue CLSB 14073, Boston, MA 02115, USA. Tel: 1 6179194518; Fax: 1 6177300242; Email: [email protected] + +

136 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 23 6319 to RNA processing and splicing including the Gemin3 and mRNA in the axon, b-actin, was expressed at similar levels in Gemin4 proteins, which can also be found in the RISC the cell body and neurite samples. In contrast, g-actin mRNA complex (15–18). In the axons and dendrites of neurons, SMN and snoRNA U6B were detected at a much lower level in the interacts with RNA-binding proteins, such as HuD, and plays neurites, as compared with the cell body compartment (Supple- a role in ribonucleoprotein (RNP) trafficking required to accom- mentary Material, Fig. S1C and D), as previously described (29). plish local protein translation in these compartments (14,19,20). To test whether SMN plays a role in miRNA expression and SMN also binds FMRP (21) and KSRP (22), which are important distribution in neurons, we knocked down SMN expression for miRNA biogenesis and function (23). Recently, it was reported using lentivirus expressing shRNA against rat Smn. Nine days thatmicelackingthemiRNA-processingenzymeDicerselectively after infection, Smn mRNA is reduced to 45% of control in in motor neurons display SMA-like phenotype, arguing for a the cell body compartment and to ,25%# of control in the potential role for miRNAs in neuromuscular disorders (24). neurite compartment (Supplementary Material, Fig. S1E). We Local axonal protein translation has also been implicated in also confirmed that SMN protein is reduced to 40% of SMA pathology (25,26). Interestingly, when full-length SMN control (Supplementary Material, Fig. S1F). Using these# RNA level is reduced, axons are shorter and growth cones are samples, we measured the expression of 187 miRNAs with smaller (27). The most extensively investigated mRNA that Taqman-based multiplexed real-time PCR. Most miRNAs mea- undergoes local translation in axonal growth cones is b-actin, sured could be detected in the neurite compartment and showed which may contribute to the observed deficits in axonal actin differential distributions between cell bodies and neurites (Sup- Downloaded from cytoskeleton organization found in SMA animal models (27). plementary Material, Fig. S1G and Table S1). This finding is Recently, we reported cpg15 (neuritin) mRNA found in axons consistent with previous reports that used laser capture micro- is regulated locally by SMN and HuD (14). These results indi- dissection of neurites from hippocampal neurons (7) and cated that SMN could regulate the expression/trafficking of a axonal miRNA profiling in sympathetic neurons (8). We then

number of mRNAs locally translated in neurites. Given that compared the expression and distribution of miRNAs in http://hmg.oxfordjournals.org/ SMN binds to KSRP (22) and FMRP (21), we hypothesized control and Smn-knockdown neurons (Supplementary Material, that SMN complex plays a role in the regulation of miRNA Fig. S1G and Tables S2–S5). While the overall distribution of expression and within neurons to regulate local translation. miRNAs was not significantly affected (Supplementary Mater- Here, we demonstrate that reduced SMN levels triggered dif- ial, Fig. S1H), there were differences in the distribution of indi- ferential expression and distribution of specific miRNAs in vidual miRNAs (Supplementary Material, Tables S2–S5). neurons. Among the miRNAs up-regulated in SMN-deficient Because complete SMN depletion in neuronal cells can cause neurons, miR-183 can suppress axon growth. We show that cell death (30), we measured levels of caspase activity in miR-183 regulated translation of mTor mRNA via direct Smn-knockdown neurons and confirmed that the apoptosis path- binding to its 3′ UTR, providing a novel link between SMN de- ways were not yet active in our samples at the time of RNA col- at Harvard Library on February 2, 2015 ficiency and a miRNA-mediated regulation of a key growth and lection (Supplementary Material, Fig. S1I). Furthermore, there survival pathway. Furthermore, we are able to demonstrate was no increase in RIP1 expression as a marker of necrosis modest prolongation of survival and improved motor function (31)afterSmn-knockdown (Supplementary Material, Fig. S1J). in vivo, in the setting of an animal model for SMA by inhibiting Thus, alterations in miRNA expression observed in SMN-deficient the elevated miR-183 expression selectively in spinal motor neurons are not due to cell death. neurons. These findings shed light on previously unidentified Because we are particularly interested in miRNA function in mechanisms implicated in SMA pathology and provide new the neurites, we focused on miRNAs whose expressionis primar- insight into the contribution of miRNA dysregulation to the path- ily changed in the neurite samples but not in cell body samples of ology of neurological disorders. Smn-knockdown neurons. Thus, miRNAs such as miR-30a-5p and miR-196b, whose expressions were altered in both cell body and neurites samples of Smn-knockdown neurons, were RESULTS excluded from further investigation. In control neurons, miR-183 is expressed at higher levels in the cell body than in Reduced SMN level alters miRNA expression the neurites. Upon Smn-knockdown, its expression increases and distribution in neurons two-fold in the neurite compartment without a significant To examine levels of miRNA expression in neurites, we cultured change in the cell body compartment (Fig. 1A, Supplementary embryonic rat cortical neurons in modified Boyden chambers Material, Tables S2 and S4). Thus, we selected miR-183 to char- (14,28). These chambers allow separation of neurites (axons acterize further. Overall expression of miR-183 in the whole cell and dendrites) from cell bodies and produce a substantial quan- was increased in both spinal motor and cortical neuron cultures tity of RNAs for consistent profiling of miRNA expression (Sup- following Smn-knockdown (Fig. 1B, Supplementary Material, plementary Material, Fig. S1A). After 10 days in vitro (DIV), Fig. S2A and B). We also found that miR-183 expression was total protein and RNA were extracted from the upper chamber, elevated in SMA type 1 patient-derived fibroblast cell lines, as which contains mainly the cell body compartment and from well as spinal cord and sciatic nerve from 4-day-old SMA the lower chamber, which contains the distal neurites. We con- model mice (FVB, Smn2/2;SMN2tg/tg;SMND7tg/tg) (Fig. 1C–E, firmed the separation of the cellular compartments by measuring Supplementary Material, Table S6). The sciatic nerve is made Tau protein, which is enriched in distal axons, and Lamin A, a up of axons from sensory and motor neurons; therefore, these marker of the nuclear envelope (Supplementary Material, data support our finding that miR-183 expression is increased Fig. S1B). Integrity of RNA samples was confirmed by measur- in the neurite compartment. As a control, we measured the ing known mRNA expression (29). The best-characterized expression of other miRNAs in our samples such as miR-124a,

137 Author’s personal copy 6320 Human Molecular Genetics, 2014, Vol. 23, No. 23 Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on February 2, 2015

Figure 1. Expression and distribution of miR-183 is altered in SMN-deﬁcient cells. (A) Real-time PCR of miR-183 expression in subcellular compartment of control andSmn-knockdowncorticalneurons.n 8 fromfourdifferentbiologicalsamples.(B)Real-timePCRshowingmiR-183expressionin Smn-knockdownspinalmotor neurons. Spinal motor neurons were isolated¼ from E15 rat embryos and cultured 7 days. n 6 from three biological samples. (C) Real-time PCR showing miR-183 ¼

138 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 23 6321 miR-19a and miR-26a, and these did not change with SMN loss a DNA oligonucleotide with reverse complementary sequence (Fig. 1B–E). Another SMA mouse model, which contains two of miR-183 (Fig. 2C). After 48 h of transfection, we visualized copies of SMN2 per integrate in their genome [FVB, Smn2/2; transfected LNA oligonucleotide with FITC-conjugated strepta- SMN2tg/0 (32)], also displayed higher level of miR-183 expres- vidin and found that .90% of neurons were transfected with sion in the spinal cord (Fig. 1F). Together, these data indicate LNA inhibitor (Supplementary Material, Fig. S3B). Inhibition that reduced neuronal SMN level increases miR-183 expression. of miR-183 lasts about 10 days whereas miR-183 expression To explore the cellular mechanism of elevated miR-183 ex- increases gradually as the neurons mature in culture (Supple- pression, we measured the primary transcript of miR-183 in P4 mentary Material, Fig. S3C and D). Interestingly, miR-183 spinal cord of the SMA mouse model containing two copies of knockdown rescued the impairment of axonal growth in human SMN2 (FVB, Smn2/2;SMN2tg/0). Because miR-183 is Smn-knockdown neurons. Both the longest and total axon transcribed as a single transcript together with miR-96 and lengths were comparable with controls in Smn-knockdown miR-182, we also measured expression of the other two neurons transfected with miR-183 LNA inhibitor (Fig. 2A, D miRNAs in the same gene cluster (Fig. 1F). Interestingly, the and E). The miR-183 LNA inhibitor, however, increased the amount of primary transcript was not increased in the spinal number of branches and percentage of neurons with multiple cord of SMA mouse model, whereas expression of the mature axons to above the control levels (Fig.2F and G). Taken together, forms of miR-183 and miR-96 was increased. In contrast, these ﬁndings suggest that reduction of miR-183 partially com- another miRNA in the cluster, miR-182, was unchanged. pensates for SMN deﬁciency in neurons. Downloaded from These data suggest that there is differential regulation of biogenesis among miRNAs in the miR-183 96 182 cluster and that reduced SMN level causes dysregulation# in# the miRNA biogen- miR-183 regulates mTOR activity by directly binding esis pathway, rather than in overall transcription. to the 3′ UTR of mTor

To confirm the up-regulation of miR-183 in the neurites, we per- To understand how miR-183 knockdown affects neurons, we http://hmg.oxfordjournals.org/ formed in situ hybridization in rat hippocampal and spinal motor first used a computational approach using miRanda to find down- neurons. Smn-knockdown neurons displayed higher expression of stream target genes of miR-183. A previous study indicates that miR-183 throughout their neurites. miR-183 levels in the neurite, miR-183 cluster regulates the PI3K/AKT/mTOR pathway in normalized to those in the cell body of individual neurons, con- medulloblastoma cell lines (33). As we had previously demon- firmed our real-time PCR data that miR-183 expression is elevated strated that mTOR hyperactivity results in aberrant neuronal two-fold in the neurites of SMN-deficient neurons (Fig. 1G growth and multiple axons (34), similar to what we observe and Supplementary Material, Fig. S2C). Using real-time PCR, with miR-183 knockdown, we specifically searched for genes miR-183 was detectable in hippocampal, cortical and spinal in this pathway among putative target genes (387 genes for rat motor neuron cultures, but it was detected at lower levels in the and 717 genes for mouse are predicted targets of miR-183). As at Harvard Library on February 2, 2015 spinal motor neurons (Supplementary Material, Fig. S2D). Taken mTor mRNA itself contains putative binding sequence for together, these results indicate that SMN deficiency elevates miR-183 (Fig. 3A), we asked whether mTor is bona fide target expression of miR-183 in several types of cells and tissues. of miR-183. We over-expressed miR-183 using pre-miR-183 and inhibited miR-183 using LNA inhibitor in neurons and then measured protein and mRNA levels of putative target Inhibition of miR-183 rescues the Smn-knockdown genes. Up- or down-regulating miR-183 expression significantly axonal phenotype in neurons changed the protein levels of mTor without altering its mRNA As miR-183 expression is up-regulated in SMN-deficient level (Fig. 3B, C and Supplementary Material, Fig. S4). These neurons, we asked whether reducing miR-183 levels could findings indicate that miR-183 regulates protein expression of rescue the impaired axonal growth seen in rat Smn-knockdown mTor at the post-transcriptional level. neurons (Fig. 2A–G). We adapted siRNA technology to knock- To determine whether miR-183 regulates the mRNAtranslation down Smn expression more rapidly than lentiviral shRNA of mTor directly, we constructed a reporter system expressing because axonal morphology must be measured when axons are firefly luciferase fused to the 3′ UTR of this gene (Fig. 3D). We shorter, at 5 DIV. Forty-eight hours after siRNA transfection, ex- measured the firefly luciferase activity with gain- or loss- of pression of Smn mRNA was reduced to 50% of initial levels miR-183 function in HEK293T cells. Inhibition of miR-183 and protein to ,10% of the control,# using two different increased firefly luciferase activity of the reporter construct siRNAs against Smn (Fig. 2B and Supplementary Material, whereas overexpression of miR-183 reduced its expression. Fig. S3A). We simultaneously reduced the expression of mTor 3′ UTR has only one putative binding site for miR-183, miR-183 to ,10% using locked nucleic acid (LNA) inhibitor, and mutation of six nucleotides in seed region of this site abolished expression in type 1 SMA patient-derived fibroblast cell lines. A control and two type I SMA cell lines were analyzed, and each cell line was examined at two different passages except for the control cell line. Genetic and clinical information about the cell lines are in Supplementary Material, Table S6. (D, E) miR-183 expression in / tg/tg tg/tg 2/2 spinal cord (D) and sciatic nerve (E) of postnatal day 4 (P4) SMA mice. n 5 for control (Smn+ +;SMN2 ;SMND7 ) and n 7 for SMA animals (Smn ; SMN2tg/tg; SMND7tg/tg). (F) Schematic representation of miR-183 96 182¼ cluster in the mouse genome. Real-time PCR of primary¼ transcript and mature form # # /2 tg/0 2/2 of miRNAs from this cluster were measured in the spinal cord of P4 SMA mice. n 9 for control (Smn+ ;SMN2 ) and n 11 for SMA animals (Smn ; SMN2tg/0); SMN2tg two copies of SMN2. (G) In situ hybridization of miR-183 using LNA¼ probes on 7 DIV spinal motor neurons¼ with SMN-knockdown. Intensities of miR-183 signals were¼ measured with ImageJ. The signals from neurites were normalized to the signal from cell body of individual neuron. N 25 for control and ¼ n 20 for Smn-knockdown neurons. Data are represented as mean + SEM. Scale bar: 50 mm. Mature miRNA expression was normalized to snoRNA, U6B. Primary miRNA¼ expressions were normalized to Gapdh expression. For neurites samples and sciatic nerve, 3 ng of total RNA was used to measure mRNA expression. Stat- istical significances were determined by student’s t-test, ∗P , 0.05, ∗∗P , 0.01 and ∗∗∗P , 0.0001.

139 Author’s personal copy 6322 Human Molecular Genetics, 2014, Vol. 23, No. 23 Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on February 2, 2015

Figure 2. Knockdown of miR-183 expression with LNA inhibitor rescues neuronal morphology of SMN-deficient neurons. (A) Axonal morphology was visualized with Tau staining on 5 DIV. (B) Real-time PCR confirming efficiency of two different siRNAs against Smn. (C) LNA inhibitor against miR-183 after 4 days of transfection. n 8, from four different experiments. (D) Length of the longest axon, (E) total length of axons, (F) number of axonal branches and (G) percentage of neurons ¼ with multiple axons. n 150–221 from five different experiments. Data are represented as mean + SEM. Student’s t-test, ∗P , 0.05. Scale bar: 100 mm. ¼

140 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 23 6323 Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on February 2, 2015

Figure 3. miR-183 directly regulates translation of mTor. (A) Putative binding sites for miR-183 in 3′ UTR of mTor.(B) Representative western blot showing that modification of miR-183 expression changes protein levels of mTOR in 48 h after transfection. (C) Quantification of protein normalized to GAPDH expression, n 6 ¼ to nine experiments. Student’s t-test, ∗P , 0.05 and ∗∗P , 0.01, compared with control samples. (D) Schematic figure of firefly luciferase reporter vector. (E) Firefly luciferase reporter assays of mTor 3′ UTRs with modifying miR-183 expression. Firefly luciferase activity is normalized to Renilla luciferase activity. Data represent relative expression of normalized firefly luciferase activity in miR-183 modified samples compared with control samples. n 8–16, student’s t-test, P , 0.01 and ¼ ∗∗ ∗∗∗P , 0.001. (F) Western blots of proteins downstream of the mTOR pathway. (G) Bar graphs represent protein expressionof 5 to 8 different biological samples. Red dotted line represents control level. Student’s t-test, compared with control samples, ∗P , 0.05. Data are represented as mean + SEM. the effect of miR-183 on the expression of luciferase reporter. mTOR kinase exists in two distinct functional complexes, From these data, we conclude that miR-183 can regulate transla- mTOR Complex 1 (mTORC1) and mTOR Complex 2 tion of mTor by directly binding to its 3′ UTR (Fig. 3DandE). (mTORC2), defined by two groups of binding partners (35).

141 Author’s personal copy 6324 Human Molecular Genetics, 2014, Vol. 23, No. 23

Because mTOR is a core component of the two complexes, we To investigate this question, we knocked down Smn and mea- asked how the activities of mTORC1 and mTORC2 were sured the expression of proteins in the mTOR pathway in cortical affected by loss of miR-183. It is well established that and spinal motor neurons. Protein levels of many genes in the mTORC1 phosphorylates S6K1 at Thr389, and mTORC2 phos- mTOR pathway such as S6K1 and SGK were down-regulated phorylates PKCa at Ser657 (36). Therefore, we measured phos- in Smn-knockdown cells compared with controls in both cortical phorylation of these two proteins as markers of mTORC1/2 and spinal motor neurons (Fig. 4A–C). Based on the expression activity. Interestingly, levels of S6K1 protein increased by and phosphorylation of S6K1, S6 ribosomal subunit, SGK 50% and the phosphorylated S6K1 (P-S6K1) increased and PKC-a, we conclude that the activity of the mTOR #25% in miR-183 knockdown neurons. Moreover, phosphory- pathway is reduced in cortical and spinal motor neurons with lated# PKCa (P-PKCa) increased 25%, whereas the total Smn-knockdown. As mTORC1 regulates protein synthesis, we amount of PKCa protein was unchanged# (Fig. 3F and G). asked whether SMN deficiency might cause impairment in These results indicate that both mTORC1 and mTORC2 are protein synthesis. We used surface sensing of translation tech- modulated by miR-183 expression in neurons. nology (SUnSET) to measure protein synthesis efficiency in cells (37). Interestingly, both Smn-knockdown neurons and neurons from the SMA mouse model showed reduced puro- Smn-knockdown neurons exhibit dysregulated mTOR mycin incorporation during 1 h of incubation, suggesting that activity and reduced protein synthesis SMN deficiency causes impairment in de novo protein synthesis Downloaded from Having demonstrated an effect of miR-183 on the mTOR efficiency (Fig. 4D, Supplementary Material, Fig. S5A). To test pathway, we examined whether SMN expression also modulates whether this is a neuron-specific phenomenon, we performed the the expression and activity of the mTOR pathway in neurons. same experiments with SMA patient-derived fibroblast cell http://hmg.oxfordjournals.org/ at Harvard Library on February 2, 2015

Figure 4. SMN deficiency impairs protein synthesis by dysregulation of mTOR activity in neurons. (A) Western blot of proteins in mTOR pathway. Neurons were infected by lentivirus expressing shRNA against Smn on 1 DIV. After 9 days (cortical neurons) and 6 days (spinal motor neurons) of infection, proteins were collected and analyzed by western blot. Bar graphs represent quantification of the expression of proteins involved in mTOR pathway in (B) cortical neurons and (C) spinal motor neurons.n 3–5 for corticalneurons;n –9 for spinalmotorneurons,student’st-test, P , 0.05,comparedwithcontrollentivirus-infected neurons.Data are repre- ¼ ¼ ∗ sented as mean + SEM. (D) SUnSET experiments independently support that protein synthesis efficiency is reduced in SMN-deficient neurons. Experiments were performed either Smn-knockdown cortical neurons (shCon and shSMN) or cortical neurons from a SMA mouse model (Con and SMA). (E) miR-183 inhibition increased S6K1 phosphorylation in SMN-deficient neurons. 50 nM siRNA and 50 nM LNA inhibitors are transfected to cortical neurons. Western blots were repeated twice with two different biological samples. Data represent mean + SEM.

142 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 23 6325 lines. We measured P-S6K1 protein as a marker of mTORC1 protein synthesis inhibitor, blocked this recovery (Fig. 5B). activity. Surprisingly, even though these cell lines do not These data suggest that recovery of GFP signal in the axons is exhibit significant differences in cell growth and apoptosis com- due to local protein synthesis (Fig. 5B). pared with those from healthy controls, fibroblast cell lines To test whether SMN-deficient neurons also exhibit impaired derived from type 1 SMA patients showed reduced mTOR activ- local translation, we performed FRAP experiments with mTor ity (Supplementary Material,Fig.S5B andC). These dataindicate reporter constructs in Smn-knockdown neurons. SMN-deficient that reduced SMN protein expression leads to down-regulation of neurons displayed impaired local translation for mTor (Fig. 5C). mTOR activity and impaired protein synthesis. To test whether We then asked whether knocking down miR-183 could regulate reduced mTOR activity can be restored by inhibition of miR- local protein synthesis of mTOR in SMN-deficient neurons. 183 in SMN-deficient neurons, we knocked down SMN and Inhibition of miR-183 with LNA improved fluorescence recov- miR-183 simultaneously in cortical neurons and measured phos- ery of mTor reporter constructs in SMN-deficient neurons phorylation of S6K1. Indeed, inhibition of miR-183 in SMN- (Fig. 5C), indicating an increase in the rate of local protein syn- deficient neurons increased phosphorylation of S6K1 (Fig. 4E). thesis for mTOR following miR-183 inhibition. To independent- These data support our hypothesis that down-regulated mTOR ly test our finding that mRNAs of mTor is locally translated, we activity can be recovered by inhibition of miR-183. asked whether mTor mRNA is present in neurites. We measured endogenous mRNA levels for mTor in the neurite compartment isolated from Boyden chambers. We found that the levels of Downloaded from mTOR is locally translated in the axon mTor mRNA is similar to those of the well-established axonal As miR-183 levels are increased in neurites of Smn-knockdown mRNA b-actin (Supplementary Material, Fig. S6B). From neurons and miR-183 regulates mTOR activity via direct binding these results, we conclude that expression of mTOR is regulated at the translational level in distal neurites. tothe3′ UTRofmTor,weaskedwhethermTorislocallytranslated in axons by performing fluorescence recovery after photobleach- http://hmg.oxfordjournals.org/ ing (FRAP). We expressed plasmids with myristoylated photo- Inhibition of miR-183 in spinal motor neurons improves destructible GFP fused to the 3′ UTR of mTor in hippocampal neurons. After 24 h, the GFP signals of the mTor reporter SMA mouse model constructs could be detected in growth cones and axons. Two Finally, we asked whether suppression of miR-183 could alter to three days after transfection, FRAP was performed using a the phenotype of an SMA mouse model. To test this, we pro- laser confocal microscope with live cell imaging (Fig. 5A and duced an adeno-associated virus serotype-9 (AAV9) vector car- Supplementary Material, Fig. S6A). The GFP signal was 50% rying a sponge sequence that would bind to and inhibit miR-183 recovered within 5 min after photobleaching, and anisomycin,# a expression following CNS injections of SMA mice. This vector at Harvard Library on February 2, 2015

Figure 5. mTor is locally translated in the axon and growth cones. (A) Representative images demonstrate FRAP in distal axons of hippocampal neurons transfected with dGFPmyr-mTor 3′ UTR over a period of 6 min. (B) Quantification of GFP intensity of dGFPmyr-mTor-3′ UTR in the distal axons and growth cones before and after photobleaching (PB). Anisomycin (50 mM, red) blocked recovery of GFP signal after PB compared with vehicle-treated neurons (DMSO, black). For each time point, the data represent a relative ratio of prebleach intensity (mean + SEM). DMSO: n 33 regions from 11 neurons, anisomycin: n 17 regions from 5 neurons. ¼ ¼ Statistical significance was determined by two-way ANOVA followed by Bonferroni’s post hoc test. DMSO versus anisomycin: ∗P , 0.05 from 3.99 to 8.06 min (C) Smn-knockdown neurons showed significantly reduced recovery of GFP signal, and inhibition of miR-183 in Smn-deficient neurons restored it. Control (black): n 52 from 19 neurons, Smn-knockdown (red): n 52 from 17 neurons and Smn and miR-183 double knockdown (blue): n 44 from 12 neurons. ¼ ¼ ¼ Control versus siSMN LNA-Scr; ∗P , 0.05 from 5.35 to 8.06 min, siSMN LNA-Scr versus siSMN LNA-183; ∗P , 0.05 from 2.86 to 8.06 min. Red bars represent times of photobleaching.+ + +

143 Author’s personal copy 6326 Human Molecular Genetics, 2014, Vol. 23, No. 23 has a beta-glucuronidase (GUSB) promoter that expresses pri- increase in righting reflex (Fig. 6E). Immunofluorescent staining marily in neurons (38), thus allowing us to restrict the inhibition confirmed that AAV9-sponge-183 virus infected motor neurons of miR-183expressionin spinal motor neurons and interneurons. in spinal cord (Fig. 6F). Despite the physiological improvement AAV9-sponge-183 reduced miR-183 expression to ,40% of in miR-183 inhibited SMA animals, we did not detect significant wild-type levels (from 1.3 to 0.5, compared with wild-type differences in NMJ morphology or survival of motor neurons control) (Fig. 6A). As miR-182 has very similar sequence with (Supplementary Material, Fig. S7A–D). miR-183, we also measured miR-182 expression as a control. miR-183 sponge sequence did not change miR-182 expression significantly. Remarkably, reduction of miR-183 in the spinal DISCUSSION cord extended the survival of SMA mice from an average of 16.5–19.5 days (Fig. 6B). Additionally, inhibition of miR-183 Local mRNA translation plays an important role in neuronal partially improved body weight and motor function, as measured development and synaptic plasticity, and its dysregulation can by grip test (Fig. 6C and D). However, there was no significant contribute to neurological disorders such as Fragile X Syndrome Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on February 2, 2015

Figure 6. AAV-sponge-mediated inhibition of miR-183 in spinal motor neurons improved survival, body weight and motor function in a mouse model of SMA. AAV9-Sponge-183, AAV9-GFP or saline was injected into the CNS of SMA mice on the day of birth. One cohort of mice was sacrificed on postnatal day 14 for age-matched expression analysis (A, F), and a second cohort of mice was analyzed for behavior and survival (B–E). (A) AAV9-Sponge-183 restored miR-183 expression in the spinal cord of SMA mice. Expression of miR-182, a miRNA from the same cluster and with a similar sequence did not show significant reduction. (B) Survival and behavior of animals. n 10 for saline-injected animals with median survival 16.5 days, n 12 for AAV9-GFP control with median survival of 17 days, and n 12 for AAV9-Sponge-183-injected¼ animals with median survival 19.5 days. Statistical significance¼ was determined by log-rank (Mantel–Cox) test and ¼ ∗∗P , 0.01. (C) Body weight, (D) grip strength and (E) rightingreflex were measuredat postnatal day 14. Statistical significance was determinedby one-wayANOVA followed by Bonferroni’s MultipleComparison test, ∗∗∗P , 0.001, ∗P , 0.05. (F) Fluorescent microscopy of the lumbarspinal cord of SMA mouse shows that AAV9 (GFP) was successfully delivered to motor neurons (ChAT).

