University of Zagreb

Faculty of Science

Department of Biology

Martina Ĉonda Genotyping of families with obsessive-compulsive disorder

Graduation thesis

Zagreb, 2014

This Graduation thesis, produced at the Neurobiochemistry laboratory of the University Clinics of Child and Adolescent Psychiatry, University of Zürich, under mentoring of Dr. Edna Grünblatt, Assoc. Prof. Department of Child and Adolescent Psychiatry at University of Zürich, Zürich (Switzerland), is subjected for evaluation to Department of Biology, Faculty of Science, University of Zagreb for acquisition of the title master of molecular biology. ACKNOWLEDGEMENTS

To PD Dr. Edna Grünblatt from University of Zürich, for warm welcoming to her research group and including me to their research project for the purpose of this Master thesis.

To Dr. Jasmin Bartl, Dr. Zoya Marinova and Miryame Hofmann for their selfless guidance during my work for this Master thesis, numerous beneficial advices and patience as well as delightful company.

To dr. sc. Domagoj Đikić, for his kindness and cooperativeness as well as useful advices during writing of this Master thesis.

To my family and friends for their endless help and support during my studies. BASIC DOCUMENTATION CARD

University of Zagreb Faculty of Science Department of Biology Graduation thesis

GENOTYPING OF FAMILIES WITH OBSESSIVE-COMPULSIVE DISORDER

Martina Ĉonda Roosveltov trg 6, 10000 Zagreb, Croatia

Obsessive-compulsive disorder (OCD), a neuropsychiatric disorder, is characterized by the presence of obsessions and/or compulsions. According to previous publications association of genetic variations in glutamatergic with OCD are considered that may potentially contribute to the pathophysiology of OCD. The main aim of this thesis was to provide confirmatory evidence for association of five selected single nucleotide polymorphism (SNP); rs301443 (G/C), rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G) and rs1556995 (G/A) from a three glutamatergic candidate genes; SLC1A1, DPGAP1, GRIK2 with early-onset OCD using family-based study and case-control study. The current study could not confirm the previous findings of these three candidate genes as risk variants in early- onset OCD.

(65 pages, 25 figures, 17 tables, 45 references, original in: English)

Thesis deposited in Central Biological Library

Keywords: early-onset, glutamate, SLC1A1, DLGAP1, GRIK2, polymorphisms

Supervisor: Dr. Edna Grünblatt, Assoc. Prof. (University of Zürich, Zürich, Switzerland)

Co-supervisor: Dr. Domagoj Đikić, Assoc. Prof.

Reviewers:

Thesis accepted: TEMELJNA DOKUMENTACIJSKA KARTICA

Sveuĉilište u Zagrebu Prirodoslovno-matematiĉki fakultet Biološki odsjek Diplomski rad

GENOTIPIZACIJA OBITELJI OBOLJELIH OD OPSESIVNO- KOMPULZIVNOG POREMEĆAJA

Martina Ĉonda Roosveltov trg 6, 10000 Zagreb

Opsesivno-kompulzivni poremećaj (engl. Obsessive-compulsive disorder, OCD) je psihiĉka bolest koja je okarakterizirana prisustvom opsesija i/ili kompulzija. Prema dosad objavljenim istraživanjima o uzroku nastanka OCD, smatra se da genetske varijacije, koje utjeĉu na poremećaj homeostaze glutamat neurotransmisije potencijalno sudjeluje u patofiziologiji OCD. Glavni cilj ovog rada je pronaći povezanost pet odabranih polimorfizama jednog nukleotida (engl. single-nucleotide polymorphism, SNP); rs301443 (G/C), rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G) i rs1556995 (G/A), i triju gena kandidata glutamat neurotransmisije; SLC1A1, DPGAP1, GRIK2 sa nastankom ranog oblika OCD koristeći uzorke obitelji oboljelih i kontrole. Dobiveni rezultati triju predloženih genskih riziĉnih varijanti ne podržavaju ulogu u nastanku ranog oblika OCD i povezanosti sa kliniĉko patološkim obilježjima.

