Mechanical Induction of Lateral Root Initiation in Arabidopsis Thaliana

The Pennsylvania State University

The Graduate School

The Huck Institutes of the Life Sciences

MECHANICAL INDUCTION

OF LATERAL ROOT INITIATION

A Dissertation in

Integrative Biosciences

Gregory L. Richter

Submitted in Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

May 2009 ii

The dissertation of Gregory L. Richter was reviewed and approved* by the following:

Richard Cyr Professor of Biology Dissertation Advisor and Chair of Committee

Simon Gilroy Professor of Botany

David Braun Assistant Professor of Biology

Randen Patterson Assistant Professor of Biology

Timothy McNellis Associate Professor of Plant Pathology

Peter Hudson Willaman Professor of Biology Director, Huck Institutes of the Life Sciences

*Signatures are on file in the Graduate School

iii

ABSTRACT

Unlike mammals whose development is limited to a short temporal window, plants produce organs de novo throughout their lifetime in order to adapt their architecture to the prevailing environmental conditions. Development of the root system represents a morphogenetic program where the positioning of new lateral organs occurs through the periodic recruitment of pericycle cells to become founder cells of a new lateral root (LR) primordium. While the hormone auxin appears intimately involved in specifying LR formation, it remains unclear why some pericycle cells are specified to initiate a LR while others are not. In the following thesis, I show that mechanical forces can act as one of the triggers for founder cell formation and so entrain the pattern of LR production to the environment. I observed that transient physical bending of the root was capable of eliciting LR formation to the convex side of the curve. Such mechanical stimulation triggered a Ca2+ transient within the pericycle, which was associated with the recruitment of ordinary pericycle cells to a LR founder cell fate. The initial establishment of the mechanically induced LR primordium was independent of an auxin supply from the shoot and was not disrupted by mutants in a suite of auxin transporters and receptor/response elements.

Mechanical forces have long been proposed to act as plant morphogenetic factors, however the cellular elements that translate mechanical force to a developmental signaling cascade have remained obscure. My observations indicate that in the case of mechanical induction of LR formation, the program of organogenesis may be triggered by mechanically elicited Ca2+ changes that can even suppress the requirement for many auxin-related elements normally involved in founder cell recruitment. Thus, the mechano-sensitive Ca2+ signaling system responsible for eliciting LR founder cell fate provides a potentially widespread mechanism whereby external and endogenous mechanical forces could be translated into morphogenetic programs during plant growth and development.

TABLE OF CONTENTS

List of Figures ...... viii

List of Movies ...... xi

List of Abreviations...... xii

Acknowlegments...... xiii

Chapter 1 Introduction to the dissertation ...... 1

Lateral roots arise from founder pericycle cells...... 1

Lateral root formation is regulated via auxin-dependent processes ...... 3

Interactions between auxin, cytokinins and brassinosteroids in lateral

root formation...... 5

Nitric oxide may play a role in auxin-dependent lateral root initiation...... 6

Cell cycle control...... 7

Towards a predictable model system for analyzing lateral root initiation.....9

References...... 11

Chapter 2 Characterization of lateral root initiation in response to root curvature.....17

Introduction...... 17

Auxin dominates lateral root production ...... 17

Curvature of the primary root promotes lateral root initiation...... 20

Materials and methods...... 21

Plant material and growth conditions ...... 21

Histochemical GUS staining...... 22

Laser ablation...... 22

Root bending ...... 23

Results and discussion ...... 23

Root curvature is the result of mechanical force and tropic growth ...... 23

Root curvature forces lateral root initiation to occur earlier in

development ...... 24

Nominal gravitropic root curvature is sufficient for lateral root initiation....24

Gravitropic signaling is not required for curve-associated lateral root

formation...... 25

Auxin dynamics precede curve-associated lateral root initiation events...... 25

Mechanical force elicits lateral root initiation ...... 26

Conclusions ...... 26

References...... 43

Chapter 3 Auxin signaling and curve-associated lateral root initiation ...... 47

Introduction...... 47

Components of the auxin signal...... 47

Auxin signaling is resposible for the endogenous regulation of lateral

root initiation...... 49

Materials and methods...... 51

Plant material and growth conditions ...... 51

Shoot removal and auxin treatment...... 52

Root bending ...... 52

Results and discussion ...... 53

An acropetal supply of auxin is required for bend-induced lateral root

emergence but not for primordium formation...... 53

Bend-induced lateral root formation occurs in auxin-related mutants ...... 53

Bend-induced lateral root formation breaks the spacing rules for lateral

root placement...... 55

References...... 67

Chapter 4 Curve associated lateral root initiation is likely a calcium-mediated

mechanoresponse...... 74

Introduction...... 74

The generation of calcium signals in plants...... 74

Calcium as a regulator of cell-cycle progression...... 77

Materials and methods...... 79

Plant material and growth conditions ...... 79

Application of lathanum chloride...... 79

Calcium imaging ...... 79

Root bending ...... 80

Results and discussion ...... 80

Transient bending is sufficient to trigger lateral root production...... 80

Bending elicits calcium increases in the pericycle of stretched cells...... 81

References...... 91

Chapter 5 Conclusion ...... 96

vii

Identifying the plant mechanosensory channel from pericycle cells ...... 98

Identifying downstream targets of the calcium change in founder

pericycle cells...... 100

Broader significance of my observations...... 102

References...... 105

Appendix...... 108

viii

LIST OF FIGURES

Figure 2.1 Auxin signaling mutants and their associated lateral root phenotypes...... 29

Figure 2.2 Young lupin with a curved principle root...... 30

Figure 2.3 Curve-induced lateral root initiation can dominate the architecture in a

root that has grown into a field of horozontal barriers for 7 days...... 31

Figure 2.4 Induction of lateral root formation in curves of roots ...... 32

Figure 2.5 Gravicurvature causes the site of lateral root initiation to shift...... 33

Figure 2.6 Angle threshold for induction of lateral roots to the convex side of

gravitropically-induced bends...... 34

Figure 2.7 Laser ablation of the root cap causes loss of the normal barrier tracking

response of the root...... 35

Figure 2.8 A decapped root still forms lateral roots on the convex side of bends in

the main root axis...... 36

Figure 2.9 Auxin asymmetries in root curvature as a function of time after

gravistimulation...... 37

Figure 2.10 Documentation of non-reorienting, gel-sliding, root bending assay ...... 38

Figure 2.11 Mechanically-induced bends lead to lateral root formation...... 39

Figure 2.12 Time course of lateral root initiation events in curves after mechanical

bending ...... 40

Figure 3.1 Model (I) ...... 57

Figure 3.2 Model (II)...... 58

Figure 3.3 Effect of shoot removal and subsequent auxin application on bend-

induced lateral root formation...... 59

Figure 3.4 Lateral root production in a range of auxin mutants disrupted at the

level of transport, reception, and response ...... 60

Figure 3.5 Effect of mutations in auxin signaling on bend-induced lateral root

formation...... 61

Figure 3.6 Comparison of the effects of mutations in auxin signaling on bend-

induced and normally occuring lateral root initiation...... 62

Figure 3.7 aux1-7 mutants initiate lateral roots in barrier-induced curves at the

same frequency as wild-type plants...... 63

Figure 3.8 Lateral root initiation in response to bending caused by barrier contact

in aux1-7 and tir1-1 mutants...... 64

Figure 3.9 Multiple lateral roots emerging from curves...... 65

Figure 3.10 Model (III)...... 66

Figure 4.1 Images of a root that has been bent and then restored to its original

position...... 84

Figure 4.2 Effect of transient bending on lateral root formation...... 85

Figure 4.3 Effect of transient bending on calcium levels...... 86

Figure 4.4 Effect of lanthanum chloride on bend-induced lateral root formation...... 87

Figure 4.5 Model (IV) ...... 88

Figure A.1 Organization of cell files is disrupted in roots of avp1 knockout

mutants...... 111

Figure A.2 Floral development is disrupted in avp1 knockout mutants...... 112

LIST OF MOVIES

Movie 2.1 Barrier tracking response of a decapped Arabidopsis root ...... 41

Movie 2.2 Barrier tracking response of an intact Arabidopsis root ...... 42

Movie 4.1 Visualization of bend-induced changes in cytosolic calcium levels ...... 89

Movie 4.2 Lanthanum blocks bend-induced changes in cytosolic calcium levels .....90

xii

LIST OF ABBREVIATIONS

ABA abscisic acid AFB auxin-signaling F-box BR brassinosteroid CaM calmodulin CDK cyclin-dependent kinase CFP cyan fluorescent protein cGMP cyclic guanosine monophosphate CML calmodulin-like protein 2-(4-carboxyphenyl)-4,4,5,5- CPTIO tetramethylimidazoline-1-oxyl 3 oxide cRNA complementary ribonucleic acid DAF-2 DA 4,5-diaminofluorescein diacetate DAG days after germination ER endoplasmic reticulum FPC founder pericycle cell FRET fluorescence resonance energy transfer GFP green fluorescent protein GUS β-glucuronidase IAA indoleacetic acid KRP kip-related protein LOX lipoxygenase LR lateral root MAPK mitogen-activated protein kinase mRNA messenger ribonucleic acid mechanosensitive channels of small MscS conductance MSL MscS-like NAA 1-napthaleneacetic acid NO nitric oxide NPA naphthylphthalamic acid RAM root apical meristem ROS reactive oxygen species RT-PCR reverse transcription polymerase chain reaction SNP sodium nitroprusside tDNA transferred deoxyribonucleic acid TREK TWIK-related K+ TRP transient receptor potential WT wild-type

xiii

ACKNOWLEDGMENTS

Numerous people have contributed in some fashion to the generation of this work. Foremost on this list is my advisor Simon Gilroy, who, in addition to providing much needed support and encouragement, challenged me to think for myself by allowing me to choose and design my own research project. I am extremely grateful to Simon. Without his keen direction and uncanny scientific foresight, the completion of this dissertation would not have been possible.

I sincerely wish to thank the following people: Richard Cyr, for his willingness to serve as chair of my committee and for critiques leading to the substantial improvement of this dissertation; committee members David Braun, Randen Patterson and Timothy McNellis, for their suggestions and guidance throughout the dissertation process; Gioia Massa, for initially characterizing the barrier-induced, curve-associated lateral root initiation response; Sasha Krol, for her help in generating figures 2.5 and 2.6; Tom Beeckman and his colleagues, for allowing me to reproduce their auxin-model in its entirety as figure 3.1; Gabriele Monshausen, for the generation of Movie 4.2 and for her invaluable advice on imaging technique and experimental design; and lab mates Sarah Swanson, Tanya Bibikova, Scott MacCleery, Phil Day and Peter Dowd, for their insight and camaraderie.

This list of acknowledgments would not be complete without the inclusion of my dearest friends and closest confidants Jeffrey Swarz and Maxim Fleischer. Better friends would be hard to find and I am deeply indebted to both of them. Lastly, I wish to thank my parents, Robert and Merrilee Richter. For 35 years they have been a stalwart source of support. All that I am is a reflection of their love. I could not have done this without them.

xiv

This dissertation is dedicated to the memory of my grandparents Leo and Ella Warshaw They were by far my greatest champions This achievement would have pleased them beyond measure

Chapter 1 Introduction to the dissertation

Root systems are responsible for providing water, nutrients and physical support to the plant by way of constructing and maintaining critical architectural configurations. Root branching is a major determinant of this architecture and investigations focused on determining the factors controlling lateral root (LR) initiation are of obvious agronomic importance. Furthermore, LR initiation is a fascinating developmental process because it involves the postembryonic production of an entire organ from a small number of differentiated cells.

LRs provide an important means by which plants can increase their absorptive area and their capacity to exploit soil resources. The placement of LRs is not predetermined and is strongly influenced by environmental conditions (Malamy and Ryan, 2001). This plasticity to environmental stimuli is one way in which plants overcome their inability to move towards areas of high nutrient or water content. Preferential production of LRs in one region results in an overall movement of the root system to effectively bring the plant into closer contact with nutrients and water (reviewed in Malamy and Benfey, 1997).

Lateral roots arise from founder pericycle cells The radial location of LRs is correlated with the xylem architecture of the stele. In Arabidopsis, which has a diarch stele, LRs arise from founder pericycle cells (FPCs) located in files adjacent to a protoxylem pole (Laskowski et al., 1995). Thus, Arabidopsis primary roots contain two columns or ranks of LRs situated 180 degrees apart. Not all pericycle cells in the correct anatomical position form LR primordia and it is unclear why some are directed to initiate the LR developmental program while others are not (reviewed in Casimiro et al., 2003). It is possible that certain pericycle cells are determined at a much earlier stage to assume this fate, and that they are simply following their predetermined developmental program. However, exogenous application of auxin, removal of the root tip, or the presence of additional nutrients, greatly increases the number of LRs initiated. These observations suggest that many, if not all, pericycle cells

2 located in the correct position with respect to protoxylem poles are capable of being stimulated to form LRs in the absence of early determination.

The notion that all LR initiation involves the dedifferentiation of pericycle cells has had its critics in the past. Based on estimates of the length of the cell cycle and the growth rate of the parent root, it has been suggested that some LRs develop from pericycle cells that have been progressing through the cell cycle continuously since their inception in the apical meristem (Blakely et al., 1982). Recently, data has emerged to further substantiate this hypothesis. Dubrovsky et al. (2000) provide evidence which suggests that xylem- pole pericycle cells continue to cycle without interruption after leaving the root apical meristem. Correspondingly, most of the pericycle remains in the G1 phase, with only the xylem-pole pericycle cells progressing from G1 to G2 phase (Beeckman et al., 2001). These results combine to form the basis of an argument supporting the concept of a monolayered extended meristem that occurs in the young apical region of the root just above the elongation zone. In contrast, LRs that develop from mature regions of the primary root most certainly require dedifferentiation and are derived from pericycle cells that were previously arrested in the cell cycle (Ferreira et al., 1994).

In Arabidopsis, the first morphological event related to LR initiation occurs when two FPCs located in the same column undergo nearly synchronous asymmetrical, transverse divisions. This event results in two short pericycle derivatives lying end to end in the same column, flanked above and below by the two longer pericycle derivatives. This morphological criterion allows for the clear identification of the site of LR initiation. Following this initial division, FPCs undergo transversal, periclinal, anticlinal, and oblique divisions, giving rise to a group of derivatives that comprise a LR primordium (reviewed in Lloret et al., 2002). Laskowski et al. (1995) have proposed that meristem formation is a two-stage process involving an initial period during which a population of rapidly dividing, approximately isodiametric cells that constitutes the primordium is formed; and a subsequent stage during which the new meristem formation takes place within the primordium.

Lateral root formation is regulated via auxin-dependent processes Most researchers agree that auxin is a key signal during LR initiation and development, as many lines of experimental evidence strongly support a role for auxin during LR formation (reviewed in Casimiro et al., 2003). It is likely that auxin transport plays an important role in regulating the hormone flux between indoleacetic acid (IAA) source and sink tissues, thereby influencing LR development. Mutations that disrupt auxin transport also modify LR architecture in Arabidopsis (Bhalerao et al., 2002). For example, the tir3 mutation causes a reduction in polar auxin transport, leading to fewer LRs (Ruegger et al., 1997), whereas the root architecture of the shoot meristemless mutant, which has lost the acropetal pattern of development because of its failure to form leaf primordia, results in a loss of the transient pulse of IAA that coordinates LR emergence (Casimiro et al., 2001). The alf4 mutants fail to initiate LR primordia, whereas in alf3 seedlings, LR initiation occurs normally but formation arrests shortly before emergence. The ALF3 protein is apparently required for the biosynthesis of indole (the precursor of IAA) as the application of indole substitutes for IAA in the phenotypic recovery of the alf3 mutant (Celenza et al., 1995). The contrasting phenotypes of the alf3 and alf4 mutants suggest that IAA is required at several stages of LR development. Mutations in the putative auxin influx carrier AUX1 modify root architecture by the disruption in hormone transport between IAA source and sink tissue and result in a 50% reduction in LR number (Hobbie and Estelle, 1995). The reason for this reduction in aux1 LR number is not the arrest of LR emergence, but rather the proportionate reduction in the rate of LR primordia initiation (Marchant et al., 2002).

Polar auxin transport allows root cells to react to stimuli according to their location on a positional framework. IAA transported from the developing leaves to the root system is detectable as a short-lived pulse in the roots and is required for the emergence of the LR primordia during early seedling development. LR primordia emergence is inhibited by the removal of apical tissues or by the application of the synthetic auxin inhibitor naphthylphthalamic acid (NPA) prior to detection of the IAA pulse in the root (Reed et al.,1998), but this treatment has minimal effects on LR primordia initiation (Bhalerao et al., 2002). Based on these results, Bhalerao et al. (2002) have proposed a model for LR

4 formation during early seedling development that can be divided into two phases: (1) a LR initiation phase dependent on a root tip-localized IAA source, and (2) a LR emergence phase dependent on leaf-derived auxin.

IAA entry into cells is facilitated by an auxin uptake carrier encoded by the AUX1 gene (Marchant et al., 1999). Recent evidence suggests that AUX1 performs a dual auxin transport function in the Arabidopsis root apex, facilitating acropetal and basipetal auxin transport in protophloem and lateral root cap cells, respectively (Swarup et al., 2001). Auxin moves out of plant cells through an efflux carrier complex that is sensitive to synthetic inhibitors of auxin transport, including NPA, and is thought to be composed of at least two polypeptides (Muday and DeLong, 2001). The first polypeptide of the efflux carrier is an integral membrane transporter presumably encoded by one of the members of the PIN gene family (Palme and Gälweiler, 1999). The PIN proteins show an asymmetric localization in the plasma membrane consistent with a role in controlling the polarity of auxin movement (Gälweiler et al., 1998; Muller et al., 1998). Several members of the PIN gene family in Arabidopsis have been identified, indicating that there are multiple auxin efflux carriers with distinct expression patterns (reviewed in Palme and Gälweiler, 1999). The second protein component of the auxin efflux carrier complex appears to act as a regulatory subunit and is the binding site for synthetic inhibitors such as NPA (Rubery, 1990). This NPA binding protein seems to be a separate polypeptide from the PIN protein, because it has a peripheral membrane association and cytoplasmic localization (Dixon et al., 1996; Muday, 2000). The NPA binding protein is also believed to bind endogenous regulatory compounds such as flavonoids, which have been shown to displace NPA binding and to inhibit auxin efflux in vitro (Rubery and Jacobs, 1990). The P-glycoprotien ABCB19/PGP19 is a member of the multidrug resistance (MDR) gene family and has recently been identified as a possible third component of the proposed auxin efflux transporter. Based on results which show that the interaction of PIN1 and ABCB19/PGP19 in the plasma membrane enhances the rate and specificity of auxin efflux and that this interaction causes the reduction of the dynamic cycling of PIN1, Titapiwatanakun et al. (2009) have proposed that ABCB19/PGP19 functions to stabilize PIN1 in the plasma membrane.