144 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 23 6327 and SMA (25). Dysfunction of translational machinery has been markedly repress protein synthesis machinery, leading to neur- shown to contribute to neurological diseases. For example, onal dysfunction and aberrant neuronal connectivity. hyperactivation of mTOR plays an important role in the neuro- Several recent studies demonstrated roles for miRNAs in pathology of tuberous sclerosis and PTEN hamartoma syn- axonal growth, which are consistent with our findings. For dromes (25,39). Moreover, dysregulation of miRNA-mediated example, the miR-17 92 cluster increased axonal outgrowth translational repression has been implicated in many neurode- by repressing PTEN expression# in embryonic cortical neurons, generative diseases, including Alzheimer’s and Huntington’s and miR-16 regulates protein synthesis at the sympathetic neur- diseases (40,41). However, the interplay between miRNA ex- onal axons by inhibiting translation of eIF2B2 and eIF4G2 pression and the mTOR pathway has not been studied in motor (46,47). At the neuromuscular junction, miR-124 and miR-142 neuron diseases, especially with respect to the axonal local trans- modulate acetylcholine release via Rab3a, which is involved lation. Here, we report a previously unappreciated relationship in synaptic vesicle delivery in response to elevated NO signals between SMN, miRNA expression and mTOR signaling. from postsynaptic skeletal muscle (48). Motor neurons differen- In vivo experiments show that modulating mTOR levels via tiated from murine embryonic stem cells harboring a mutation miR-183 knockdown is a potential target for adjunctive treat- causing SMA showed dysregulation in miR-9 expression (24). ment in a severe mouse model of SMA. Although reducing Interestingly, miR-9 regulates axonal growth via regulation of miR-183 resulted in a significant increase in grip strength and MAP1b expression in neurons (49). Dysregulated miR-9 expres- median survival, we were not able to detect differences in sion in SMA neurons might also contribute to pathological Downloaded from gross NMJ morphology compared with control SMA mice. axonal morphology in SMA. These findings, together with our Future studies are needed to investigate the possibility that data, strongly suggest that axon growth and axonal local transla- subtle changes in the NMJ structure and/or function might tion are regulated by miRNAs and are dysregulated in SMA. have contributed to the observed improvement in motor function We demonstrate that inhibition of miR-183 rescues much of

and longevity. the neuronal phenotype associated with Smn-knockdown, par- http://hmg.oxfordjournals.org/ The mechanisms by which SMN deficiency leads to dysregu- ticularly axon outgrowth. miR-183 increases mTOR pathway lation of miRNA expression/localization and mTOR activity are activity, which contributes to this effect, but miR-183 may unclear. The predominant mechanism for miR-183 dysregula- have additional targets that also augment this result. Our findings tion appears to be post-transcriptional because the transcription are consistent with previous reports demonstrating that PTEN of miR-183 96 182 cluster is unchanged, and miR-182 from deletion in SMA neurons improved neuronal growth (50) and the same gene# cluster# is not affected by SMN loss. There are that IGF-1 enhanced survival of SMA mice (51,52). Our study several possible explanations for this observation. First, as provides a potential link between the SMN/miR-183/mTOR SMN plays a major role in splicing, incorrect splicing of genes interaction and the SMA neuronal phenotype. Most of the thera- important for miRNA biogenesis could lead to aberrant peutic strategies in SMA have focused on increasing SMN levels at Harvard Library on February 2, 2015 miRNA expression/distribution. Second, the SMN complex (38,53). Although our AAV9-sponge-183 modestly decreased is involved in the formation of ribonucleoproteins (RNPs) miR-183 expression to 50% of wild type, we nonetheless (42,43). Recently, our lab and others showed that SMN observed an improvement in a mouse model of SMA. Inhibition complex binds to the RNA-binding protein HuD and delivers of miR-183 alone unlikely provides a cure for SMA, but it may mRNAs to the axonal compartment to be translated locally work in concert with other therapeutic modalities that are (14,19). The SMN complex may play a role in the formation or aimed to increase SMN protein levels in cells. Whether similar trafficking of miRNA–RISC complexes and/or translational mechanisms are in play in human SMA disease requires future machinery. Third, loss of SMN may potentiate cellular stress investigations. If they are, then more efficient, cell-type-specific mechanisms. The SMN complex is necessary for stress modulation of the mTOR pathway via small molecules or RNAi granule formation and function in neurons (44). As stress gran- could potentially provide a new mechanism-based adjunctive ules may regulate miRNA function by sequestering Argonaute, therapy for this devastating disease. RNA-binding proteins and RNA editing enzymes (45), their dysfunction could also affect miRNA expression and distribution. Regardless of the mechanism, there appears to be specificity MATERIALS AND METHODS for certain miRNAs, suggesting that the distribution of different miRNAs may depend on distinct processing and transport Primary neuron cultures mechanisms. Identification of RNP complexes involved in trans- All experimental procedures were performed in compliance with port and processing of different miRNAs could help elucidate animal protocols approved by the IACUC at Boston Children’s these mechanisms. Hospital and University of Cologne. Hippocampi and cortices Another important consideration is that the role of mTOR- were dissected from E18 Sprague–Dawley rat embryos related protein synthesis in growing neurons, including mRNA (Charles River). Neurons were dissociated with papain, tritu- translation of mTOR pathway components, is regulated locally rated and plated on poly-D-lysine/Laminin-coated plates. Cells in developing axons. There have been numerous studies report- were plated at 1 M 250 K cells/6-well plates for biochemistry ing that the mTOR pathway plays a role in axonal outgrowth and 30 000 cells/24# well plates for immunostaining experiments. (25,28). In this study, we demonstrated that mTor itself is Neurons were cultured in Neurobasal medium with B27 supple- locally translated in the developing axon. Local synthesis of ment, 2 mML-glutamine, 1 pen-strep (Invitrogen) at 378C in a × the mTOR protein that is the master regulator of protein synthe- humidified incubator with 5% CO2. For the motor neuron sis has important implications. One would predict that down- culture, we used embryonic spinal motor neuron from E15 regulated mTOR signaling in SMN-deficient cells would Sprague–Dawley rat embryos (Charles River). Primary motor

145 Author’s personal copy 6328 Human Molecular Genetics, 2014, Vol. 23, No. 23 neurons were cultured with same media with 50 ng/ml BDNF, phospho-SGK (Ser255/Thr256, Millipore), Akt1 (Santa Cruz), 50 ng/ml GDNF and 25 ng/ml CNTF (PeproTech) as described SMN (Santa Cruz), mTOR (Cell Signaling), phospho-Akt1 before (14). (Ser473, Cell Signaling), PKCa (Cell Signaling), S6 (Cell Sig- naling), phospho-S6 (Ser240/244, Cell Signaling), S6K1 (Cell Signaling), SGK (Abcam), Tau (Millopore), RIP1 (Cell Signal- Boyden chamber and collection of samples from neurite ing), Caspase 3 (Cell Signaling), Lamin B1 (Abcam) and compartment GAPDH (Ambion). Cortical neurons were cultured on modiﬁed Boyden chambers as described previously (28). In brief, neurons were seeded on the Boyden membrane with 3-mm pores with Neurobasal media 3′ UTR reporter system, site directed mutagenesis and luciferase assay with B27 supplement, 2 mML-glutamine and 1 pen-strep (Invi- × trogen). We added this culture media with BDNF (50 ng/ml), We ampliﬁed 3′ UTR of mTOR from the rat genomic DNA and CNTF (50 ng/ml) and GDNF (25 ng/ml) to the lower compart- cloned into pmiR-report vector (Ambion). Three hundred nano- ment of the culture dishes. One day after seeding, cells were grams of reporter vectors were transiently transfected to infected with lentivirus containing either the shRNA against HEK293T cells together with 50 ng of control vector expressing Smn or the scramble control (14). Samples were collected 9 Renilla luciferase and 50 nM of pre-miRNA (AB) or LNA inhi- days after infection from both the lower membrane surface, bitors (Exiqon) using Lipofectamine2000 (Life Tech). In 24 h Downloaded from which contained mainly the neurite compartment and growth after transfection, cells were harvested and luciferase activity cones, and the upper membrane surface, which contained cell was measured with Dual luciferase system (Promega). To con- bodies. struct reported vector containing mutations in miRNA seed region, we used QuickChange II XL Site Directed Mutagenesis

Kit (Agilent). In brief, we designed primers containing inverted http://hmg.oxfordjournals.org/ RNA extraction and measuring expression of mRNAs sequences of 6 base pairs in seed region (IDT) and followed Total RNA was extracted using miRVana total RNA isolation kit manufacturer’s instruction for detailed procedures. Primer seq- (Ambion) according to manufacturer’s instruction. RNA uences used to make point mutation are for mTOR 3′ UTR, amount was measured using Nanodrop (Thermo Scientific). forward primer: 5′ GTATCTGAGTAATTTTTACCGTGA- To measure the expression of mRNAs, we used a previously TAAATGACATCAG 3′; reverse primer: 5′ CTGATGTCATT- described protocol (54). In brief, 120 ng of total RNA was TATCACGGTAAAAATTACTCAGATAC 3′. reversed-transcribed using cDNA Archiving Kit with random primers (Life Tech). Power SyBr Green PCR Master Mix (Life In situ hybridization of miR-183 using LNA probe Tech) was used to amplify and detect signals with 10 ng of at Harvard Library on February 2, 2015 and image analysis cDNA and 1 mM of each gene-specific primer. Sequences of individual primers for mRNA detection are in Supplementary Mater- We performed in situ hybridization of miR-183 with LNA ial, Table S7. Amplified signals were collected by 7300HT fast probes as previously described (7). We used 578C as a hybridiza- real-time System (ABI) and normalized with Gapdh intensity. tion temperature, which is 208C below Tm of our LNA probes. Images were taken with Zeiss Axio ImagerM2, and miR-183 signals from neurites were measured with ImageJ. We measured Multiplexed real-time PCR for miRNA analysis and single signals from neurites at least 25 mm away from cell body. miRNA analysis miRNA expression was also measured using multiplexed real- time PCR as described before (7). In brief, 187-plexed real-time Lentiviral production and infection PCR was used to measure the expression of individual miRNAs. Lentiviral particles were produced in HEK293T cells as Twenty nanograms of total RNA was reverse-transcribed using described before (55). In brief, lentiviral plasmids were transi- cDNA Archiving Kit (Life Tech) and 2.5 nM miRNA-specific ently transfected with packaging vectors using Lipofecta- reverse primers. cDNA was pre-amplified using a common mine2000 and OptiMEM (Life Tech). Lentiviral particles were reverse primer (UR) and miRNA-specific forward primers collected 48 h after transfection. using Universal Master Mix with no UNG (Life Tech). PCR product was diluted 4 times, and 0.1 ml was used for real-time PCR. Real-time PCR was performed in 7500HT fast real-time Immunostaining and axon length measurement System (ABI). To measure individual miRNA expression, we Neurons were fixed and stained with Tau antibody (Millipore) used Taqman microRNA assays (Lite Tech). Data were col- to measure axonal morphology. Tau-positive neurites were lected and analyzed as previously described (54). Threshold measured using ImageJ. cycles (Ct) were normalized by a single proportionality constant as we did not observe any Ct-dependent bias. miRNA inhibition in cultured neuron using transient transfection Western blotting We designed inhibitors of miRNA using Locked Nucleic Acid Protein expression was quantified by western blotting. Anti- technology (LNA, Exiqon). LNA sequence to inhibit expression bodies used for this study were purchased from phospho- of miR-183 was A G T G AATTCTACCAGTG C PKCa (Ser657, Millipore), phospho-S6K1 (Ser389, Millipore), C A T A.+ For+ the negative+ + control,+ we used C A +T + + + + + + +

146 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 23 6329

T AATGTCGGACAAC T C A A T (‘ ’ signiﬁcance was determined with two-way ANOVA followed locked+ + base). We transiently transfected+ + + LNA+ oligonucleotides+ + ¼ by Bonferroni’s post hoc test. using Lipofectamine2000 reagent and OptiMEM (Invitrogen) on 1 DIV. For transfection protocol, we followed the manufacturer’s instructions. SUPPLEMENTARY MATERIAL Supplementary Material is available at HMG online. Protein synthesis efﬁciency (SUnSET experiment)

Primary cultured neurons were incubated with 50 mM puro- ACKNOWLEDGEMENTS mycin, 1 h in their culture medium and protein was extracted. We thank members of the Sahin lab, Drs Larry Benowitz and Incorporated puromycin was quantified with anti-puromycin Elizabeth Engle for critical reading of the manuscript. We antibody (KeraFest) by western blot. Twenty micrograms of pro- thank Jason Steinberg, Abbey Sadowski, Sam Goldman, Emily teins were used for western analysis (37). Western blot images Greene-Colozzi, Jarrett Leech, Jie Bu and Amy Richards for were quantified with ImageJ. technical assistance. Human tissue was obtained from the Pedi- atric Neuromuscular Clinical Research Network (PNCRN). The Sponge-183 AAV production and injection role of the PNCR tissue repository is to distribute tissue and Downloaded from therefore cannot endorse the studies performed or the interpret- The sponge-183 sequence was cloned into a shuttle plasmid that ation of the results. contained the eGFP cDNA, the 0.4-kb human GUSB promoter and the self-complementary AAV2 inverted terminal repeats. Conflicts of Interest statement: Marco Passini and Pablo Sardi The sponge-183 sequence consisted of seven bulged binding are paid employees of Genzyme, a Sanofi Company. sites for miR-183 and four nucleotide spacer sequences (CCGG) http://hmg.oxfordjournals.org/ between them [5′ CAGTGAATTCTTATGTGCCATACCGG CAGTGAATTCTTATGTGCCATACCGGCAGTGAATTCTT FUNDING ATGTGCCATACCGGCAGTGAATTCTTATGTGCCATACCGG CAGTGAATTCTTATGTGCCATACCGGCAGTGAATTCT This work is supported in part by grants of the Slaney Family Fund, Whitehall Foundation and Boston Children’s Hospital TATGTGCCATACCGGCAGTGAATTCTTATGTGCCATA 3′ (56)]. TherecombinantplasmidwaspackagedintoAAVserotype-9 (BCH) Translational Research Program to M.S., and the BCH capsid by triple-plasmid co-transfection of HEK293 cells to gen- Intellectual and Developmental Disabilities Research Center erate AAV9-sponge-183 (scAAV2/9-GUSB-GFP-sponge-183). (P30 HD18655). M.K. was supported by a grant from the at Harvard Library on February 2, 2015 The negative control vector, AAV9-GFP (scAAV2/9-GUSB- Harvard NeuroDiscovery Center and fellowship from the GFP), was identical except that it did not contain the sponge- Hearst Foundation. E.D.N. received support from the Develop- 183 sequence. All animal procedures were performed under a mental Neurology Training Grant (T32 NS007473). P.N.’s re- protocol approved by the Institutional Animal Care and Use search was supported in part by the National Science Committee. On the day of birth (P0), pups received 2 ml into Foundation under Grant No. PHY05-51164. B.W. was supported each the right and left cerebral lateral ventricles and into the by grants of the Deutsche Forschungsgemeinschaft Wi945-14/1 lumbar spinal cord for a total volume of 6 ml and a total dose and the EU FP7/2007-2013 program under grant agreement no of 2.5e10 genome copies per pup. All the injections were per- 2012-305121 (Project acronym NeurOmics), the CMMC formed with a finely drawn glass micropipette needle as project no C11 and M.R. by SMA-Europe. U.M. was supported described earlier (57). A subset of the litters was treated with by grants from SMA-Europe, fSMA, MDA and R01 NS057482. saline to control for the injection procedure. Following the injections, the pups were toe-clipped and genotyped to identify SMA 2/2 / / /2 REFERENCES (Smn , hSMN2+ +, SMND7+ +), heterozygote (Smn+ , / / / / hSMN2+ +, SMND7+ +) and wild-type (Smn+ +, hSMN2+ +, 1. Sengupta, S., Nie, J., Wagner, R.J., Yang, C., Stewart, R. and Thomson, J.A. / (2009) MicroRNA 92b controls the G1/S checkpoint gene p57 in human SMND7+ +) mice. Behavioral tests and tissue analyses were per- embryonic stem cells. Stem Cells, 27, 1524–1528. formed as reported (57). 2. Conaco, C., Otto, S., Han, J.J. and Mandel, G. (2006) Reciprocal actions of REST and a microRNA promote neuronal identity. Proc. Natl. Acad. Sci. USA, 103, 2422–2427. Fluorescence recovery after photobleaching 3. Gao, J.,Wang,W.Y.,Mao,Y.W.,Graff, J.,Guan,J.S.,Pan, L.,Mak,G., Kim, D., Su, S.C. and Tsai, L.H. (2010) A novel pathway regulates memory and 3′ UTR of mTor was cloned into myristoylated GFP vectors to plasticity via SIRT1 and miR-134. Nature, 466, 1105–1109. measure local translation in neurons (gift from Dr Jeffery 4. Konopka, W., Kiryk, A., Novak, M., Herwerth, M., Parkitna, J.R., Twiss), as described previously (28). In brief, 3 UTR:myrGFP Wawrzyniak, M., Kowarsch, A., Michaluk, P., Dzwonek, J., Arnsperger, T. ′ et al. (2010) MicroRNA loss enhances learning and memory in mice. vectors were transfected into neurons using Amaxa nucleofec- J. Neurosci., 30, 14835–14842. tion (Lonza). We followed the manufacturer’s instruction for 5. Landthaler, M., Gaidatzis, D., Rothballer, A., Chen, P.Y., Soll, S.J., Dinic, experimental procedures. Two days after transfection, images L., Ojo, T., Hafner, M., Zavolan, M. and Tuschl, T. (2008) Molecular were collected using Zeiss LSM5 confocal microscopy with a characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. RNA, 14, 2580–2596. 378C platform and analyzed with Zen (Zeiss). For anisomycin 6. Murashov, A.K., Chintalgattu, V., Islamov, R.R., Lever, T.E., Pak, E.S., treatment, neurons were incubated with vehicle (DMSO) or Sierpinski, P.L., Katwa, L.C. and Van Scott, M.R. (2007) RNAi pathway is anisomycin (50 ng/ml) for 30 min before imaging. Statistical functional in peripheral nerve axons. FASEB J., 21, 656–670.

147 Author’s personal copy 6330 Human Molecular Genetics, 2014, Vol. 23, No. 23

7. Kye, M.J., Liu, T., Levy, S.F., Xu, N.L., Groves, B.B., Bonneau, R., Lao, K. 28. Nie, D., Di Nardo, A., Han, J.M., Baharanyi, H., Kramvis, I., Huynh, T., and Kosik, K.S. (2007) Somatodendritic microRNAs identified by laser Dabora, S., Codeluppi, S., Pandolfi, P.P., Pasquale, E.B. et al. (2010) capture and multiplex RT-PCR. RNA, 13, 1224–1234. Tsc2-Rheb signaling regulates EphA-mediated axon guidance. Nat. 8. Natera-Naranjo, O., Aschrafi, A., Gioio, A.E. and Kaplan, B.B. (2010) Neurosci., 13, 163–172. Identification and quantitative analyses of microRNAs located in the distal 29. Willis, D., Li, K.W., Zheng, J.Q., Chang, J.H., Smit, A., Kelly, T., Merianda, axons of sympathetic neurons. RNA, 16, 1516–1529. T.T., Sylvester, J., van Minnen, J. and Twiss, J.L. (2005) Differential 9. Banerjee, S., Neveu, P. and Kosik, K.S. (2009) A coordinated local transport and local translation of cytoskeletal, injury-response, and translational control point at the synapse involving relief from silencing and neurodegeneration protein mRNAs in axons. J. Neurosci., 25, 778–791. MOV10 degradation. Neuron, 64, 871–884. 30. Kerr, D.A., Nery, J.P., Traystman, R.J., Chau, B.N. and Hardwick, J.M. 10. Yoon, B.C., Zivraj, K.H. and Holt, C.E. (2009) Local translation and mRNA (2000) Survival motor neuron protein modulates neuron-specific apoptosis. trafficking in axon pathfinding. Results Probl. Cell. Differ., 48, 269–288. Proc. Natl. Acad. Sci. USA, 97, 13312–13317. 11. Wirth, B., Garbes, L. and Riessland, M. (2013) How genetic modifiers 31. Chen, W.W., Yu, H., Fan, H.B., Zhang, C.C., Zhang, M., Zhang, C., Cheng, influence the phenotype of spinal muscular atrophy and suggest future Y., Kong, J., Liu, C.F., Geng, D. et al. (2012) RIP1 mediates the protection of therapeutic approaches. Curr. Opin. Genet. Dev., 23, 330–338. geldanamycin on neuronal injury induced by oxygen-glucose deprivation 12. Burghes, A.H. and Beattie, C.E. (2009) Spinal muscularatrophy: why do low combined with zVAD in primary cortical neurons. J. Neurochem., 120, levels of survival motor neuron protein make motor neurons sick? Nat. Rev. 70–77. Neurosci., 10, 597–609. 32. Riessland, M., Ackermann, B., Forster, A., Jakubik, M., Hauke, J., Garbes, 13. Zhang, H., Xing, L., Rossoll, W., Wichterle, H., Singer, R.H. and Bassell, L., Fritzsche, I., Mende, Y., Blumcke, I., Hahnen, E. et al. (2010) SAHA G.J. (2006) Multiprotein complexes of the survival of motor neuron protein ameliorates the SMA phenotype in two mouse models for spinal muscular SMN with Gemins traffic to neuronal processes and growth cones of motor atrophy. Hum. Mol. Genet., 19, 1492–1506. Downloaded from neurons. J. Neurosci., 26, 8622–8632. 33. Weeraratne, S.D., Amani, V., Teider, N., Pierre-Francois, J., Winter, D., 14. Akten, B., Kye, M.J., Hao le, T., Wertz, M.H., Singh, S., Nie, D., Huang, J., Kye, M.J., Sengupta, S., Archer, T., Remke, M., Bai, A.H. et al. (2012) Merianda, T.T., Twiss, J.L., Beattie, C.E. et al. (2011) Interaction of survival Pleiotropic effects of miR-183 96 182 converge to regulate cell survival, of motor neuron (SMN) and HuD proteins with mRNA cpg15 rescues motor proliferation and migration in medulloblastoma.# # Acta Neuropathol., 123, neuron axonal deficits. Proc. Natl. Acad. Sci. USA, 108, 10337–10342. 539–552. 15. Pellizzoni, L., Kataoka, N., Charroux, B. and Dreyfuss, G. (1998) A novel

34. Choi, Y.J., Di Nardo, A., Kramvis, I., Meikle, L., Kwiatkowski, D.J., Sahin, http://hmg.oxfordjournals.org/ function for SMN, the spinal muscular atrophy disease gene product, in M. and He, X. (2008) Tuberous sclerosis complex proteins control axon pre-mRNA splicing. Cell, 95, 615–624. formation. Genes Dev., 22, 2485–2495. 16. Charroux,B., Pellizzoni,L., Perkinson, R.A., Shevchenko, A.,Mann,M. and 35. Huang, J. and Manning, B.D. (2009) A complex interplay between Akt, Dreyfuss, G. (1999) Gemin3: a novel DEAD box protein that interacts with TSC2 and the two mTOR complexes. Biochem. Soc. Trans., 37, 217–222. SMN, the spinalmuscular atrophygene product, and is a componentof gems. 36. Sarbassov, D.D., Ali, S.M., Kim, D.H., Guertin, D.A., Latek, R.R., J. Cell Biol., 147, 1181–1194. Erdjument-Bromage, H., Tempst, P. and Sabatini, D.M. (2004) Rictor, a 17. Charroux, B., Pellizzoni, L., Perkinson, R.A., Yong, J., Shevchenko, A., novel binding partner of mTOR, deﬁnes a rapamycin-insensitive and Mann, M. and Dreyfuss, G. (2000) Gemin4. A novel component of the SMN raptor-independent pathway that regulates the cytoskeleton. Curr. Biol., 14, complex that is found in both gems and nucleoli. J. Cell Biol., 148, 1296–1302. 1177–1186. 37. Schmidt, E.K., Clavarino, G., Ceppi, M. and Pierre, P. (2009) SUnSET, a

18. Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., at Harvard Library on February 2, 2015 nonradioactive method to monitor protein synthesis. Nat. Methods, 6, Rappsilber, J., Mann, M. and Dreyfuss, G. (2002) miRNPs: a novel class of 275–277. ribonucleoproteins containingnumerousmicroRNAs. Genes Dev., 16, 720– 38. Hua, Y., Sahashi, K., Hung, G., Rigo, F., Passini, M.A., Bennett, C.F. and 728. Krainer, A.R. (2010) Antisense correction of SMN2 splicing in the CNS 19. Fallini, C., Zhang, H., Su, Y., Silani, V., Singer, R.H., Rossoll, W. and rescues necrosis in a type III SMA mouse model. Genes Dev., 24, Bassell, G.J. (2011) The survival of motor neuron (SMN) protein interacts 1634–1644. with the mRNA-binding protein HuD and regulates localization of poly(A) mRNA in primary motor neuron axons. J. Neurosci., 31, 3914–3925. 39. Kelleher, R.J. 3rd. and Bear, M.F. (2008) The autistic neuron: troubled 20. Hubers, L., Valderrama-Carvajal, H., Laframboise, J., Timbers, J., Sanchez, translation? Cell, 135, 401–406. G. and Cote, J. (2011) HuD interacts with survival motor neuron protein and 40. Lehmann, S.M., Kruger, C., Park, B., Derkow, K., Rosenberger, K., can rescue spinal muscular atrophy-like neuronal defects. Hum. Mol. Genet., Baumgart, J., Trimbuch, T., Eom, G., Hinz, M., Kaul, D. et al. (2012) An 20, 553–579. unconventional role for miRNA: let-7 activates Toll-like receptor 7 and 21. Piazzon, N., Rage, F., Schlotter, F., Moine, H., Branlant, C. and Massenet, S. causes neurodegeneration. Nat. Neurosci., 15, 827–835. (2008) In vitro and in cellulo evidences for association of the survival of 41. Packer, A.N., Xing, Y., Harper, S.Q., Jones, L. and Davidson, B.L. motor neuron complex with the fragile X mental retardation protein. J. Biol. (2008) The bifunctional microRNA miR-9/miR-9∗ regulates REST and Chem., 283, 5598–5610. CoREST and is downregulated in Huntington’s disease. J. Neurosci., 28, 22. Tadesse, H., Deschenes-Furry, J., Boisvenue, S. and Cote, J. (2008) KH-type 14341–14346. splicing regulatory protein interacts with survival motor neuron protein and 42. Gubitz, A.K., Feng, W. and Dreyfuss, G. (2004) The SMN complex. Exp. is misregulated in spinal muscular atrophy. Hum. Mol. Genet., 17, 506–524. Cell. Res., 296, 51–56. 23. Trabucchi, M., Briata, P., Garcia-Mayoral, M., Haase, A.D., Filipowicz, W., 43. Pellizzoni, L. (2007) Chaperoning ribonucleoprotein biogenesis in health Ramos, A., Gherzi, R. and Rosenfeld, M.G. (2009) The RNA-binding and disease. EMBO Rep., 8, 340–345. protein KSRP promotes the biogenesis of a subset of microRNAs. Nature, 44. Zou, T., Yang, X., Pan, D., Huang, J., Sahin, M. and Zhou, J. (2011) SMN 459, 1010–1014. deﬁciency reduces cellular ability to form stress granules, sensitizing cells to 24. Haramati, S., Chapnik, E., Sztainberg, Y., Eilam, R., Zwang, R., Gershoni, stress. Cell. Mol. Neurobiol., 31, 541–550. N., McGlinn, E., Heiser, P.W., Wills, A.M., Wirguin, I. et al. (2010) miRNA 45. Kedersha, N. and Anderson, P. (2007) Mammalian stress granules and malfunction causes spinal motor neuron disease. Proc. Natl. Acad. Sci. USA, processing bodies. Methods Enzymol., 431, 61–81. 107, 13111–13116. 46. Zhang, Y., Ueno, Y., Liu, X.S., Buller, B., Wang, X., Chopp, M. and Zhang, 25. Liu-Yesucevitz, L., Bassell,G.J.,Gitler, A.D.,Hart, A.C.,Klann,E., Richter, Z.G. (2013) The microRNA-17–92 cluster enhances axonal outgrowth in J.D., Warren, S.T. and Wolozin, B. (2011) Local RNA translation at the embryonic cortical neurons. J. Neurosci., 33, 6885–6894. synapse and in disease. J. Neurosci., 31, 16086–16093. 47. Kar, A.N., Macgibeny, M.A., Gervasi, N.M., Gioio, A.E. and Kaplan, B.B. 26. Fallini, C., Bassell, G.J. and Rossoll, W. (2012) Spinal muscular atrophy: the (2013) Intra-axonal synthesis of eukaryotic translation initiation factors role of SMN in axonal mRNA regulation. Brain Res., 1462, 81–92. regulates local protein synthesis and axon growth in rat sympathetic neurons. 27. Rossoll, W., Jablonka, S., Andreassi, C., Kroning, A.K., Karle, K., Monani, J. Neurosci., 33, 7165–7174. U.R. and Sendtner, M. (2003) Smn, the spinalmuscular atrophy-determining 48. Zhu, H., Bhattacharyya, B.J., Lin, H. and Gomez, C.M. (2013) Skeletal gene product, modulates axon growth and localization of beta-actin mRNA muscle calpain acts through nitric oxide and neural miRNAs to regulate in growth cones of motoneurons. J. Cell Biol., 163, 801–812. acetylcholine release in motor nerve terminals. J. Neurosci., 33, 7308–7324.

148 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 23 6331

49. Dajas-Bailador, F., Bonev, B., Garcez, P., Stanley, P., Guillemot, F. and small nuclear RNA (snRNA) strategy to correct splicing defects. Hum. Mol. Papalopulu, N. (2012) microRNA-9 regulates axon extension and branching Genet., 21, 2389–2398. by targeting Map1b in mouse cortical neurons. Nat. Neurosci., 15, 697–699. 54. Kye, M.J.,Neveu, P., Lee, Y.S.,Zhou, M., Steen, J.A., Sahin,M., Kosik,K.S. 50. Ning, K., Drepper, C., Valori, C.F., Ahsan, M., Wyles, M., Higginbottom, and Silva, A.J. (2011) NMDA mediated contextual conditioning changes A., Herrmann, T., Shaw, P., Azzouz, M. and Sendtner, M. (2010) PTEN miRNA expression. PLoS One, 6, e24682. depletion rescues axonal growth defect and improves survival in 55. Di Nardo, A., Kramvis, I., Cho, N., Sadowski, A., Meikle, L., Kwiatkowski, SMN-deﬁcient motor neurons. Hum. Mol. Genet., 19, 3159–3168. D.J. and Sahin, M. (2009) Tuberous sclerosis complex activity is required to 51. Bosch-Marce, M., Wee, C.D., Martinez, T.L., Lipkes, C.E., Choe, D.W., control neuronal stress responses in an mTOR-dependent manner. Kong,L., Van Meerbeke, J.P.,Musaro, A. and Sumner, C.J.(2011) Increased J. Neurosci., 29, 5926–5937. IGF-1 in muscle modulates the phenotype of severe SMA mice. Hum. Mol. 56. Elcheva, I., Goswami, S., Noubissi, F.K. and Spiegelman, V.S. (2009) Genet., 20, 1844–1853. CRD-BP protects the coding region of betaTrCP1 mRNA from 52. Shababi, M., Glascock, J. and Lorson, C.L. (2011) Combination of SMN miR-183-mediated degradation. Mol. Cell, 35, 240–246. trans-splicing anda neurotrophic factorincreases the life span and bodymass 57. Passini, M.A., Bu, J., Roskelley, E.M., Richards, A.M., Sardi, S.P., in a severe model of spinal muscular atrophy. Hum. Gene Ther, 22, 135–144. O’Riordan, C.R., Klinger, K.W., Shihabuddin, L.S. and Cheng, S.H. (2010) 53. Fernandez Alanis, E., Pinotti, M., Dal Mas, A., Balestra, D., Cavallari, N., CNS-targeted gene therapy improvessurvival and motor function in a mouse Rogalska, M.E., Bernardi, F. and Pagani, F. (2012) An exon-speciﬁc U1 model of spinal muscular atrophy. J. Clin. Invest., 120, 1253–1264. Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on February 2, 2015

149 $ ! ! Appendix!3!

“Interaction!of!survival!of!motor!neuron!(SMN)!and!HuD!proteins!

with!mRNA!cpg15!rescues!motor!neuron!axonal!deficits.”!

! ! ! ! $ Akten$B,$Kye$MJ,$Hao$le$T,$Wertz!MH,$Singh$S,$Nie$D,$Huang$J,$Merianda$TT,$Twiss$JL,$ Beattie$CE,$Steen$JA,$Sahin$M.$PNAS$108:10337I10342$2011$ $ $ $ $ This$ study$ focused$ on$ the$ axonal$ interaction$ of$ SMN$ with$ an$ RNAIbinding$ protein$HuD$and$mRNA$cpg15$and$the$consequences$of$SMN$loss$of$function$on$this$ interaction.$We$showed$that$overexpression$of$human$cpg15$in$in$a$zebrafish$model$ of$SMA$can$ameliorate$the$axonal$phenotype.$As$part$of$this$work,$I$cultured$cortical$ and$ motor$ neurons$ for$ 5DIV,$ then$ fixed$ and$ stained$ them$ for$ various$ markers$ including$ HuD,$ SMN,$ ChAT$ and$ tau$ and$ contributed$ to$ Figures$ S1$ and$ S2.$ I$ completed$axonal$imaging$studies$and$confirmed$coIlocalization$of$SMN$and$HuD$in$ cultured$primary$motor$neurons,$as$shown$in$Figure$1DIF.$$

150$ Author’s personal copy Interaction of survival of motor neuron (SMN) and HuD proteins with mRNA cpg15 rescues motor neuron axonal deﬁcits Bikem Aktena, Min Jeong Kyea, Le T. Haob, Mary H. Wertza, Sasha Singha, Duyu Niea, Jia Huanga, Tanuja T. Meriandac, Jeffery L. Twissc, Christine E. Beattieb, Judith A. J. Steena,1, and Mustafa Sahina,1 aThe F.M. Kirby Neurobiology Center, Department of Neurology, Children’sHospitalBoston,HarvardMedicalSchool,Boston,MA02115;bDepartment of Neuroscience and Center for Molecular Neurobiology, Ohio State University, Columbus, OH 43210; and cDepartment of Biology, Drexel University, Philadelphia, PA 19104

Edited* by Louis M. Kunkel, Children’s Hospital Boston, Boston, MA, and approved May 12, 2011 (received for review March 29, 2011) Spinal muscular atrophy (SMA), caused by the deletion of the SMN1 levels of β-actin mRNA in growth cones (4), lending credence to gene, is the leading genetic cause of infant mortality. SMN protein the hypothesis that SMN complex functions in mRNA transport, is present at high levels in both axons and growth cones, and loss of stability, or translational control in the axons. Reduced SMN its function disrupts axonal extension and pathfinding. SMN is levels may disrupt the assembly of such RNPs on target mRNAs, known to associate with the RNA-binding protein hnRNP-R, and leading to decreased mRNA stability and possibly transport together they are responsible for the transport and/or local trans- within the axons. Here we identify HuD as a novel interacting lation of β-actin mRNA in the growth cones of motor neurons. partner of SMN, and show that SMN and HuD both colocalize in However, the full complement of SMN-interacting proteins in neu- motor neurons and bind to the candidate plasticity-related gene 15 rons remains unknown. Here we used mass spectrometry to iden- (cpg15) mRNA. We also demonstrate that cpg15 mRNA coloc- tify HuD as a novel neuronal SMN-interacting partner. HuD is alizes with SMN protein in axons and is locally translated in growth a neuron-specific RNA-binding protein that interacts with mRNAs, cones. Finally, we show that in zebrafish, cpg15 overexpression including candidate plasticity-related gene 15 (cpg15). We show partially rescues SMN deficiency, demonstrating that cpg15 may that SMN and HuD form a complex in spinal motor axons, and serve as a modifier of SMA deficiency. These results identify cpg15 that both interact with cpg15 mRNA in neurons. CPG15 is highly as an mRNA target for the SMN–HuD complex and provide po- expressed in the developing ventral spinal cord and can promote tential avenues for studying the mechanisms of SMN function in motor axon branching and neuromuscular synapse formation, sug- motor neuron axons. gesting a crucial role in the development of motor axons and neuromuscular junctions. Cpg15 mRNA previously has been shown to Results localize into axonal processes. Here we show that SMN deficiency To examine the functional interactions of SMN in developing reduces cpg15 mRNA levels in neurons, and, more importantly, neurons, we performed mass spectrometry (MS) analysis of pro- NEUROSCIENCE cpg15 overexpression partially rescues the SMN-deficiency pheno- teins that coimmunoprecipitate with the SMN complex. Unlike type in zebrafish. Our results provide insight into the function of previous studies that investigated interactions of SMN using cell SMN protein in axons and also identify potential targets for the lines that overexpressed SMN with epitope tagging (7), we used study of mechanisms that lead to the SMA pathology and related primary embryonic cortical neurons to immunoprecipitate the en- neuromuscular diseases. dogenous SMN complex. We performed coimmunoprecipitation (co-IP) experiments under high stringency conditions to isolate neuritin | embryonic lethal abnormal vision Drosophila-like 4 (ELAV-L4) | proteins that associate with SMN, and chose a 1% false discovery local protein synthesis rate (FDR) cutoff for our database searches to ensure minimal false-positive peptide hits. As predicted from the previous estab- pinal muscular atrophy (SMA) is a devastating genetic disease lishment of SMN’s involvement in RNA biogenesis and splicing, Sleading to infant mortality, due mainly to the loss of α-motor the MS data from neuronal SMN immunoprecipitation (IP) neurons of the spinal cord and brainstem nuclei. SMA occurs due showed a strong association with known SMN interaction partners, to depletion of a ubiquitously expressed protein, SMN, which in including Gemin 2–8, RNA helicases (Ddx3x and Ddx17), nucle- all cells regulates RNA biogenesis and splicing through its role in olin (1, 7, 8), and hnRNP-R (9) (Fig. 1A and Table S1). In addition, the assembly of small nuclear ribonucleoprotein (snRNP) com- we detected a novel interaction with the RNA-binding protein plexes (1). Despite the well-characterized association of SMN (RBP) HuD (also known as ELAV-L4), with a consistently low fi with the snRNP complex in both the nucleus and cytoplasm of FDR (Fig. 1 A and B). HuD is a neuron-speci c RBP of the Hu/ motor neurons, in the axons SMN associates with mobile ribo- Elav-family that regulates the stability of mRNAs important for nucleoprotein (RNP) particles that are free of the core snRNP neural development and plasticity (10, 11). fi complex proteins (2). Thus, it is hypothesized that SMN may To further con rm the interaction of SMN with HuD, we function in the assembly of axonal RNPs to regulate axonal performed reciprocal IPs of the endogenous proteins that were mRNA transport and/or local protein synthesis (3, 4). Deficits in mRNA transport and local mRNA translation are associated with such neurologic disorders as fragile X syndrome and tuberous Author contributions: B.A., J.H., C.E.B., J.A.J.S., and M.S. designed research; B.A., M.J.K., L.T.H., M.H.W., S.S., and D.N. performed research; T.T.M. and J.L.T. contributed new sclerosis (5, 6). Therefore, the interaction of SMN complex with reagents/analytic tools; B.A., M.J.K., L.T.H., M.H.W., D.N., C.E.B., J.A.J.S., and M.S. analyzed other RNPs and their associated mRNAs within the axon may be data; and B.A., C.E.B., J.A.J.S., and M.S. wrote the paper. crucial to understanding the pathophysiology of SMA. The authors declare no conflict of interest. At present, the only RNP known to bind SMN in the axons is *This Direct Submission article had a prearranged editor. hnRNP-R, which regulates β-actin mRNA localization in growth 1To whom correspondence may be addressed. E-mail: [email protected] cones (4). In fact, dissociated motor neurons from a severe SMN- or [email protected]. fi −/− de ciency mouse model, Smn ;SMN2tg, display defects in ax- This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. onal growth and growth cone morphology and contain reduced 1073/pnas.1104928108/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1104928108 PNAS | June 21, 2011 | vol. 108 | no. 25 | 10337–10342

151 Author’s personal copy

Fig. 1. SMN interacts with HuD. (A) List of proteins that coimmunoprecipitate with SMN from cortical neurons with an FDR ∼1%. All peptides with a Mascot score >35 are listed. All proteins listed were found in three biological replicates. Unique peptides observed for each protein are listed in Table S1.(B)Mass spectrum of a peptide derived from HuD identified in SMN IP from cortical neurons. HuD protein is a strong interactor, with a protein score of 75 and an FDR of ≤1%. (C) IP from spinal cord lysates using the SMN, HuD, or IgG antibody. A 38-kDa band representing SMN protein is observed in the HuD IPs, and a 40- to 45-kDa band specific for HuD is seen in the SMN IPs. (D) Immunofluorescence with anti-SMN (green) and anti-HuD (red) showing colocalization of the HuD protein with SMN granules along the motor neuron axon (0.1-μm section). (E)DetailofD showing colocalization of SMN with HuD. Arrows indicate fully overlapping signals. (F)Graphofthemean± SEM percentage of SMN granules that colocalize with the HuD signal or synaptophysin signal (P < 0.005, Student t test; n =7–10 per group). identified in the co-IP from embryonic neuronal tissues. In both translational initiation (13). We reasoned that in developing cortical and spinal cord lysates, we detected endogenous HuD neurons, the interaction between HuD and SMN might regulate and SMN proteins in Western blot analyses of SMN IPs and the stability and/or transport of a subset of mRNAs; thus, we fo- HuD IPs, respectively (Fig. 1C). We then quantitatively analyzed cused on mRNAs that are essential during neuronal growth and the colocalization of SMN and HuD proteins in 5 d in vitro (DIV) differentiation, including those identified as HuD targets (GAP43, primary motor neuron cultures that were derived from E13 mouse cpg15, tau, and Homer) (14–17). Among the mRNAs that we spinal cord by immunopanning (Figs. S1A and S2). Motor neurons tested, cpg15 mRNA demonstrated relatively high abundance in that were double-labeled with anti-SMN and anti-HuD or anti- HuD IPs compared with other mRNAs (Fig. 2A and Table S2). synaptophysin antibodies were quantified for colocalization. Although there is no evidence suggesting that mRNAs bind SMN Quantitative analyses demonstrated a statistically nonrandom directly, such mRNAs as β-actin have been shown to bind and colocalization of SMN with HuD within the granules localizing to colocalize with the SMN-binding partner hnRNP-R along the neuronal processes, with a mean value of 52.7% ± 6.5%, where the axons (4, 18, 19). Similarly, we examined whether mRNAs abun- signal for SMN protein fully overlapped with the signal for HuD dant in HuD IPs could be detected in SMN IPs as well, and found protein (Fig. 1 D–F). In contrast, the colocalization of SMN with that levels of the mRNAs cpg15, β-actin, and GAP43 were com- synaptophysin, a relatively abundant protein in the axons (2), only parably detectable in SMN IPs (Fig. 2B). Because cpg15 mRNA revealed 19.0 ± 7.7% overlap (Fig. 1D and Fig. S1B). This overlap was the most abundant mRNA in HuD IPs and was also detected of SMN with synaptophysin differed significantly from the coloc- in SMN IPs, we decided to analyze whether this mRNA may play alization of SMN with HuD (Fig. 1F; P ≤ 0.005) and was similar to a role in defects induced by SMN deficiency in primary neurons. that previously reported for axonal SMN colocalizing with Gemin Cpg15 (also known as neuritin), is expressed in postmitotic proteins (2). Together with our co-IP data, these results indicate neurons, and its expression can be induced by neuronal activity that SMN associates with HuD in motor neurons, and that these and growth factors (20). CPG15 protein is known to protect two proteins colocalize in granules within motor neuron axons. cortical neurons from apoptosis by preventing activation of the HuD stabilizes mRNAs by binding to AU-rich elements (AREs) caspase pathway (21). In Xenopus, CPG15 protein is expressed in located in their 3′ UTR sequences (11, 12), and may promote the developing ventral spinal cord (22) and is involved in motor

10338 | www.pnas.org/cgi/doi/10.1073/pnas.1104928108 Akten et al.

152 Author’s personal copy

Fig. 2. Cpg15 mRNA interacts with HuD and SMN in vitro and in vivo. RNA was isolated from the HuD-IP (A)andSMN-IP(B) complexes of cortical neurons. RT- PCR was performed using primers specific for HuD, SMN, cpg15, β-actin, Homer, GAP43, Tau, EphA4, and GAPDH (n = 6, from three independent experiments and two technical replicates; Table S2). Data represent values normalized to IgG-IPs. (C) cpg15 mRNA (red) colocalizes with SMN protein (green) in motor neuron axons. (Inset) Arrows show colocalization of SMN and cpg15 mRNA within the axon. neuron axon branching and neuromuscular synapse formation Given the colocalization of SMN protein with HuD protein (23), suggesting that it plays a role in the development of motor and cpg15 mRNA in axons, we wanted to know whether cpg15 NEUROSCIENCE neuron axons and neuromuscular synapses. Interestingly, cpg15 mRNA is transported to and locally translated within the axons. To mRNA contains several AREs in its 3′ UTR that are known to explore this, we used a reporter construct encoding a modified interact with HuD protein (14, 17, 24) and is present in axons of GFP transcript fused to the full-length 3′ UTR of cpg15. The GFP cultured DRG neurons (16). Taking these previous observations protein encoded by this construct is myristoylated and destabilized into account, we analyzed cpg15 mRNA expression and colocali- (dGFPmyr-cpg15 3′ UTR), resulting in its restricted mobility and zation with SMN in embryonic mouse motor neuron axons. We rapid turnover, respectively. Expression of this plasmid in hippo- observed punctate staining for cpg15 mRNA that colocalized with campal neurons at 2 DIV resulted in a robust GFP signal in cell SMN protein along the motor neuron axons (Fig. 2C). A negative bodies, axons, and axon terminals (Fig S5). Using the fluorescence control cpg15 scrambled probe displayed faint background staining recovery after photobleaching (FRAP) method, we photobleached (Fig S3). Quantitative analyses of cpg15 punctae that colocalized transfected hippocampal neurons at the distal axonal terminal (i.e., with SMN demonstrated a statistically nonrandom colocalization, five or six cell body lengths away from the soma, ∼50–60 μm) in- with a mean value of 37.4% ± 4.5% (mean ± SEM; n = 6). This cluding the growth cone, and then monitored these neurons for pattern of colocalization suggests that SMN may play a regulatory signal recovery over a period of ∼12 min (Fig. 3 B and C). We used role in the local stability and/or translation of cpg15 mRNA within the translational inhibitor cycloheximide (CHX) as a control for the motor neuron axon and growth cone. translational recovery. We observed that the dGFPmyr-cpg15 3′ Our finding that SMN protein associates with HuD protein and UTR fluorescence signal recovery in control axons was rapid after the HuD target cpg15 mRNA in neurons led us to ask whether bleaching, whereas the dGFPmyr-cpg15 3′ UTR fluorescence re- SMN deficiency affects the abundance or cellular distribution of covery in axons pretreated with CHX was significantly repressed, cpg15 mRNA. To address this question, we compared the amount indicating that the observed recovery is indeed translation- of cpg15 mRNA in the neurite and cell body compartments of SMN dependent (Fig. 3 B and C). Taken together, these results indicate knockdown and control neurons. We used the modified Boyden that the 3′ UTR of cpg15 mRNA is sufficient for its transport along chamber system to harvest neurite-enriched lysates from cortical axons and localized translation within the axons. neuronal cultures (6) in which cells were infected with lentivirus Because previous studies have shown that CPG15 is important containing either SMN or control shRNAs (Fig. S4). In neurons for motor neuron axonal growth and synaptogenesis in Xenopus with reduced SMN protein levels, cpg15 mRNA was substantially (23), we asked whether CPG15 overexpression could modify SMA diminished in both the cell body and neurite compartments com- phenotype in vivo. To date, SMN2 and plastin 3 are the only two pared with control cultures (Fig. 3A). Other axonal mRNAs, in- identified genes that act as modifiers of SMA pathology (26, 27). cluding β-actin and GAPDH (25), did not show a significant change To investigate whether cpg15 might serve as a modifier gene of with SMN knockdown, suggesting that only selected mRNAs are SMN deficiency, we took advantage of the well-characterized affected in our experimental model (Fig. 3A). These results indicate zebrafish smn-morpholino (MO) model, in which motor axon de- that SMN deficiency affects cpg15 mRNA levels. velopment is specifically perturbed when SMN levels are decreased

Akten et al. PNAS | June 21, 2011 | vol. 108 | no. 25 | 10339

153 Author’s personal copy

Fig. 3. Cpg15 mRNA distribution and local translation. (A) cpg15 mRNA expression decreases in the neurites when SMN levels are reduced. Cortical neurons were infected with lentivirus carrying either SMN shRNA (shSMN) or the control empty vector (CTL). RNA was isolated from both compartments of the Boyden chamber after 10DIV. Equal amounts of RNA was used to prepare cDNAs and quantitative real-time RT-PCR was performed using primers specific for SMN, cpg15, β-actin, and GAPDH mRNA. Results are normalized to control conditions for the cell body and the neurites separately. *P < 0.0001, Student t test; n = 12, from six independent biological sets. Data are presented as mean ± SEM. (B) cpg15 is locally translated in the growth cones. Representative images demonstrate the fluorescence recovery after photobleaching (FRAP) in distal hippocampal axons transfected with dGFPmyr-cpg15 over a period of 12 min in the absence (Upper)orpresence(Lower)of100μMCHX.(Scalebar:10μm.) (C)Quantification of GFP intensity in the distal growth cones during prebleaching and postbleaching of hippocampal neurons in the absence (CTL, black line) or presence (+CHX, red line) of CHX. For each time point, the data represent an average percentage of prebleach intensity ± SEM, with the prebleach intensity normalized to 100 (n = 3 for the +CHX group; n = 5 for the CTL group). Significant recovery was observed by two-way ANOVA when comparing the CTL and +CHX groups at each time point: *P < 0.05 from 6.7 to 7.3 min; **P < 0.01 from 7.7 to 12 min.