Interactions between auxin, cytokinins and brassinosteroids in lateral root formation The study of LR formation is complicated due to its internal nature, and many questions about the hormonal control of LR initiation remain unanswered. However, the availability of new molecular tools and more complete genomic data in the model species Arabidopsis has dramatically increased the probability of finding new and crucial elements in the LR initiation pathway. To this end, it has become increasingly apparent that other hormone signaling pathways converge to play integral roles during the initiation and establishment of LR primordia (reviewed in Casimiro et al., 2003) and many investigators feel that the control of LR formation would be better understood if it were analyzed in terms of interactions between hormones rather than considering the effects of an isolated growth regulator.

Thus, auxin and cytokinin concentrations along the parent root have both been thought to control LR initiation, meristem formation, and LR emergence. For example, in excised pea roots the behavior of the pericycle depends on the ratio of exogenous auxin to cytokinins. Auxin alone promotes LR initiation; cytokinins alone bring about the formation of a multiseriate pericycle; and the combination of both growth regulators organizes a functional cambium (reviewed in Lloret and Casero 2002). Recently, auxin has been shown to mediate a very rapid negative control of the cytokinin pool by suppressing biosynthesis via the isopentenyladenosine-5’-monophosphate-independent pathway. In contrast, the effect of cytokinin overproduction on the entire auxin pool in the plant was slower, indicating that this most likely is mediated through altered development (Nordstrom et al., 2004). The demonstration that auxin imposes a very rapid regulation of cytokinin biosynthesis, illustrates that the two hormones can also interact on the metabolic level during the control of plant development.

Brassinosteroids (BRs) and auxin have been known to exert some similar physiological effects likely through their functional interaction, but the mechanism for this interaction is unknown. Recently, Bao et al. (2004) have shown BR perception is required for the transgenic expression of the β-glucuronidase gene fused to a synthetic auxin-inducible

6 promoter (DR5::GUS) in root tips, and that BR induction of both LR formation and DR5::GUS expression is suppressed by the auxin transport inhibitor NPA. The idea that BRs act synergistically with auxin by regulating IAA transport to promote LR formation is an interesting hypothesis concerning the hormonal interactions required for LR development in Arabidopsis.

Nitric oxide may play a role in auxin-dependent lateral root initiation The gaseous signaling molecule, nitric oxide (NO) has received a lot of attention in the plant research community of late and as such has been linked to processes as diverse as gravitropism and the regulation of K+ and Cl- channels in guard cells (reviewed in Lamattina et al., 2003). Correa-Aragunde et al. (2004) have discovered that the application of the NO donor sodium nitroprusside (SNP) to tomato seedlings induced LR emergence and elongation in a dose-dependent manner. The effect was shown to be specific for NO since the NO scavenger CPTIO blocked the action of SNP and prevented LR formation in response to the synthetic auxin NAA in a dose-dependent manner. Depletion of endogenous NO with CPTIO resulted in the complete abolition of LR emergence, while the detection of endogenous NO by the specific probe DAF-2 DA revealed that the NO signal was specifically located in LR primordia during all stages of their development. In addition, SNP was able to promote LR development in auxin- depleted seedlings treated with the auxin transport inhibitor NPA (Correa-Aragunde et al., 2004).

While considered a distinct process from LR formation, adventitious root formation involves the development of a new root primordium and thus is thought to share many critical aspects of molecular function with LR initiation and development. Adventitious root formation induced by the removal of the primary root has been used to show that NO and cGMP are involved in the auxin response during the adventitious rooting process in cucumber (Pagnussat et al., 2002; Pagnussat et al., 2003). Furthermore, evidence has recently surfaced indicating that a MAP kinase (MAPK) signaling cascade is activated during the adventitious rooting process induced by IAA in a NO-mediated, but cGMP- independent, pathway (Pagnussat et al., 2004).

Cell cycle control In the absence of applied auxins, LRs are initiated in acropetal sequence. Upon treatment with exogenous auxin, additional LRs are initiated along the length of the primary root (Blakely et al., 1988). For these and other reasons, LRs arising in response to auxin application are believed to have slightly different origins than those arising without added auxin. Roots deprived of endogenous auxin by growing them in the presence of NPA fail to initiate mitosis (Casimiro et al., 2001). Deprivation of auxin keeps pericycle cells in

G1 phase and re-addition of auxin promotes the G1–S transition (Stals and Inzé, 2001). This is contrary to normal LR initiation, in which pericycle cells are thought to arrest in the G2 phase (Beeckman et al., 2001).

In all higher eukaryotes, including plants, activation of a cyclin-dependent kinase (CDK) at the G1–S transition leads to hyperphosphorylation of the transcriptional repressor retinoblastoma protein (Meijer and Murray, 2000; Boniotti and Gutierrez, 2001). Inactivated retinoblastoma releases the transcription factor E2F/DP, which then triggers the expression of S phase–specific genes (De Veylder et al., 2002; Kosugi and Ohashi,

2002). The next checkpoint, G2–M, regulates cell cycle progression to the mitotic phase, mainly through B-type CDKs (Joubès et al., 2000; Boudolf et al., 2001). Characteristically, cell cycle–regulatory proteins fluctuate during the cell cycle. Generally, this fluctuation is mediated by stringent transcriptional regulation and controlled proteolysis (Pagano et al., 1995; Genschik et al., 1998). In addition, a class of CDK-inhibitory proteins, the Kip-related proteins (KRPs), is involved in inactivating CDK/cyclin complexes (De Veylder et al., 2001).

Arabidopsis D-type cyclin genes are expressed in a manner independent of the cell cycle phase with transcription being regulated by the presence of mitogens, just as described for their mammalian counterparts (Fuerst et al., 1996). By using the cyclin-dependent kinase CDC2a as bait during a two-hybrid screen, De Veylder et al. (1999) isolated a novel Arabidopsis D-type cyclin, CYCD4;1. The expression of CYCD4;1 was limited to embryogenesis, vascular tissue development, and the formation of LR primordia,

8 prompting the authors to speculate that the expression of D-type cyclins by mitogenic stimuli might be one of the rate-limiting events for the initiation of LRs.

In an elegant set of experiments, Himanen et al. (2002) utilized the synchronous LR initiation phenomena resulting from the inhibition of auxin transport followed by the addition of exogenous auxin, to create a LR–inducible system and study the transcriptional regulation of CDKs and KRPs, as these genes were likely candidates for a starting point in the study of the molecular targeting mechanism of auxin action during the LR initiation process. The expression level of the KRP2 gene was high in roots treated with NPA and dramatically declined upon auxin treatment (Stals and Inzé, 2001). Himanen et al. (2002) monitored auxin induced pericycle division using the well- characterized marker line for active cell division, CYCB1;1::uidA. In situ hybridization revealed that KRP2 transcripts accumulated in pericycle cells not implicated in LR initiation and overexpression of KRP2 reduced the number of LRs by more than 60%. These data suggest a role for the CDK inhibitor KRP2 in controlling the LR initiation process and imply that auxin levels in the root apex might control LR initiation via the transcriptional regulation of KRP2. These researchers have speculated that by binding to and thus inhibiting the permanently present CDK complexes, KRP2 could finely control the division activity of the meristematically competent pericycle.

By using several promoter-β-glucuronidase (GUS) reporter lines and performing RT- PCR analysis for cell cycle and auxin-responsive genes, Himanen et al. (2004) have demonstrated a protoxylem pole-specific auxin response of pericycle cells in their LR- induction system. The only tissues other than the pericycle responding to the auxin treatment were the root apical meristem and the hypocotyl, and these tissues were dissected and excluded from analyses prior to microarray transcript profiling. The reproducible expression profiles achieved during a time course study allowed these researchers to define four stages that precede cell division in the pericycle. These early stages were characterized by expression profiles reflecting (1) a G1 cell cycle block, (2) auxin perception, (3) signal transduction, and (4) a progression from G1–S and G2–M.

Towards a predictable model system for analyzing lateral root initiation Novel approaches geared towards utilizing large numbers of pericycle cells uniformly synchronized in their ability to initiate LR development, such as those developed by Himanen et al. (2002; 2004) have facilitated the investigation of forward-genetics minded projects evaluating the LR initiation response in Arabidopsis. To further substantiate the molecular roles of the genetic components gleaned from such studies, physiological assays in which the initiation and formation of LRs can be monitored in a reproducible manner will be required. In an effort to effect these investigations, I have attempted to establish a set of growth conditions where LR initiation is both consistent and predictable.

In a study to determine the developmental window, spatial patterning, density and predictability of LR initiation, Dubrovsky et al. (2006) concluded that there are no specific cell count or distance measuring mechanisms that can reliably determine the site of successive LR initiation events. However, by rediscovering the phenomenon of curve- associated LR formation and finding unique ways of manipulating root architecture, I have established a physiological assay that allows me to predictably determine the site of future LR initiation events. This new assay has proved to be a valuable tool, providing a wealth of information regarding the control of LR initiation. By knowing which pericycle cells are eventually going to divide and become LR primordia, I have been able to identify a novel regulatory signaling element involved in LR initiation. In the following chapters, I will address many unanswered questions regarding the environmental control of FPC fate specification and provide a unique perspective on some of the more elusive elements of the signal transduction pathway governing the LR initiation process.

In this chapter, I have provided a broad introduction to LR initiation.

In chapter two, I will discuss the relationship between LR initiation and primary root curvature. Furthermore, I will show that (1) curvature of the primary root promotes LR initiation on the convex side, (2) root curvature forces LR initiation to occur earlier in development, (3) nominal root curvature is sufficient for LR initiation, (4) the signaling

10 mechanism responsible for LR initiation in response to primary root curvature is separate from that which governs gravitropism, and (5) it is possible to induce LR initiation by physically bending a primary root.

In chapter three, I will discuss the role of auxin in LR initiation and show that (1) shoot- derived auxin is not required for LR initiation in response to bending, (2) prior to LR initiation, auxin is asymmetrically localized to the convex side of the bent root, and (3) the Arabidopsis mutants aux1, axr4 and tir1 all have LR initiation phenotypes that can be overcome by bending.

In chapter four, I will discuss the involvement of Ca2+ signaling in plant mechanoresponses and the role of Ca2+ as a regulator of cell cycle control. In addition, I will show that (1) a biphasic Ca2+ transient occurs in pericycle cells during bending, (2) this Ca2+ transient correlates precisely with the site of LR initiation, (3) keeping a root bent for as little as 20 seconds before straightening it provides enough of a stimulus to induce LR initiation on the convex side of the bend site, and (4) the Ca2+ channel blocker

LaCl3 prevents LR initiation in response to the transient stimulus generated by bending a primary Arabidopsis root.

In chapter five, I will discuss the major themes covered in this thesis, explore possible avenues for future investigations, and conclude with a discussion of the significance of my observations.

References

Bao F, Shen J, Brady SR, Muday GK, Asami T, Yang Z (2004) Brassinosteroids interact with auxin to promote lateral root development in Arabidopsis. Plant Physiol 134: 1624- 1631

Beeckman T, Burssens S, Inzé D (2001) The peri-cell cycle in Arabidopsis. J Exp Bot 52: 403–411

Bhalerao R, Eklöf J, Ljung K, Marchant A, Bennett M, Sandberg G (2002) Shoot derived auxin is essential for early lateral root emergence in Arabidopsis seedlings. Plant J 29: 325–332

Blakely LM, Durham M, Evans TA, Blakely RM (1982) Experimental studies on lateral root formation in radish seedling roots I: General methods, developmental stages, spontaneous formation of laterals. Bot Gaz 143: 341-352

Blakely LM, Blakely RM, Colowit PM, Elliot DS (1988) Experimental studies on lateral root formation in radish seedling roots II: Analysis of the dose response to exogenous auxin. Plant Physiol 87: 414-419

Boniotti MB and Gutierrez C (2001) A cell-cycle-regulated kinase activity phosphorylates plant retinoblastoma protein and contains, in Arabidopsis, a CDKA/cyclin D complex. Plant J 28: 341–350

Boudolf V, Rombauts S, Naudts M, Inzé D, De Veylder L (2001) Identification of novel cyclin-dependent kinases interacting with the CKS1 protein of Arabidopsis. J Exp Bot 52: 1381–1382

Casimiro I, Marchant A, Bhalerao RP, Beeckman T, Dhooge S, Swarup R, Graham N, Inzé D, Sandberg G, Casero PJ, Bennett M (2001) Auxin transport promotes Arabidopsis lateral root initiation. Plant Cell 13: 843–852

Casimiro I, Beeckman T, Graham N, Bhalerao R, Zhang H, Casero P, Sandberg G, Bennett MJ (2003) Dissecting Arabidopsis lateral root development. Trends Plant Sci 8: 165-171

Celenza JL, Grisa PL, Fink GR (1995) A pathway for lateral root formation in Arabidopsis thaliana. Genes Dev 9: 2131-2142

Correa-Aragunde N, Graziano M, Lamattina L (2004) Nitric oxide plays a central role in determining lateral root development in tomato. Planta 218: 900-905

De Veylder L, de Almeida JE, Burssens S, Manevski A, Lescure B, Van Montagu1 M, Engler1 G, Inze D (1999) A new D-type cyclin of Arabidopsis thaliana expressed during lateral root primordia formation. Planta 208: 453-462

De Veylder L, Beeckman T, Beemster G, Krols L, Terras F, Landrieu I, Van Der Schueren E, Maes S, Naudts M, Inzé D (2001) Functional analysis of cyclin-dependent kinase inhibitors of Arabidopsis. Plant Cell 13: 1653–1667

De Veylder L, Beeckman T, Beemster G, de Almeida EJ, Ormenese S, Maes S, Naudts M, Van Der Schueren E, Jacqmard A, Engler G, Inzé D (2002) Control of proliferation endoreduplication and differentiation by the Arabidopsis E2Fa-Dpa transcription factor. EMBO J. 21: 1360–1368

Dixon MW, Jacobson JA, Cady CT, Muday GK (1996) Cytoplasmic orientation of the naphthylphthalamic acid-binding protein in zucchini plasma membrane vesicles. Plant Physiol 112: 421–432

Dubrovsky JG, Doerner PW, Colon-Carmona A, Rost TL (2000) Pericycle cell proliferation and lateral root initiation in Arabidopsis. Plant Physiol 124: 1648-1657

Ferreira PCG, Hemerly A, de Almeida EJ, Van Montagu M, Engler G, Inze D (1994) Developmental expression of the Arabidopsis Cyclin gene cyc1At. Plant Cell 6: 1763– 1774

Fuerst R, Soni R, Murray JAH, Lindsey K (1996) Modulation of cyclin transcript levels in cultured cells of Arabidopsis thaliana. Plant Physiol 112: 1023–1033

Gälweiler L, Guan C, Muller A, Wisman E, Mendgen K, Yephremov A, Palme K (1998) Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science 282: 2226-2230

Genschik P, Criqui MC, Parmentier Y, Derevier A, Fleck J (1998) Cell cycle-dependent proteolysis in plants: Identification of the destruction box pathway and metaphase arrest produced by the protease inhibitor MG132. Plant Cell 10: 2063–2075

Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inze D, Beeckman T (2002) Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14: 2339-2351

Himanen K, Vuylsteke M, Vanneste S, Vercruysse S, Boucheron E, Alard P, Chriqui D, Van Montagu M, Inze D, Beeckman T (2004) Transcript profiling of early lateral root initiation. Proc Natl Acad Sci 101: 5146-5151

Hobbie L. and Estelle M (1995) The axr4 auxin-resistant mutants of Arabidopsis thaliana define a gene important for root gravitropism and lateral root initiation. Plant J 7: 211- 220

Joubès J, Chevalier C, Dudits D, Heberle-Bors E, Inzé D, Umeda M, Renaudin JP (2000) CDK-related protein kinases in plants. Plant Mol Biol 43: 607–620

Kosugi S and Ohashi Y (2002) Interaction of the Arabidopsis E2F and DP proteins confers their concomitant nuclear translocation and transactivation. Plant Physiol 128: 833–843

Lamattina L, Garcia-Mata C, Graziano M, Pagnussat G (2003) Nitric Oxide: The versatility of an extensive signal molecule. Ann Rev Plant Biol 54: 109-136

Laskowski MJ, Williams ME, Nusbaum HC, Sussex IM (1995) Formation of lateral root meristems is a two-stage process. Development 121: 3303–3310

Lloret PG, Casero PJ, Navascues J, Pulgarin A (2002) Chapter 8. In Plant Roots: The hidden half. 3rd ed. Waisel Y, Eshel A, Kafkafi U, eds. New York and Basel, Marcel Dekker 127-155

Malamy JE and Benfey PN (1997) Down and out in Arabidopsis: the formation of lateral roots. Trends Plant Sci 2: 390–396

Malamy JE and Ryan KS (2001) Environmental regulation of lateral root initiation in Arabidopsis. Plant Physiol 127: 899–909

Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C, Bennett MJ (1999) AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. EMBO J 18: 2066-2073

Marchant A, Bhalerao R, Casimin, I, Caseno P, Bennett M, Sandberg G (2002) Aux 1 promotes lateral root formation by facilitating IAA distribution between sink and source tissues in Arabidopsis seedling. Plant Cell 14: 589-597

Meijer M. and Murray JAH (2000) The role and regulation of D-type cyclins in the plant cell cycle. Plant Mol Biol 43: 621–633

Muday G (2000) Maintenance of asymmetric cellular localization of an auxin transport protein through interaction with the actin cytoskeleton. JPGR 19: 385–396

Muday GK and DeLong A (2001) Polar auxin transport: Controlling where and how much. Trends Plant Sci 6: 535-542

Muller A, Guan C, Gälweiler L, Tanzler P, Huijser P, Marchant A, Parry G, Bennett M, Wisman E, Palme K (1998) AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J 17: 6903–6911

Nordstrom A, Tarkowski P, Tarkowska D, Norbaek R, Åstot C, Dolezal k, Sandberg G (2004) Auxin regulation of cytokinin biosynthesis in Arabidopsis thaliana: A factor of potential importance for auxin–cytokinin-regulated development. Proc Natl Acad Sci 101: 8039-8044

Pagano M, Tam SW, Theodoras AM, Beer-Romero P, Del Sal G, Chau V, Yew PR, Draetta GF, Rolfe M (1995) Role of the ubiquitin-proteasome pathway in regulating abundance of the cyclin-dependent kinase inhibitor p27. Science 269: 682–685

Pagnussat GC, Simontacchi M, Puntarulo S, Lamattina L (2002) Nitric oxide is required for root organogenesis. Plant Physiol 129: 954–956

Pagnussat GC, Lanteri ML, Lamattina L (2003) Nitric oxide and cyclic GMP are messengers in the IAA-induced adventitious rooting process. Plant Physiol 132: 1241– 1248

Pagnussat GC, Lanteri ML, Lombardo MC, Lamattina L (2004) Nitric oxide mediates the indole acetic acid induction activation of a mitogen-activated protein kinase cascade involved in adventitious root development. Plant Physiol 135: 279-286

Palme K and Gälweiler L (1999) PIN-pointing the molecular basis of auxin transport. Curr Opin Plant Biol 2: 375–381

Reed RC, Brady SR, Muday GK (1998) Inhibition of auxin movement from the shoot into the root inhibits lateral root development in Arabidopsis. Plant Physiol 118: 1369-78

Rubery PH (1990) Phytotropins: Receptors and endogenous ligands. Symp Soc Exp Biol 44: 119–146

Rubery P and Jacobs M (1990) Auxin transport and its regulation by flavonoids. In Plant Growth Substances. Pharis RP and Rood SB, eds. Berlin. Springer Verlag 428–440

Ruegger M, Dewey E, Hobbie L, Brown D, Bernasconi P, Turner J, Muday G, Estelle M (1997) Reduced naphthylphthalamic acid binding in the tir3 mutant of Arabidopsis is associated with a reduction in polar auxin transport and diverse morphological defects. Plant Cell 9: 745-757

Stals H. and Inzé D (2001) When plant cells decide to divide. Trends Plant Sci 6: 359– 364

Swarup R, Friml J, Marchant A, Ljung K, Sandberg G, Palme K, Bennett M (2001) Localization of the auxin permease AUX1 suggests two functionally distinct hormone transport pathways operate in the Arabidopsis root apex. Genes Dev 15: 2648-2653

Titapiwatanakun B, Blakeslee JJ, Bandyopadhyay A, Yang H, Mravec J, Sauer M, Cheng Y, Adamec J, Nagashima A, Geisler M, Sakai T, Friml J, Peer WA, Murphy AS (2009) ABCB19/PGP19 stabilises PIN1 in membrane microdomains in Arabidopsis. Plant J 57: 27-44

Chapter 2 Characterization of lateral root initiation in response to root curvature

Introduction The production of a root system, with respect to LRs and branching patterns, is classically split into two stages: LR initiation, and primordium construction/development. LR initiation represents the decision by a specific pericycle cell overlying the xylem pole of the vasculature to become a LR founder cell; whereas primordium formation consists of cell divisions, production of a new organ and subsequent emergence from the root surface. Figure 2.1 depicts a number of auxin-signaling related mutants and their associated LR phenotypes. Analysis of these mutants reveals that while some fail to initiate LRs, others initiate LRs but fail to form primordia correctly. Thus, it is possible to genetically remove the LR construction/development component and still have initiation occur in a normal fashion, suggesting that specification of founder cells and the subsequent activation of cell division leading to primordium formation represent two genetically separable events.