(28) (Fig. 4 A and B). In this system, transgenic zebrafish with GFP- also show that cpg15 mRNA is a target of the SMN–HuD complex positive motor neurons and axons are injected at the one- or two- in neurons, such that a loss of SMN leads to a reduction in cpg15 cell stage with smn MO. At 28 h postfertilization, fish are classified mRNA level, and that the axonal defects observed in SMA as normal, mildly, moderately, or severely affected based on the zebrafish are rescued by the overexpression of human CPG15. Our motor axon defects (29). Such a classification of SMN-deficient findings elucidate an additional mechanism by which SMN de- motor neurons allows a rapid readout for modifier genes of SMN ficiency may lead to abnormal axons. (27, 29). To test whether cpg15 might modify Smn deficiency The SMN protein interacts with several proteins in neurons, in vivo, we overexpressed a human cpg15 construct in SMN- many of which have ubiquitous functions, such as pre-mRNA depleted zebrafish. Smn morphants were categorized as 19.7% ± splicing, RNA metabolism and helicase activity, E2-dependent 2.4% severe, 20% ± 0.6% moderate, 26% ± 1.6% mild, and 34% ± transcriptional activation, and mRNA transport (30). The best- 1% unaffected (Fig. 4D). After injection of cpg15 mRNA together characterized function of SMN is its role in pre-mRNA splicing, with smn MO, we observed a partial rescue of the motor axon where it forms a stable and stoichiometric complex with Gemins phenotype, with only 11% ± 3% severe, 16% ± 1.6% moderate, 2–8toregulatetheassemblyofsnRNPsandtheirsubsequenttrans- 22.7% ± 7.5% mild, and 50% ± 7.9% unaffected (Fig. 4 C and D; port into nuclei for target-specificpre-mRNAsplicing.snRNPsare P < 0.01). Partial rescue of the motor neuron axonal deficits ob- the major components of the spliceosome that consists of Smith served in Smn-deficient zebrafish by CPG15 supports the hypoth- antigen (Sm), Sm-like (LSm) proteins, and U small nuclear RNAs esis that CPG15 is an important downstream effector of SMN and (30). Interestingly, the axonal SMN complex is devoid of Sm pro- may serve as a modifier gene of SMA pathology in humans. teins (2) and instead interacts with LSm proteins, suggesting a role in the assembly of RNP complexes important for mRNA transport Discussion (31). Furthermore, SMN can form a complex with hnRNP-Q/R Currently, MS-based proteomics is the most sensitive and com- protein, an RNP that appears to regulate axonal transport of prehensive method for characterizing protein complexes. It is es- β-actin mRNA (4, 9). In the present study, using MS and reciprocal pecially applicable to the study of low- abundance complexes, such co-IP analysis on neuronal tissues, we identified HuD as an RBP as the SMN complex in neurons, where the starting material is that strongly associates with SMN in motor neuron axons. Our limited. Our MS analysis of SMN interactions in neurons allowed findings provide further support for the hypothesis that SMN can us to isolate in vivo associations of the SMN protein in a quantita- associate with multiple RBPs to regulate axonal mRNA levels in tive manner. Our MS and co-IP data demonstrate a strong interneurons, and that the different SMN–RBP complexes may be de- action between SMN and HuD in spinal motor neuron axons. They fined by their mRNA contents.

10340 | www.pnas.org/cgi/doi/10.1073/pnas.1104928108 Akten et al.

154 Author’s personal copy

whose transport and/or stability are controlled by SMN and SMN- associated RBPs. Understanding such interactions and their motor neuron–speciﬁc dynamics will bring new insight into the mechanisms of SMN and its role in disease pathology.

Materials and Methods See SI Materials and Methods for further experimental details.

Animals. All experimental procedures were performed in compliance with animal protocols approved by the Institutional Animal Care and Use Com- mittees at Children’sHospitalBostonandOhioStateUniversity.

Immunofluorescence and Colocalization Analysis. E13 mouse motor neurons Fig. 4. Cpg15 partially rescues SMN deficiency. (A–C) Lateral-view repre- were isolated and grown in culture media for 5 d, as described in SI Materials sentative images of Tg(hb9:GFP) embryos at 28 hpf uninjected (A), injected and Methods. After 5 DIV, dissociated E13 mouse motor neurons were fixed, with 9 ng of smn MO (B), and injected with 9 ng of smn MO and 200 ng of permeabilized in PBS Tween-20 (PBST), blocked in block buffer [5% normal full-length human cpg15 mRNA (C). (D) Full-length human cpg15 rescues goat serum (NGS) with 1× PBST], and incubated with primary antibodies motor axon defects caused by a reduction of Smn in zebrafish. Tg(hb9:GFP) diluted in block buffer at 4 °C overnight and then with secondary antibodies zebrafish injected with 9 ng of smn MO and scored at 28 hpf using previously diluted in block buffer for 5 h. Coverslips were mounted with Prolong-Gold published criteria (29) resulted in a distribution of fish with motor nerve mounting media with DAPI (Invitrogen). The identity of motor neurons was defects (n =260fish, 5,200 nerves, three injections). Coinjection of 9 ng of verified by morphology and immunostaining with mouse choline acetyl- smn MO with 200 pg of full-length human cpg15 mRNA was able to partially transferase (ChAT; 28C4, ab78023; Abcam). At 5 DIV, >90% of the cells rescue the nerve defects (n =326fish, 6,520 nerves; P < 0.01). The distri- stained positive for anti-mouse ChAT (Fig. S1). Monoclonal mouse antibody bution of larval classifications (severe, moderate, mild, and no defects) was to HuD (E-1, sc28299), monoclonal mouse synaptophysin antibody analyzed using the Mann–Whitney nonparametric rank test. (mab5258; Millipore), rabbit antibody to SMN (H-195, sc15320), and goat antibody to HB9 were used to detect colocalization of endogenous proteins fi fi Our analysis of known HuD-associated mRNAs in neurons in motor neuron axons. The speci city of mouse HuD was con rmed by fi Western blot analysis; the polyclonal rabbit SMN antibody also was con- identi ed cpg15 mRNA as a highly abundant mRNA in HuD IPs firmed on lysates obtained from control and shSMN-infected neurons (Fig. compared with other known targets of HuD, such as GAP43 and S6). Secondary antibodies to rabbit Alexa Fluor 488 (Invitrogen), rabbit Alexa Tau. Given the role of SMN–hnRNP–β-actin mRNA interaction Fluor 594 (Invitrogen), and goat Cy5 (Abcam) were used to detect respective in targeting the β-actin mRNA to the axons, a similar mechanism primary antibodies. Mouse antibody to Tau (mab3420; Millipore) was used appears to be at work with respect to the SMN/HuD protein to detect localization of SMN in the axons, and goat anti-Tau (C-17, sc1995) complex and cpg15 mRNA. Using the Boyden chamber system, we was used to detect localization of HuD in the axons (Fig. S2). Fluorescence found cpg15 mRNA expression in both the cell body and neurites imaging was visualized using a Zeiss LSM510 Meta NLO confocal microscope fi along with β-actin and GAPDH mRNAs. CPG15 appears to be a at a 63× magni cation with zoom. Axons were imaged in either green crucial downstream effector of SMN in neurons and may play (Alexa Fluor 488) or red (Alexa Fluor 594) channels along the z-axis (nine or ten 0.1-μm sections). Colocalization was measured using Zeiss LSM510 Im- a role in SMA disease by regulating axon extension and axon aging software, with the signal from individual puncta from each channel NEUROSCIENCE terminal differentiation. Whether this role is cell-autonomous or represented as peak intensity with a threshold value determined by the not is not clear, however. CPG15 previously has been shown to software. All of the green (SMN) puncta were counted, and all red puncta function noncell-autonomously to regulate the growth and matu- (representing either endogenous HuD or synaptophysin proteins) that fully ration of neighboring dendritic and axonal arbors (32, 33). Over- overlapped with green puncta (representing endogenous SMN protein) expression of CPG15 in SMA zebrafish motor neurons may exert were counted individually along the length of the axon (n = 10 for HuD vs. nonautonomous effects by interacting with its receptor on neigh- SMN colocalization and n =7forsynaptophysinvs.SMNcolocalization).The percentage of colocalization of SMN with HuD or synaptophysin was cal- boring cells supporting axonal growth and leading to partial rescue fi of the SMA phenotype. Identification of the CPG15 receptor culated, and the signi cance of the dataset was analyzed using the unpaired Student t test with Prism software. would provide important information to distinguish between these possible mechanisms. In addition, further analyses are needed to fi fi Zebra sh Morpholino and Overexpression Experiments. Human cpg15 was determine whether motor neuron de cits and lethality in mouse amplified with forward primer 5′-GATGGATCCCTATGGGACTTAAGTTG-3′ and SMA models can be rescued by CPG15 overexpression. reverse primer 5′-GATGAATTCTCAGAAGGAAAGCCAGG-3′ and then subcl- While this manuscript was being revised, two other groups oned into the pCS2+ vector using BamHI and EcoRI restriction sites. Plasmid reported an interaction between HuD and SMN, lending further DNA was linearized with NotI, and capped RNA was generated using the Sp6 support to our findings for a possible role of HuD in SMA pa- mMESSAGE mMACHINE kit (Ambion) following the manufacturer’s protocol. thology and the role of SMN–HuD interaction in mRNA trans- One- or two-cell stage Tg(hb9:GFP) (36) embryos were injected with ∼9ngof smn MO (28) with or without 200 pg of synthetic human cpg15 RNA using an port/stability in neurons. Hubers et al. (34) provided substantial fi evidence that methylation of HuD by coactivator-associated ar- MPPI-2 pressure injector (Applied Scienti c Instrumentation). Three separate experiments were performed, with at least 50 embryos analyzed per exper- ginine methyltransferase 1 regulates the ability of HuD to bind to iment. At 28 h postfertilization (hpf), live embryos were anesthetized with target mRNAs and SMN. Thus, it would be interesting to explore tricaine and mounted on glass coverslips for observation with a Zeiss Axio- whether cpg15 mRNA expression and axonal transportation are plan2 microscope. Motor axons were scored as described previously (see table also affected by HuD methylation. Fallini et al. (35) demonstrated 1 in ref. 29). In brief, motor axons innervating the mid-trunk (myotomes 7–16) that SMN and HuD are transported together in motor neurons, were examined under the compound microscope. Normal motor axon mor- and that SMN-deficient motor neurons have decreased amounts phology is stereotyped along the trunk, and decreasing Smn levels caused of HuD and poly(A) mRNA in their axons. Our results further motor axon truncations and abnormal branching. We defined abnormal highlight the role of SMN–HuD interaction and identify cpg15 branching as extra branches along the entire length of the motor axon or fi fi mRNA as a candidate mRNA that modifies SMA pathology. excessive branching at the distal region of the motor axon. We classi ed sh fi as having severe, moderate, mild, or no defects based on the character of the Together, these ndings support the notion that SMN forms other motor axon defects. Fish with at least 20% severe axon defects (i.e., trunca- RNP complexes in motor neurons that may serve to regulate tions or truncation with abnormal branching) or 40% moderate defects (i.e., stability and transport of a subset of target mRNAs into axonal abnormal branching without truncations, “wishboned” axons) were classified terminals. Characterization of the SMN–HuD complex will enable as severe. Fish classified as moderate had 10% severe defects, 20–40% identification of the full repertoire of associated axonal mRNAs moderate defects, or >40% mild defects (i.e., axons lacking sterotyped

Akten et al. PNAS | June 21, 2011 | vol. 108 | no. 25 | 10341

155 Author’s personal copy morphology but not abnormally branched). Fish classified as mild had 10% Waldon, Saima Ahmed, Abbey Sadowski, and Samuel Goldman for technical moderate defects and 20–40% mild defects. Each side of the fish was scored assistance. This work was supported in part by National Institutes of Health (20 total motor axons), and a classification was generated from the combined Grants R01 NS66973 (to J.A.J.S. and M.S.), NS041596 (to J.L.T.), and NS050414 (to C.E.B.); the SMA Foundation grants (to C.E.B. and M.S.), American motor axon defects. Data were analyzed and statistical significance was de- Academy of Neurology Foundation, the Slaney Family Fund and Children’s – termined using the Mann Whitney nonparametric rank test. Hospital Boston Translational Research Program grants (to M.S.), and Child- ren’sHospitalBostonMentalRetardationandDevelopmentalDisabilities ACKNOWLEDGMENTS. We thank Thomas Schwarz, Elly Nedivi, and members Research Center Grant P30 HD18655). B.A. is supported by a grant from of the M.S. laboratory for critical reading of the manuscript, and Xianhua the William Randolph Hearst Foundation. M.J.K. is supported by a grant Chen for sharing unpublished data. We also thank John Sauld, Zachary from the Harvard NeuroDiscovery Center.

1. Gubitz AK, Feng W, Dreyfuss G (2004) The SMN complex. Exp Cell Res 296:51–56. 19. Glinka M, et al. (2010) The heterogeneous nuclear ribonucleoprotein-R is necessary 2. Zhang H, et al. (2006) Multiprotein complexes of the survival of motor neuron protein for axonal β-actin mRNA translocation in spinal motor neurons. Hum Mol Genet 19: SMN with Gemins traffic to neuronal processes and growth cones of motor neurons. 1951–1966. JNeurosci26:8622–8632. 20. Nedivi E, Fieldust S, Theill LE, Hevron D (1996) A set of genes expressed in response to 3. Zhang HL, et al. (2003) Active transport of the survival motor neuron protein and the light in the adult cerebral cortex and regulated during development. Proc Natl Acad role of exon-7 in cytoplasmic localization. JNeurosci23:6627–6637. Sci USA 93:2048–2053. 4. Rossoll W, et al. (2003) Smn, the spinal muscular atrophy-determining gene product, 21. Putz U, Harwell C, Nedivi E (2005) Soluble CPG15 expressed during early development modulates axon growth and localization of beta-actin mRNA in growth cones of rescues cortical progenitors from apoptosis. Nat Neurosci 8:322–331. motoneurons. JCellBiol163:801–812. 22. Nedivi E, Javaherian A, Cantallops I, Cline HT (2001) Developmental regulation of 5. Wang H, et al. (2008) Dynamic association of the fragile X mental retardation protein CPG15 expression in Xenopus. JCompNeurol435:464–473. as a messenger ribonucleoprotein between microtubules and polyribosomes. Mol Biol 23. Javaherian A, Cline HT (2005) Coordinated motor neuron axon growth and Cell 19:105–114. neuromuscular synaptogenesis are promoted by CPG15 in vivo. Neuron 45:505–512. 6. Nie D, et al. (2010) Tsc2-Rheb signaling regulates EphA-mediated axon guidance. Nat 24. Tiruchinapalli DM, Caron MG, Keene JD (2008) Activity-dependent expression of – Neurosci 13:163 172. ELAV/Hu RBPs and neuronal mRNAs in seizure and cocaine brain. JNeurochem107: fi 7. Shafey D, Boyer JG, Bhanot K, Kothary R (2010) Identi cation of novel interacting 1529–1543. fi fi protein partners of SMN using tandem af nity puri cation. JProteomeRes9: 25. Taylor AM, et al. (2009) Axonal mRNA in uninjured and regenerating cortical 1659–1669. mammalian axons. JNeurosci29:4697–4707. 8. Lefebvre S, et al. (2002) A novel association of the SMN protein with two major non- 26. Lefebvre S, et al. (1997) Correlation between severity and SMN protein level in spinal ribosomal nucleolar proteins and its implication in spinal muscular atrophy. Hum Mol muscular atrophy. Nat Genet 16:265–269. Genet 11:1017–1027. 27. Oprea GE, et al. (2008) Plastin 3 is a protective modifier of autosomal recessive spinal 9. Rossoll W, et al. (2002) Specific interaction of Smn, the spinal muscular atrophy muscular atrophy. Science 320:524–527. determining gene product, with hnRNP-R and gry-rbp/hnRNP-Q: A role for Smn in 28. McWhorter ML, Monani UR, Burghes AH, Beattie CE (2003) Knockdown of the survival RNA processing in motor axons? Hum Mol Genet 11:93–105. motor neuron (Smn) protein in zebrafish causes defects in motor axon outgrowth and 10. Pascale A, et al. (2004) Increase of the RNA-binding protein HuD and posttran- pathfinding. JCellBiol162:919–931. scriptional up-regulation of the GAP-43 gene during spatial memory. Proc Natl Acad 29. Carrel TL, et al. (2006) Survival motor neuron function in motor axons is independent Sci USA 101:1217–1222. of functions required for small nuclear ribonucleoprotein biogenesis. JNeurosci26: 11. Hinman MN, Lou H (2008) Diverse molecular functions of Hu proteins. Cell Mol Life Sci – 65:3168–3181. 11014 11022. 12. Bolognani F, Contente-Cuomo T, Perrone-Bizzozero NI (2010) Novel recognition 30. Burghes AH, Beattie CE (2009) Spinal muscular atrophy: Why do low levels of survival – motifs and biological functions of the RNA-binding protein HuD revealed by genome- motor neuron protein make motor neurons sick? Nat Rev Neurosci 10:597 609. wide identification of its targets. Nucleic Acids Res 38:117–130. 31. di Penta A, et al. (2009) Dendritic LSm1/CBP80-mRNPs mark the early steps of trans- 13. Fukao A, et al. (2009) The ELAV protein HuD stimulates cap-dependent translation in port commitment and translational control. JCellBiol184:423–435. aPoly(A)-andeIF4A-dependentmanner.Mol Cell 36:1007–1017. 32. Nedivi E, Wu GY, Cline HT (1998) Promotion of dendritic growth by CPG15, an activity- 14. Tiruchinapalli DM, Ehlers MD, Keene JD (2008) Activity-dependent expression of RNA- induced signaling molecule. Science 281:1863–1866. binding protein HuD and its association with mRNAs in neurons. RNA Biol 5:157–168. 33. Cantallops I, Haas K, Cline HT (2000) Postsynaptic CPG15 promotes synaptic matura- 15. Atlas R, Behar L, Elliott E, Ginzburg I (2004) The insulin-like growth factor mRNA- tion and presynaptic axon arbor elaboration in vivo. Nat Neurosci 3:1004–1011. binding protein IMP-1 and the Ras-regulatory protein G3BP associate with tau mRNA 34. Hubers L, et al. (2011) HuD interacts with survival motor neuron protein and can and HuD protein in differentiated P19 neuronal cells. JNeurochem89:613–626. rescue spinal muscular atrophy-like neuronal defects. Hum Mol Genet 20:553–579. 16. Willis DE, et al. (2007) Extracellular stimuli specifically regulate localized levels of 35. Fallini C, et al. (2011) The survival of motor neuron (SMN) protein interacts with the individual neuronal mRNAs. JCellBiol178:965–980. mRNA-binding protein HuD and regulates localization of poly(A) mRNA in primary 17. Wang ZH, et al. (2011) HuD regulates cpg15 expression via the 3′-UTR and AU-rich motor neuron axons. JNeurosci31:3914–3925. element. Neurochem Res 36:1027–1036. 36. Flanagan-Steet H, Fox MA, Meyer D, Sanes JR (2005) Neuromuscular synapses can 18. Todd AG, et al. (2010) SMN, Gemin2 and Gemin3 associate with β-actin mRNA in the form in vivo by incorporation of initially aneural postsynaptic specializations. cytoplasm of neuronal cells in vitro. JMolBiol401:681–689. Development 132:4471–4481.

10342 | www.pnas.org/cgi/doi/10.1073/pnas.1104928108 Akten et al.

156 Appendix(4(

(

“Neuronal(Tsc1/2(complex(control(autophagy(through((

AMPK?dependent(regulation(of(ULK”(

( ( Di$Nardo$A,$Wertz(MH,$Kwiatkowski$E,$Tsai$PT,$Leech$JD,$Greene=Colozzi$E,$Goto$J,$ Dilsiz$P,$Talos$DM,$Clish$CB,$Kwiatkowski$DJ,$Sahin$M.$Human$Molecular$Genetics$ 23:3865=3874$2014$ $ $ $ For$my$rotation$in$the$Sahin$lab,$I$worked$closely$with$Dr.$Alessia$Di$Nardo$ on$ her$ project$ to$ examine$ altered$ expression$ of$ autophagy$ related$ proteins$ by$ western,$ qRT=PCR,$ and$ immunostaining.$ For$ this$ publication,$ I$ was$ specifically$ responsible$ for$ developing$ and$ troubleshooting$ an$ assay$ for$ quantification$ of$ transient=transfection$ of$ the$ red=LC3$ construct$ to$ investigate$ autophagosomes$ in$ cultured$neurons.$Briefly,$neurons$were$plated$at$low$density$on$24=well$coverslips$ were$ infected$ with$ a$ GFP=tagged$ ctl=shRNA$ or$ Tsc2=shRNA$ to$ knockdown$ Tsc2$ expression$followed$by$transient$transfection$for$48$hours$of$a$control=Red$vector$ or$Red=LC3$(a$marker$of$autophagosome).$20$randomly$selected$cells$were$imaged$ per$ experiment$ per$ condition,$ N=3$ experiments.$ GFP=Positive$ cells$ containing$ punctate$ Red=LC3$ staining$ were$ quantified$ by$ eye.$ The$ results$ of$ this$ experiment$ are$ shown$ in$ Supplementary$ Figure$ 4$ and$ are$ the$ basis$ for$ experiments$ with$ lentiviral$transduction$of$the$same$red=LC3$constructs$shown$in$Figure$1G=H.$

157$ Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 14 3865–3874 doi:10.1093/hmg/ddu101 Advance Access published on March 5, 2014 Neuronal Tsc1/2 complex controls autophagy through AMPK-dependent regulation of ULK1

Alessia Di Nardo1, Mary H. Wertz1, Erica Kwiatkowski1, Peter T. Tsai1, Jarrett D. Leech1, Emily Greene-Colozzi1, June Goto2, Pelin Dilsiz3, Delia M. Talos3, Clary B. Clish4, 2 1, David J. Kwiatkowski and Mustafa Sahin ∗

1The F.M. Kirby Neurobiology Center, Department of Neurology, Children’s Hospital Boston, Harvard Medical School, Boston, MA 02115, USA, 2Division of Translational Medicine, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA 02115, USA, 3Department of Neurology, New York University School of Medicine, New York, NY 10016, USA and 4Broad Institute of Massachusetts Institute of Technology and Harvard University, Downloaded from Cambridge, MA 02142, USA

Received November 13, 2013; Revised February 17, 2014; Accepted March 3, 2014

Tuberous sclerosis complex (TSC) is a disorder arising from mutation in the TSC1 or TSC2 gene, characterized http://hmg.oxfordjournals.org/ by the development of hamartomas in various organs and neurological manifestations including epilepsy, intellectual disability and autism. TSC1/2 protein complex negatively regulates the mammalian target of rapamycin complex 1 (mTORC1) a master regulator of protein synthesis, cell growth and autophagy. Autophagy is a cellular quality-control process that sequesters cytosolic material in double membrane vesicles called autophagosomes and degrades it in autolysosomes. Previous studies in dividing cells have shown that mTORC1 blocks autophagy through inhibition of Unc-51-like-kinase1/2 (ULK1/2). Despite the fact that autophagy plays critical roles in neuronal homeostasis, little is known on the regulation of autophagy in neurons. Here we show that unlike in non-neuronal cells, Tsc2-deficient neurons have increased autolysosome accumulation and autopha- at Harvard Library on November 2, 2014 gic flux despite mTORC1-dependent inhibition of ULK1. Our data demonstrate that loss of Tsc2 results in autophagic activity via AMPK-dependent activation of ULK1. Thus, in Tsc2-knockdown neurons AMPK activation is the dominant regulator of autophagy. Notably, increased AMPK activity and autophagy activation are also found in the brains of Tsc1-conditional mouse models and in cortical tubers resected from TSC patients. Together, our findings indicate that neuronal Tsc1/2 complex activity is required for the coordinated regulation of autophagy by AMPK. By uncovering the autophagy dysfunction associated with Tsc2 loss in neurons, our work sheds light on a previously uncharacterized cellular mechanism that contributes to altered neuronal homeostasis in TSC disease.

INTRODUCTION and mTORC2 (3). The TSC1/2 complex functions as a checkpoint for mTORC1 (4), which acts as an inhibitor of macroauto- Tuberous sclerosis complex (TSC) is a multisystem disease with phagy (hereafter referred to as autophagy) (5). an incidence of 1:6000 worldwide (1). Neurological manifes- Autophagy is a cellular quality-control and metabolic process tations include epilepsy," intellectual disability and autism with for the removal of damaged organelles and energy retrieval pathological abnormalities such as cortical tubers (2). TSC is whereby cytoplasmic material and damaged organelles are caused by TSC1 and TSC2 mutations that abrogate the activity engulfed in double membrane vesicles called autophagosomes of the TSC1/2 protein complex. The TSC1/2 complex plays a (6). The latter are delivered to the lysosome to form the autolyso- major role in controlling mammalian target of rapamycin some where the cargo is degraded by lysosomal proteases. The (mTOR), which exists in two distinct complexes: mTORC1 autophagosomal lipidated microtubule-associated protein 1

∗To whom correspondence should be addressed at: Department of Neurology, Children’s Hospital, 300 Longwood Avenue CLSB 13074, Boston, MA 02115, USA. Tel: 1 6179194518; Fax: 1 6177300242; Email: [email protected] + +

158 Author’s personal copy 3866 Human Molecular Genetics, 2014, Vol. 23, No. 14 light chain 3 (LC3-II), and the autophagy substrate sequesto- (Fig. 1D and F); however, the LC3-II accumulation (Fig. 1D–E) some p62/SQSTM1 are often used to monitor autophagy (7,8). sharply contrasted with the LC3-II reduction seen in either the The homeostatic function of this pathway is particularly critical Tsc12/2 (Fig. 1A and B) or the Tsc22/2 MEFs (16). Although for the brain where alterations of autophagy have been asso- autophagy is mainly regulated at the posttranslational level, ciated with several neurological disorders (9). Previous studies recent findings have shown that certain autophagy genes such have indicated that mTORC1 and the AMP-activated protein as LC3 can be regulated at the transcriptional level (25–27). kinase (AMPK) act respectively as an autophagy repressor and We confirmed that the Tsc2-sh neurons had a significant inducer through differential phosphorylation of the Atg1/ reduction in the Tsc2 mRNA expression but no difference in Unc-51-like-kinase1 (ULK1) (10–14). Despite the involvement LC3 transcriptional regulation or Tsc1 mRNA expression (Sup- of the mTORC1 pathway in autophagy and its critical role in plementary Material, Fig. S2A–C). The LC3-II accumulation neuronal function (15), most of the current knowledge on the observed in the Tsc2-sh neurons was autophagy dependent as effect of mTORC1 activity on autophagy is based on studies it was significantly reduced by silencing of the atg5 gene, performed using dividing cells (16,17). which is essential for autophagosome formation (28) (Supple- In this study, via knockdown of the Tsc2 gene in a cell culture mentary Material, Fig. S3A–C). system, we investigated how activation of mTORC1 affects To visualize autophagic organelles, we performed immuno- autophagy in postmitotic neurons. Here, we show that loss of fluorescent (IF) analysis of neuronal cultures transduced with a Tsc1/2 complex function and subsequent mTORC1 activation lentivirus expressing the membrane associated LC3B tagged to Downloaded from in neurons results in accumulation of the autophagic marker a red fluorescent protein (LV/Red-LC3) (27). Compared with LC3-II and of the autophagy substrate p62. Our data demonstrate controls, Tsc2-sh cultures had a significant increase in the per- that concomitant to mTORC1-mediated inhibitory phosphor- centage of neurons with LV/Red-LC3-positive organelles mea- ylation of ULK1 at Ser757, Tsc2-knockdown neurons have sured as red puncta (Fig. 1G and H). Similar results were increased AMPK-activation and AMPK-dependent activat- obtained when we expressed the Red-LC3 protein by transient http://hmg.oxfordjournals.org/ ing phosphorylation of ULK1 at Ser555. As a result, Tsc2- transfection of neurons transduced with a GFP-tagged version knockdown neurons have AMPK-dependent autophagic flux. of the Tsc2-shRNA virus. No puncta were observed when we Importantly, similar autophagy dysfunction was observed in expressed the Red alone (Supplementary Material, Fig. S4A–E). brain tissues of the Tsc1c/c;NestinCre and the Tsc1c/c;L7Cre condi- Electron microscopy (EM) is as another method often used to tional knockout mice and in cortical tuber specimens from TSC visualize autophagic organelles (27). Similar to the IF, EM patients. analysis revealed that Tsc2-sh neurons had a significant Our work reveals unexpected autophagy dysfunction specific- accumulation of double membrane organelles with dense ally associated with loss of TSC1/2 in brain tissue and the luminal material similar to surrounding cytosol resembling molecular mechanism underlying these defects. In contrast to late autophagosome vesicles (Fig. 1I and J). at Harvard Library on November 2, 2014 the current knowledge that mTORC1 activation by TSC1/2-loss To examine autophagic flux, we monitored LC3-II accumula- inhibits autophagy, we show evidence that Tsc2-knockdown tion in the presence and in the absence of the proton pump inhibi- neurons display increased accumulation of autolysosomes and tor bafilomycin A1 (bafA1)(29). BafA1 blocks the fusion autophagic activity through AMPK-dependent activation of between autophagosomes and autolysosomes thus an enhance- ULK1. The autophagy defects identified in this study may help ment of LC3-II in the presence of bafA1 indicates presence of to elucidate the mechanisms that contribute to altered neuronal autophagic flux while no change indicates inhibition of autopha- function in TSC disease. gic degradation. In addition, the ratio of LC3-II (bafA1 treated/ untreated) can be used to determine level of flux. Although the reduced ratio of LC3-II indicated that compared with controls RESULTS Tsc2-sh neurons had lower autophagic flux, we still observed accumulation of LC3-II in the bafA1-treated Tsc2-sh cultures Loss of Tsc1/2 in neurons results in accumulation of the versus the untreated ones, indicating the presence of autophagic autophagic marker LC3-II and autophagic organelles activity (Fig. 1K and M). Together, the identification of autopha- In dividing cells, mTORC1 inhibits autophagy, and accordingly, gic organelle accumulation and presence of autophagic activity we found that mTORC1 activation in Tsc12/2 mouse embryonic in the Tsc2-sh neurons suggest that the mechanisms of autop- fibroblasts (MEFs) reduced the level of LC3-II and increased p62 hagy regulation in response to reduced Tsc1/2 function differ (Fig. 1A–C). Since we had previously shown that knockdown of between neurons and fibroblasts. Tsc2 results in the same morphological and biochemical changes as Tsc1 knockout in dissociated cells (18), we used shRNA interference of the Tsc2 gene to investigate the effect of neuronal Tsc2-sh neurons have mTORC1-independent accumulation Tsc1/2-loss on autophagy. We choose Akt as loading control of autolysosomes as it was previously reported unchanged in different models of The identification of autophagic flux in the Tsc2-sh neurons was TSC-loss (19–24). As compared with controls (ctrl-sh), unexpected given that mTORC1 is a known repressor of the neurons transduced with Tsc2-shRNA (Tsc2-sh) lentivirus autophagy-initiating kinase ULK1 (10–13). To assess how displayed decreased Tsc2 protein expression and increased mTORC1 activity affected autophagy in Tsc2-sh neurons, we mTORC1 activation as shown by phosphorylation of the examined regulation of ULK1 in neurons in the presence and mTORC1 downstream target S6 protein (Fig. 1D; Supplemen- absence of the mTORC1-inhibitor rapamycin. Tsc2-knockdown tary Material, Fig. S1). Similarly to the MEFs, the Tsc2-sh neurons showed a rapamycin-sensitive increase in ULK1 phos- neurons had increased levels of the autophagy substrate p62 phorylation at the mTORC1-dependent inactivating site S757

159 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 14 3867 Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on November 2, 2014

Figure 1. Loss of Tsc1/2 in neurons results in accumulation of the autophagic marker LC3-II and autophagic organelles. (A) Representative western blot of LC3-II and p62 in wild-type (WT) and Tsc12/2 MEFs and in rat hippocampal neurons (D) transduced with control (ctrl-sh) and with Tsc2-sh lentivirus. S6 phosphorylation at Ser235/236 (p-S6) indicates mTORC1 activation. Densitometric quantification of LC3-II (MEFs in (B) n 4; neurons in (E) n 3) and p62 (MEFs in (C) n 4; neurons in (F) n 5) normalized to total Akt. Experiments performed on independent culture preparations.¼ (G) Tsc2-sh neurons¼ transduced with LV/Red-LC3¼ virus display accumulation¼ of red puncta. Immunofluorescent analysis of LV/Red-LC3 (in red) and mTORC1 activation identified by p-S6 antibody staining (in green) in ctrl-sh and in Tsc2-sh neurons. Scale bar is 10 mm. (H) Quantification of the percentage of neurons with red puncta (n 4; 20–60 neurons/exp.). ¼ ∗P , 0.05; ∗∗P , 0.01; ∗∗∗P , 0.001). (I) Representative EM images from control and Tsc2-sh cultures. Scale bar is 500 nM.(J) Quantification of organelles 2 with double membrane vesicles/EM field (50 mm ). A total of 51 control and 52 Tsc2-sh neurons were imaged and analyzed (∗∗∗P , 0.001). (K) Western blot of LC3-II in ctrl-sh and Tsc2-sh neurons untreated or treated with 400 nM bafilomycin (bafA1) for 4 h. (L) Densitometry quantification of LC3-II ratio (bafA1 treated/untreated) in ctrl-sh and Tsc2-sh cultures normalized to total Akt (n 4, P , 0.05). (M) Densitometry quantification of LC3-II level (a.u.) in untreated ¼ ∗ and bafA1-treated neurons. (n 6, ∗P , 0.05). Bars represent mean + s.e.m. ¼

(Fig. 2A and B). In addition, rapamycin reversed p62 accumula- exhibiting both red and green fluorescence when in the autopha- tion as assessed by both western blot and IF staining of Tsc2-sh gosome (RFP /GFP puncta) and red fluorescence only when neurons (Supplementary Material, Fig. S5A–D). Together, in the autolysosome+ + (RFP /GFP2 puncta) (27,30). The these findings suggest that mTORC1 acts as a repressor of autop- td-tag-LC3 reporter was able+ to track autophagic flux faithfully hagy in Tsc2-sh neurons. (Supplementary Material, Fig. S6). Compared with controls, the Intriguingly, rapamycin did not alter the elevated LC3-II Tsc2-sh neurons displayed a baseline increase in the number of levels in the Tsc2-knockdown neurons (Fig. 2A and C). autolysosomes and no change in the number of autophagosomes To directly examine whether mTORC1 activity affected the (Fig. 2D and E). While the autolysosome number was largely LC3-II transit through the autophagy pathway, we used the insensitive to mTORC1 inhibition, induction of autophagy tandem-tagged mCherry-EGFP-LC3B (td-tag-LC3) assay in with rapamycin significantly increased the autophagosomes. the absence and presence of rapamycin. The td-tag-LC3 reporter The findings that the baseline number of autophagosomes was construct is pH sensitive; thus, it allows the expression of LC3 unchanged despite ULK1 inhibition and that accumulation

160 Author’s personal copy 3868 Human Molecular Genetics, 2014, Vol. 23, No. 14 Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on November 2, 2014

Figure 2. Tsc2-sh neurons have mTORC1-dependent inhibition of ULK1 at S757 and mTORC1-independent accumulation of autolysosomes. (A) Representative western blot of ULK1 and LC3-II regulation in ctrl-sh and Tsc2-sh neurons untreated or treated with 20 nM rapamycin (rapa) for 24 h. Effective mTORC1 inhibition by rapamycin treatment is shown by reduced pS6 phosphorylation at S235/6. Densitometry quantification of p-ULK1 S757 (n 4) normalized to total ULK1 (B) and LC3-II (n 3) normalized to total Akt (C)( P , 0.01; P , 0.001). (D) Expression of the td-tag-LC3 vector in control and¼ in Tsc2-sh neurons untreated or treated ¼ ∗∗ ∗∗∗ with 20 nM rapamycin (rapa) for 24 h. Scale bar is 10 mm(E) Quantification of the number of RFP /GFP puncta (autophagosomes) per neurons or RFP /GFP2 + + + puncta (autolysosomes) per neurons (n 3, ∗P , 0.05). Bars represent mean + s.e.m. ≥ of autolysosomes was rapamycin insensitive indicate that at the AMPK-dependent site S555 (Fig. 3A–C). Notably, Tsc2-sh neurons have mTORC1-independent mechanism to Tsc2-sh neurons displayed increased AMP levels indicating en- regulate autophagy. ergetic stress, which is a prerequisite for AMPK activation (Fig. 3F). To confirm that ULK1 phosphorylation at S555 was AMPK dependent, we treated the Tsc2-sh neurons with the Tsc2-sh neurons have AMPK-dependent ULK1 pharmacological AMPK inhibitor, compound C (cC) (32). Com- activation and autolysosome accumulation pared with vehicle-treated neurons, Tsc2-sh neurons treated with Having identified autophagic flux in the Tsc2-sh neurons, we cC had a reduction of AMPK activation as shown by decreased hypothesized the existence of an autophagy initiation signal phosphorylation of AMPK at T172 and of its direct substrate counteracting mTORC1. We examined regulation of the the regulatory associated protein of mTORC1 (raptor) at S792 AMPK, which induces autophagy by direct activating phosphor- (33). Furthermore, cC treatment specifically reduced phosphorylation of ULK1 under conditions of energetic stress (11,14). ylation of ULK1 at S555 while it did not change the mTORC1- Compared with controls, Tsc2-sh neurons had a significant dependent ULK1 phosphorylation site S757 or p62 level increase of AMPK activation with higher phosphorylation (Fig. 3A, C and E). Interestingly, ULK1 activation by AMPK at T172 (31); moreover, ULK1 phosphorylation was increased was specific to neurons, as Tsc12/2 MEFs had no AMPK

161 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 14 3869 Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on November 2, 2014

Figure3.Tsc2-sh neurons haveAMPK-dependent ULK1activation and autolysosome accumulation. (A) Representative westernblot of ULK1and AMPKregulation inctrl-sh andTsc2-shneurons untreated or treatedwith5 mM cCfor 3 h.Quantificationofp-AMPK(T172)(n 3)(B),p-ULK1S555(n 5)(C),p-ULK1S757(n 4) (D) and p62 (n 3) (E). (F) Quantification of AMP level by LC–MC analysis in ctrl-sh and Tsc2-sh neurons¼ (n 4, P , 0.01). (G) Western¼ blot of LC3-II in ctrl-sh¼ ¼ ¼ ∗∗ and Tsc2-sh neurons untreated or treated with 400 nM bafilomycin (bafA1) for 4 h in the presence or in the absence of cC. (H) Densitometry quantification of LC3-II ratio (bafA treated/untreated) versus cC bafA /cC. (I) Expression of the td-tag-LC3 vector in control and in Tsc2-sh neurons untreated or treated with cC. Scale bar 1 + 1 is 10 mm. (J) Quantification of the RFP /GFP puncta and the RFP /GFP2 puncta per neuron. ∗P , 0.05; ∗∗P , 0.01; ∗∗∗P , 0.001. Bars represent mean + s.e.m. (n 3). + + + ≥ activation or ULK1-S555 phosphorylation (Supplementary Tsc1 gene silencing was confirmed by the increased phosphoryl- c/c Material, Fig. S7). We next addressed whether AMPK inhibition ation of S6 at S235/6 in the Tsc1 ; Nestin+ (Fig. 4A and F). c/c affected autophagic flux. cC treatment abrogated the LC3-II Notably, compared with controls, the brains of Tsc1 ; Nestin+ accumulation seen in the Tsc2-sh neurons in the presence of mice showed a significant increase in LC3-II (Fig. 4A and B). In c/c bafA1 and significantly reduced the number of autolysosomes addition, the Tsc1 ; Nestin+ brain lysates displayed significant in the td-tag-LC3 assay (Fig. 3G–L). Together, these data indi- increase in the phosphorylation of ULK1 at S555 and of raptor cate that autophagic flux and autolysosome accumulation we at S792, indicating AMPK activation similar to what we observed observe in Tsc2-knockdown neurons are AMPK dependent. in Tsc2-knockdown cultured neurons (Fig. 4A, C and E). c/c The Tsc1 ; L7+ mice have Tsc1 gene loss in the PC. These mice display autistic-like behaviors including abnormal social interaction, repetitive behavior and vocalization in addition LC3-II is increased in brain tissue of TSC mouse models to altered axonal morphology and PC excitability (34). Here, and in cortical tubers of TSC patients we used a viral vector approach to monitor autophagy. Cerebella To investigate whether the autophagy defect seen in the Tsc2-sh of 3- to 3.5-week-old controls and mutant mice were transduced c/c neurons also occurs in vivo, we examined Tsc1 ; Nestin+ and with a mixture of DsRed-LC3 (LV/Red-LC3) and GFP c/c Tsc1 ; L7+ mice, which have mTORC1 signaling activation in (LV/GFP) lentivirus. The mice were sacrificed 3 weeks after in- neuronal progenitor cells or cerebellar Purkinje cells (PC), jection, and LV/Red-LC3-positive organelles were identified respectively (21,34). Activation of the mTORC1 pathway by by examining red puncta in GFP expressing PC. Compared

162 Author’s personal copy 3870 Human Molecular Genetics, 2014, Vol. 23, No. 14 Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on November 2, 2014

Figure 4. LC3-II increase in brain tissue of TSC mouse models. (A) Western blot of LC3-II, ULK1 and AMPK activity in protein lysates from P0 brains of control Tsc1c/w;Nestin and mutant Tsc1c/c;Nestin mice. Loss of Tsc1/2 complex and high mTORC1 activity are demonstrated by reduced expression of the Tsc1 protein and increasedp-S6atS235/6inthe mutantmice.Quantification ofthe westernblotsbydensitometryanalysis.LC3-II(B) andp-S6S235/6(F)valueswereexpressedas fold change normalized to total S6 level; p-ULK1 S555 (C), p-AMPK T172 (D) and p-raptor (S792) (E) were normalized to the respective total protein bands (n 3–6 c/w c/c ¼ mice/group ∗P , 0.05, ∗∗P , 0.01). (G) Representative confocal images of control Tsc1 ;L7 (a–f) and mutant Tsc1 ;L7 (g–l) mice injected with LV/GFP and LV/ Red-LC3. GFP-fluorescence was used to identify injected PC. White boxes indicate zoom area in the controls (d–f) and in the mutant mice (j–l). GFP-positive PC of mutant mice display discrete LV/Red-LC3 puncta. Scale bars are 30 mm in top row and scale bar is 5 mm in bottom row. (H) Quantification of the number of LV/ Red-LC3 puncta in area unit of 103 mm2 (n 3 mice/group, P , 0.01). ¼ ∗∗

c/c with controls, Tsc1 ; L7+ mice had increased appearance of DISCUSSION LV/Red-LC3-positive puncta indicating accumulation of autophagic organelles (Fig. 4G and H). Therefore, the evaluation of Autophagy is a tightly regulated cellular quality-control mech- c/c autophagy in the brains of both the Tsc1 ; Nestin+ and the anism (9). Our work demonstrates that in neurons the Tsc1/2 c/c Tsc1 ; L7+ mice supports our findings that LC3-II and autopha- complex represents a critical node for AMPK-dependent regula- gic organelles accumulate under neuronal TSC loss. tion of autophagy. It was previously reported that Tsc1/ To address regulation of autophagy in TSC brain specimen, 2-deficient dividing cells have reduced autophagy via mTORC1- we used cortical tubers resected from TSC patients in compari- dependent inhibition and phosphorylation of ULK1 at S757. son with age-matched and region-match controls. Activation However, here we show that Tsc2-sh neurons have autophagic of mTORC1 was confirmed by increased pS6 phosphorylation activity through activation of ULK1 via AMPK-dependent at S235/6 in the cortical tuber lysates compared with controls phosphorylation at S555 concomitant with mTORC1 inhibition (Fig. 5A and F). A significant increase was observed in LC3-II of ULK1. The overall effect of AMPK activation of autophagy is relative to controls (Fig. 5A and B). In addition, the phosphoryl- autophagic flux and accumulation of autolysosomes. ation of ULK1 S555, AMPK T172 and raptor S792 were higher Autophagy plays an essential cytoprotective role to help in the TSC cortical tubers compared with controls (Fig. 5A, prevent buildup of protein aggregates and damaged organelles C–E). The identification of LC3-II accumulation and increased particularly critical to postmitotic neurons that cannot dilute AMPK/ULK1 activation in the cortical tubers is consistent with the byproducts of cellular metabolism or stress by cell division our findings in the Tsc2-sh cultures. Together, these data further (6). Several lines of evidence have previously indicated that support a role for the TSC1/2 complex in the control of neuronal loss of Tsc1/2 in neurons results in increased stress detrimental autophagy through AMPK-dependent regulation of ULK1. for neuronal homeostasis: (i) Tsc2-knockdown in neurons

163 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 14 3871 Downloaded from http://hmg.oxfordjournals.org/

Figure 5. Autophagy in cortical tubers of TSC patients. (A) Representative western blots of LC3-II, ULK1 and AMPK activation in protein lysates from control brain (C1 and C2) and cortical tubers (T1 and T2). (B–F) Quantification of the western blots by densitometry analysis. LC3-II (B) was normalized to actin; p-ULK1 S555 (C),p-AMPKT172(D), p-raptor(S792) (E) and p-S6S235/6(F) were normalized to therespectivetotal proteinbands. Valueswere expressedas foldchangerelativeto control levels (n 4 samples/group; ∗P , 0.05, ∗∗P , 0.01). Bars represent mean + s.e.m. ¼ at Harvard Library on November 2, 2014 leads to higher susceptibility to endoplasmic reticulum and oxi- raise the possibility that uncleared protein aggregates and dative stress (19), (ii) Tsc1/2-dependent inhibition of mTORC1 cellular debris may contribute to the altered cerebellar axonal is required to regulate autophagy in response to reactive oxygen morphology and PC loss in the mutant mice. Furthermore, the species (35) and (iii) mouse models of Tsc1/2 loss display accumulation of autolysosomes we identified in the Tsc2-sh increased stress responses (19,21,34). In this study, we also neurons may explain the presence of dysfunctional organelles show that Tsc2-knockdown neurons have increased AMP observed in the enlarged giant cells of the Tsc1/Nestin-rtTA levels thus indicating energetic stress. An open question knockout mice at late ages and of vacuole accumulation in the arising from this work is whether AMPK activation in giant cells seen in human tubers (22). Tsc2-knockdown neurons may represent a positive feedback In the brain, Tsc1/2 complex-mediated regulation of mTORC1 on autophagy to help prevent the long-term pathological effect is crucial for growth cone dynamics and proper axonal connectiv- of cellular stress as depicted in our working model (Fig. 6). ity (20). Remarkably, ULK1 has been implicated in synaptic vesi- Consistent with our findings, higher levels of the autophagic cles transport in Drosophila (40), in axonal elongation in organelle marker LC3-II was also found in hippocampal cultures Caenorhabditis elegans (41,42) and in neurite extension in transduced with Tsc1 shRNA, and the same study reported that mouse cerebellar granule cells (43). Although it is currently induction of efficient autophagic flux by Tsc1 overexpression unclear whether the role of ULK1 in autophagy is connected to was neuroprotective in a model of cerebral ischaemia (36). its other roles in neuronal function, our findings raise the possibil- Our data show that despite the AMPK-dependent autophagic ity that alteration in ULK1 regulation might contribute to both the activity, Tsc2-sh neurons have p62 accumulation, which was defects in autophagy and in neuronal connectivity in TSC. mTORC1 dependent as it was sensitive to rapamycin. Growing Depending on the disease status, autophagy has been found evidence suggests that aside from ULK1 suppression, mTORC1 beneficial or detrimental. Recently, significant advances have activation can affect autophagy through the regulation of lyso- been made in the discovery of autophagy inducers since somal biogenesis and function (37,38). Hence, in the Tsc2-sh several studies have shown the beneficial effect of autophagy neurons reduced p62 degradation may result from mTORC1- induction in the clearance of protein aggregates in neuronal dependent direct inhibition of autophagyat the termination stages. tissues affected by defective autophagy (44–46). The Defective autophagy is a hallmark of several neurodegenera- finding that increased AMPK-dependent activation of ULK1 tive diseases (39). Although TSC has never been classified as counteracts its inhibition by mTORC1 in Tsc2-knockdown a neurodegenerative disease, the increased stress response in neurons suggests that the use of autophagy enhancers may c/c the Tsc1 ; L7+ mice (34) together with the accumulation of be a potential therapeutic strategy for the neuronal pathology autophagic organelles identified by this study (Fig. 4G and H) of TSC.