Auxin dominates lateral root production Hormonal signals have been intimately connected with the regulation of both these phases of LR formation and it is widely accepted that auxin plays a principal role in this process. This characteristic function of auxin has been successfully exploited in several mutant screenings, resulting in the identification of auxin-signaling mutants with distinct LR phenotypes. For instance, the alf (aberrant lateral root formation) mutants are disrupted at the level of auxin biosynthesis and depending on the gene, either (a) display a hyper-proliferation of LRs (alf1), (b) form incomplete LR primordia (alf3), or (c) fail to initiate LRs altogether (alf4). Interestingly, the alf3 mutant can be rescued by IAA, whereas the alf4 mutant is not rescued (Celenza et al., 1995). The aux1 and tir3 mutants are disrupted at the level of auxin transport and show a reduced frequency of LR initiation events (Marchant et al., 2002; Lease et al., 2001). Similarly, the tir1 mutant (disrupted at the level of signal perception) is deficient in IAA-induction of LRs. (Ruegger et al., 1998). Thus, there is a significant amount of data to suggest that auxin

18 signaling at different levels is involved in both stages (founder cell specification and subsequent primordium construction/development) of LR production.

Based on the results from experiments using the highly active, synthetic auxin response element DR5 to drive expression of the GUS reporter gene and visualize auxin maxima in the basal meristem, De Smet et al. (2007) have theorized that temporal oscillations in auxin maxima act as an endogenous regulator to pre-pattern LR production. DR5-GUS staining patterns in the meristem show rhythmic expression with the same periodicity as LR initiation (De Smet et al., 2007) and this phasing of roughly 15 hours correlates with the time span between the initiation of two successive LRs, as was recently calculated for Arabidopsis by Dubrovsky et al. (2006). Taken together, these data support the concept of an endogenous developmental program driven by auxin that functions to evenly space LR initiation events in the basal meristem.

There is also circumstantial experimental evidence that auxin is the local instructive signal sufficient for the acquisition of founder cell identity. In a recent paper, Dubrovsky et al. (2008) showed that the local production and subsequent accumulation of auxin in single pericycle cells induced by a Cre-Lox-based activation of auxin synthesis converts them into founder cells. Thus, these researchers used the heat shock-inducible Cre recombinase gene to drive expression of the GUS reporter and the bacterial enzyme (indoleacetic acid tryptophan monooxygenase) that converts tryptophan to indole-3- acetamide in one of the first steps in tryptophan-dependent auxin biosynthesis. By using GUS to co-mark cells receiving the gene for the enzyme, they were able to show that tryptophan-fed pericycle cells expressing the auxin synthetic enzyme were recruited to make LRs; implying that elevated auxin in these cells determined their fate as FPCs. However, because this work utilized a biosynthetic enzyme to generate an auxin precursor and did not directly increase auxin levels within specified pericycle cells, there is a lack of direct experimental proof that auxin itself is the inductive signal determining FPC specification.

The work discussed above suggests that, at a mechanistic level, the two genetically distinct processes, LR initiation and primordium formation/development, share auxin signal transduction components. However, the evidence that auxin actually determines the pattern of LRs remains circumstantial. To summarize this indirect evidence for auxin as the key regulator of LR patterning/formation: (1) successive treatments with an auxin transport inhibitor and exogenous auxin lead to the synchronous initiation of LRs within the entire pericycle (Himanen et al., 2002), (2) oscillations in DR5 activity are correlated with LR initiation sites (Dubrovsky, 2006; De Smet, 2007), suggesting local elevations in auxin activity could determine LR position, and (3) increasing auxin levels in specific pericycle cells forces those cells to make LRs (Dubrovsky, 2008). This data would seem to be consistent with an endogenous auxin-driven program regulating the placement and production of LRs.

In addition to endogenous regulation, the placement of LRs is dramatically influenced by external cues and is a highly plastic phenomenon (Leyser and Fitter, 1998). For instance, the availability of nutrients affects both the number and location of LR initiation sites (Drew et al., 1973; Drew, 1975; Drew and Saker, 1978). The fact that LR initiation does not always appear to follow a predetermined, endogenous program is not surprising; nutrient availability and distribution is in constant flux in the environment, and root branching has a central role in exploring the soil. For optimal growth, plants must be able to (1) sense these fluxes in nutrient availability, (2) monitor and respond to their own internal nutrient status, and (3) decide when and where to trigger LR initiation (Malamy and Ryan, 2001). Thus, it would be difficult for a model based solely on fluctuations in auxin maxima, to account for the combination and complexity of endogenous and environmental signals controlling LR initiation.

Indeed, there are mutants with phenotypes in LR production that do not appear to be directly related to auxin. For instance, the oxylipin synthesis deficient Arabidopsis mutants noxy2, lox1, and lox5, have decreased lipoxygenase (LOX) activity and show an increased number of LRs compared to WT plants. In addition, LOX1 and LOX5 are expressed in developing LR primordia and the application of a LOX derivative causes the arrest of LR primordium emergence (Vellosillo et al., 2007). The armadillo-related

Arabidopsis arabidillo-1/-2 mutants form fewer LRs than WT plants. ARABIDILLO-1- overexpressing lines show a hyper-proliferation of LRs, while the overexpression of ARABIDILLO-1 protein fragments in WT seedlings reduces LR formation to the level of the arabidillo-1/-2 mutant (Coates et al., 2006). Thus, there is sufficient evidence to suggest that LR initiation may also be controlled by something other than auxin.

Curvature of the primary root promotes lateral root initiation More than 100 years ago, Noll (1900) noted that LRs predictably form on the convex side of a curved primary root (Fig 2.2). This phenomenon happens whether the curve is the result of mechanical impedance by a barrier (Goss and Russell, 1979) or a change in unidirectional gravitational stimulus (Fourtin et al., 1989). Together, these findings provide one of the best indications that LR formation is responsive to something other than an endogenous program. Recently, Lucas et al. (2008a) confirmed that LR initiation can be induced by curvature in response to a perceived change in the gravity vector and hypothesized that LR initiation and gravitropic response are controlled by the same signaling components. Considering the close link between auxin redistribution and tropic growth, it is tempting to speculate that the auxin movements elicited by gravitropic response could directly play into modulating an auxin-dependent system that determines LR positioning. Yet another reason to suspect that LR initiation and gravitropic response share mechanistic features, is that several mutations simultaneously affect both responses. For instance, the Arabidopsis axr4, rgr1, and aux1, show both reduced gravitropic response and a decrease in the frequency of LR initiation events (Hobbie and Estelle, 1995; Simmons et al., 1995; Marchant et al., 2002).

As plant roots are constantly encountering barriers to impede downward growth, the curve-induced LR initiation phenomenon may significantly influence the root system’s pattern formation. This is demonstrated in figure 2.3, where a root was grown into a series of barriers for 7 days. Note that in every barrier-created curve, there is at least one LR positioned at the apex on the convex side. However, it is important to realize that a root growing in such a controlled environment lacks the variety of modulating stimuli that a root growing in soil would encounter (i.e. moisture gradients, temperature fluxes

21 and varying nutrient concentrations). Thus, it is possible that roots grown in a more natural environment may not demonstrate such dominant curve-induced LR pattern formation.

Both thigmotropic growth (in response to barrier contact) and gravitropic growth (due to reorientation) each result in LR initiation to the convex side of the curve. In the case of gravitropism, auxin plays an important role in both signaling and curvature development. The gravitropic reorientation of Arabidopsis seedlings induces a rapid, asymmetric release of auxin from gravity-sensing columella cells at the root apex (Ottenschläger et al., 2003). The resulting lateral auxin gradient is hypothesized to drive differential cell expansion in elongation-zone tissues in an AUX1 dependent manner (Swarup et al., 2005). Thus, gravitropic growth is linked to the localized redistribution of auxin and the resulting maxima of the hormone could modulate auxin-dependent LR formation. However, the redistribution of auxin induced by gravitropism leads to epidermal cells on the concave portion of the root having higher concentrations of auxin than those on the convex portion. Therefore, the auxin asymmetry created in the epidermal cells during gravitropic reorientation is the opposite of what one might expect if the lateral auxin flux was directly responsible for curve-induced LR initiation. Currently, such inconsistencies are unexplainable due in large part to the lack of (1) a rigorous characterization of the effects of curvature on LR placement and (2) a robust analysis of the potential roles of tropic signaling versus the mechanics/geometry of the curve itself. The work described subsequently in this chapter will address both these deficiencies. It will provide a quantitative characterization of curve-related LR formation and demonstrate that it is the mechanical forces inherent in bending, rather than tropic signaling from the root cap, that is the inductive event in this process.

Materials and methods Plant material and growth conditions Arabidopsis thaliana (L.) Heyhn seeds of the Columbia ecotype were used in experiments involving wild-type plants. DR5::GUS and GFP seeds were kindly provided by Dr. Ellison Blancaflor at the Noble Foundation. DR5::GUS is in the Colombia background and has been described previously (Ulmasov et al., 1997).

Unless otherwise stated, all chemicals were obtained from Sigma. Seeds were surface sterilized with 50% (v/v) bleach for 10 min, rinsed three times and incubated in sterile 0.05M HCl for 2 min followed by an additional three rinses. Half strength Epstein’s . . medium (3 mM KNO3, 2 mM Ca(NO3)2 4H2O, 0.5 mM MgSO, 7H2O, 1 mM (NH4)2PO4, 0.56 mM myo-inositol, 2.3 mM Mes, 0.5% (w/v) sucrose, micronutrients (25 µM KCl, . . . 17.5 µM H3BO3, 1 µM MnSO4 H2O, 1 µM ZnSO4 7H20, 0.25 µM CuSO4 5H2O, 0.25 µM . (NH4)6MoO24 4H2O, and 25 µM Fe-Na EDTA), and 1.5% (w/v) Phytagel at pH 5.7) was autoclaved for 25 min (Wymer et al., 1997). The nutrient media was poured into 90-mm plastic Petri dishes and seeds were planted by pushing them beneath the surface of the solidified media using a toothpick. The dishes were wrapped with Parafilm and inclined at 80o to vertical so that emerging roots would grow through the phytagel and lie flat against the bottom of the dish, allowing for high resolution imaging. Growth was under continuous fluorescent light (90 mmol m-2 s-1) and at room temperature (22°C).

Histochemical GUS staining GUS staining was performed by incubating seedlings (in media) overnight at room temperature in a solution containing 4mM X-gluc (GOLD Biotech), 2.5 mM K3Fe(CN)6, . 2.5 mM K4Fe(CN)6 H2O, and 0.5% (v/v) Triton X-100, in 100mM sodium phosphate buffer containing 39% (w/v) NaH2PO4 and 61% (w/v) Na2HPO4 , at pH 7.

Laser ablation Laser ablation of the root cap was performed using the Cameleon Ti-saphire multiphoton laser of the Zeiss LSM 510 NLO system tuned to 720 nm and running at 50% transmission power, which was sufficient to ablate cells. A region of interest was defined at the level of columella tier 1 in the root cap using the LSM 510 photobleaching software and the multiphoton laser was scanned in this region as for a photobleaching protocol while slowly focusing through the root cap, and thereby severing the cap from the root body

Root bending Roots were bent using a technique that ensured the root apex and shoot remained parallel to the gravity vector. This non-reorienting bending process was achieved by cutting (without severing the root) the media in a box shape around the first 1 mm of the root tip. Then, a section of media directly adjacent to this box was removed and the box containing the root tip was gently moved into the open space. This created two bends in the root, the most distal of which (approximately 1mm from the root tip) was used to score LR initiation events.

Results and Discussion Root curvature is the result of mechanical force and tropic growth When a root encounters a barrier to growth such as a rock or hardpan layer of soil, it adopts an avoidance response to circumnavigate the obstacle and two curves are created. The first of these curves owes its shape to the mechanical force inherent in the roots resistance to the obstacle, while the second is a function of the interaction between thigmotropism and gravitropism (Massa and Gilroy 2003a; Massa and Gilroy 2003b; Monshausen and Gilroy, unpublished data). As is shown in figure 2.3, LR initiation is restricted almost exclusively to these curves when obstacle contact dominates root growth. Therefore, it is appropriate to use both tropically and mechanically formed curves to study the control of root system architecture. The following results are from experiments using either tropically or manually created bends to characterize the relationship between gravitropism and curve-associated LR initiation and to determine the nature of the signal responsible for the recruitment of FPCs to the convex side.

The images in figure 2.4 show that under my growth conditions, LR initiation to the convex side of the curve can be triggered by root waving, gravitropism, and by mechanically-induced reorientation of growth, confirming previous reports of curve- related LR induction under all these conditions (Goss and Russell, 1979; Fourtin et al., 1998; De Smet et al., 2007;). Thus, multiple methods of generating a curve appear to yield the same phenomenon of LR formation. This ‘curve-induced’ organogenesis

24 provided me with a model to investigate how pericycle cells are recruited from the general xylem pole pericycle population to a LR founder cell fate.

Root curvature forces lateral root initiation to occur earlier in development All of the manipulations shown in figure 2.4 have an element of gravitropic stimulation in them. Therefore, I started by characterizing the LR induction response to a change in the gravity vector and posing the following questions: Does gravitropic stimulation elicit LR initiation? And if so, is gravitropic stimulation itself a required component of this response? Creating a curve by gravitropic reorientation is a simple and reproducible phenomenon. Figure 2.5 shows that a 90o reorientation and subsequent gravitropic reorientation of the root significantly (P<0.05, t-test) shifts the site of the first LR induction closer to the apex than seen in a vertically growing control. This indicates that LR initiation is a plastic process and pericycle cells are capable of recruitment to FPC fate at varying developmental stages.

Nominal gravitropic root curvature is sufficient for lateral root initiation Figure 2.6 shows that the gravitropic response does lead to the induction of LRs to the convex side of the resulting root curvature, and can do so with as little as 10˚ stimulation. This implies that a very small amount of gravitropic stimulus is sufficient to elicit the LR initiation process to the convex side of the curve, and suggests that gravitropic signaling may be a component of the response. An interesting trend in figure 2.6 is the correlation of an increase in frequency of LR initiation events with an increase in the degree of gravitropic root curvature. Thus, while subtle alterations in curvature are sufficient to elicit the response, more dramatic changes have a greater effect.

It is clear from the results shown in figures 2.5 and 2.6 that there is the potential for a strong link between gravitropic reorientation and LR induction. Also root waving and the barrier response contain components of gravitropic response and also lead to LR initiation to the convex side of the bend. The next question I asked is whether gravitropic signaling is a requirement for bend-induced LR formation. To answer that question, I have divorced the gravitropic signaling machinery from the bend-induction process as described in figures 2.6 and 2.7.

Gravitropic signaling is not required for curve-associated lateral root formation In the natural environment, root curvature is a result of tropic interaction at the level of the root cap (Massa and Gilroy, 2003a; Massa and Gilroy, 2003b). Specifically, the signaling machinery responsible for the gravitropic response is located in the columella cells of the root cap (Sack, 1997). Therefore, one way to divorce the gravity-signaling component from others in the LR initiation process is to physically remove the root cap from a continually developing root. Figure 2.7 and Movie 2.1 demonstrate the results of forcing such a decapped root to bend by encountering a barrier. (The barrier response of a root with an intact cap is shown in Movie 2.2). First, the root cap was removed by laser ablation. Then I placed a barrier in the path of the decapped root and the root was forced to bend by growing into this barrier. Interestingly, LRs were still induced to form on the convex side of the curved region even when the root was exhibiting clearly agravitropic growth (Fig. 2.8). Similarly, mutants altered in gravitropic response such as pin2 and aux1 were not disrupted in bend-induced LR induction (see chapter 3). These results demonstrate that gravitropic signaling is not absolutely needed to elicit curve-related LR formation.

Auxin dynamics precede curve-associated lateral root initiation events A shared component of gravitropism and LR initiation is the creation of an asymmetrical auxin maximum. It has been demonstrated that within a matter of minutes, gravitropic stimulation leads to a lateral redistribution of auxin to the side of the root cap that correlates most closely with the direction of the gravity vector (Ottenschläger et al., 2003). Figure 2.9 shows a root expressing GFP, driven by the auxin-responsive promoter DR5, after several hours of gravitropic response. The intense GFP signal seen in this gravitropically stimulated root suggests that several hours after gravitropic stimulation a second asymmetric auxin maxima forms. However, this time it is localized on the side furthest from the direction of the gravity vector and correlates closely with the site of LR initiation on the convex side of the curve generated by the gravi-responding root. It is interesting that these two auxin asymmetries (one immediately following gravistimulation and the other following curvature development) occur on opposite sides of

26 the root. Taken together with the results on bend-induced LR formation in decapped roots shown in figures 2.7 and 2.8, it appears unlikely that the lateral redistribution of auxin occurring in the root cap upon gravi-simulation is directly connected to the inductive event for curve-related LR induction.

Mechanical force elicits lateral root initiation Because gravitropic signaling did not appear to be required for curve-related production of LRs, I next asked if the mechanics of the bend itself might be the inductive signal. To ensure the continued distinction between gravitropic and mechanical signaling pathways, I developed a gel-sliding assay to form two bends in the root without reorienting either the aerial parts of the plant or the root tip (Fig. 2.10, Fig. 2.11A). Subsequent to such bending, LRs formed on the convex side of the most distal curve in 99% of cases compared to 18% in the equivalent position of unbent controls (Fig. 2.11B). Importantly, LR initiation occurred consistently in the proximal bend as well. However, the proximally located bend-induced LRs were often arrested as primordia and failed to emerge (data not shown). Figure 2.12 shows the progression of LR initiation and development as a result of the bending process and provides further evidence to link LR initiation directly to mechanical stimulation. Taken together these results indicate that mechanical cues are sufficient to trigger LR development.

Conclusions The seemingly inseparable relationship between auxin and LR development has resulted in many studies using auxin treatment and mutants disturbed in auxin signaling as tools to elucidate components of the LR initiation signaling pathway. By using a root’s preference for initiating a LR in a curve, I have demonstrated an alternative approach to studying this signal transduction process. I have shown that while auxin dynamics correlate with, and precede, curve-dependent LR initiation, the lateral auxin gradient created during gravitropic stimulation is not required for this process. In addition, I have provided evidence that the mechanical force (or the change in geometry of the root cells upon bending) is responsible for determining the pattern of LR formation to the convex side of curve.

Auxin’s overwhelmingly strong relationship with LR formation necessitates its inclusion in any study on LR initiation. However, assuming LR initiation and primordium development represent developmentally distinct stages of LR production and the process of deciding when and where to produce a LR is biologically different from the mechanism of actually making the root, it would not be surprising if different signaling molecules governed these two processes.

De Smet et al. (2007) demonstrated that the processes for LR initiation and gravitropic response are intertwined at the level of auxin signaling in the basal meristem. Using mathematical modeling and results obtained from experiments with gravitropically re- oriented plants, Lucas et al. (2008a, 2008b) have concluded that auxin fluxes in the root apex co-regulate gravitropism and LR initiation. Indeed, from these observations alone, it is tempting to speculate that the perception of a change in the gravity vector affects the decision of when and where to make a new LR. Based on the results from De Smet et al. (2007) and Lucas et al. (2008a, 2008b) along with those taken from figures 2.5 and 2.6, it would seem likely that the pathway leading to bend induced LR formation is controlled by the same auxin signaling machinery as gravitropism.

However, by removing the gravity-perceiving root cap, and rendering the bend-induced LR initiating roots agravitropic, I was able to distinguish between gravitropic and bend- induce LR initiation signals. So, while current literature, along with figures 2.5 and 2.6 indicate the potential for a strong link between gravitropic reorientation and LR induction, figures 2.7 and 2.8 demonstrate that gravitropic signaling is not a requirement for the induction of LRs in this response.

The idea that bend-induced LR initiation is not linked to the lateral auxin distribution created during the gravitropic response is further substantiated by the results shown in figures 2.10, 2.11 and 2.12 which demonstrate that mechanical stimuli alone are sufficient for curve-associated LR formation. Furthermore, the fact that non-tropically formed curves predictably result in LR initiation, suggests that the mechanical force

28 controls the inductive events in this process. Massa and Gilroy (2003a) have shown that mechanical force alone causes the bending in the initial response of a root encountering an obstacle, and Figures 2.3 and 2.4 suggest that this bending also leads to LR formation at the induced curve. Importantly, the curve created using the manual bending technique described in figure 2.10 occurs in the distal elongation zone, the same region as the curve induced by barrier contact.

In summary, the question posed at the beginning of this chapter asked whether bend- induced LR production relied on the gravitropic signaling machinery and consequent redistribution of auxin. My results indicate that although the gravitropic response can be linked to LR production, gravitropic signaling and export of auxin from the root tip is not a requirement. In other words, simple gravitropic redistribution of auxin is not responsible for LR formation in response to bending. It is important to note that while the lateral auxin asymmetry formed during the gravitropic response may not be driving curve-induced LR formation, auxin itself may still be playing an important role in the induction of LRs in response to bending. For instance, localized maxima of auxin may still be dominating LR production. If it is not gravitropism, but rather the mechanics of bending that is the inductive signal, the logical next question is “Does this mechanical signal induce an auxin-dependent series of events in the same way that gravitropism does?” My work shows that gravitropic signaling at the level of auxin transport from the root cap is not what is important for recruiting LR initiation events to the convex side of bends. However, auxin is clearly important as a regulator of LR formation and the bend- induction signal could be feeding into this well-characterized auxin-dependent system. Therefore, in chapter 3, I will address questions concerning the relationship between auxin transport/signaling and curve-associated LR formation.

References

Celenza JL, Grisa PL, Fink GR (1995) A pathway for lateral root formation in Arabidopsis thaliana. Genes Dev 9: 2131-2142

Coates JC, Laplaze L, Haseloff J (2006) Armadillo-related proteins promote lateral root development in Arabidopsis. PNAS 103: 1621-1626

De Smet I, Tetsumura T, De Rybel B, Frey NF, Laplaze L, Casimiro I, Swarup R, Naudts M, Vanneste S, Audenaert D, Inzé D, Bennett MJ, Beeckman T (2007) Auxin-dependent regulation of lateral root positioning in the basal meristem of Arabidopsis. Development. 134: 681-690

Drew MC, Saker LR, Ashley TW (1973) Nutrient supply and the growth of the seminal root system in barley. J Exp Bot 24: 1189–1202

Drew MC (1975) Comparison of the effects of a localized supply of phosphate, nitrate, ammonium and potassium on the growth of the seminal root system, and the shoot, in barley. New Phytol 75: 479–490

Drew MC and Saker LR (1978) Nutrient supply and the growth of the seminal root system in barley. J Exp Bot 29: 435–451

Dubrovsky, JG and Gambetta GA, Hernández-Barrera A, Shishkova S, González I (2006) Lateral root initiation in Arabidopsis: Developmental window, spatial patterning, density and predictability. Ann Bot 97: 903-915

Dubrovsky JG, Sauer M, Napsucialy-Mendivil S, Ivanchenko MG, Friml J, Shishkova S, Celenza J, Benková E (2008) Auxin acts as a local morphogenetic trigger to specify lateral root founder cells. Proc Natl Acad Sci 105: 8790-8794

Fourtin MC, Pierce FJ, Poff KL (1989) The pattern of secondary root formation in curving roots of Arabidopsis thaliana. Plant Cell Env 12: 337-339

Goss MJ and Russell RS (1979) Effects of mechanical impedance on root growth in barley. J Exp Bot 31: 577-588

Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inze D, Beeckman T (2002) Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14: 2339-2351

Hobbie L and Estelle M (1995) The axr4 auxin-resistant mutants of Arabidopsis thaliana define a gene important for root gravitropism and lateral root initiation. Plant J 7: 211- 220

Lease KA, Wen J, Li J, Doke JT, Liscum E, Walker JC (2001) A mutant Arabidopsis heterotrimeric G-protein beta subunit affects leaf, flower, and fruit development. Plant Cell 13: 2631-2641

Leyser O and Fitter A (1998) Roots are branching out in patches. Trends Plant Sci 3: 203–204

Lucas M, Godin C, Jay-Allemand C, Laplaze L (2008a) Auxin fluxes in the root apex co- regulate gravitropism and lateral root initiation. J Exp Bot 59: 55-66

Lucas M, Guédon Y, Jay-Allemand C, Godin C, Laplaze L (2008b) An auxin transport- based model of root branching in Arabidopsis thaliana. PLoS ONE. 3(11): e3673.doi:10.1371/journal.pone.0003673

Malamy JE, and Ryan KS (2001) Environmental regulation of lateral root initiation in Arabidopsis. Plant Physiol 127: 899-909

Marchant A, Bhalerao R, Casimiro I, Eklöf J, Casero PJ, Bennett M, Sandberg G (2002) AUX1 promotes lateral root formation by facilitating indole-3-acetic acid distribution between sink and source tissues in the Arabidopsis seedling. Plant Cell 14: 589-597

Massa GD and Gilroy S (2003a) Touch modulates gravity sensing to regulate the growth of primary roots of Arabidopsis thaliana. Plant J 33: 435-445

Massa GD and Gilroy S (2003b) Touch and gravitropic set-point angle interact to modulate gravitropic growth in roots. Adv Space Res 31: 2195-2202

Noll, R (1900) Uber den bestimmenden einfluss von wurzelkrummengen auf entstehung und anordnung der seitenwurzeln. Landwirtsch Jahrb 29: 361-426

Ottenschläger I, Wolff P, Wolverton C, Bhalerao RP, Sandberg G, Ishikawa H, Evans M, Palme K (2003) Gravity-regulated differential auxin transport from columella to lateral root cap cells. Proc Natl Acad Sci 100: 2987-2991

Ruegger M, Dewey E, Gray WM, Hobbie L, Turner J, Estelle M (1998) The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast Grr1p. Genes Dev 12: 198-207

Sack FD (1997) Plastids and gravitropic sensing. Planta 203:S63–S68

Simmons C, Migliaccio F, Masson P, Caspar T, Soll D (1995) A novel root gravitropism mutant of Arabidopsis thaliana exhibiting altered auxin physiology. Physiologia Plantarium 93: 790-798

Swarup R, Kramer EM, Perry P, Knox K, Leyser HM, Haseloff J, Beemster GT, Bhalerao R, Bennett MJ (2005) Root gravitropism requires lateral root cap and epidermal cells for transport and response to a mobile auxin signal. Nat Cell Biol 7: 1057-1065

Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ (1997) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9: 1963-1971

Vellosillo T, Martínez M, López MA, Vicente J, Cascón T, Dolan L, Hamberg M, Castresana C (2007) Oxylipins produced by the 9-lipoxygenase pathway in Arabidopsis regulate lateral root development and defense responses through a specific signaling cascade. Plant Cell 19: 831-846

Wymer C, Bibikova T, Gilroy S (1997) Calcium distributions in growing root hairs of Arabidopsis thaliana. Plant J 12: 427-439

Chapter 3 Auxin signaling and curve-associated lateral root initiation

Introduction Based on the results of the experiments presented in chapter two, it is evident that mechanical force is responsible for inducing LR formation in a curve dependent manner. But what are the signaling mechanisms responsible for coupling mechanical action to the initiation of a developmental program? Experiments from the previous chapter suggest that gravitropic signaling is not required for bend-induced LR initiation, but do not address the role of auxin in this process. Here, I will discuss the evidence linking auxin to LR formation and investigate the possibility that this hormone is responsible for translating the bending signal to developmental response in FPCs.

Among the first known biological processes influenced by auxin were the growth inhibition of the primary root and the stimulation of LR initiation (Hitchcock and Zimmermann, 1942). Subsequently, these and other physiological effects were used in bioassays for the identification of endogenous and artificial compounds exerting auxin- like functions (Thimann, 1977). While numerous research groups have contributed to our understanding of auxin-regulated processes and the underlying molecular mechanisms, it has become clear that the auxin signaling pathway is more complicated than previously anticipated.

Components of the auxin signal Auxin signaling can be divided broadly into four levels: (1) the spatio-temporal pattern of auxin biosynthesis, (2) the direction of auxin transport, (3) signal perception, and (4) cell- specific and tissue-specific responses.

In Arabidopsis, auxin is synthesized via several tryptophan-dependent and tryptophan- independent pathways in embryos, leaves, and roots (reviewed in Woodward and Bartel, 2005). The active transport of auxin leads to the formation of auxin maxima and gradients and is controlled by specific proteins: PIN-FORMED (PIN) efflux carriers, AUX1 and LAX (like aux1) influx carriers, and MULTIDRUG RESISTANCE/P-

GLYCOPROTEIN/ABCB transporters (reviewed in Blakeslee et al., 2005; Delker et al., 2008). Upon reaching specific threshold concentrations, auxin induces cell-type specific responses that trigger diverse developmental and physiological effects (reviewed in Teale et al., 2006). Recent modeling approaches have shed light on the putative mechanisms such as the regulation of PIN activity, underlying the establishment of auxin gradients and maxima essential for many auxin-regulated processes (reviewed in Teale et al., 2006).

A significant breakthrough in our understanding of how the auxin signal is perceived has been achieved with the identification of the F-box protein TIR1 as an auxin receptor (Dharmasiri et al., 2005a; Kepinski and Leyser, 2005). TIR1 is part of the 4 member AFB (auxin-signaling F-box) family and analysis of mutant phenotypes suggests functional redundancy between these receptors. However, of these putative auxin receptors, only the tir1 knockout has been reported to affect LR formation (Ruegger et al., 1997). The perception of auxin by the TIR receptor triggers the degradation of the 29 member AUXIN/INDOLE-3-ACETIC ACID (AUX/IAA) family of proteins. Under low auxin concentrations, these AUX/IAAs form dimers with AUXIN RESPONSE FACTOR (ARF) transcription factors, blocking the activity of the ARFs and so repressing transcription. Once released from the AUX/IAAs, these ARFs in turn bind to the auxin- responsive element TGTCTC, thereby regulating the expression of auxin-responsive genes. Many early plant responses to auxin are mediated by this ARF/AUX/IAA system (Liscum and Reed, 2002). AUX/IAA proteins are inherently unstable, and their degradation is triggered by a ubiquitin-protein ligase that is regulated by modification with a ubiquitin-related protein (Tiwari et al., 2001). Recent genetic and biochemical evidence indicates that auxin accelerates the degradation of the already short-lived AUX/IAA proteins to derepress transcription by ARF proteins (Weijers et al., 2005). In addition, combined genetic and biochemical evidence suggests that interactions of ARFs with ARFs, ARFs with AUX/IAA proteins, and AUX/IAA proteins with AUX/IAA proteins function collectively to control auxin responsive transcription (Guilfoyle et al., 1998; Morgan et al., 1999). TIR1 is an integral component of the SKP1/CULLIN/F-BOX PROTEIN (SCF) complex that mediates this ubiquitination of AUX/IAAs, sending them

49 to the 26S proteasome for degradation (reviewed in Abel, 2007). Interestingly, AUX/IAAs are bound by TIR1 in a pocket on the surface of the protein via their domain II, and auxin acts as a ‘molecular glue’ to enhance this interaction (Tan et al., 2007). Whereas degradation of AUX/IAA proteins has been extensively studied (reviewed in Rogg and Bartel, 2001; Dharmasiri and Estelle, 2002), very little detailed information is available on the transcriptional regulation of AUX/IAA genes apart from their auxin inducibility, which depends on the cell or tissue type, the actual auxin concentration, and the duration of exposure to certain auxin levels (Paponov et al., 2008).

Although to date the AFB family represents the best characterized auxin receptors, it is important to note that other proteins have been proposed to play equivalent roles in hormone perception. For example, it has been suggested that the auxin-binding protein ABP1 functions as a receptor to regulate auxin-dependent cell division in embryo development (Chen et al., 2001). It seems likely that there are multiple auxin perception systems that may be linked to specific suites of cellular response.

Auxin signaling is responsible for the endogenous regulation of lateral root initiation De Smet et al. (2007) have postulated the existence of an auxin-driven, endogenous program for LR initiation by demonstrating that an auxin response reporter (DR5-GUS) in the basal meristem shows rhythmic expression with the same periodicity as LR initiation. This phasing of approximately 15 hours is in agreement with the temporal window between the initiation of two successive LRs as was recently calculated for Arabidopsis by Dubrovsky et al. (2006). Figure 3.1 depicts a model of the endogenous program postulated by De Smet et al (2007). In this model, AUX1-dependent auxin signaling occurs in the basal meristem and auxin gradients in the protoxylem cells function to prime adjacent founder pericycle cells (FPCs) for division. Later in development, as these primed FPCs reach the elongation zone, auxin response and signaling mechanisms such as AUX/IAA activity result in cell division and LR initiation.

Dubrovsky et al. (2008) showed that the activation of an auxin response (as monitored by DR5-GUS expression levels) is the earliest detectable event in founder cell specification. Accordingly, local activation of auxin response correlates absolutely with the acquisition

50 of founder cell identity, preceding the actual formation of a LR primordium through patterned cell division. In addition, the local production and subsequent accumulation of auxin in single pericycle cells converts them into founder cells. This localized auxin accumulation was induced by Cre-Lox-based activation of expression of a bacterial enzyme that converts tryptophan to a precursor for the tryptophan-dependent auxin synthetic pathway. The results from Dubrovsky et al. (2008) suggest a modification of the endogenous program model proposed by De Smet et al. (2007), in which auxin accumulation in FPCs triggers activation of a developmental pathway made possible because of additional fate-specification factors laid down during the founder cell recruitment phase of the pericycle cell population in the meristem.

Although periodic maxima in the levels of the hormone auxin may pre-pattern the distribution of LR initiation sites, it is clear that the positioning of founder events is also tightly coordinated with environmental stimuli. Thus there are numerous inputs in the form of intrinsic and environmental cues that feed into the pathway controlling LR initiation. In figure 3.2, I suggest a model of this pathway based on current literature and results from the second chapter of this thesis. In this model, both an endogenous program and environmental signals such as root-bending and nutrient availability coordinate to control the onset of cell division that marks the initiation of LR primordium formation.

Figure 3.2 illustrates the cellular and molecular events that fit with a proposed role for auxin as a determinant of founder cell identity, including auxin accumulation in FPCs, followed by a series of auxin-dependant events that leads to cell division. These events depend on auxin biosynthesis, transport, perception, and response. Therefore approaches that test the requirement for these components in mechanically induced LR initiation might help to define the relationship between the mechanical signal and the auxin dependent pathway governing cell division in FPCs.