164 Author’s personal copy 3872 Human Molecular Genetics, 2014, Vol. 23, No. 14 Downloaded from http://hmg.oxfordjournals.org/

Figure 6. Model for regulation of autophagy in the Tsc2-sh neurons. In wild-type cells, Tsc1/2 complex keeps mTORC1 under control and allows autophagy. In fibroblasts, when Tsc1/2 complex activity is lost, mTORC1 activation inhibits autophagy via ULK1 phosphorylation at S757. Neuronal Tsc1/2 complex allows autophagy by acting as a checkpoint on mTORC1. Prolonged Tsc1/2 complex loss causes a buildup of neuronal stress providing a positive feedback on autophagy via AMPK- dependent activation of ULK1 by phosphorylation at S555. Dysfunctional autophagy leads to accumulation of the autophagic substrate p62 and of autolysosomes. at Harvard Library on November 2, 2014 In conclusion, by uncovering that neuronal Tsc1/2 complex SUPPLEMENTARY MATERIAL controls autophagy through AMPK-dependent regulation of Supplementary Material is available at HMG online. ULK1, our study provides fundamental insights for the mechanisms that may underlie the neurological manifestations in TSC or TSC-related proteinopathies with defective autophagy. ACKNOWLEDGEMENTS MATERIALS AND METHODS The authors thank members of the Sahin lab for critical reading Rat hippocampal neuronal cultures were prepared as previously of the manuscript, Elizabeth Petri Henske, Hilaire C. Lam and published (19). HEK293T cells (ATCC) were used for these David Clapham for helpful discussions, Anthony Hill and studies. Autophagy was monitored by LC3-I to LC3-II conver- Boston Children’s Hospital Intellectual and Developmental sion, by quantification of Red fluorescent puncta in neuronal Disabilities Research Center for technical assistance (supported cultures transduced with Red-LC3 lentivirus or transiently trans- by P30HD18655). fected with the Red-LC3 construct, bythe td-tag-LC3 report con- Conflict of Interest statement. None declared. struct, by EM, by autophagic flux, by LV/Red-LC3 injection in cerebellar vermis and by p62/SQSTM1 accumulation. The cc c/c Tsc1 Nestin+ and the Tsc1 ; L7+ mice used in this study were previously described (21,34). Experimental procedures FUNDING were performed in compliance with animal protocols approved by the Animal Research Committee of Boston Children’s Hos- This work was supported by Nancy Lurie Marks Family Founda- pital. Human TSC specimens were collected from patients tion, Autism Speaks and Boston Children’s Hospital Transla- who underwent surgery for medically intractable epilepsy at tional Research Program (to M.S.), National Institute of Health New York University Langone Medical Center (NYULMC), [P01 NS024279 (to D.J.K.) and K08 NS083733 (to P.T.T.)], New York, NY, USA. Postmortem control samples were the Tuberous Sclerosis Alliance (to A.D.N.), FACES [Finding obtained from the Brain and Tissue Bank for Developmental a Cure for Epilepsy and Seizures (to D.M.T.)]. Control human Disorders at the University of Maryland, Baltimore, MD, tissue was obtained from the National Institute of Child Health USA. The study was approved by the NYULMC Institutional and Human Development- Brain and Tissue Bank for Develop- Review Board. Detailed descriptions are provided in Supple- mental Disorders at the University of Maryland, Baltimore, MD, mentary Material, Methods. USA, contract HHSN275200900011C,Ref.No.N01-HD-9-0011.

165 Author’s personal copy Human Molecular Genetics, 2014, Vol. 23, No. 14 3873

REFERENCES 23. Lee, C.H., Hong, C.H., Yu, H.S., Chen, G.S. and Yang, K.C. (2010) Transforming growth factor-beta enhances matrix metalloproteinase-2 1. Han, J.M. and Sahin, M. (2011) TSC1/TSC2 signaling in the CNS. FEBS expression and activity through AKT in fibroblasts derived from Lett., 585, 973–980. angiofibromas in patients with tuberous sclerosis complex. Br. J. Dermatol., 2. Tsai, P. and Sahin, M. (2011) Mechanisms of neurocognitive dysfunction 163, 1238–1244. and therapeutic considerations in tuberous sclerosis complex. Curr. Opin. 24. Sato, A., Kasai, S., Kobayashi, T., Takamatsu, Y., Hino, O., Ikeda, K. and Neurol., 24, 106–113. Mizuguchi, M. (2012) Rapamycin reverses impaired social interaction in 3. Huang, J. and Manning, B.D. (2009) A complex interplay between Akt, mouse models of tuberous sclerosis complex. Nat. Commun., 3, 1292. TSC2 and the two mTOR complexes. Biochem. Soc. Trans., 37, 217–222. 25. Rouschop, K.M., van den Beucken, T., Dubois, L., Niessen, H., Bussink, J., 4. Inoki, K., Li, Y., Zhu, T., Wu, J. and Guan, K.L. (2002) TSC2 is Savelkouls, K., Keulers, T., Mujcic, H., Landuyt, W., Voncken, J.W. et al. phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat. (2010) The unfolded protein response protects human tumor cells during Cell Biol., 4, 648–657. hypoxia through regulation of the autophagy genes MAP1LC3B and ATG5. 5. Arsham, A.M. and Neufeld, T.P. (2006) Thinkingglobally and acting locally J. Clin. Invest., 120, 127–141. with TOR. Curr. Opin. Cell Biol., 18, 589–597. 26. Moussay, E., Kaoma, T., Baginska, J., Muller, A., Van Moer, K., Nicot, N., 6. Mizushima, N., Levine, B., Cuervo, A.M. and Klionsky, D.J. (2008) Nazarov, P.V., Vallar, L., Chouaib, S., Berchem, G. et al. (2011) The Autophagy fights disease through cellular self-digestion. Nature, 451, acquisition of resistance to TNFalpha in breast cancer cells is associated with 1069–1075. constitutive activation of autophagy as revealed by a transcriptome analysis 7. Kabeya, Y., Mizushima, N., Ueno,T., Yamamoto, A., Kirisako, T., Noda, T., using a custom microarray. Autophagy, 7, 760–770. Kominami, E., Ohsumi, Y. and Yoshimori, T. (2000) LC3, a mammalian 27. Klionsky, D.J., Abdalla, F.C., Abeliovich, H., Abraham, R.T.,

homologue of yeast Apg8p, is localized in autophagosome membranes after Acevedo-Arozena, A., Adeli, K., Agholme, L., Agnello, M., Agostinis, P., Downloaded from processing. EMBO J., 19, 5720–5728. Aguirre-Ghiso, J.A. et al. (2012) Guidelines for the use and interpretation of 8. Pankiv, S., Clausen, T.H., Lamark, T., Brech, A., Bruun, J.A., Outzen, H., assays for monitoring autophagy. Autophagy, 8, 445–544. Overvatn, A., Bjorkoy, G. and Johansen, T. (2007) p62/SQSTM1 binds 28. Hara, T., Nakamura, K., Matsui, M., Yamamoto, A., Nakahara, Y., directly to Atg8/LC3 to facilitate degradation of ubiquitinated protein Suzuki-Migishima, R., Yokoyama, M., Mishima, K., Saito, I., Okano, H. aggregates by autophagy. J. Biol. Chem., 282, 24131–24145. et al. (2006) Suppression of basal autophagy in neural cells causes 9. Murrow, L. and Debnath, J. (2013) Autophagy as a stress-response and neurodegenerative disease in mice. Nature, 441, 885–889. quality-control mechanism: implications for cell injury and human disease. 29. Sarkar, S., Perlstein, E.O., Imarisio, S., Pineau, S., Cordenier, A., http://hmg.oxfordjournals.org/ Annu. Rev. Pathol., 8, 105–137. Maglathlin, R.L., Webster, J.A., Lewis, T.A., O’Kane, C.J., Schreiber, S.L. 10. Chang, Y.Y. and Neufeld, T.P. (2009) An Atg1/Atg13 complex with et al. (2007) Small molecules enhance autophagy and reduce toxicity in multiple roles in TOR-mediated autophagy regulation. Mol. Biol. Cell, 20, Huntington’s disease models. Nat. Chem. Biol., 3, 331–338. 2004–2014. 30. Renna, M., Schaffner, C., Winslow, A.R., Menzies, F.M., Peden, A.A., Floto, 11. Kim, J., Kundu, M., Viollet, B. and Guan, K.L. (2011) AMPK and mTOR R.A. and Rubinsztein, D.C. (2011) Autophagic substrate clearance requires regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol., activity of the syntaxin-5 SNARE complex. J. Cell Sci., 124, 469–482. 13, 132–141. 31. Alers, S., Loffler, A.S., Wesselborg, S. and Stork, B. (2012) Role of 12. Jung, C.H., Jun, C.B., Ro, S.H., Kim, Y.M., Otto, N.M., Cao, J., Kundu, M. AMPK-mTOR-Ulk1/2 in the regulation of autophagy: cross talk, shortcuts, and Kim, D.H. (2009) ULK-Atg13-FIP200 complexes mediate mTOR and feedbacks. Mol. Cell. Biol., 32, 2–11. signaling to the autophagy machinery. Mol. Biol. Cell, 20, 1992–2003. 32. Meley, D., Bauvy, C., Houben-Weerts, J.H., Dubbelhuis, P.F., Helmond, 13. Ganley, I.G., Lam du, H., Wang, J., Ding, X., Chen, S. and Jiang, X. (2009) M.T., Codogno, P. and Meijer, A.J. (2006) AMP-activated protein kinase at Harvard Library on November 2, 2014 ULK1.ATG13.FIP200 complex mediates mTOR signaling and is essential and the regulation of autophagic proteolysis. J. Biol. Chem., 281, for autophagy. J. Biol. Chem., 284, 12297–12305. 34870–34879. 14. Egan, D.F., Shackelford, D.B., Mihaylova, M.M., Gelino, S., Kohnz, R.A., 33. Gwinn, D.M., Shackelford, D.B., Egan, D.F., Mihaylova, M.M., Mery, A., Mair, W., Vasquez, D.S., Joshi, A., Gwinn, D.M., Taylor, R. et al. (2011) Vasquez, D.S., Turk, B.E. and Shaw, R.J. (2008) AMPK phosphorylation of Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase raptor mediates a metabolic checkpoint. Mol. Cell, 30, 214–226. connects energy sensing to mitophagy. Science, 331, 456–461. 34. Tsai, P.T., Hull, C., Chu, Y., Greene-Colozzi, E., Sadowski, A.R., Leech, 15. Garelick, M.G. and Kennedy, B.K. (2011) TOR on the brain. Exp. Gerontol., J.M., Steinberg, J., Crawley, J.N., Regehr, W.G. and Sahin, M. (2012) 46, 155–163. Autistic-like behaviour and cerebellar dysfunction in Purkinje cell Tsc1 16. Parkhitko, A., Myachina, F., Morrison, T.A., Hindi, K.M., Auricchio, N., mutant mice. Nature, 488, 647–651. Karbowniczek, M., Wu, J.J., Finkel, T., Kwiatkowski, D.J., Yu, J.J. et al. 35. Zhang, J., Kim, J., Alexander, A., Cai, S., Tripathi, D.N., Dere, R., Tee, A.R., (2011) Tumorigenesis in tuberous sclerosis complex is autophagy and p62/ Tait-Mulder, J., Di Nardo, A., Han, J.M. et al. (2013) A tuberous sclerosis sequestosome 1 (SQSTM1)-dependent. Proc. Natl. Acad. Sci. USA, 108, complex signalling node at the peroxisome regulates mTORC1 and 12455–12460. autophagy in response to ROS. Nat. Cell Biol., 15, 1186–1196. 17. Qin, L., Wang, Z., Tao, L. and Wang, Y. (2010) ER stress negatively 36. Papadakis, M., Hadley, G., Xilouri, M., Hoyte, L.C., Nagel, S., McMenamin, regulates AKT/TSC/mTOR pathway to enhance autophagy. Autophagy, 6, M.M., Tsaknakis, G., Watt, S.M., Drakesmith, C.W., Chen, R. et al. (2013) 239–247. Tsc1 (hamartin) confers neuroprotection against ischemia by inducing 18. Choi, Y.J., Di Nardo, A., Kramvis, I., Meikle, L., Kwiatkowski, D.J., Sahin, autophagy. Nat. Med., 19, 351–357. M. and He, X. (2008) Tuberous sclerosis complex proteins control axon 37. Settembre, C., Di Malta, C., Polito, V.A., Garcia Arencibia, M., Vetrini, F., formation. Genes Dev., 22, 2485–2495. Erdin, S., Erdin, S.U., Huynh, T., Medina, D., Colella, P. et al. (2011) TFEB 19. Di Nardo, A., Kramvis, I., Cho, N., Sadowski, A., Meikle, L., Kwiatkowski, links autophagy to lysosomal biogenesis. Science, 332, 1429–1433. D.J. and Sahin, M. (2009) Tuberous sclerosis complex activity is required to 38. Korolchuk, V.I. and Rubinsztein, D.C. (2011) Regulation of autophagy by control neuronal stress responses in an mTOR-dependent manner. lysosomal positioning. Autophagy, 7, 927–928. J. Neurosci., 29, 5926–5937. 39. Son, J.H., Shim, J.H., Kim, K.H., Ha, J.Y. and Han, J.Y. (2012) Neuronal 20. Nie, D., Di Nardo, A., Han, J.M., Baharanyi, H., Kramvis, I., Huynh, T., autophagy and neurodegenerative diseases. Exp. Mol. Med., 44, 89–98. Dabora, S., Codeluppi, S., Pandolfi, P.P., Pasquale, E.B. et al. (2010) 40. Toda, H., Mochizuki, H., Flores, R. 3rd, Josowitz, R., Krasieva, T.B., Tsc2-Rheb signaling regulates EphA-mediated axon guidance. Nat. Lamorte, V.J., Suzuki, E., Gindhart, J.G., Furukubo-Tokunaga, K. and Neurosci., 13, 163–172. Tomoda, T. (2008) UNC-51/ATG1 kinase regulates axonal transport by 21. Anderl, S., Freeland, M., Kwiatkowski, D.J. and Goto, J. (2011) Therapeutic mediating motor-cargo assembly. Genes Dev., 22, 3292–3307. value of prenatal rapamycin treatment in a mouse brain model of tuberous 41. Ogura, K. and Goshima, Y. (2006) The autophagy-related kinase UNC-51 and sclerosis complex. Hum. Mol. Genet., 20, 4597–4604. its binding partner UNC-14 regulate the subcellular localization of the Netrin 22. Goto, J., Talos, D.M., Klein, P., Qin, W., Chekaluk, Y.I., Anderl, S., receptor UNC-5 in Caenorhabditis elegans. Development, 133, 3441–3450. Malinowska, I.A., Di Nardo, A., Bronson, R.T., Chan, J.A. et al. (2011) 42. Ogura, K., Wicky, C., Magnenat, L., Tobler, H., Mori, I., Muller, F. and Regulable neural progenitor-specific Tsc1 loss yields giant cells with Ohshima, Y. (1994) Caenorhabditis elegans unc-51 gene required for axonal organellar dysfunction in a model of tuberous sclerosis complex. Proc. Natl. elongation encodes a novel serine/threonine kinase. Genes Dev., 8, Acad. Sci. USA, 108, E1070–E1079. 2389–2400.

166 Author’s personal copy 3874 Human Molecular Genetics, 2014, Vol. 23, No. 14

43. Tomoda, T., Bhatt, R.S., Kuroyanagi, H., Shirasawa, T. and Hatten, M.E. 45. Tsvetkov, A.S., Miller, J., Arrasate, M., Wong, J.S., Pleiss, M.A. and (1999) A mouse serine/threonine kinase homologous to C. elegans UNC51 Finkbeiner, S. (2010) A small-molecule scaffold induces autophagy in functions in parallel ﬁber formation of cerebellar granule neurons. Neuron, primary neurons and protects against toxicity in a Huntington disease model. 24, 833–846. Proc. Natl. Acad. Sci. USA, 107, 16982–16987. 44. Williams, A., Sarkar, S., Cuddon, P., Ttoﬁ, E.K., Saiki, S., Siddiqi, F.H., 46. Sarkar, S. (2013) Regulation of autophagy by mTOR-dependent and Jahreiss, L., Fleming, A., Pask, D., Goldsmith, P. et al. (2008) Novel targets mTOR-independentpathways: autophagydysfunction inneurodegenerative for Huntington’s disease in an mTOR-independent autophagy pathway. Nat. diseases and therapeutic application of autophagy enhancers. Biochem. Soc. Chem. Biol., 4, 295–305. Trans., 41, 1103–1130. Downloaded from http://hmg.oxfordjournals.org/ at Harvard Library on November 2, 2014

167 $ ! ! Appendix!5!

“Divergent!dysregulation!of!gene!expression!in!murine!models!of!

fragile!X!syndrome!and!tuberous!sclerosis”!

! ! ! ! Kong$SW,$Sahin$M,$Collins$CD,$Wertz!MH,$Campbell$MG,$Leech$JD,$Krueger$D,$Bear$ MF,$Kunkel$LM,$Kohane,$IS.$Molecular$Autism$5:16$2014$ $ $ $ The$aim$of$this$work$was$to$understand$the$molecular$convergence$of$two$ monogenic$disorders$Tuberos$Sclerosis$(TSC)$and$Fragile$X$syndrome$with$high$coS morbidity$ with$ Autism$ Spectrum$ Disorders$ (ASDs)$ to$ identify$ common$ pathways$ that$may$contribute$to$disease$etiology.$As$part$of$this$work,$I$performed$qRTSPCR$ on$mRNA$extracted$from$TSC2+/'(and$Fmr1'KO$mouse$brains$for$Tsc2,$EPS811,$and$

Grin3A$ to$ validate$ the$ findings$ of$ the$ microarrays.$ The$ results$ of$ this$ analysis$

(discussed$on$pages$4S5)$showed$differential$expression$of$EPS811$and$Grin3A$in$ these$models$and$helped$confirm$the$findings$of$the$microarray$experiments.$

168$ Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 http://www.molecularautism.com/content/5/1/16

RESEARCH Open Access Divergent dysregulation of gene expression in murine models of fragile X syndrome and tuberous sclerosis Sek Won Kong1,5†, Mustafa Sahin2†, Christin D Collins3, Mary H Wertz2, Malcolm G Campbell5, Jarrett D Leech2, Dilja Krueger4, Mark F Bear4, Louis M Kunkel3 and Isaac S Kohane1,5*

Abstract Background: Fragile X syndrome and tuberous sclerosis are genetic syndromes that both have a high rate of comorbidity with autism spectrum disorder (ASD). Several lines of evidence suggest that these two monogenic disorders may converge at a molecular level through the dysfunction of activity-dependent synaptic plasticity. Methods: To explore the characteristics of transcriptomic changes in these monogenic disorders, we profiled genome-wide gene expression levels in cerebellum and blood from murine models of fragile X syndrome and tuberous sclerosis. Results: Differentially expressed genes and enriched pathways were distinct for the two murine models examined, with the exception of immune response-related pathways. In the cerebellum of the Fmr1 knockout (Fmr1-KO) model, the neuroactive ligand receptor interaction pathway and gene sets associated with synaptic plasticity such as long-term potentiation, gap junction, and axon guidance were the most significantly perturbed pathways. The phosphatidylinositol signaling pathway was significantly dysregulated in both cerebellum and blood of Fmr1-KO mice. In Tsc2 heterozygous (+/−) mice, immune system-related pathways, genes encoding ribosomal proteins, and glycolipid metabolism pathways were significantly changed in both tissues. Conclusions: Our data suggest that distinct molecular pathways may be involved in ASD with known but different genetic causes and that blood gene expression profiles of Fmr1-KO and Tsc2+/− mice mirror some, but not all, of the perturbed molecular pathways in the brain. Keywords: Fragile X syndrome, Tuberous sclerosis, Autism, Cerebellum, Blood, Gene expression, Murine model

Background etiologies implicated in ASD may converge on a few com- Autism spectrum disorder (ASD) manifests significant mon pathways. Further research on single gene disorders heterogeneity in part because of the interaction of under- associated with ASD such as tuberous sclerosis complex lying genetic [1-3], neurobiological, and environmental (TSC) and fragile X syndrome (FXS) may lead to an un- factors [4,5] during early brain development. This hetero- derstanding of common dysfunction at the cellular or cir- geneity presents one of the main obstacles to the develop- cuit level for a majority of ASD. In a recent survey of over ment of effective treatments for ASD. The complex 14,000 individuals under age 35 with ASD in a Boston genetics of ASD suggest that it is a large set of related area hospital, Kohane and colleagues reported that the disorders with diverse mechanisms; however, many of the prevalence of genetic disorders of FXS and TSC in individuals with ASD were 0.5% and 0.8% [6]. Conversely, 30% and 50-61% of patients with FXS and TSC present * Correspondence: [email protected] ASD core symptoms, respectively [7,8]. If such shared † Equal contributors pathophysiology exists, then treatments developed for a 1Informatics Program, Boston Children’s Hospital, Harvard Medical School, Boston, MA, USA target in one disorder might be applicable to others. Mouse 5Center for Biomedical Informatics, Harvard Medical School, Boston, MA, USA models for ASD serve an increasingly important role in Full list of author information is available at the end of the article

© 2014 Kong et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.