In summary, the results from chapter two suggest that the mechanical force of the bending stimulus is responsible for the onset of cell division in FPCs and a review of current literature highlights the possibility that this signal is feeding into the auxin- dependant pathway governing the endogenous regulation of LR initiation. These

51 observations raise a number of questions regarding the transduction of the bending signal and the requirement of auxin signaling machinery in this process. For instance, does mechanical force affect auxin distribution and do such putative changes operate at the level of AUX1 or TIR1 activity? Does mechanical force affect auxin gradients in some other fashion, or alternatively, does the bending signal (in the form of mechanical force) elicit another messenger molecule that is responsible for completion of the transduction process? In other words, is curve-associated LR initiation feeding into the auxin- dependent pathway, and if it is, are auxin biosynthesis, transport, perception, and response required components for the transduction of the bending signal? The experiments in this chapter will directly address these questions and show that many components of the auxin signaling pathway that are required for the control of normal LR initiation patterning can be bypassed by the bending stimulus.

Materials and methods Plant material and growth conditions Arabidopsis thaliana (L.) Heyhn seeds of the Columbia and Landsberg erecta ecotypes were used in experiments involving wild-type plants. DR5::GFP, DR5::GUS and tir1-1 seeds were kindly provided by Dr. Elison Blancaflor (The Noble Foundation), and Dr. Mark Estelle (Indiana University), respectively. All other seed stock was obtained from the Arabidopsis Biological Resource Center at Ohio State University. With the exception of agr1/pin2 (Landsberg), the following mutants and transgenic plants are all in the Colombia background and all have been described previously: DR5::GUS (Ulmasov et al., 1997), aux1-7 (Marchant et al., 2002), axr4-1, axr4-2, aux1-7/axr4-2, axr1-3/axr4-2 (Hobbie and Estelle, 1995), axr1-3, axr1-12 (Lincoln et al., 1990), ABCB19/mdr1-3 (Lewis et al, 2007), ABCB4/pgp4-1 (Santelia et al., 2005), agr1/pin2 (Bell and Maher, 1990; Muller et al., 1998), pin 3-4, pin3-5 (Friml et al., 2003), pin 4-3 (Friml et al., 2002), tir1-1 (Ruegger et al., 1998), tir3-101 and tir3-102 (Ruegger et al., 1997; Lease et al., 2001).

Unless otherwise stated, all chemicals were obtained from Sigma. Seeds were surface sterilized with 50% (v/v) bleach for 10 min, rinsed three times and incubated in sterile

0.05M HCl for 2 min followed by an additional three rinses. Half strength Epstein’s . . medium ( 3 mM KNO3, 2 mM Ca(NO3)2 4H2O, 0.5 mM MgSO, 7H2O, 1 mM (NH4)2PO4, 0.56 mM myo-inositol, 2.3 mM Mes, 0.5% (w/v) sucrose, micronutrients (25 µM KCl, . . . 17.5 µM H3BO3, 1 µM MnSO4 H2O, 1 µM ZnSO4 7H20, 0.25 µM CuSO4 5H2O, 0.25 µM . (NH4)6MoO24 4H2O, and 25 µM Fe-Na EDTA), and 1.5% (w/v) Phytagel at pH 5.7) was autoclaved for 25 min. The nutrient media was poured into 90-mm plastic Petri dishes and seeds were planted by pushing them beneath the surface of the solidified media using a toothpick. The dishes were wrapped with Parafilm and inclined at 80o to vertical so that emerging roots would grow through the phytagel and lie flat against the bottom of the dish, allowing for high resolution imaging. Growth was under continuous fluorescent light (90 mmol m-2 s-1) and at room temperature (22°C).

Shoot removal and auxin treatment Blocks of agar containing a final concentration of 100 µM NAA, approx 1mm square, were generated by adding 1-NAA (GIBCO) to cooling phytagel/nutrient media from an ethanol stock of 100 mM. Four days after germination, shoots were surgically removed just below the hypocotyl-root junction, and roots were bent 12 h thereafter to induce LR formation. During this period, LR initiation was 75% of controls (decapitated LR density = 0.414 ± 0.014 vs. 0.55 ± 0.015 laterals/mm in controls). NAA-containing agar blocks were applied to de-shooted seedlings either directly after severance or after root bending.

Root bending Roots were bent using one of two methods. The first method caused neither the root apex nor the shoot to undergo reorientation. This non-reorienting bending process was achieved by cutting (without severing the root) the media in a box shape around the first 1 mm of the root tip. Then, a section of media directly adjacent to this box was removed and the box containing the root tip was gently moved into the open space. This created two bends in the root, the most distal of which (approximately 1mm from the root tip) was used to score LR initiation events. In order to generate the large number of measurements required for the mutant analysis described in figures 3.4 and 3.5, this approach was modified such that the box of media contained only the first 1mm of the root apex. When this box was pushed into the adjacent vacated space, a 900 bend was

53 created. The root was then oriented such that the root apex remained parallel to the gravity vector.

Results and discussion An acropetal supply of auxin is required for bend-induced lateral root emergence but not for primordium formation Because LR emergence has been shown to be dependent on auxin biosynthesis and subsequent transport from the cotyledons (Bhalerao et al., 2002), I conducted decapitation experiments to evaluate the role of an acropetal auxin source on the initiation of bend-induced LRs. Figure 3.3 shows that hypocotyl removal did not disrupt bend-induced LR initiation, although LRs failed to develop past the initial stages of primordium formation. Figure 3.3 also shows that this failure of LRs to emerge could be rescued by application of an agar block containing 100 µM of the auxin 1-NAA to the cut surface either before, or directly after bending. These observations are in keeping with the known role of shoot-derived auxin in supporting LR emergence, but the lack of a role for this supply of hormone for founder cell activation to primordium formation (Bhalerao et al., 2002).

Bend-induced lateral root formation occurs in auxin-related mutants To further test if mechanical stimulation specifies FPC fate via an auxin-dependent pathway, I investigated bend-induced LR formation in a range of mutants in root- expressed auxin transporters and auxin receptor/response elements. Lesions in the PIN and ABCB proteins likely responsible for auxin efflux from root cells do not alter normal LR production (Bilou et al., 2005; Wu et al., 2007; Fig. 3.4) and had no significant effect on bend-induced LR formation (Fig. 3.5 and 3.6). On the other hand, a number of auxin transport or response mutants which normally show a reduced frequency of LR production were rescued to wild-type (WT) frequencies by the bend induction process. For example, even though aux1 mutants normally exhibit a 50% reduction in LR density (Fig. 3.4), they show WT frequency of LR induction by bending (Fig. 3.5 and 3.6). This observation is consistent with the reported LR production to the outside of bends in aux1 roots undergoing coiling growth (De Smet et al., 2007; Ditengou et al., 2008) and my observation of LR production by aux1 roots that bend upon encountering barriers to

54 growth (Fig. 3.7 and 3.8). Analysis of the presence of unemerged primordia versus fully emerged LRs (Fig. 3.5) showed that suppression of the aux1 LR phenotype by bending led to the emergence of growing LRs with no evidence for accumulation of unemerged primordia. Thus, bending was able to elicit the full developmental program of LR formation in the aux1 background. The mechanical signal from the bend appears able to bypass the effect of lesions in the AUX1 auxin permease, perhaps by promoting alternate auxin accumulation mechanisms or by activating a pathway to FPC fate specification acting in parallel to the auxin-dependent pathway. Importantly, the production of LRs to bends in aux1 induced by root coiling, and the growth response to a barrier (Fig. 3.7 and 3.8), shows that such responses are elicited by the normal forces inherent in growth and are not an artifact of the experimental manipulations related to mechanically bending the root.

In keeping with this model of suppression of the aux1 phenotype, bending also compensated the reduced LR phenotype of axr4, again with formation of fully emerged LRs and no evidence for an accumulation of unemerged primordia. (Fig. 3.5 and 3.6). AXR4 is thought to play a major role in correctly localizing AUX1 (Dharmasiri et al., 2006). However, the observation that the aux1-7/axr4-2 double mutant more severely reduces LR formation than predicted from aux1- or axr4-related effects alone has been used to argue other roles for AXR4 in this process (Hobbie and Estelle 1995). This idea is supported by my finding that the reduction in LR formation in the aux1-7/axr4-2 double mutant could not be compensated by the bend-induction process (Fig. 3.5 and 3.6).

My observation that the pin and ABCB mutants lack a noticeable LR initiation phenotype under normal growth conditions (i.e. unbent roots) is perhaps not surprising given the functional redundancy of the efflux carrier system (Vieten et al., 2005). Thus, many members of this system appear to be sufficient to generate differential auxin distribution. In addition, polar localization of auxin influx carriers appears critical only when rapid auxin uptake is necessary to maintain gradients that would otherwise be dissipated by diffusion in the apoplast (Swarup et al., 2001; Reinhardt et al., 2003). Taken together, these observations may explain the lack of an effect of single mutants in these transporters in unbent and curve-related LR formation.

Although I observed that bend-induced LR formation was suppressed in mutants of axr1 and tir3 (Fig. 3.5 and 3.6), this lower frequency was equivalent to the reduction seen during normal growth (Fig. 3.4), suggesting that axr1 and tir3 neither selectively promotes nor inhibits bend-induction of LRs. TIR3 encodes the callosin-like protein BIG (also DOC1/UMB1/ASA1). While BIG is known to be required for polar auxin transport (Gil et al., 2001), mutations in this gene have pleiotropic effects, likely manifested through multiple hormone-related mechanisms (Desgagne-Penix et al., 2005; Kanyuka et al., 2003).

Lastly, TIR1 is a member of a well-characterized family of auxin receptors (Tan et al., 2007), but of these, only tir1 shows severely reduced LR density under normal growth conditions (Dharmasiri et al., 2005b; Ruegger et al., 1998); Fig. 3.4). However, upon mechanical bending, 90% of tir1-1 roots produced LRs to the convex side of the curved region (Fig. 3.5 and 3.6). In addition, tir1-1 roots consistently developed LRs on the convex side of the curve when forced to bend by growing into a barrier (Fig. 3.8). Taken together, these results demonstrate that TIR1-dependent signaling is not required for bend-induction of LR formation during normal growth and development.

Interestingly, Ditgenou et al (2008) have reported that mechanical bending of roots of the solitary root (slr) mutant, which synthesizes a stable form of the IAA14 protein and lacks LRs, can induce limited LR formation in approximately 10% of cases. Similarly, 50% of double mutants in the auxin response factors arf7/arf19 that normally lack fully developed LR primordia could be induced to form LRs in a bend upon removal of the root tip. These results further support the hypothesis that bend-induced LR formation functions independently from auxin to dictate the onset of cell division in FPCs.

Bend-induced lateral root formation breaks the spacing rules for lateral root placement It has been proposed that LR spacing is controlled by competition between LR primordia, e.g. for carbon resources or auxin, which prevents LRs from forming next to one another (O'Brien et al., 2007; Lucas et al., 2008a; Lucas et al., 2008b). However, I observed that upon bending, LRs could form side-by-side, or directly opposite each other across the

56 vasculature (Fig. 3.9), positioning never seen under conditions of normal, unbent growth of wild-type plants. These results suggest that either the bending stimulus can trigger multiple primordium specification events, or that the endogenous LR developmental program (De Smet et al., 2007) had already specified a LR in this position onto which the bend-induced program was superimposed. However, neither of these possibilities is completely explained by spacing models such as resource competition or inhibitory fields of auxin depletion (Lucas et al., 2008a; Lucas et al., 2008b). Instead, my observations point to a complex, plastic regulation of LR patterning.

In summary, results presented in this chapter suggest a model for LR formation shown in figure 3.10. The ability of bending to suppress the requirement for aux1, axr4 and tir1 in normal placement of LRs, but not to suppress the need for an acropetal source of auxin for LR emergence, suggests that while the LR primordia associated with root curvature may require auxin to develop properly, auxin signaling may not be required for the initiation of these primordia. Should the model in figure 3.10 be correct, it would imply that a signaling pathway exists in parallel to at least the initial events of auxin-dependent LR formation. In the next chapter, I will further explore the characteristics of this possible, novel bend-related LR inductive signal and test the idea that mechanically- induced Ca2+ signals might play a role in this process.

References

Abel S (2007) Auxin is surfacing. ACS Chem Biol 2: 380-384

Bell CJ and Maher EP (1990) Mutants of Arabidopsis thaliana with abnormal gravitropic responses. Mol Gen Genet 220: 289-293

Bhalerao R, Eklöf J, Ljung K, Marchant A, Bennett M, Sandberg G (2002) Shoot derived auxin is essential for early lateral root emergence in Arabidopsis seedlings. Plant J 29: 325–332

Blakeslee JJ, Peer WA, Murphy AS (2005) Auxin transport. Curr Opin Plant Biol 8: 494- 500

Blilou I, Xu J, Wildwater M, Willemsen V, Paponov I, Friml J, Heidstra R, Aida M, Palme K, Scheres B (2005) The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. Nature 433: 39-44

Chen JG, Shimomura S, Sitbon F, Sandberg G, Jones AM (2001) ABP1 is required for organized cell elongation and division in Arabidopsis embryogenesis. Genes Dev 15: 902-911

Delker C, Raschke A, Quint M (2008) Auxin dynamics: The dazzling complexity of a small molecule's message. Planta 227: 929-41

Desgagne-Penix I, Eakanunkul S, Coles JP, Phillips AL, Hedden P, Sponsel VM (2005) The auxin transport inhibitor response 3 (tir3) allele of BIG and auxin transport inhibitors affect the gibberellin status of Arabidopsis. Plant J 41: 231-242

Dharmasiri S and Estelle M (2002) The role of regulated protein degradation in auxin response. Plant Mol Biol 49: 401-409

Dharmasiri N , Dharmasiri S, Estelle M (2005a) The F-box protein TIR1 is an auxin receptor. Nature 435: 441–445

Dharmasiri, N., Dharmasiri, S., Weijers, D., Lechner, E., Yamada, M., Hobbie, L., Ehrismann, J.S., Jurgens, G. and Estelle, M. (2005b) Plant development is regulated by a family of auxin receptor F box proteins. Dev Cell 9: 109-119

Dharmasiri S, Swarup R, Mockaitis K, Dharmasiri N, Singh SK, Kowalchyk,M, Marchant A, Mills S, Sandberg G, Bennett MJ Estelle M (2006) AXR4 is required for localization of the auxin influx facilitator AUX1. Science 312: 1218-1220

Ditengou FA, Teale WD, Kochersperger P, Flittner KA, Kneuper I, van der Graaff E, Nziengui H, Pinosa F, Li X, Nitschke R, Laux T, Palme K (2008) Mechanical induction of lateral root initiation in Arabidopsis thaliana. Proc Natl Acad Sci 105: 18818-18823

Dubrovsky JG, Gambetta GA, Hernández-Barrera A, Shishkova S, González I (2006) Lateral root initiation in Arabidopsis: Developmental window, spatial patterning, density and predictability. Ann Bot 97: 903-915

Friml J, Benkova E, Blilou I, Wisniewska J, Hamann T, Ljung K, Woody S, Sandberg G, Scheres B, Jurgens G, Palme K (2002) AtPIN4 mediates sink-driven auxin gradients and root patterning in Arabidopsis. Cell 108: 661-673

Friml J, Vieten A, Sauer M, Weijers D, Schwarz H, Hamann T, Offringa R, Jurgens G (2003) Efflux-dependent auxin gradients establish the apical–basal axis of Arabidopsis. Nature 426: 147-153

Gil P, Dewey E, Friml J, Zhao Y, Snowden KC, Putterill J, Palme K, Estelle M, Chory J (2001) BIG: a calossin-like protein required for polar auxin transport in Arabidopsis. Genes Dev 15: 1985-1997

Guilfoyle T, Hagen G, Ulmasov T, Murfett J (1998). How does auxin turn on genes? Plant Physiol 118: 341–347

Hitchcock AE and Zimmermann PW (1942) Root-inducing activity of phenoxy compounds in relation to their structure. Contrib Boyce Thompson Inst 12: 497–507

Hobbie L. and Estelle M (1995) The axr4 auxin-resistant mutants of Arabidopsis thaliana define a gene important for root gravitropism and lateral root initiation. Plant J 7: 211- 220

Kanyuka K, Praekelt U, Franklin KA, Billingham OE, Hooley R, Whitelam GC, Halliday, KJ (2003) Mutations in the huge Arabidopsis gene BIG affect a range of hormone and light responses. Plant J 35: 57-70

Kepinski S and Leyser O (2005) The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 435: 446–451

Lease KA, Wen J, Li J, Doke JT, Liscum E, Walker JC (2001) A mutant Arabidopsis heterotrimeric G-protein beta subunit affects leaf, flower, and fruit development. Plant Cell 13:2631-2641

Lewis DR, Miller ND, Splitt BL, Wu G, Spalding EP (2007) Separating the roles of acropetal and basipetal auxin transport on gravitropism with mutations in two Arabidopsis multidrug resistance-like ABC transporter genes. Plant Cell 19: 1838-1850

Likhoshvaĭ VA, Omel'ianchuk NA, Mironova VV, Fadeev SI, Melsness ED, Kolchanov NA (2007) Mathematical model of auxin distribution in the plant root. Russian Journal of Developmental Biology 38: 374–382

Lincoln C, Britton JH, Estelle M (1990) Growth and development of the axrl mutants of Arabidopsis. Plant Cell 2: 1071-1080

Liscum E and Reed JW (2002) Genetics of Aux/IAA and ARF action in plant growth and development. Plant Mol Biol 49: 387-400

Lucas M, Godin C, Jay-Allemand C, Laplaze L (2008a) Auxin fluxes in the root apex co-regulate gravitropism and lateral root initiation. J Exp Bot 59: 55-66

Lucas M, Guédon Y, Jay-Allemand C, Godin C, Laplaze L (2008b) An auxin transport- based model of root branching in Arabidopsis thaliana. PLoS ONE 3(11): e3673.doi:10.1371/journal.pone.0003673

Morgan KE, Zarembinski TI, Theologis A, Abel S (1999). Biochemical characterization of recombinant polypeptides corresponding to the predicted fold in Aux/IAA proteins. FEBS Letters 454, 283–287

Muller A, Guan C, Galweiler L, Tanzler P, Huijser P, Marchant A, Parry G, Bennett M, Wisman E, Palme K (1998) AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J 17: 6903-6911

O'Brien EE, Brown JS, Moll JD (2007) Roots in space: a spatially explicit model for below-ground competition in plants. Proc Biol Sci 274: 929-934

Paponov IA, Paponov MT, Teale W, Menges M, Chakrabortee S,Murray JAH, Palme K (2008) Comprehensive transcriptome analysis of auxin responses in Arabidopsis. Mol Plant 1: 321–337

Pérez-Torres CA, López-Bucio J, Cruz-Ramírez A, Ibarra-Laclette E, Dharmasiri S, Estelle M, Herrera-Estrella L (2008) Phosphate Availability Alters Lateral Root Development in Arabidopsis by Modulating Auxin Sensitivity via a Mechanism Involving the TIR1 Auxin Receptor. Plant Cell 20: 3258-3272

Reinhardt D, Pesce ER, Stieger P, Mandel T, Baltensperger K, Bennett M, Traas J, Friml J, Kuhlemeier C (2003) Regulation of phyllotaxis by polar auxin transport. Nature 426: 255-260

Rogg LE and Bartel B (2001) Auxin signaling: Derepression through regulated proteolysis. Developmental Cell 1: 595–604

Ruegger M, Dewey E, Gray WM, Hobbie L, Turner J, Estelle M (1998) The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast Grr1p. Genes Dev 12: 198-207

Santeliaa D, Vincenzettia V, Azzarellod E, Bovetb L, Fukaoa Y, Duchtigc P, Mancusod S, Martinoiaa E, Geisler M (2005) MDR-like ABC transporter AtPGP4 is involved in auxin-mediated lateral root and root hair development. FEBS Letters 579: 5399-5406

Tan X, Calderon-Villalobos LI, Sharon M, Zheng C, Robinson CV, Estelle M, Zheng N (2007) Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature 446: 640- 645.