169 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 2 of 11 http://www.molecularautism.com/content/5/1/16

providing a pre-clinical test of promising pharmacological Methods therapeutics [9,10]. Inactivating mutation in Tsc2 (Tsc2+/− Murine models of fragile X syndrome and tuberous mice) showed defects in axon guidance [11] and cognitive sclerosis deficits such as impaired water maze performance [12], To identify molecular signatures of each mouse model and mice with Fmr1-knockout (KO) presented impair- of ASD, we performed gene expression profiling on cere- ments in long-term depression, hyperactivity, anxiety-like, bellum and peripheral blood collected from two mouse and unusual social behaviors [13]. Therefore, deter- models and compared to wild-type (WT) controls. We mining the degree to which there are shared molecular used cerebellum where the most consistent abnormalities mechanisms in these models will inform clinical trials, were reported in the patients with ASD [14]. Post-mortem particularly those that address populations with genetically studies have shown a reduced number of Purkinje cells heterogeneous causes of ASD. (PC), and several neuroimaging studies reported enlarged Although several cellular mechanisms may be impli- cerebella in ASD [29,30]. The cerebellum is also implicated (reviewed in Fatemi et al. [14]), accumulating data cated in social interaction [31], and the loss of Tsc1 from support a role for the PI3K-mTOR signaling cascade in cerebellar PC was associated with autistic-like behaviors several genetic causes of ASD. Evidence for the PI3K- [32]. Additionally, we profiled whole blood from the same mTOR pathway first emerged from TSC [15,16] and individual mouse to compare with the gene expression mutations in the PTEN gene associated with ASD and changes in cerebellum. macrocephaly [17-19]. Later, investigation of copy num- All male C57BL/6 congenic Fmr1-KO mice and ber variants (CNV) in autistic individuals identified that Tsc2+/− mice with mixed 129/SvJae-C57BL/6 J back- PI3K-mTOR pathway-related genes were located in ground have been previously described [33,34]. We pro- CNV hotspots [20]. These findings have led to the hy- filed Tsc2+/− mice since homozygous Tsc2 KO was pothesis that overactivation of the mTOR pathway could embryonic lethal. The mice were killed at 8–10 weeks lead to abnormal synaptic function owing to an excess of age following the institutional animal care and use of protein synthesis at the synapse [21]. Genetic evi- committee (IACUC) euthanasia criteria (the Boston dence that directly implicates a translation initiating Children’s Hospital IACUC animal protocol no. 12-07- factor, EIF4E, which is a downstream target of mTOR, 2227R). For the Fmr1-KO model, 5 KO and 5 WT mice in ASD has provided further support for this hypothesis were profiled, and for the Tsc2+/− model 3 transgenic and [22]. Interestingly, exposuretoteratogenssuchasval- 3 WT mice were profiled. Paired blood and cerebellum proate in utero can lead to ASD in children [23], and samples were prepared for gene expression profiling. valproate can also modulate this signaling pathway [24], suggesting that environmental factors associated Genome-wide gene expression profiling using with ASD can also play a role in PI3K-mTOR pathway microarrays regulation [25]. More recently, studies have found that A total of 250 ng RNA was processed using established PI3K-mTOR signaling is upregulated in mouse models Affymetrix protocols for the generation of biotin-labeled of FXS, one of the most common genetic causes of cRNA, and the hybridization, staining, and scanning of ASD [26-28]. arrays were performed. Briefly, total RNA was converted Together, the aforementioned findings suggest that an to double-stranded cDNA using a T7 primer and biotin- upregulated PI3K-mTOR signaling cascade might be a labeled cRNA was then generated from the cDNA by common mechanism in ASD and therefore would po- in vitro transcription. The cRNA was quantified (using tentially be a promising drug target. Indeed, clinical A260) and fragmented. Fragmented cRNA was hybrid- trials using inhibitors of mTOR are already in progress ized to the Affymetrix Mouse Gene ST 1.0 array and in patients with TSC. We hypothesized that if the PI3K- scanned on an Affymetrix GeneChip scanner 3000 at mTOR signaling pathway is dysregulated in various 2.5 μm resolution [35]. Microarray data are available at causes of ASD, then these disorders should present with the Gene Expression Omnibus database (GSE40630). a similar gene expression profile signature. We chose to analyze TSC and FXS, two Mendelian disorders highly Validation of gene expression changes using quantitative associated with ASD. Better understanding of similarities RT-PCR and differences of the cellular and molecular defects Total RNA was extracted using TRIzol according to the leading to abnormal neurological function in these two manufacturer’s instruction. The RNA amount was mea- disorders is essential to the development of new therap- sured using the Nanodrop (Thermo Scientific); 100 ng ies for ASD. Here, we used mouse models available for of total RNA was reversed transcribed using a cDNA both genetic disorders to investigate the similarities and reverse transcription kit with random primers (Applied differences between gene expression profiles in the brain Biosystems). SyBr Green PCR Master Mix (Applied Bio- and blood cells. systems) was used to amplify and detect signals from

170 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 3 of 11 http://www.molecularautism.com/content/5/1/16

cDNA with 1 mM gene-specific primers. Amplified Results signals were collected by the 7300HT Fast Real-Time Distinct gene expression changes define Fmr1 and Tsc2 System (Applied Biosystems) and normalized to Gapdh. transgenic models Primer sequences used for this study were Gapdh forward A total of 107 and 115 probe sets were significantly 5′-tgtgtccgtcgtggatctga-3′ reverse 5′-cctgcttcaccaccttcttga- changed in Fmr1-KO and Tsc2+/− mice compared to 3′, Fmr1 forward 5′-ggtcaaggaatgggtcgagg-3′, reverse 5′- corresponding WT littermates, respectively (uncorrected agtcgtctctgtggtcagat-3′, Tsc2 forward 5′-cagtgtcgac p-value < 0.01). Not surprisingly, Fmr1 was the most sig- cagctgtctt-3′, reverse 5′-tcacgctgtctggtcttgtc-3′, Eps811 nificantly downregulated gene in Fmr1-KO (p-value forward 5′-cagctacaacacgagaagcg-3′, reverse 5′-ccgaaccttc 8.85 ×10-6, corresponding FDR 0.29). We used nominal caccatttgc-3′ and Grin3a forward 5′-ctgaaacctgggtgtgaggt- p-values estimated from a linear model less than 0.01 to 3′, and reverse 5′-aatgctgttcccacacaaca-3′. rank significant probe sets because multiple testing correction procedures did not make any gene significant. Microarray analysis The expression levels of 16 out of 107 significant probe All microarrays were normalized together at the probesets (15.0%) in Fmr1-KO mice and 58 out of 115 signifi- level using a quantile method, and the Affymetrix Probe cant probe sets (50.4%) in Tsc2+/− mice did not show a Logarithmic Intensity ERror (PLIER) model was used to significant difference between blood and brain. We used calculate the absolute gene expression levels as previ- an agglomerative hierarchical clustering with the signifi- ously described [35]. We fitted a linear model of the tissue cant probe sets for each model to explore the similarity (i.e., blood vs. cerebellum) and treatment (i.e., transgenic of gene expression profiles in two genotypes and across vs. WT) as predicting variables to each probe set. Two tissue types. Samples were clearly separated by tissue murine models were analyzed separately as different back- type and then by genotype (Figure 1A and 1B). Interest- ground strains were used. Differentially expressed genes in ingly, 71% of significant probe sets in Fmr1-KO mice each murine model were compared to the differentially were highly expressed in cerebellum compared to blood expressed genes between the wild types of two models. (Figure 1A). For the Tsc2+/− model, the average expres- The false discovery rate (FDR) was calculated using Storey sion levels of 63 out of 115 probe sets (57.5%) were and Tibshirani’s method [36]. We did not use non- higher in cerebellum (Figure 1B). Differentially expressed parametric tests such as the Wilcoxon rank sum test be- genes with statistical scores are listed in Additional cause of the granularity of the test statistics with a small file 1: Table S1 (Fmr1-KO vs. WT) and Additional file 1: number of samples per group. Table S2 (Tsc2+/− vs. WT). We identified enriched pathways using the Gene Set We compared the gene expression profiles of WT Enrichment Analysis (GSEA) [37]. The Kyoto Encyclopedia mice since Tsc2+/− mice had 129/SvJae-C57BL/6 J back- of Genes and Genomes (KEGG) pathways of size 15–500 grounds compared to C57BL/6 congenic backgrounds of were used for pathway analysis. Due to the relatively small Fmr1-KO mice. A total of 1,486 probes sets were differ- number of samples in each group, we randomly sampled entially expressed between two WT strains. Seven probe gene sets of equal size for each KEGG pathway to calcu- sets, representing five genes, Cog7, Cc2d1a, Smurf1, late the background distribution of enrichment scores. Sec31a, and AU040320, overlapped with the differen- This procedure was done with 2,000 random drawings, tially expressed genes in Fmr1-KO vs. WT comparison. thus the minimum permutation p-value was 0.0005. We For the differentially expressed genes in Tsc2+/− vs. WT used permutation p-value 0.05 as the significance comparison, 13 probe sets (representing 9 genes: Fhad1, threshold for GSEA, and corresponding FDRs were Pgam5, Cts8, Piwil4, Tmem101, Heatr7a, Mucl1, described. To identify the core set of genes that ac- 2210404J11Rik, and Fam181b) were significantly differ- counts for the gene set’s enrichment signal, we used ent between two WT mice strains. leading edge analysis as described in Subramanian Epidermal growth factor (EGF) receptor pathway et al. [37] where a leading edge subset was defined as the substrate 8-like 1 (Eps811) (Affymetrix probe set ID: subset of genes that gave the maximum enrichment score. 10549655) was the only gene that was significant in These genes were the topmost correlated genes with both murine models. Eps811 was upregulated in Tsc2+/− phenotype in a gene set. mice, but downregulated in Fmr1-KO mice. Post hoc To compare differentially expressed genes with the list two-group comparison of the transgenic model to WT for of known ASD candidate genes as curated in the SFARI- each tissue showed that Eps811 was upregulated in blood genes 2.0 database (http://gene.sfari.org/) [38], we mapped (Welch’s t-test p-value 0.07) and brain (Welch’s t-test mouse genes to human homologs using the Mouse p-value 0.06) of Tsc2+/− mice, while it was downregu- Genome Informatics (MGI) Web database (http://www. lated in blood (Welch’s t-test p-value 0.015) of Fmr1-KO informatics.jax.org) and performed hypergeometric tests mice. Downregulation of Eps811 in brain of Fmr1-KO was to check the significance of overlap. not significant (Welch’s t-test p-value 0.38). The homolog

171 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 4 of 11 http://www.molecularautism.com/content/5/1/16

(A) Fmr1-KO vs. wildtype (B) Tsc2 +/- vs. wildtype

Treatment Treatment Tissue Tissue

Blood

Brain

Wildtype

Transgenic

-3 0 3 Figure 1 Agglomerative hierarchical clustering of blood and brain samples. (A) Hierarchical clustering of Fmr1-KO and wild-type samples. One hundred seven differentially expressed transcripts (nominal p-value < 0.01) are used for hierarchical clustering of transcripts (rows in the heatmap) and samples (columns in the heatmap). The gene expression levels are normalized across samples, and red (upregulated) and blue (downregulated) are color coded according to the bottom color bar. Color keys on the top of the heatmap denote tissue type and transgenic model. By far the most pronounced clustering is by tissue type. Within the blood samples, the two mice strains are clearly separated. (B) Hierarchical clustering of Tsc2 +/− and wild-type samples. One hundred fifteen significant transcripts are used for cluster analysis. Two mice strains formed separate clusters in each tissue type. The tissue specificity is not significant for the differentially expressed transcripts in Tsc2 +/− mice, whereas a majority of differentially expressed genes are highly expressed in cerebellum of Fmr1-KO mice (lower right cluster in the heatmap of Figure 1A). of Eps811 in human, EPS8L1 is a member of EPS8-related were differentially expressed in Fmr1-KO mice, and proteins that play an important role in actin remodel- Oxtr and Taf1c were significantly changed in Tsc2+/− ing in response to EGF [39], and EPS8 is one of the mice. The differentially expressed genes were not signifi- reported targets of FMRP [40]. Interestingly, Stamata- cantly enriched for known ASD candidate genes in human kou and colleagues reported that Eps8 loss of func- (hypergeometric test p-value 0.48 for Fmr1-KO and 0.70 tion impaired the structural and functional plasticity for Tsc2+/−). of synapses induced by long-term potentiation in primary rat hippocampal neurons [41]. Phenotypically, Validation of differentially expressed genes using Eps8-KO mice have impaired learning and memory, quantitative RT-PCR and excessive synaptic growth and abnormal spine Quantitative RT-PCR for individual genes was used to morphology were observed in the hippocampus [42]. further confirm the results of the expression profiling in In human samples, the average expression of EPS8 in the brain samples used for the initial analysis. As expected, fusiform gyri was significantly lower among the pa- Fmr1 gene expression was significantly decreased in tients with ASD compared to controls [42]. Although Fmr1-KO mice as compared to controls (average 5.24-fold Eps8 itself was not significantly changed in our study, downregulated, Welch’s t-test p-value 0.025), while Fmr1 EPS8 family genes are interesting candidates for fur- was unchanged in Tsc2+/− mice (Welch’s t-test p-value ther investigation. Thus, we performed qRT-PCR of 0.70). Tsc2 gene expression showed a trend of decreased Eps8 in brain samples of two murine models. expression in both Tsc2+/− and Fmr1-KO mice as com- Of the differentially expressed genes, several were pared to WT mice that did not reach significance (average also found in the expert curated database of autism fold change 1.12 and 1.31 downregulation, Welch’s t-test candidate genes. Of these, Chd7, Fmr1,andTmlhe p-value 0.55 and 0.27, respectively). We previously found

172 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 5 of 11 http://www.molecularautism.com/content/5/1/16

a significant reduction of Tsc2 protein in cortical neurons was only one overlapping gene—Eps8l1—between the of Tsc2+/− mice [11]; however, Tsc2 mRNA expression two lists of differentially expressed genes in Fmr1-KO was not significantly downregulated. Further, our re- and Tsc2+/− mice. The genes that contributed to making sults confirm that Eps8l1 exhibited a three-fold increase in a pathway significant were identified using leading edge Tsc2+/− animals as compared to WT mice (average 3.15- analysis. First, all genes were ranked by a per-gene fold upregulation, Welch’s t-test p-value 0.06). However, signal-to-noise ratio that was defined as mean difference Eps8l1 expression shows a decreased trend—an average divided by the sum of standard deviation of each group. 1.26 fold downregulation—in Fmr1-KO compared to WT Then a running sum was calculated for each gene set. similar to that observed in the expression profiling but not Beginning with the top-ranked gene, the running sum significantly changed (Welch’s t-test p-value 0.74). increased when a gene in a gene set was found and We observed significant downregulation of subtype 3a decreased otherwise. The enrichment score (ES) was de- of the N-methyl-D-aspartate receptor gene (Grin3a)in fined to be the largest value of the running sum, and the the blood of Fmr1-KO mice (uncorrected p-value 0.0098). genes that maximized ES were defined as the leading Grin3a was not significant in brain with microarray data; edge subset. however, a quantitative RT-PCR analysis of the same sam- Two pathways related to cytokine and complement- ples showed a significant downregulation of this gene in mediated signaling, cytokine-cytokine receptor inter- Fmr1-KO brain (5.69-fold downregulated, Welch’s t-test action (HSA04060, FDR < 0.0005) and complement and p-value 0.046). coagulation cascades (HSA04610, FDR < 0.0005), were the most significantly enriched pathways in Fmr1-KO Enriched biological pathways in blood and brain of the brain (Table 1). Neuroactive ligand receptor inter- two mouse models action (HSA04080, FDR < 0.0005), long-term potentiation We explored whether similar sets of biological pathways (HSA04720, FDR 0.0023), gap junction (HSA04540, FDR were perturbed in both models using GSEA [37] as there 0.0429), and axon guidance (HSA04360, FDR 0.048) were

Table 1 Enriched pathways in blood and brain of Fmr1 knockout mice KEGG categories Name SIZE NES NOM p-val FDR q-val Brain Nervous system HSA04080 Neuroactive ligand receptor interaction 223 2.34 < 0.0005 0.0000 HSA04720 Long-term potentiation 62 −2.15 < 0.0005 0.0023 HSA04540 Gap junction 77 −1.75 < 0.0005 0.0429 HSA04360 Axon guidance 125 −1.81 < 0.0005 0.0480 Immune system HSA04060 Cytokine-cytokine receptor interaction 212 2.72 < 0.0005 < 0.0005 HSA04610 Complement and coagulation cascades 47 2.32 < 0.0005 < 0.0005 HSA04650 Natural killer cell mediated cytotoxicity 95 1.70 0.0015 0.0379 HSA04612 Antigen processing and representation 42 1.67 0.0049 0.0397 HSA04640 Hematopoietic cell lineage 66 2.09 < 0.0005 0.0004 Signaling pathways HSA01430 Cell communication 118 2.14 < 0.0005 0.0004 HSA04630 Jak-STAT signaling pathway 137 2.07 < 0.0005 0.0005 HSA04070 Phosphatidylinositol signaling system 65 1.77 0.0029 0.0420 HSA04910 Insulin signaling pathway 126 1.80 < 0.0005 0.0455 Metabolism HSA00150 Androgen and estrogen metabolism 33 1.84 0.0043 0.0118 HSA00590 Arachidonic acid metabolism 39 1.81 0.0017 0.0147 HSA00361 γ-hexachlorocyclohexane degradation 17 1.69 0.0118 0.0370 HSA00020 Citrate cycle 25 1.93 0.0023 0.0375 HSA00592 α-linolenic acid metabolism 15 1.70 0.0127 0.0392 HSA00251 Glutamate metabolism 30 1.87 0.0038 0.0430 Folding, sorting, and degradation HSA04120 Ubiquitin mediated proteolysis 36 1.78 0.0039 0.0453 HSA04130 Snare interactions in vesicular transport 29 1.84 < 0.0005 0.0450 Blood Signaling pathways HSA04070 Phosphatidylinositol signaling system 65 1.78 < 0.0005 0.0500

173 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 6 of 11 http://www.molecularautism.com/content/5/1/16

also enriched in Fmr1-KO brain. Among the signaling Common signature of Fmr1 and Tsc2 transgenic models pathways, the PI3K signaling pathway (HSA04070) was Cytokine-cytokine receptor interaction pathway, hematopoietic changed in both brain (FDR 0.042) and blood (FDR 0.05) cell linage, and cell communication were enriched in brain of Fmr1-KO mice. Eight genes were in the leading edges gene expression profiles of both Fmr1-KO and Tsc2+/− of the two tissues (see Methods). These were Dgkb, Dgkg, mice (Figure 2). We performed leading edge analysis to Dgkh, Inpp4b, Inpp5a, Itpr3, Plcb4, and Prkca. Glutamate find core genes that made a pathway significant, although metabolism (HSA00251) was also enriched in Fmr1-KO each gene was not necessarily differentially expressed. For brain (FDR 0.043). the cytokine-cytokine receptor pathway (N = 212), 105 Eight pathways were significantly enriched in Tsc2+/− and 106 genes were the core genes in Tsc2+/− and Fmr1- brain, while 11 pathways were enriched in Tsc2+/− KO brain data sets. Il7r was the only gene that showed blood (Table 2). Pathways associated with the immune marginal significances in both data sets (post-hoc Welch’s system were significantly enriched in both blood and brain. t-test p-values 0.011 and 0.013 in Tsc2+/− and Fmr1-KO Ribosome (HSA03010, FDR < 0.0005), cytokine-cytokine brain profiles, respectively). The same gene was also the receptor interaction (HSA04060, FDR < 0.0005), and oxida- only common significant gene for the hematopoietic cell tive phosphorylation (HSA00190, FDR < 0.0005) were the lineage pathway. Thirty-two genes were in common most significant pathways in the brain, and the ribosome between the leading edges of cell communication for pathway was also significantly deregulated in Tsc2+/− Fmr1-KO and Tsc2+/− brain; however, no genes were blood (FDR 0.0468). In the Tsc2+/− brain, cytokine- significantly differentially expressed. Interestingly, Tsc2 cytokine receptor interaction (FDR < 0.0005) and gene expression was downregulated in Fmr1-KO blood hematopoietic cell linage (HSA04640, FDR 0.0389) (post-hoc Welch’s t-test p-value 0.0045). were significant, while the Toll-like receptor signaling pathway (HSA04620, FDR 0.0016) and B-cell receptor Discussion signaling pathway (HSA04662, FDR 0.0072) were sig- We hypothesized that Fmr1-KO and Tsc2+/− mice nificant in Tsc2+/− blood. None of the differentially would have similar gene expression profiles. In contrast, expressed genes between two WT strains was a mem- our findings indicate that different gene expression sig- ber of significant pathways that we identified above. natures define these two monogenic mouse models of

Table 2 Enriched pathways in blood and brain of Tsc2+/− mice KEGG categories Name SIZE NES NOM p-val FDR q-val Brain Immune system HSA04060 Cytokine-cytokine receptor interaction 212 2.37 < 0.0005 < 0.0005 HSA04640 Hematopoietic cell lineage 66 1.75 < 0.0005 0.0389 Signaling pathways HSA04010 MAPK signaling pathway 241 −1.92 < 0.0005 0.0431 HSA01430 Cell communication 118 2.15 < 0.0005 0.0007 Translation HSA03010 Ribosome 66 3.21 < 0.0005 < 0.0005 Metabolism HSA00563 Glycosylphosphatidylinositol anchor biosynthesis 21 −1.85 0.0017 0.0444 HSA00190 Oxidative phosphorylation 110 2.75 < 0.0005 < 0.0005 HSA00980 Metabolism of xenobiotics by cytochrome P450 35 1.77 < 0.0005 0.0379 Blood Nervous system HSA05010 Alzheimer’s disease 26 1.92 < 0.0005 0.0034 Immune system HSA04620 Toll-like receptor signaling pathway 94 2.00 < 0.0005 0.0016 HSA04662 B cell receptor signaling pathway 60 1.85 < 0.0005 0.0072 Cell growth and death HSA04110 Cell cycle 107 −2.31 < 0.0005 0.0005 HSA04210 Apoptosis 73 1.78 0.0006 0.0181 Translation HSA03010 Ribosome 66 1.68 0.0026 0.0468 Metabolism HSA01032 Glycan structures degradation 29 2.16 < 0.0005 0.0000 HSA00530 Aminosugars metabolism 29 1.95 0.0007 0.0035 HSA00531 Glycosaminoglycan degradation 17 1.92 < 0.0005 0.0043 HSA00511 Other glycan degradation 15 1.88 0.0007 0.0047 HSA00600 Sphingolipid metabolism 31 1.69 0.0064 0.0473

174 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 7 of 11 http://www.molecularautism.com/content/5/1/16

KEGG categories Name Fmr1 Brain Fmr1 Blood Tsc2 Brain Tsc2 Blood Immune system HSA04060 Cytokine-cytokine receptor interaction HSA04640 Hematopoietic cell lineage HSA04650 Natural killer cell mediated cytotoxicity HSA04612 Antigen processing and representation HSA04610 Complement and coagulation cascades HSA04620 Toll-like receptor signaling pathway HSA04662 B cell receptor signaling pathway

Nervous system HSA04080 Neuroactive ligand receptor interaction HSA04720 Long-term potentiation HSA04360 Axon guidance HSA04540 Gap junction HSA05010 Alzheimer’s disease

Translation HSA03010 Ribosome

Signaling pathways HSA01430 Cell communication HSA04070 Phosphatidylinositol signaling system HSA04630 Jak-STAT signaling pathway HSA04910 Insulin signaling pathway HSA04010 MAPK signaling pathway

Cell growth and death HSA04110 Cell cycle HSA04210 Apoptosis

Folding, sorting, and degradation HSA04120 Ubiquitin mediated proteolysis HSA04130 Snare interactions in vesicular transport

Metabolism HSA00020 Citrate cycle HSA00361 -hexachlorocyclohexane degradation HSA00592 -linolenic acid metabolism HSA00590 Arachidonic acid metabolism HSA00150 Androgen and estrogen metabolism HSA00251 Glutamate metabolism HSA00511 Other glycan degradation HSA00530 Aminosugars metabolism HSA00531 Glycosaminoglycan degradation HSA00563 Glycosylphosphatidylinositol anchor biosynthesis HSA00600 Sphingolipid metabolism HSA01032 Glycan structures degradation HSA00980 Metabolism of xenobiotics by cytochrome P450 HSA00190 Oxidative phosphorylation Figure 2 Enriched pathways in Fmr1-KO and Tsc2+/− models of ASD, found using the Gene Set Enrichment Analysis (GSEA). Red (upregulated) and blue (downregulated) squares in the matrix represent enriched pathways for each data set (false discovery rate ≤ 0.05). Two immune system pathways (cytokine-cytokine receptor signaling pathway and hematopoietic cell lineage) and one signaling pathway (cell communication) were significant in the brain gene expression profiles of both mice models.