Teale WD, Paponov IA, Palme K (2006) Auxin in action: Signalling, transport and the control of plant growth and development. Nat Rev Mol Cell Biol 7: 847–859

Thimann KV (1977) Hormone action in the whole life of plants. Massachussetts. University of Massachusetts Press

Tiwari SB, Wang XJ, Hagen G, Guilfoyle TJ (2001) AUX/IAA proteins are active repressors, and their stability and activity are modulated by auxin. Plant Cell 13: 2809- 2822

Vieten A, Vanneste S, Wisniewska J, Benková E, Benjamins R, Beeckman T, Luschnig

C, Friml J (2005) Functional redundancy of PIN proteins is accompanied by auxin- dependent cross-regulation of PIN expression. Development 132: 4521-4531

Weijers D, Benkova E, Jäger KE, Schlereth A, Hamann T, Kientz M, Wilmoth JC, Reed JW, Jürgens G (2005) Developmental specificity of auxin response by pairs of ARF and Aux/IAA transcriptional regulators. EMBO J 24: 1874-85

Woodward AW and Bartel B (2005) Auxin: Regulation, action, and interaction. Ann Bot 95: 707–735

Wu G, Lewis DR, Spalding EP (2007) Mutations in Arabidopsis: Multidrug resistance- like ABC transporters separate the roles of acropetal and basipetal auxin transport in lateral root development. Plant Cell 19: 1826–1837

Chapter 4 Curve associated lateral root initiation is likely a calcium mediated mechanoresponse

Introduction Chapters two and three conclude that (1) bends cause LR induction, (2) gravitropic signaling is not involved in this process, and (3) the mechanics of bending generates an important developmental signal that can suppress auxin dependencies. These findings imply that bending the root elicits an inductive signal that recruits ordinary pericycle cells to a FPC fate. In this chapter, I will review the role of Ca2+ in cell division and mechanoresponse, and investigate the possibility that this ubiquitous second messenger is transducing the bending signal.

The immediate, transient, and dose-dependent increase in cytosolic Ca2+ following mechanical perturbations has led to the belief that Ca2+ is responsible for transducing the mechanical signal in plants (Knight et al., 1991; Knight et al.,1992; Fasano et al., 2002; reviewed in Monshausen et al., 2007). For example, touch stimulation leads directly to transient Ca2+ increases in epidermal and cortical cells of Arabidopsis roots (Legue et al., 1997). Thus, a mechanically-triggered Ca2+ increase is a strong candidate for the proposed LR inductive signal.

There is a wealth of evidence linking changes in Ca2+ fluxes to mechanoresponse at the whole plant level (reviewed in Chehab et al., 2009). In addition, electrophysiology data suggest the existence of a variety of different mechanosensitive channels (reviewed in Monshausen et al., 2007). Although very little is known about the molecular structure of these channels, there are some likely suspects for Ca2+ responsive macromolecules such as calmodulin (CaM) and calmodulin-like proteins (CMLs), which could react to mechanically-related Ca2+ signals, as discussed below.

The generation of calcium signals in plants Biochemical activities within plant cells cannot tolerate the high levels of Ca2+ found outside of the cells (10-3 M). Cytosolic Ca2+ is kept at low concentrations (10-6M) by the

75 active removal of Ca2+ to either the extracellular space, or to intracellular organelles such as the endoplasmic reticulum (ER), mitochondria and vacuole. This process produces a transmembrane Ca2+ gradient permitting a rapid influx of cytosolic Ca2+ through the opening of Ca2+ permeable channels in the plasma (Ding and Pickard, 1993; Gens et al., 2000; Demidchick et al., 2002) and organellar (Knight et al., 1992; Klusener et al., 1995) membranes and enables the propagation of a Ca2+ signal.

Although intracellular compartments such as the vacuole and ER have long been known to act as Ca2+ stores, the nucleus contains the enzymes to hydrolyze phosphatidylinositol

4,5-bisphosphate (PIP2), and therefore synthesize the calcium mobilizing agent, inositol

1,4,5-trisphosphate (IP3) (Trewavas and Knight, 1994). This suggests the nucleus also could act to modulate Ca2+ signals. Indeed, there is evidence from observed changes in Ca2+ signal kinetics that the nucleus acts as a compartment separate from the cytosol (Mazars et al., 2008). Ca2+ signaling in the nucleus has been proposed to underlie the transcriptional changes elicited by Nod Factors during rhizobium/legume interactions (Oldroyd and Downie, 2006). In addition, transcriptional activity has been shown to be responsive to Ca2+-dependent signaling. For example, the calmodulin-dependent transcription factor Atsr1 has recently been shown to regulate gene expression related to salicylic acid production and so modulate defense signaling (Du et al., 2009). Thus, it is possible that mechanically induced Ca2+ signals are capable of directly modulating gene expression patterns in plants (Sistrunk et al., 1994; Xu et al., 1995) linking mechanoperception to downstream transcriptional reprogramming of FPC fate.

Consistent with these concepts, Arabidopsis plants respond to wind and rain by modulating the expression levels of at least four touch (TCH) genes (Braam and Davis, 1990). Interestingly, TCH3 (CML11) accumulates in pericycle cells, especially in the FPC derivatives prior to primordium formation (Antosiewicz et al., 1995). Three of these originally defined TCH genes encode for a potential Ca2+ sensor, either CaM or a CML protein (Braam and Davis, 1990). Recently, Lee et al. (2005) performed a comprehensive transcriptome analysis in Arabidopsis and identified 12 CML genes whose expression is up-regulated in response to touch, suggesting that CMLs are potential sensors of cytosolic Ca2+ changes induced by mechanical disturbances.

Another potential component of such a Ca2+-related plant mechanosensory apparatus has been identified by the functional complementation of the Saccharomyces cerevisiae mid1 mutant with a plant cDNA. mid1 mutants lack a component of a yeast stretch-activated, Ca2+-permeable channel complex leading to a lack of cell growth when challenged with yeast mating pheromone. Nakagawa and colleagues (2007) obtained an Arabidopsis clone named MCA1 that partially complemented the yeast MID1 phenotype. The predicted protein shares only 10% identity and 41% similarity to MID1. It also has no obvious homology to known channel components and appears unlikely to be acting in the same fashion as the yeast protein. However, MCA1 was shown to increase Ca2+ uptake in yeast, suggesting it does have a link to Ca2+ homeostasis, potentially explaining its partial complementation of the mid1 mutant.

The roots of a knockout mutant of MCA1 showed a reduced ability to penetrate a layer of hard agar, suggesting some defect in either growth or mechanical responsiveness. However, constitutive MCA1 over-expressing lines exhibited more obvious defects in development, with short stems, small rosettes, no petals, and shrunken seed pods. These plants also showed an increased basal Ca2+ uptake and an elevated cytosolic Ca2+ level in response to osmotic shock that was not evident in wild-type plants. Similarly, when MCA1 was heterologously expressed in Chinese Hamster Ovary cells, a novel Ca2+ increase could be elicited upon stretching the cells (Nakagawa et al., 2007).

Thus, MCA1 appears to provide a possible link between Ca2+ fluxes and mechanical response in Arabidopsis. Although its precise role remains obscure, MCA1 may be a regulatory component of a mechanosensitive channel complex conserved between yeast and plants. The evidence for a link to mechanoresponse is enticing. For example, as discussed above, the gene TCH3 (CML11) is a Ca2+-dependent protein that has been closely linked to touch response in Arabidopsis (Braam and Davis, 1990). This gene is up-regulated in MCA1 over-expressing plants, suggesting that touch sensing is constitutively activated in these lines. TCH3 expression is also responsive to developmental regulation and environmental stimuli such as darkness. Therefore, altered

77 levels of TCH3 could simply reflect the disruption of growth that accompanies MCA1 over-expression.

Calcium as a regulator of cell-cycle progression For Ca2+ to act as a regulator of mechanically-induced LR formation, via the signal transduction events as outlined above, it would have to elicit founder cell fate specification not only in the pericycle, but also support subsequent cell division for primordium formation. There is evidence from both plants and animals supporting Ca2+ as a regulator of the progression of the cell cycle.

A complex signaling network chaperones cell cycle events to ensure that cell cycle progression does not occur until any detected errors are corrected. The signaling network consists of cell cycle control proteins that are phosphorylated and dephosphorylated, synthesized and degraded interactively to generate a set of sensors and molecular switches that are thrown at appropriate times to permit or trigger cell cycle progression. In many animal systems, the coordinated elevation of the intracellular free Ca2+ concentration functions as a key component of this molecular switch mechanism (reviewed in Kahl and Means, 2003).

Calmodulin is the primary calcium receptor in animal cells, and as such, is the major signal transducing factor in the Ca2+-dependent regulation of cell proliferation. The available animal data indicate that Ca2+ and CaM can act at multiple points in the cell cycle, including the initiation of S phase and both initiation and completion of M phase (Rasmussen and Means, 1989). In addition, Ca2+ and CaM stimulate the expression of genes involved in cell cycle progression, leading to the activation of cyclin-dependent kinases (Taules et al., 1998). The mechanism(s) through which Ca2+ and CaM concentrations regulate cell cycle are beginning to be elucidated in many animal systems. For instance, in a recent study, Choi and Husain (2006) identified functional protein- protein interaction between the late G1-active cyclin E1 and CaM as the molecular basis 2+ for the Ca -sensitive cell cycle transition from G1 to S phase.

The discovery in the early 1970’s that elevated levels of Ca2+ depolymerize microtubules made it reasonable to assume that cells possess a mechanism to raise the intracellular Ca2+ level in order to promote the necessary breakdown of microtubules as chromosomes move to the spindle poles. There are reports from both plant (Hepler and Callaham, 1987) and mammalian cell studies (Ratan et al., 1988; Tombes and Borisy, 1989) of a gradual increase in Ca2+ during anaphase which would be consistent with a role in microtubule depolymerization. However, there are also studies that fail to show this gradual increase (Kao et al., 1990).

There are also a variety of reports, using pharmacological agents such as channel blockers, Ca2+ antagonists such as lanthanum, or inhibitors of inositol turnover such as lithium, that support the idea of a Ca2+ transient preceding the onset of anaphase. In other studies, researchers have shown that the anaphase spindle apparatus and chromosome motion is exquisitely sensitive to Ca2+ levels modulated within the physiological range (Hepler, 1989; Hepler, 1992; reviewed in Hepler, 1994). Using stamen hair cells of Tradescantia, Zhang et al. (1990) have found that the injection of Ca2+ to levels reaching 10 µM causes chromosomes to immediately arrest their poleward motion. And, in parallel studies on cells that have been injected with fluorescently labeled tubulin to mark the spindle fibers, these same levels of Ca2+ extensively depolymerize kinetochore fibers (Zhang et al., 1992).

To summarize, there is extensive experimental evidence linking Ca2+ to mechanoperception in plants and to cell cycle progression in a variety of model systems. This suggests that Ca2+ may function to transduce the bending signal to developmental response, although the supporting data are circumstantial at the moment. Other possibilities do exist, as mechanical signals are known to cause fluxes in reactive oxygen species (ROS) and K+ concentrations (Beffagna et al., 2005). Interestingly, Bellamine et al. (1998) have reported that auxin-induced initiation of adventitious roots in poplar is a Ca2+-dependant process. In addition, Chen et al. (2006) have shown that ABA application leads to the initiation of LRs in rice, and that the effects of ABA on root morphogenesis are Ca2+-dependent and require the participation of CaM. Thus, there are existing data to support the hypothesis that LR initiation is linked to Ca2+ signaling in plants. I will now

79 characterize the transient nature of the bending signal and investigate the possibility that Ca2+ is acting as a second messenger to translate the information contained therein.

Materials and Methods Plant Material and Growth Conditions Arabidopsis thaliana (L.) Heyhn seeds of the Columbia ecotype were used in experiments in this chapter. Unless otherwise stated, all chemicals were obtained from Sigma. Seeds were surface sterilized with 50% (v/v) bleach for 10 min, rinsed three times and incubated in sterile 0.05M HCl for 2 min followed by an additional three . rinses. Half strength Epstein’s medium (3 mM KNO3, 2 mM Ca(NO3)2 4H2O, 0.5 mM . MgSO, 7H2O, 1 mM (NH4)2PO4, 0.56 mM myo-inositol, 2.3 mM Mes, 0.5% (w/v) . sucrose, micronutrients (25 µM KCl, 17.5 µM H3BO3, 1 µM MnSO4 H2O, 1 µM . . . ZnSO4 7H20, 0.25 µM CuSO4 5H2O, 0.25 µM (NH4)6MoO24 4H2O, and 25 µM Fe-Na EDTA), and 1.5% (w/v) Phytagel at pH 5.7) was autoclaved for 25 min. The nutrient media was poured into 90-mm plastic Petri dishes and seeds were planted by pushing them beneath the surface of the solidified media using a toothpick. The dishes were wrapped with Parafilm and inclined at 80o to vertical so that emerging roots would grow through the phytagel and lie flat against the bottom of the dish, allowing for high resolution imaging. Growth was under continuous fluorescent light (90 mmol m-2 s-1) and at room temperature (22°C).

Application of lathanum chloride By carefully removing the gel covering the apical 1 mm of the root tip, a well was created to allow addition of liquid to that section of the root. LaCl3 at the indicated concentration (dissolved in water) or water (control) was then added to the well. After a 5 min treatment, the root tip was rinsed with water and then bent using the protocol described below. The well was then filled with nutrient media containing 1% (w/v) low melting- point agar (Sigma type IV, added at approx 30˚C), and LR development followed.

Calcium imaging To measure cytosolic Ca2+ levels, Arabidopsis seedlings expressing the FRET-based Ca2+ sensor yellow cameleon YC3.6 (Nagai, et al., 2004) driven by the CaMV 35S promoter

80 were transferred to purpose-built cuvettes and mounted as described previously (Monshausen et al., 2008). After several hours of recovery from transfer to the cuvettes, roots were ratio imaged with the Zeiss LSM 510 laser scanning confocal microscope (Carl Zeiss Inc., Thornwood, NY) using a 20x water immersion objective (1.2 numerical aperture, C-Apochromat) and an argon laser. Excitation was set at 458 nm using the primary dichroic mirror and the Meta detector of the LSM 510 was used to capture CFP (473-505nm) and FRET-dependent cpVenus (526-537 nm) emission. Bright-field images were acquired simultaneously using the transmission detector of the microscope. For time-lapse analysis, images were collected every 2 s, with each individual image scans lasting 1.97 s. In situ calibration was performed according to Monshausen et al. (2008).

Root Bending The modified bending approach described in chapter 2 was also used for the bend-back experiments. However, in this case the agar medium covering the apical 1 mm of the root tip was completely removed and an adjacent box shaped piece of media was cut and used to bend and restore the root tip to its original resting position.

Results and Discussion Transient bending is sufficient to trigger lateral root production In order to define when the signal for bend-induced FPC specification was generated, I characterized the inductive window required for LR formation. By providing a transient bending stimulus (Fig. 1B), I determined how long a root needed to be bent in order to trigger production of a LR in the curve. Recent modeling work by Laskowski et al. (2008) concluded that a change in cell geometry could, over many hours, lead to asymmetric accumulation of auxin (through AUX1 action) in the slightly larger cells on the convex side of the bend and enhance auxin-dependent founder cell specification. My chapter 3 results suggest that bending can bypass this AUX1 requirement.

Accordingly, it was important in designing these experiments to separate the possible role of cell geometry from the triggering of more classical signal transduction cascades. My protocol therefore, ensured that no bend-related structural deformity was still present

81 after the application of the bending stimulus. Figures 4.1A and 4.1C demonstrate that no geometric asymmetry persisted after transient bending. Therefore, using this technique, LRs that originated from the previously bent regions may be viewed as resulting from a truly transient disturbance.

Figure 4.2 illustrates how using this transient bending technique with a stimulus as short as 20 s can yield a significant (p<0.05, t-test) increase in the number of LRs on the convex side of the formerly bent regions. This finding implies that the mechanical stresses of the bend rapidly generate a signal, triggering subsequent signal transduction events that elicit FPC specification even when the bend has disappeared. In addition, a longer stimulus resulted in a higher percent of LR initiation events occurring on the convex side of the transiently bent root (Fig. 4.2). These observations suggest that the geometry-based model of Laskowski et al. (2008) may apply under the conditions of a permanent bend, such as those generated via gravitropism, but does not apply to mechanically-induced LR production. The results shown in figure 4.2 are consistent with LR production in response to rapid bending reported by Ditengou et al. (2008). However, these researchers ”transiently” bent roots past 135o and did so at a point further than 3 mm from the root tip (well beyond the zone where the bending signal occurs during tropic growth and development), making these bending experiments less physiologically relevant. Also, unlike the roots bent using the 90o bend-back technique described in figure 4.2, the roots in the experiments of Ditengou et al. (2008) were never fully unbent. Therefore, the transient nature of the stimulus that elicited LRs was never experimentally addressed.

Bending elicits calcium increases in the pericycle of stretched cells Mechanical stimulation is closely linked to the rapid generation of Ca2+ signals (reviewed in Monshausen et al., 2007) providing a candidate for the bend-related signal. I therefore monitored cytosolic Ca2+ concentration using confocal imaging of Arabidopsis expressing the FRET-based Ca2+ sensor YC3.6 (Monshausen et al., 2008, Nagai et al., 2004). Bending the root elicited a rapid biphasic Ca2+ increase in epidermal, cortical and pericycle cells on the convex side of the curve (Fig. 4.3, Movie 4.1).

In order to inhibit such bend-elicited Ca2+ transients, I treated roots with the Ca2+ channel blocker La3+. Because prolonged exposure to La3+ has adverse effects on root growth and development, I pre-incubated roots with the channel blocker for only 5 min and then provided a short bending stimulus of 5 min, which is well within the inductive window required to elicit LR formation (Fig. 4.2). This treatment completely abolished bend- induced Ca2+ transients (Fig. 4.3, Movie 4.2) and bend-induced LR production (Fig. 4.4). Importantly, LR formation elsewhere, e.g. on the concave side of the formerly bent region, was unaffected, indicating that blocking Ca2+ transients was selectively inhibiting the bend-induced promotion of LR formation. Treatments at <1 mM La3+ were ineffective at inhibiting Ca2+ changes or LR formation (data not shown). It is important to note that La3+ has been reported to potentially affect cellular targets other than Ca2+ channels, such as anion channels (Lewis and Spalding, 1998). Therefore, the effects of this inhibitor acting alone need to be interpreted with caution.

Taken together, the observations presented in this chapter strongly support the hypothesis that cytoplasmic Ca2+ changes, caused by the stretching of cells during bending, result in the propagation of a signal that ends in cell division and LR primordium formation. Figure 4.5 depicts a model based on this hypothesis and highlights the possible mechanisms of calcium action that might result in cell division. For example, the Ca2+ signal might feed into the SCF ubiquitination pathway independently of TIR1, and target exactly the same AUX/IAAs that auxin does. There is a huge diversity among F-box proteins predicted from the Arabidopsis genome sequence (Kuroda et al., 2002) hinting that there could be a Ca2+-dependent TIR1 F-box homolog supporting this action. However, this seems an unlikely scenario, because it would require additional transduction steps across the nuclear membrane to move the cytosolic signal (identified in Fig. 4.3) into the nucleus where AUX/IAA action should occur. In my opinion, it is more likely that Ca2+ binds to a CaM or CML (possibly TCH3). Once activated, these proteins could modulate target enzyme activities to control the onset of cell division in a completely auxin-independent manner. This scenario would fit nicely with the observations highlighted in chapter three, as well as those reported by Ditengou et al. (2008) concerning the ability of a bend to bypass auxin-related components normally

83 required for LR patterning. Importantly however, this proposed auxin-independent system does not bypass auxin requirements for LR primordium construction and emergence as shown by the decapitation experiments in chapter three.

References

Antosiewicz DM, Polisensky DH, Braam J (1995) Cellular localization of the Ca2+ binding TCH3 protein of Arabidopsis. Plant J 8: 623–636

Beffagna N, Buffoli B, Busi C (2005) Modulation of reactive oxygen species production during osmotic stress in Arabidopsis thaliana cultured cells: involvement of the plasma membrane Ca2+-ATPase and H+-ATPase. Plant Cell Physiol 46: 1326-39

Bellamine J, Penel C, Greppin H, Gaspar T (1998) Confirmation of the role of auxin and calcium in the late phases of adventitious root formation. Plant Growth J 26: 191-194

Braam J and Davis RW (1990) Rain-, wind-, and touch-induced expression of calmodulin and calmodulin-related genes in Arabidopsis. Cell 60: 357–364

Chehab EW, Eich E, Braam J (2009) Thigmomorphogenesis: a complex plant response to mechano-stimulation. J Exp Bot 60: 43-56

Chen CW, Yang YW, Lur HS, Tsai YG, Chang MC (2006) A novel function of abscisic acid in the regulation of rice (Oryza sativa L.) root growth and development. Plant Cell Physiol 47: 1-13

Choi J and Husain M (2006) Calmodulin-mediated cell cycle regulation: New mechanisms for old observations. Cell Cycle 5: 2183-2186

Demidchik V, Shabala SN, Coutts KB, Tester MA, Davies JM (2002) Free oxygen radicals regulate plasma membrane Ca2+- and K+-permeable channels in plant root cells. J Cell Sci 116: 81-88

Ding JP and Pickard BG (1993) Modulation of mechanosensitive calcium-selective cation channels by temperature. Plant J 3: 713–720

Du L, Ali GS, Simons KA, Hou J, Yang T, Reddy AS, Poovaiah BW (2009) Ca2+/calmodulin regulates salicylic-acid-mediated plant immunity. Nature advance online publication/doi:10.1038/nature07612

Fasano JM, Massa GD, Gilroy S (2002) Ionic signaling in plant gravity and touch responses. Gravitational and Space Biology Bulletin 16: 71–82

Gens JS, Fujiki M, Pickard BG (2000) Arabinoglactan protein and wall-associated kinases in a plasmalemmal reticulum with specialized vertices. Protoplasma 2122: 115– 134

Hepler PK (1989) Calcium transients during mitosis: Observations in flux. J Cell Biol 109: 2567-2573

Hepler PK (1992) Calcium and mitosis. Int Rev Cytol 138: 239-268

Hepler PK (1994) The role of calcium in cell division. Cell Calcium 16: 322-330

Hepler PK and Callaham DA (1987) Free calcium increases during anaphase in stamen hair cells of Tradescantia. J Cell Biol 105: 2137-2143

Kahl CR and Means AR (2003) Regulation of cell cycle progression by calcium/calmodulin-dependent pathways. Endocrine Reviews 24: 719-736

Kao JPY, Alderton JM, Tsien RY, Steinhardt RA (1990) Active involvement of calcium ion in mitotic progression of Swiss 3T3 tibroblasts. J Cell Biol 111: 183-196

Klusener B, Boheim G, Liss H, Engelberth J, Weiler EW (1995) Gadolinium-sensitive, voltage-dependent calcium release channels in the endoplasmic reticulum of a higher plant mechanoreceptor organ. EMBO J 14: 2708–2714

Knight MR, Campbell AK, Smith SM, Trewavas AJ (1991) Transgenic plant aequorin reports the effects of touch and coldshock and elicitors on cytoplasmic calcium. Nature 352: 524–526

Knight MR, Smith SM, Trewavas AJ (1992) Wind-induced plant motion immediately increases cytosolic calcium. Proc Natl Acad Sci 89: 4967–4971

Kuroda H, Takahashi N, Shimada H, Seki M, Shinozaki K, Matsui M (2002) Classification and expression analysis of Arabidopsis F-box-containing protein genes. Plant Cell Physiol 43: 1073-1085

Laskowski M, Grieneisen VA, Hofhuis H, Hove CA, Hogeweg P, Marée AF, Scheres B (2008) Root system architecture from coupling cell shape to auxin transport. PLoS Biol 6(12): e307. doi:10.1371/journal.pbio.0060307

Lee D, Polisensky DH, Braam J (2005) Genome-wide identification of touch- and darkness-regulated Arabidopsis genes: a focus on calmodulin-like and XTH genes. New Phytol 165: 429–444

Legue V, Blancaflor E, Wymer C, Perbal G, Fantin D, Gilroy S (1997) Cytoplasmic free Ca2+ in Arabidopsis roots changes in response to touch but not gravity. Plant Physiol 114: 789–800

Lewis BD and Spalding EP (1998) Nonselective block by La3+ of Arabidoposis ion channels involved in signal transduction. J Membrane Biology 162: 81-90

Mazars C, Bourque S, Mithöfer A, Pugin A, Ranjeva R (2008) Calcium homeostasis in plant cell nuclei. New Phytol 181: 261-274

Monshausen GB, Swanson SJ, Gilroy S (2007) Chapter 5. Touch sensing and thigmotropism. In Plant Tropisms Gilroy S and Masson P, eds. New Jersey. John Wiley & Sons

Monshausen GB, Messerli MA, Gilroy S (2008) Imaging of the yellow cameleon 3.6 indicator reveals that elevations in cytosolic Ca2+ follow oscillating increases in growth in root hairs of Arabidopsis thaliana. Plant Physiol 147: 1690-1698

Nagai T, Yamada S, Tominaga T, Ichikawa M, Miyawaki A (2004) Expanded dynamic range of fluorescent indicators for Ca2+ by circularly permuted yellow fluorescent proteins. Proc Natl Acad Sci 101: 10554-10559

Nakagawa Y, Katagiri T, Shinozaki K, Qi Z, Tatsumi H, Furuichi T, Kishigami A, Sokabe M, Kojima I, Sato S, Kato T, Tabata S, Iida K, Terashima A, Nakano M, Ikeda M, Yamanaka T, Iida H (2007) Arabidopsis plasma membrane protein crucial for Ca2+ influx and touch sensing in roots. Proc Natl Acad Sci 104: 3639-3644

Oldroyd GE and Downie JA (2006) Nuclear calcium changes at the core of symbiosis signaling. Curr Opin Plant Biol 9: 351-357

Rasmussen CD and Means AR (1989) Calmodulin is required for cell cycle progression during G1 and mitosis. EMBO J 8: 73–82

Ratan RR, Maxtield FR, Shelanski ML (1988) Long lasting and rapid calcium changes during mitosis. J Cell Biol 107: 993-999

Sistrunk ML, Antosiewicz DM, Purugganan MM, Braam J (1994) Arabidopsis TCH3 encodes a novel Ca21 binding protein and shown environmentally induced and tissue- specific regulation. Plant Cell 6: 1553–1565

Taules M, Rius E, Talaya D, Lopez-Girona A, Bachs O, Agell N (1998) Calmodulin is essential for cyclin-dependent kinase 4 (Cdk4) activity and nuclear accumulation of cyclin D1-Cdk4 during G1. J Biol Chem 273: 33279–33286

Tombes RM and Borisy GG (1989) Intracellular free calcium and mitosis in mammalian cells: Anaphase onset is calcium modulated, but is not triggered by a brief transient. J Cell Biol 109: 627-636

Trewavas A and Knight M (1994) Mechanical signaling, calcium and plant form. Plant Mol Biol 26: 1329–1341

Xu W, Purugganan MM, Polisensky DH, Antosiewicz DM, Fry SC, Braam J (1995) Arabidopsis TCH4, regulated by hormones and the environment, encodes a xyloglucan endotransglycosylase. Plant Cell 7: 1555–1567

Zhang DH. Callaham DA. Hepler PK (1990) Regulation of anaphase chromosome motion in Tradescantia stamen hair cells by calcium and related signaling agents. J Cell Biol 111: 171-182

Zhang DH, Wadsworth P, Hepler PK (1992) Modulation of anaphase spindle microtubule structure in stamen hair cells of Tradescantia by calcium and related agents. J Cell Sci 102: 79-89

Chapter 5 Conclusion

A number of dedicated researchers have contributed to our understanding of the mechanisms that regulate the complex signal transduction system leading to FPC fate specification. We now know that oscillations in local auxin maxima coordinate to activate responses in FPCs governing the endogenous regulation of LR initiation. Additionally, it is recognized that environmental parameters such as phosphate availability can modulate this system by directly manipulating the expression levels of principal auxin-signaling components. The results highlighted in chapters two, three and four of this thesis present a unique perspective on the environmental regulation of LR initiation and provide valuable insight into the factors controlling this highly plastic developmental phenomenon.

In chapter two, I demonstrated that root curvature could dictate LR pattern formation by recruiting FPCs to the convex side of the curve. I also showed that only a nominal degree of curvature is required for this induction and that gravitropic signaling at the level of auxin transport from the root cap is not involved in this process. In addition, I was able to prove that bending a root elicits LR formation, suggesting that mechanical force is responsible for the induction of FPC fate specification.

The experiments in chapter three sought to address the role of auxin signaling in curve- associated LR formation. Consistent with previous reports on the requirements of shoot derived auxin in the endogenous regulation of LR formation, my data revealed that while curve-associated LR primordium formation relies on auxin transport from the cotyledons, an acropetal source of auxin is not required for the initiation of these primordia. Furthermore, the results from experiments in chapter three indicate that the bending stimulus can bypass known transport and signal perception components of the auxin- dependent LR initiation pathway, suggesting that curve-associated LR initiation may be an auxin-independent process.

In chapter four, I presented evidence that a transient bending stimulus lasting only 20 seconds generates a signal resulting in LR initiation. My findings further establish that this transient stimulus elicits a La+3-sensitive Ca2+ transient in pericycle cells that is required for transduction of the bending signal. Taken together, results from the experiments outlined in chapters two, three, and four, support the hypothesis that that a Ca2+-dependent mechanical signaling system operates either upstream of, or in parallel to, the auxin-dependent pathway controlling FPC specification.

Prior to the publication of this thesis, auxin-dependent signaling was considered a major component of the proposed mechanism responsible for both the endogenous and environmental control of LR initiation. My work supports the existence of another mechanism, where mechanical forces function independently of auxin signaling to reprogram the cellular events leading to the establishment of root architecture. By using mechanically induced Ca2+ transients to provide positional cues, this mechanism allows the root to sense and respond to its environment, branching only at points that ensure optimal soil exploration.

My observations are consistent with very recent work from Ditengou et al. (2008) and Laskowski et al. (2008) who both used mechanical bending to elicit LR formation. However, these research groups used bending protocols that involved non-stabilized roots grown on the surface of agar. Ditengou et al. (2008) used fine forceps to reorient the root tip and create a bend approximately 0.3 cm from the RAM, while Laskowski et al. (2008) created a J-shaped bend approximately 0.5 cm from the RAM by using tweezers to grasp the hypocotyl and drag the root across the agar surface. Consequently, the approaches used by Ditengou et al. (2008) and Laskowski et al. (2008) present the following significant problems: (1) both techniques involve the reorientation of organs capable of the perception of a change in the gravity vector, (2) both approaches introduce an excessive amount of mechanical perturbations, and (3) the curve created by both methods is located in an area of the root where bending does not normally occur. These problems are not associated with the bending protocol illustrated in figures 2.10 and 2.11A. Thus,

98 when roots are bent using this technique, the bending stimulus more closely resembles that which a root encounters during normal growth conditions.

Rather than a direct role for mechanosensors and signaling, Laskowski et al. (2008) have proposed a geometric model for the developmental effect of the bend. These researchers have combined microscopic analysis of bent roots expressing either DR5::GFP or AUX1:YFP, along with mathematical modeling, to support the hypothesis that AUX1 activity and the geometry of curved cells act together to form the mechanism responsible for curve-associated LR initiation. The physiological and modeling data obtained by these researchers indicates that auxin concentrations are altered to levels sufficient to elicit LR initiation approximately 90 minutes after bending. The timing of the inductive event in this model does not fit with my results on transiently bent roots described in figure 4.2. In addition, the conclusions of Laskowski et al. (2008) are inconsistent with my observations that the LR initiation phenotype in aux1 roots can be rescued by mechanical bending (Fig. 3.5). It is important to note that none of results presented in this thesis directly contradict the model proposed by Laskowski et al. (2008). Indeed, it is likely that more than one mechanism is functioning to determine curve-dependent LR placement.

Although the data presented in this thesis strongly supports the idea that a mechanical signaling system is able to elicit the LR development program, a number of questions remain regarding the exact nature of the mechanistic components involved in this process. More specifically, my results highlight the need to better define the precise mechanical sensor and the signaling events it triggers. I will continue by discussing possible approaches to resolving these questions.

Identifying the plant mechanosensory channel from pericycle cells 2+ The effect of LaCl3 on bend-induced Ca changes described in chapter four suggests that the mechanosensor is a Ca2+ channel. However, there are other mechanically sensitive elements which might be responsible for eliciting these changes. Phospholipase C, for example, has been proposed to elicit subsequent mechanosensory events during hyphal

99 growth in fungi (Silverman-Gavrila and Lew, 2003). Identifying this unknown plant mechanosensor will be an important next step in the research described in this thesis.

One way to determine if a mechanically sensitive Ca2+ channel is responsible for eliciting bend-induced Ca2+ increases in FPCs, would be to utilize the data set generated by Brady et al. (2007) which provides a tool to find the pericycle-specific expression of genes coding for transmembrane proteins with channel-like characteristics. This proposed study would identify a set of candidates that could then be experimentally tested for a role in LR formation. For example, using mutants with T-DNA insertions in these genes (such as from the Salk collection), I would perform the bending assay described in figures 2.10 and 2.11. Using this strategy, it may be possible to isolate a mutant that is disrupted in its ability to respond to mechano-stimulation and is unable to initiate LRs when bent, yet is able to generate LRs from its endogenous program, i.e. LRs not recruited to bends.

There are, however, more than 12,000 genes expressed in pericycle cells (Brady et al., 2007) and our understanding of the molecular characteristics of the plant mechanosensory channel is currently unclear. Obvious homologs of the best characterized animal stretch-activated channels, such as the TWIK-related K+ (TREK) and transient receptor potential (TRP) channels (Monshausen and Gilroy, 2009) are not present in the Arabidopsis or rice genomes. The bacterial mechanosensitive channels of small conductance (MscS) are homologous to 6 genes in rice and there are 10 MscS-like (MSL) genes present in Arabidopsis (Haswell and Meyerowitz, 2006). However, these appear to represent Cl- channels and a quintuple knockout in all 5 root expressed MSL genes has no obvious phenotype (Haswell et al., 2008). Therefore, the expression data may highlight many potential channels requiring searching through hundreds of Salk lines (notorious for not being true knockouts) before finding one in which this mechanically sensitive component of development had disappeared. Furthermore, this approach would fail if the channel I was looking for displayed functional redundancy or exhibited lethality.

100

An alternative approach to isolating the mechanosensor would be to try to identify the protein via a heterologous expression system. Using the cell-sorting technique described in Brady et al. (2007) it should be possible to collect sufficient pericycle cells to extract the spectrum of mRNAs present and convert them to cDNAs. Then, Xenopus oocytes could be injected with these cRNAs and assayed using patch-clamp technology for the presence of a novel, mechanically sensitive channel. This would be followed by size fractionation to isolate a small pool of (theoretically one or two) RNAs that retained its associated novel channel activity. These RNAs could then be sequenced to identify the candidate channels. Although such heterologous expression is a routine method for the identification of mechanically sensitive channels, the approach in this case would suffer from a number of experimental design limitations including: (1) the “leap of faith” that the Xenopus oocytes will properly process the RNA, (2) the chance that functional channels will not be transported properly to the plasma membrane, (3) the expectation that the channel does not require other proteins to show its mechanical nature, and (4) the possibility that the mechanically sensitive nature of the channel will get lost during size fractionation. Still, a similar procedure involving the expression of cRNA followed by the assessment of channel activity and fractionation of the RNA population to home in on candidate genes, has been used to identify components of the ABA response in stomatal guard cells (Leyman et al., 1999), suggesting that this is not a totally unfeasible approach.

Identifying downstream targets of the calcium change in founder pericycle cells Given the possible experimental limitations of isolating the mechanosensor responsible for LR initiation, it may be more prudent to keep the focus of immediate future investigations on the pathway leading from Ca2+ changes to cell division in FPCs. When exploring the nature of this pathway, one must first determine if auxin-signaling machinery is required for the transduction of the Ca2+ signal.

The slr1 mutant is deficient in the endogenous regulation of FPC specification and under normal circumstances does not initiate LRs (Fukaki et al., 2002). The gain-of-function mutation in slr1 encodes a stabilized form of an AUX/IAA protein that binds to and constitutively represses the auxin response factors ARF7 and ARF19 (Fukaki et al.,

101

2006). While ARF7 and ARF19 are not required for LR initiation, primordium formation and the latter stages of LR development are dependent on the function of these two transcriptional activators (Okushima et al., 2007).