ASD. Global expression profiles of the two models ex- Our data indicate that FXS and TSC may have very amined were distinct, such that only one gene—Eps8l1— distinct brain and blood cellular phenotypes despite the was in common. This is a particularly surprising result fact that both syndromes result in similar behavioral and since translational dysregulation as well as aberrant syn- cognitive symptoms. aptic protein synthesis associated with both disorders Nonetheless, we did find that the cytokine and com- has been proposed as one possible pathway leading to plement signaling pathways are differentially regulated autistic phenotypes, including cognitive impairment [21]. in both mouse models although the specific genes

175 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 8 of 11 http://www.molecularautism.com/content/5/1/16

affected within these pathways were different. The This finding points to another level of interaction be- immune system has been implicated in ASD in multiple tween the FMRP and Tsc2 functions in the cell. Fu- ways, but the exact mechanism of the interaction ture studies are required to understand whether Fmr1 between the immune system and genetic disorders that loss leads to changes in Tsc2 mRNA via transcriptional or result in an increased risk of autism has not been well post-transcriptional regulation. studied. Modulation of the immune system may not be Similarities between the proposed roles of TSC1/2 and completely unexpected since the TSC-mTORC1 path- FMRP proteins in regulation of protein synthesis have way regulates inflammatory responses after bacterial led to the popular hypothesis that hyperactive mTOR stimulation in monocytes, macrophages, and primary signaling is pathogenic in both FXS and TSC. Our re- dendritic cells [43], and this pathway contributes to sults indicate the gene expression dysregulation differs cytokine upregulation in response to endotoxins [44]. markedly in the two conditions. This is consistent with However, this is of particular interest in light of a recent the previously reported changes in neuronal morphology study that showed that immune activation during gesta- in each of these models. Neurons deficient in Tsc1 or tion can markedly worsen the neurological phenotype of Tsc2 display lower dendritic spine density in contrast to Tsc2+/− mouse pups [45]. Similarly, preliminary obser- Fmr1-KO neurons [50], which have increased spine vations indicate that plasma protein levels of a number density [51]. At the biochemical level there are also some of cytokines differ between individuals with and without important differences. In TSC1/2-null cells, mTORC1- FXS. Furthermore, differences in cytokine and other dependent negative feedback mechanisms exist to dampen immune-signaling genes were observed between the FXS the activation of upstream components of the network group with autism and the FXS group without autism such that Akt activation is decreased [52]. However, in [46]. On the other hand, Yuskaitis and colleagues inves- Fmr1-KO neurons, Akt activity is enhanced [27]. While tigated the peripheral immune system of Fmr1-KO mice, mTORC1 may be activated because of loss of either Tsc1/2 but did not find any differences in either the T-cell popu- or FMRP, the neuronal phenotype and gene expression lation at basal and stimulated status or the proinflamma- profiles may be altered by changes in the activation of tory cytokines TNFα and IFNγ at basal and stimulated other signaling pathways. Such differences have implica- status [47]. How the loss of FMRP leads to changes in the tions for targeted treatment options of the two distinct immune system, however, remains unclear. genetic conditions. Accumulating evidence over the last few years indi- The mouse models we have explored have been devel- cates that the TSC and FMRP pathways interact. How- oped as models of ASD with known divergent genetic ever, precisely how these pathways interact remains an etiologies. The overall divergence in gene expression open question. On the one hand, FMRP can be phos- dysregulation in these two models does not rule out phorylated by S6K, an enzyme downstream of TSC [48]. shared downstream effects, and indeed we observed an On the other hand, mTOR, the kinase inhibited by the overlapping dysregulation of the cytokine signaling path- TSC2 protein, has increased activity in Fmr1-KO neu- way. Nonetheless, it does suggest that a multiplicity of rons [26], and FMRP-deficient cells display increased therapeutics will have to be developed for the varied activity of PI3K, an enzyme upstream of TSC proteins mechanisms contributing to the increasingly fine-grained [27]. Recently Auerbach et al. reported that the synaptic distinctions between the etiologies of ASD. dysfunction in the CA1 region of the hippocampus of We could identify similar sets of biological pathways Tsc2+/− mice was opposite to that of Fmr1-KO mice [49]. enriched in both tissues. In the Fmr1-KO mice, the PI3K In fact, manipulating the mGluR receptors with positive signaling pathway was dysregulated in both blood and allosteric modulators was sufficient to rescue this defect in brain, while the ribosome pathway was dysregulated in Tsc2+/−, while inhibiting the mGluR receptors was neces- both tissues of Tsc2 +/−. With the two mouse models, we sary in the case of Fmr1-KO mice. Finally, a genetic cross also could identify biological pathways that were positively of the Tsc2+/− and Fmr1-KO mice was similar to WT in correlated with genetic background in both tissues. Previ- CA1 synaptic physiology and contextual learning. These ous studies demonstrated that peripheral blood expression results argue that loss of Tsc2 and Fmr1 have some oppos- signatures could be used to classify the clinical conditions ite cellular phenotypes, which can be rescued in a double of brain disorders [35,53]. Likewise, our results suggest knockout. However, the mechanisms by which Tsc2 and that peripheral blood signatures could be used to identify Fmr1 result in opposite synaptic phenotypes is not yet genotypes as well as some transcriptional changes present clear. In post-hoc analysis, we found that Tsc2 gene ex- in brain. pression was downregulated in Fmr1-KO blood (Welch’s The current study is limited by the different back- t-test p-value 0.0045). Thus, in the Tsc2+/− Fmr1-KO ground strains of Fmr1-KO and Tsc2+/− mice and by mice, the Tsc2 expression level may be closer to WT and the small sample size. The differentially expressed genes may contribute to the rescue of the synaptic physiology. between two WT background strains overlapped with the

176 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 9 of 11 http://www.molecularautism.com/content/5/1/16

significant genes in each murine model – 5 for Fmr1-KO Additional file and 9 for Tsc2+/−. Although 1,486 probe sets were significantly differentially expressed between WT mice of two Additional file 1: Table S1. The 107 transcripts were differentially different backgrounds, none of these genes was a member expressed in Fmr1-KO mice compared to wildtype littermates. These probesets were used for the hierarchical clustering analysis as showed in of the significant pathways that characterized Fmr1-KO Figure 1A. The transcript that was assigned for uncharacterized gene was and Tsc2+/− mice in blood and brain. Due to the small designated as ‘NA’ with the Affymetrix probeset identifiers (AffyID). The sample size, we did not have enough statistical power for p-value was estimated from a linear model using genotype and tissue as predicting variables for each probeset. The q-value denotes the false microarray experiments to detect and compare relatively discovery rate that were calculated from the distribution of p-values low-expressed genes. Further study using the same back- using Storey and Tibshirani’s (see Methods). Negative values in the fold ground strain and increasing the sample size will be essen- changes represent down-regulated transcripts in transgenic mice. Table S2. The 115 transcripts were differentially expressed in Tsc2 +/- tial to confirm our findings, and using a more sensitive mice compared to wildtype littermates. These probesets were used for quantification method such as RNA-seq will improve sen- the hierarchical clustering analysis as showed in Figure 1B. The transcript sitivity for low abundance transcripts. For the Fmr1-KO that was assigned for uncharacterized gene was designated as ‘NA’ with the Affymetrix probeset identifiers (AffyID). The p-value was estimated model, we did not include female mice heterozygous for from a linear model using genotype and tissue as predicting variables for Fmr1 in this experiment. Heterozygous Fmr1 female each probeset. The q-value denotes the false discovery rate that were mice should exhibit genetic mosaicism due to random calculated from the distribution of p-values using Storey and Tibshirani’s (see Methods). Negative values in the fold changes represent X-inactivation of one X chromosome during develop- down-regulated transcripts in transgenic mice. ment. For this reason, most previous studies characterized male Fmr1 KO models. Qin and colleagues performed an Abbreviations interesting comparison of male Fmr1-KO and homozy- Akt: v-Akt murine thymoma viral oncogene; ASD: Autism spectrum disorder; gous and heterozygous KO in female mice [54]. They CA1: Cornu ammonis 1; Chd7: Chromodomain-helicase-DNA-binding protein 7; Dgkb: Diacylglycerol kinase beta; Dgkg: Diacylglycerol kinase gamma; reported that only the homozygous mice had a deficit on Dgkh: Diacylglycerol kinase eta; EGF: Epidermal growth factor; the passive avoidance test, whereas both homozygous and EIF4E: Eukaryotic translation initiation factor 4E; EPS8: Epidermal growth heterozygous female mice exhibited hyperactivity and factor receptor pathway substrate 8; EPS8L1: Epidermal growth factor receptor pathway substrate 8 like 1; FDR: False discovery rate; Fmr1: Fragile X increased susceptibility to seizures. A follow-up experimental retardation 1; FMRP: Fragile X mental retardation protein; FXS: Fragile ment with both sexes and different dosages of Fmr1 in X syndrome; Grin3a: N-methyl-D-aspartate receptor subtype 3a; GSEA: Gene female mice with a larger sample size would be ideal set enrichment analysis; Inpp4b: Inositol polyphosphate-4-phosphatase, type II; Inpp5a: Type I inositol-1,4,5-trisphosphate 5-phosphatase; Itpr3: Inositol since a gender effect on global gene expression profiles 1,4,5-trisphosphate receptor, type 3; KEGG: Kyoto encyclopedia of genes and should be considered when both sexes are included in the genomes; KO: Knockout; mGluR: Metabotropic glutamate receptor; experiment. mTOR: Mammalian target of rapamycin; mTORC1: Mammalian target of rapamycin complex 1; Oxtr: Oxytocin receptor; PI3K: Phosphatidylinositide 3-kinases; Plcb4: 1-Phosphatidylinositol-4,5-bisphosphate phosphodiesterase Conclusions beta-4; PLIER: Probe logarithmic Intensity error model; Prkca: Protein kinase C, Contrary to our initial hypothesis that Fmr1-KO and alpha; PTEN: Phosphatase and tensin homolog; RNA-seq: mRNA sequencing; Taf1c: TATA box-binding protein-associated factor RNA polymerase I subunit Tsc2+/− mice would share a transcriptional signature, C; Tmlhe: Trimethyllysine dioxygenase; TSC: Tuberous sclerosis complex; we found that the two mouse models presented distinct Tsc1: Tuberous sclerosis protein 1; Tsc2: Tuberous sclerosis protein 2; sets of differentially expressed genes. In retrospect, this WT: Wild type. is not surprising as multiple lines of evidence suggest that FXS and TSC are actually driven by opposite mo- Competing interests MFB declares a financial interest in Seaside Therapeutics. SWK, MS, CDC, lecular phenotypes [49]. Despite these gene-level differ- MGC, JL, DK, LMK, and ISK report no biomedical financial interests. The ences, however, we observed that cytokine signaling, cell authors declare no competing financial interests. communication, and hematopoietic cell lineage genes were differentially expressed in both mouse strains. Sec- Authors’ contributions SWK and CDC collected and analyzed the data, and JDL and MHW ond, our results show that blood expression signatures performed qRT-PCR validation. SWK and MGC performed statistical analyses. mirror many aspects of the brain transcriptome. Specif- MS provided Tsc2 heterozygous mouse, and DK and MFB provided Fmr1 ically, several pathways were dysregulated in both the knockout mouse. ISK and LMK conceived the study, and SWK, MS, and ISK wrote the manuscript. All authors read and approved the final manuscript. brain and blood of the two mouse models studied here. This confirmation is important for the future use of Acknowledgements blood tissue to study neurodevelopmental disorders. This work was supported by grants from Simons Foundation (95117, to L.M. K. and I.S.K.), Nancy Lurie Marks Family Foundation (to L.M.K. and I.S.K.), Autism Speaks (1968, to L.M.K.), Howard Hughes Medical Institute (L.M.K.), Availability of supporting data Autism Consortium, NIMH (R01MH085143 to L.M.K. and P50MH094267 to The data set supporting the results of this article is avail- S.W.K. and I.S.K.), Molecular Genetics Core laboratory supported by NICHD able in the Gene Expression Omnibus repository with (P30HD018655, to L.M.K.), and Charles H. Hood Foundation (S.W.K.). M.S. is supported by the NIH (R01NS58956), the John Merck Scholars Fund, Nancy the accession identifier GSE40630 (http://www.ncbi.nlm. Lurie Marks Family Foundation, Boston Children’s Hospital Translational nih.gov/geo/query/acc.cgi?acc=GSE40630). Research Program, Manton Center for Orphan Diseases and Boston

177 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 10 of 11 http://www.molecularautism.com/content/5/1/16

Children’s Hospital Intellectual and Developmental Disabilities Research 20. Cusco I, Medrano A, Gener B, Vilardell M, Gallastegui F, Villa O, Gonzalez E, Center (P30HD18655). Rodriguez-Santiago B, Vilella E, Del Campo M, Perez-Jurado LA: Autism- specific copy number variants further implicate the phosphatidylinositol Author details signaling pathway and the glutamatergic synapse in the etiology of the 1Informatics Program, Boston Children’s Hospital, Harvard Medical School, disorder. Hum Mol Genet 2009, 18:1795–1804. Boston, MA, USA. 2The F.M. Kirby Neurobiology Center, Department of 21. Kelleher RJ, Bear MF: The autistic neuron: troubled translation? Cell 2008, Neurology, Boston Children’s Hospital, Harvard Medical School, Boston, MA, 135:401–406. USA. 3Howard Hughes Medical Institute, Department of Genetics, Boston 22. Neves-Pereira M, Muller B, Massie D, Williams JH, O'Brien PC, Hughes A, Children’s Hospital, Harvard Medical School, Boston, MA, USA. 4Howard Shen SB, Clair DS, Miedzybrodzka Z: Deregulation of EIF4E: a novel Hughes Medical Institute, The Picower Institute for Learning and Memory, mechanism for autism. J Med Genet 2009, 46:759–765. Department of Brain and Cognitive Sciences, Massachusetts Institute of 23. Bromley RL, Mawer G, Clayton-Smith J, Baker GA: Autism spectrum disorders Technology, Cambridge, MA, USA. 5Center for Biomedical Informatics, following in utero exposure to antiepileptic drugs. Neurology 2008, Harvard Medical School, Boston, MA, USA. 71:1923–1924. 24. Gurpur PB, Liu J, Burkin DJ, Kaufman SJ: Valproic acid activates the Received: 8 June 2013 Accepted: 4 February 2014 PI3K/Akt/mTOR pathway in muscle and ameliorates pathology in a Published: 24 February 2014 mouse model of Duchenne muscular dystrophy. Am J Pathol 2009, 174:999–1008. 25. Dufour-Rainfray D, Vourc'h P, Le Guisquet AM, Garreau L, Ternant D, Bodard S, References Jaumain E, Gulhan Z, Belzung C, Andres CR, Chalon S, Guilloteau D: Behavior 1. Scherer SW, Dawson G: Risk factors for autism: translating genomic and serotonergic disorders in rats exposed prenatally to valproate: a model discoveries into diagnostics. Hum Genet 2011, 130:123–148. for autism. Neurosci Lett 2010, 470:55–59. 2. Schaaf CP, Zoghbi HY: Solving the autism puzzle a few pieces at a time. 26. Sharma A, Hoeffer CA, Takayasu Y, Miyawaki T, McBride SM, Klann E, Zukin RS: Neuron 2011, 70:806–808. Dysregulation of mTOR signaling in fragile X syndrome. J Neurosci 2010, 3. Abrahams BS, Geschwind DH: Advances in autism genetics: on the 30:694–702. threshold of a new neurobiology. Nat Rev Genet 2008, 9:341–355. 27. Gross C, Nakamoto M, Yao X, Chan CB, Yim SY, Ye K, Warren ST, Bassell GJ: 4. Patterson PH: Maternal infection and immune involvement in autism. Excess phosphoinositide 3-kinase subunit synthesis and activity as a Trends Mol Med 2011, 17:389–394. novel therapeutic target in fragile X syndrome. J Neurosci 2010, 5. Grandjean P, Landrigan PJ: Developmental neurotoxicity of industrial 30:10624–10638. chemicals. Lancet 2006, 368:2167–2178. 6. Kohane IS, McMurry A, Weber G, MacFadden D, Rappaport L, Kunkel L, 28. Vanderklish PW, Edelman GM: Differential translation and fragile X – Bickel J, Wattanasin N, Spence S, Murphy S, Churchill S: The co-morbidity syndrome. Genes Brain Behav 2005, 4:360 384. burden of children and young adults with autism spectrum disorders. 29. Amaral DG, Schumann CM, Nordahl CW: Neuroanatomy of autism. – PLoS One 2012, 7:e33224. Trends Neurosci 2008, 31:137 145. 7. Hagerman R, Hoem G, Hagerman P: Fragile X and autism: intertwined at 30. Bauman ML, Kemper TL: Neuroanatomic observations of the brain in the molecular level leading to targeted treatments. Mol Autism 2010, autism: a review and future directions. Int J Dev Neurosci 2005, 23:183–187. 1:12. 31. Insel TR, Fernald RD: How the brain processes social information: 8. Harrison JE, Bolton PF: Annotation: tuberous sclerosis. J Child Psychol searching for the social brain. Annu Rev Neurosci 2004, 27:697–722. Psychiatry 1997, 38:603–614. 32. Tsai PT, Hull C, Chu Y, Greene-Colozzi E, Sadowski AR, Leech JM, Steinberg J, 9. Silverman JL, Yang M, Lord C, Crawley JN: Behavioural phenotyping assays Crawley JN, Regehr WG, Sahin M: Autistic-like behaviour and for mouse models of autism. Nat Rev Neurosci 2010, 11:490–502. cerebellar dysfunction in Purkinje cell Tsc1 mutant mice. Nature 2012, 10. Ey E, Leblond CS, Bourgeron T: Behavioral profiles of mouse models for 488:647–651. autism spectrum disorders. Autism Research 2011, 4:5–16. 33. Huber KM, Gallagher SM, Warren ST, Bear MF: Altered synaptic plasticity in 11. Nie D, Di Nardo A, Han JM, Baharanyi H, Kramvis I, Huynh T, Dabora S, a mouse model of fragile X mental retardation. Proc Natl Acad Sci USA Codeluppi S, Pandolfi PP, Pasquale EB, Sahin M: Tsc2-Rheb signaling 2002, 99:7746–7750. regulates EphA-mediated axon guidance. Nat Neurosci 2010, 13:163–172. 34. Onda H, Lueck A, Marks PW, Warren HB, Kwiatkowski DJ: Tsc2(+/−) mice 12. Ehninger D, Han S, Shilyansky C, Zhou Y, Li W, Kwiatkowski DJ, Ramesh V, develop tumors in multiple sites that express gelsolin and are Silva AJ: Reversal of learning deficits in a Tsc2+/− mouse model of influenced by genetic background. J Clin Invest 1999, 104:687–695. tuberous sclerosis. Nat Med 2008, 14:843–848. 35. Kong SW, Collins CD, Shimizu-Motohashi Y, Holm IA, Campbell MG, Lee IH, 13. Bear MF: Therapeutic implications of the mGluR theory of fragile X Brewster SJ, Hanson E, Harris HK, Lowe KR, Saada A, Mora A, Madison K, mental retardation. Genes Brain Behav 2005, 4:393–398. Hundley R, Egan J, McCarthy J, Eran A, Galdzicki M, Rappaport L, Kunkel LM, 14. Fatemi SH, Aldinger KA, Ashwood P, Bauman ML, Blaha CD, Blatt GJ, Kohane IS: Characteristics and predictive value of blood transcriptome Chauhan A, Chauhan V, Dager SR, Dickson PE, Estes AM, Goldowitz D, Heck signature in males with autism spectrum disorders. PLoS One 2012, DH, Kemper TL, King BH, Martin LA, Millen KJ, Mittleman G, Mosconi MW, 7:e49475. Persico AM, Sweeney JA, Webb SJ, Welsh JP: Consensus paper: 36. Storey JD, Tibshirani R: Statistical significance for genomewide studies. pathological role of the cerebellum in autism. Cerebellum 2012, 11:777–807. Proc Natl Acad Sci USA 2003, 100:9440–9445. 15. Jeste SS, Sahin M, Bolton P, Ploubidis GB, Humphrey A: Characterization of 37. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, autism in young children with tuberous sclerosis complex. J Child Neurol Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP: Gene set 2008, 23:520–525. enrichment analysis: a knowledge-based approach for interpreting 16. Tsai P, Sahin M: Mechanisms of neurocognitive dysfunction and genome-wide expression profiles. Proc Natl Acad Sci USA 2005, therapeutic considerations in tuberous sclerosis complex. Curr Opin 102:15545–15550. Neurol 2011, 24:106–113. 38. Basu SN, Kollu R, Banerjee-Basu S: AutDB: a gene reference resource for 17. Butler MG, Dasouki MJ, Zhou XP, Talebizadeh Z, Brown M, Takahashi TN, autism research. Nucleic Acids Res 2009, 37:D832–D836. Miles JH, Wang CH, Stratton R, Pilarski R, Eng C: Subset of individuals with 39. Tocchetti A, Confalonieri S, Scita G, Di Fiore PP, Betsholtz C: In silico autism spectrum disorders and extreme macrocephaly associated with analysis of the EPS8 gene family: genomic organization, expression germline PTEN tumour suppressor gene mutations. J Med Genet 2005, profile, and protein structure. Genomics 2003, 81:234–244. 42:318–321. 40. Ascano M Jr, Mukherjee N, Bandaru P, Miller JB, Nusbaum JD, Corcoran DL, 18. Redfern RE, Daou MC, Li L, Munson M, Gericke A, Ross AH: A mutant form Langlois C, Munschauer M, Dewell S, Hafner M, Williams Z, Ohler U, of PTEN linked to autism. Protein Sci 2010, 19:1948–1956. Tuschl T: FMRP targets distinct mRNA sequence elements to regulate 19. McBride KL, Varga EA, Pastore MT, Prior TW, Manickam K, Atkin JF, Herman GE: protein expression. Nature 2012, 492:382–386. Confirmation study of PTEN mutations among individuals with autism or 41. Stamatakou E, Marzo A, Gibb A, Salinas PC: Activity-dependent spine developmental delays/mental retardation and macrocephaly. Autism Res morphogenesis: a role for the actin-capping protein Eps8. J Neurosci 2010, 3:137–141. 2013, 33:2661–2670.

178 Author’s personal copy Kong et al. Molecular Autism 2014, 5:16 Page 11 of 11 http://www.molecularautism.com/content/5/1/16

42. Menna E, Zambetti S, Morini R, Donzelli A, Disanza A, Calvigioni D, Braida D, Nicolini C, Orlando M, Fossati G, Cristina Regondi M, Pattini L, Frassoni C, Francolini M, Scita G, Sala M, Fahnestock M, Matteoli M: Eps8 controls dendritic spine density and synaptic plasticity through its actin-capping activity. EMBO J 2013. 43. Weichhart T, Saemann MD: The multiple facets of mTOR in immunity. Trends Immunol 2009, 30:218–226. 44. Lee PS, Tsang SW, Moses MA, Trayes-Gibson Z, Hsiao LL, Jensen R, Squillace R, Kwiatkowski DJ: Rapamycin-insensitive up-regulation of MMP2 and other genes in tuberous sclerosis complex 2-deficient lymphangioleiomyomatosis-like cells. Am J Respir Cell Mol Biol 2010, 42:227–234. 45. Ehninger D, Sano Y, de Vries PJ, Dies K, Franz D, Geschwind DH, Kaur M, Lee YS, Li W, Lowe JK, Nakagawa JA, Sahin M, Smith K, Whittemore V, Silva AJ: Gestational immune activation and Tsc2 haploinsufficiency cooperate to disrupt fetal survival and may perturb social behavior in adult mice. Mol Psychiatry 2012, 17:62–70. 46. Ashwood P, Nguyen DV, Hessl D, Hagerman RJ, Tassone F: Plasma cytokine profiles in Fragile X subjects: is there a role for cytokines in the pathogenesis? Brain Behav Immun 2010, 24:898–902. 47. Yuskaitis CJ, Beurel E, Jope RS: Evidence of reactive astrocytes but not peripheral immune system activation in a mouse model of fragile X syndrome. Biochim Biophys Acta 2010, 1802:1006–1012. 48. Narayanan U, Nalavadi V, Nakamoto M, Thomas G, Ceman S, Bassell GJ, Warren ST: S6K1 phosphorylates and regulates fragile X mental retardation protein (FMRP) with the neuronal protein synthesis- dependent mammalian target of rapamycin (mTOR) signaling cascade. J Biol Chem 2008, 283:18478–18482. 49. Auerbach BD, Osterweil EK, Bear MF: Mutations causing syndromic autism define an axis of synaptic pathophysiology. Nature 2011, 480:63–68. 50. Tavazoie SF, Alvarez VA, Ridenour DA, Kwiatkowski DJ, Sabatini BL: Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2. Nat Neurosci 2005, 8:1727–1734. 51. Comery TA, Harris JB, Willems PJ, Oostra BA, Irwin SA, Weiler IJ, Greenough WT: Abnormal dendritic spines in fragile X knockout mice: maturation and pruning deficits. Proc Natl Acad Sci U S A 1997, 94:5401–5404. 52. Choo AY, Kim SG, Vander Heiden MG, Mahoney SJ, Vu H, Yoon SO, Cantley LC, Blenis J: Glucose addiction of TSC null cells is caused by failed mTORC1- dependent balancing of metabolic demand with supply. Mol Cell 2010, 38:487–499. 53. Lunnon K, Sattlecker M, Furney SJ, Coppola G, Simmons A, Proitsi P, Lupton MK, Lourdusamy A, Johnston C, Soininen H, Kłoszewska I, Mecocci P, Tsolaki M, Vellas B, Geschwind D, Lovestone S, Dobson R, Hodges A; dNeuroMed Consortium: A blood gene expression marker of early Alzheimer's disease. J Alzheimers Dis 2013, 33:737–753. 54. Qin M, Kang J, Smith CB: A null mutation for Fmr1 in female mice: effects on regional cerebral metabolic rate for glucose and relationship to behavior. Neuroscience 2005, 135:999–1009.

doi:10.1186/2040-2392-5-16 Cite this article as: Kong et al.: Divergent dysregulation of gene expression in murine models of fragile X syndrome and tuberous sclerosis. Molecular Autism 2014 5:16.

Submit your next manuscript to BioMed Central and take full advantage of:

• Convenient online submission • Thorough peer review • No space constraints or color ﬁgure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

179 !

! !

! Appendix!6!

! ! ! ! ! ! Supplementary!Material!for!Chapter!3! ! ! !

Attached! to! the! thesis! in! a! separate! excel! file! is! Supplementary! Table! 1:!

Differentially!expressed!miRNAs!and!mRNAs.!This!file!contains!in!Tab!1!the!list!of! differentially! expressed! mRNAs! after! RNA;Seq! profiling! and! in! Tab! 2! the! differentially!expressed!miRNAs!from!the!Exiqon!miRNA!microarray!experiment.!!

! ! !

! 180!