Ditengou et al. (2008) have found that mechanical bending of arf/7/arf19 roots induces LR initiation but is not sufficient to support subsequent LR primordium development. However, when bending was followed by removal of the root tip, 50% of arf7/arf19 double mutants displayed curve-associated LR formation. Ditengou et al. (2008) have concluded that their inability to affect LR initiation in arf7/ar19 double mutants without removing the root tip indicates the existence of a mobile, root tip-derived, inhibitory signal. Given that auxin plays a principal role in LR primordium development, and that auxin transport dynamics are dramatically altered by removal of the root tip, it seems more likely that the ability of arf7/arf19 double mutants to properly develop LR primordia when decapitated reflects the associated change in local auxin maxima.

Ditengou et al. (2008) have also reported that the slr1 phenotype can be partially rescued by mechanical bending and that this effect does not require the subsequent removal of the root tip. These results support the hypothesis that the bending stimulus acts independently from auxin-signaling machinery to elicit FPC fate. However, support for the idea that the mechanoresponse and auxin-dependent pathways are separate is limited because these researchers failed to fully rescue the slr1 phenotype. While it is possible that the inability to fully rescue this mutant reflects a dependency of the bending signal on the activity of auxin response elements, it is more likely that this inability is due to excess mechanical perturbations introduced during the root-bending protocol used by these researchers. If this assumption is correct, then slr1 roots bent using the protocol described in figures 2.10 and 2.11A should display a WT-like frequency of curve-associated LR initiation events. Should this be shown to be true, it would mean that the bending stimulus is bypassing auxin signaling at the level of response and would provide further evidence that Ca2+ is acting independently from auxin to determine FPC fate.

102

If Ca2+ is acting independently of auxin, then the elements responsible for translating Ca2+ changes to cell division in FPCs should exhibit the following traits: (1) upregulation in response to a transient bending stimulus, (2) upregulation independent of auxin, and (3) upregulation prevented by the presence of La3+. Therefore, one experimental design to identify these elements would involve transiently bending roots treated with and without

LaCl3 and IAA and then to look for differences in signaling component activation between these treatments. The rapid timing of the inductive period I characterized in chapter four, coupled to the long term nature of the subsequent response of LR formation in the absence of further mechanical stimulation, implies that the earliest inductive events are most likely stable posttranslational modifications of signaling proteins. Therefore, the curved sections of these roots could be excised (at 5, 10, 20 and 30 min after bending) and sent for subsequent proteomic/mass spec analysis. By isolating and sequencing elements that appeared or disappeared in roots bent without LaCl3 and IAA, it may be possible to identify downstream components of an auxin-independent Ca2+ signal transduction pathway leading to cell division in FPCs.

Broader significance of my observations More than half a century ago, Turing (1952) combined mathematical analysis, with what is perhaps the first example of computer simulation in developmental biology, to show that a pattern could emerge from a group of identical cells, all operating with identical rules. Twenty years later, Gierer and Meinhardt (1972) modified Turing’s model, defining the need for an element of local activation combined with a longer-range inhibition. The local activation selects particular cells for differentiation, whereas the longer-range inhibition is required to suppress the activation of neighbors. Recently, Smith (2008) described the construction of Gierer and Meinhardt’s model in the following manner.

There are two substances, an activator and an inhibitor. The activator enhances its own production as well as the production of the inhibitor. The inhibitor, in turn, inhibits production of the activator. Such a system is easy to envision as a feedback loop in a genetic regulatory network. A slightly increased concentration of the activator in a cell due to random variation can lead to a small local increase in production of both the

103 activator and the inhibitor in the cell. If the inhibitor diffuses to neighbor cells much more quickly than the activator, it will reduce the inhibitor’s negative effect on local activator self-enhancement, and suppress the activation of cells nearby. Thus, in a system of identical cells, each operating with the same set of rules, a small amount of noise can lead to a periodic pattern of peaks high in activator concentration. This then triggers differentiation, leading to visible pattern formation. My observations suggest that in the case of FPC fate specification, mechanically induced Ca2+ transients represent the noise responsible for cell differentiation.

Mechanical forces have long been proposed to act as plant morphogenetic factors (Green, 1962; Selker et al., 1992; Green, 1997). Until now, the positive identification of a cellular element capable of translating mechanical force to a developmental signaling cascade has remained elusive. Recent work on vegetative meristem morphogenesis has built on a wealth of previous reports (Wymer et al., 1996; Fisher and Cyr, 2000; reviewed in Paradez et al., 2006) linking microtubule reorientation to mechanical signals. By using fluorescently labeled microtubules, Hamant et al. (2008) established that the pattern of microtubule orientations correlated both spatially and temporally with the evolving morphology of Arabidopsis vegetative meristems. They next implemented a simple mechanical model of the growing shoot and observed that microtubule orientations corresponded to the predicted directions of maximal stress. Then by ablating specific cells in the outer layer of the meristem, they forced a stress redistribution that was computed in a more detailed mechanical model of the organ. This new stress pattern again matched the observed changes in microtubule configurations. The data presented by Hamant et al. (2008) indicate that mechanical signals are capable of translation to developmental response in shoots, and highlight an important role for sensing and mechanosensors in the vegetative meristem. My observations indicate that in the case of mechanical induction of LR formation, the program of organogenesis is likely triggered by mechanically elicited Ca2+ changes that can even suppress the requirement for many auxin-related elements normally involved in FPC recruitment. Thus, the mechanosensitive Ca2+ signaling system described in this thesis provides a possible mechanism

104 whereby external and endogenous mechanical forces could be translated into morphogenetic programs during plant growth and development.

105

References

Brady SM, Orlando DA, Lee JY, Wang JY, Koch J, Dinneny JR, Mace D, Ohler U, Benfey PN (2007) A high-resolution root spatiotemporal map reveals dominant expression patterns. Science 318: 801-806

Fisher DD and Cyr RJ (2000) Mechanical forces in plant growth and development. Gravit Space Biol Bull 13: 67-73

Fukaki H, Tameda S, Masuda H, Tasaka M (2002) Lateral root formation is blocked by a gain-of-function mutation in the SOLITARY-ROOT/IAA14 gene of Arabidopsis. Plant J 29: 153-168

Fukaki H, Taniguchi N, Tasaka M (2006) PICKLE is required for SOLITARY- ROOT/IAA14-mediated repression of ARF7 and ARF19 activity during Arabidopsis lateral root initiation. Plant J 48: 380-389

Gierer A and Meinhardt H (1972) A theory of biological pattern formation. Kybernetik 12: 30-39

Green PB (1962) Mechanism for plant cellular morphogenesis. Science 138: 1404-1405

Green PB (1997) Transductions to generate plant form and pattern: an essay on cause and effect. Gravit Space Biol Bull 10: 17-32

106

Hamant O, Heisler MG, Jönsson H, Krupinski P, Uyttewaal M, Bokov P, Corson F, Sahlin P, Boudaoud A, Meyerowitz EM, Couder Y, Traas J (2008) Developmental patterning by mechanical signals in Arabidopsis. Science. 322: 1650-1655

Haswell, ES, and Meyerowitz, EM (2006) MscS-like proteins control plastid size and shape in Arabidopsis thaliana. Curr Biol 16: 1-11

Haswell ES, Peyronnet R, Barbier-Brygoo H, Meyerowitz EM, Frachisse JM (2008) Two MscS homologs provide mechanosensitive channel activities in the Arabidopsis root. Curr Biol 18: 730-734

Laskowski M, Grieneisen VA, Hofhuis H, Hove CA, Hogeweg P, Marée AF, Scheres B (2008) Root system architecture from coupling cell shape to auxin transport. PLoS Biol 6: e307. doi:10.1371/journal.pbio.0060307

Leyman B, Geelen D, Quintero FJ, Blatt MR (1999) A tobacco syntaxin with a role in hormonal control of guard cell ion channels. Science 283: 537-540

Monshausen G and Gilroy S (2009) Feeling green: Mechanosensing in plants. Trends Cell Biol In press

Okushima Y, Fukaki H, Onoda M, Theologis A, Tasaka M (2007) ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASL genes in Arabidopsis. Plant Cell. 19: 118-130

Paradez A, Wright A, Ehrhardt DW (2006) Microtubule cortical array organization and plant cell morphogenesis. Curr Opin Plant Biol 9: 571-578

Selker JM, Steucek GL, Green PB (1992) Biophysical mechanisms for morphogenetic progressions at the shoot apex. Dev Biol 153: 29-43

107

Silverman-Gavrila LB, Lew RR (2003) Calcium gradient dependence of Neurospora crassa hyphal growth. Microbiology 149: 2475-2485

Smith R (2008) The role of auxin transport in plant patterning mechanisms. PLoS Biol 6: e323. doi:10.1371/journal.pbio.0060323

Turing AM (1952) The chemical basis of morphogenesis. Philos Trans R Soc Lond B Biol Sci 237: 37-52

Wymer CL, Wymer SA, Cosgrove DJ, Cyr RJ (1996) Plant cell growth responds to external forces and the response requires intact microtubules. Plant Physiol 110: 425-430

108

Appendix

Introduction Plants have three distinct kinds of membrane H+ pumps capable of generating pH gradients: P-type H+-adenosine triphosphatases (P-ATPases), V-type H+-adenosine triphosphatases (V-ATPases) and type I and II H+-pyrophosphatases (H+-PPases) (Sze et al., 1999). P-ATPases are single-subunit proteins that energize transport across the plasma membrane (PM) by extruding H+ from the cell (Serrano, 1993). V-ATPases are protein complexes encoded by at least 26 genes, and acidify the vacuole as well as other intracellular trafficking compartments (Padmanaban et al., 2004; Strompen et al., 2005). Type I and II H+-PPases are single-subunit proteins that also generate proton gradients in endomembrane compartments with the use of pyrophosphate instead of ATP (Zhen et al., 1997).

The Arabidopsis genome contains one type I H+-PPase, AVP1 (Sarafian et al., 1992), and one type II H+-PPase, AVP2/AVPL1, which shares 35% amino acid identity with AVP1 (Mitsuda et al., 2001). Traditionally, AVP1 has been viewed solely as a vacuolar H+- pump. However, Li et al. (2005) report that alterations in AVP1 expression modulate apoplastic pH, alter auxin transport levels and produce plants with morphogenetic variations typical of hormonal defects. Li et al. (2005) propose that AVP1 plays an important and previously undefined role in the regulation of plant development by mediating the trafficking of the PM P-ATPase and associated proteins, including PIN1.

Only a small portion of my characterization of avp1 mutant morphology was presented in Li et al. (2005). The following results represent previously unpublished data and serve to further characterize the morphological variations I observed in avp1 knockout mutants.

Materials and methods The Arabidopsis thaliana loss-of-function avp1-1 line used in this study was in the Columbia-0 ecotype and was obtained from GABI-Kat, Koln, Germany (original

109 assigned number 005D04). Direct sequencing showed that the T-DNA insertion of this line localizes to the predicted fifth exon of the AVP1 ORF. The T-DNA insertion contains the SUL’ open reading frame for resistance against the herbicide sulfadiazine. For the genetic analysis of the T-DNA insertion line, T2 seeds were selected in half strength MS (Murashige and Skoog salt mixture) media supplemented with 11.5mg/L sulfadiazine. The ratio of resistant to sensitive seedlings was approximately 3/1 (438/145) consistent with a single integration locus. About one-third (129 from 438) of the herbicide resistant seedlings displayed a dramatic impairment in their root and shoot development even after transfer to herbicide free media. PCR analysis using the following primer pairs demonstrated that these abnormal seedlings were homozygous for the T-DNA insertion in the fifth exon of the AVP1 ORF. AVP1-specific primer AVP1244 (5’-CCAATGATAACTTTAGGGGTCAAA-3’) was paired with a T-DNA- specific primer TDNA245 (5’- CCCATTTGGACGTGAATGTAGAC AC-3’) yielding a 740bp fragment, or with another AVP1-specific primer AVP118 (5’- GTCGGCGCTGACCTTGTCGGTAAA- 3’), yielding 8228 bp product. Homozygous avp1-1 plants are not fertile. Therefore, the avp1-1 allele was propagated as a heterozygote.

Seeds were surface sterilized with 50% (v/v) bleach for 10 min, rinsed three times and incubated in sterile 0.05M HCl for 2 min followed by an additional three rinses. Half . . strength Epstein’s medium (3 mM KNO3, 2 mM Ca(NO3)2 4H2O, 0.5 mM MgSO, 7H2O,

1 mM (NH4)2PO4, 0.56 mM myo-inositol, 2.3 mM Mes, 0.5% (w/v) sucrose, . . micronutrients (25 µM KCl, 17.5 µM H3BO3, 1 µM MnSO4 H2O, 1 µM ZnSO4 7H20, . . 0.25 µM CuSO4 5H2O, 0.25 µM (NH4)6MoO24 4H2O, and 25 µM Fe-Na EDTA), and 0.7% (w/v) Phytagel at pH 5.7) was autoclaved for 25 min and poured into 90 mm Petri dishes as in (Wymer et al., 1997). Dishes were sealed with Parafilm to prevent dessication and plants were grown, at 25 °C under a 16h light / 8h dark cycle.

Confocal images were obtained from plants stained with 25 µM of the fluorescent dye FM 4-64 (Molecular Probes, Eugene, OR) diluted in water from a 1 mM stock in DMSO. For root imaging, seedlings were incubated in dye for 5 min and visualized using a LSM

110

510 confocal microscope (Zeiss, Thornwood, NY) with a 20x, 0.75 numerical aperture, dry objective, or 40x 1.2 numerical aperture water immersion objective, 543 nm excitation, 543 nm primary dichroic mirror and >600 nm emission. For shoot imaging, the plants were incubated in dye for 15 min then visualized as described above.

Results and discussion Wild-type Arabidopsis roots have a highly organized cellular structure. A characteristic feature of this organization is the arrangement of cell files in parallel lines. Figure A.1 illustrates that cell file organization appears normal in the basal meristem of knockout mutants of avp1. However, by the time that maturing avp1 root cells reach the proximal elongation zone, their respective cell files no longer run parallel to each other. Instead a waving pattern is established, persisting well into the zone of maturation. This waving pattern affects all cell layers as is evident from the confocal image in figure A.1B.

Floral development in avp1 knockout mutants does not proceed in a normal fashion. Malformed floral structures like the one depicted in figure A.2B are found at the inflorescence apex, while axillary buds (Fig. A.2C) usually fail to form. Axillary floral meristems often become elongated, and form pinoid structures like the one shown in Figure A.2D.

The morphological characteristics of the root and shoot systems of mutants described in this appendix support the hypothesis presented in Li et al. (2005) that AVP1 function is required for polar auxin transport.

111

112

113

References

Li J, Yang H, Peer WA, Richter G, Blakeslee J, Bandyopadhyay A, Titapiwantakun B, Undurraga S, Khodakovskaya M, Richards EL, Krizek B, Murphy AS, Gilroy S, Gaxiola R (2005) Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development. Science 310:121-125

Mitsuda N, Enami K, Nakata M, Takeyasu K, Sato MH (2001) Novel type Arabidopsis thaliana H(+)-PPase is localized to the Golgi apparatus. FEBS Lett 488: 29-33

Padmanaban S, Lin X, Perera I, Kawamura Y, Sze H (2004) Differential expression of vacuolar H+-ATPase subunit c genes in tissues active in membrane trafficking and their roles in plant growth as revealed by RNAi. Plant Physiol 134: 1514-1526

Sarafian V, Kim Y, Poole RJ, Rea PA (1992) Molecular cloning and sequence of cDNA encoding the pyrophosphate-energized vacuolar membrane proton pump of Arabidopsis thaliana. PNAS 89: 1775-1779

Serrano R (1993) Structure, function and regulation of plasma membrane H(+)-ATPase. FEBS Lett 325: 108-111

Strompen G, Dettmer J, Stierhof YD, Schumacher K, Jürgens G, Mayer U (2005) Arabidopsis vacuolar H-ATPase subunit E isoform 1 is required for Golgi organization and vacuole function in embryogenesis. Plant J 41: 125-132

Sze H, Li X, Palmgren MG (1999) Energization of plant cell membranes by H+-pumping ATPases: Regulation and biosynthesis. Plant Cell 11: 677-90

Wymer C, Bibikova T, Gilroy S (1997) Calcium distributions in growing root hairs of Arabidopsis thaliana. Plant J 12: 427-439

114

Zhen RG, Kim EJ, Rea PA (1997) The molecular and biochemical basis of pyrophosphate-energized proton translocation at the vacuolar membrane. In The Plant Vacuole Leigh RA, Saanders D, Callow JA eds. San Diego, California. Academic Press Limited

VITA Gregory L. Richter

Education Ph.D. ◦ May, 2009 Pennsylvania State University, University Park, PA

B.S. magna cum laude ◦ May, 2001 University of Massachusetts, Amherst, MA

A.A. with highest honors Liberal Arts ◦ May, 1998 Massachusetts Bay Community College, Wellesley Hills, MA

Grants NASA Graduate Student Research Fellowship ◦ September, 2003 – August, 2006

Research Experience Graduate Student ◦ September, 2001 – present Pennsylvania State University, The Huck Institutes for the Life Sciences Cellular signaling mechanisms controlling root architecture in A. thaliana

Honors Thesis ◦ May, 2001 University of Massachusetts Characterization and regulation of senescence in corollas of N. tabacum

Research Assistant ◦ Summer, 2000 University of Massachusetts Correlation between water-logging stress and soluble sugar content in foliar tissue of B. rapa

Teaching Experience Teaching Assistant ◦ Fall, 2006 semester Introductory Biology, Pennsylvania State University

Teaching Assistant ◦ Spring, 2003 semester Plant Development, Pennsylvania State University

Teaching Assistant ◦ Fall, 2002 semester Turfgrass Management, Pennsylvania State University

Teaching Assistant ◦ Fall, 2000 semester Introductory Botany, University of Massachusetts

Teaching Assistant ◦ Fall, 1999 semester Plant Pathology, University of Massachusetts

Publications Richter GL, Monshausen GB, Krol A, Gilroy, S (2009) Mechanical stimuli modulate lateral root organogenesis In submission

Li J, Yang H, Peer WA, Richter G, Blakeslee J, Brandyopadhyay A, Titapiwantakun B, Undurraga S, Khodakovskaya M, Richards EL, Krizek B, Murphy AS, Gilroy S, Gaxiola R (2005) Arabidopsis H+-PPase AVP1 regulates auxin-mediated organ development. Science 310: 121-125

Affiliations American Society of Plant Biology ◦ American Association for the Advancement of Science Phi Kappa Phi National Honor Society ◦ Golden Key National Honors Society