(65 stranica, 25 slika, 17 tablica, 45 literaturnih navoda, jezik izvornika: engleski)

Rad je pohranjen u Središnjoj biološkoj knjižnici.

Kljuĉne rijeĉi: rano pojavljivanje bolesti, glutamat, SLC1A1, DLGAP1, GRIK2, polimofizam

Voditelj: Dr. sc. Edna Grünblatt, izv. prof. (Sveuĉilište u Zürichu, Zürich, Švicarska)

Suvoditelj: Dr. sc. Domagoj Đikić, izv. prof.

Ocjenitelji:

Rad prihvaćen: Table of Contents

1. Introduction ...... 1

1.1. Obsessive compulsive disorder ...... 1

1.1.1. Definition and clinical features ...... 1

1.1.2. Epidemiology of obsessive-compulsive disorder ...... 3

1.1.3. Diagnosing of obsessive-compulsive disorder ...... 3

1.1.3.1. Clinical classification of obsessive-compulsive disorder .... 4 1.1.4. Etiological factors of obsessive-compulsive disorder ...... 5

1.1.4.1. Neuroanatomical brain alterations involved in OCD ...... 6 1.1.4.2. Genetic factors ...... 7 1.1.4.3. Environmental factors ...... 8 1.1.5. Treatment of obsessive-compulsive disorder ...... 9

1.1.6. Heritability of OCD ...... 9

1.2. Genome-wide association studies ...... 10

1.2.1. Single-nucleotide polymorphism (SNP) ...... 12

1.2.2. Glutamatergic candidate genes ...... 12

1.2.2.1. SLC1A1 ...... 13 1.2.2.2. DLGAP1 gene ...... 15 1.2.2.3. GRIK2 gene ...... 16 1.3. Study design ...... 17

1.3.1. Family-based study ...... 17

1.3.2. Case-control study ...... 19

1.4. Aim ...... 20

2. Materials and Methods ...... 21

2.1. Materials ...... 21

2.2. Methods ...... 23

2.2.1. Subject collection ...... 23

2.2.2. Extraction DNA ...... 24

2.2.2.1. DNA extraction and purification from saliva ...... 24 2.2.2.2. DNA extraction and purification from blood ...... 25 2.2.3. DNA concentration measurement ...... 26 2.2.4. TaqMan SNP Genotyping Assay ...... 26

2.2.5. SNPman ...... 29

2.2.6. Statistical analysis ...... 30

3. RESULTS ...... 32

3.1. TaqMan SNP Genotyping Assay results ...... 32

3.1.1. Analysis of polymorphisms on the SLC1A1 gene ...... 32

3.1.2. Analysis of polymorphisms on the DLGAP1 gene ...... 33

3.2. Results of case–control study ...... 35

3.2.1. Genotype distribution and Hardy-Weinberg equilibrium (HWE) test of SLC1A1, DLGAP1, GRIK2 genes polymorphisms in the case– control study ...... 35

3.2.2. Case-control association analysis ...... 37

3.2.3. Male case-control association analysis ...... 38

3.3. Results of family–based study ...... 40

3.3.1. Transmission disequilibrium test (TDT) analysis ...... 40

3.3.2. Sib - transmission disequilibrium test (DFAM) analysis ...... 41

3.4. Association of SLC1A1, DLGAP1, GRIK2 genes polymorphisms with clinical-pathological features in OCD patients ...... 42

3.4.1. Severity of symptoms analysis (measured by the CY-BOCS) .. 43

3.4.1.1. Analysis of severity of symptoms between the three genotypes using one-way ANOVA test...... 43 3.4.1.2. Analysis of severity of symptoms between risk allele and non-risk allele using independent samples T test ...... 46 3.4.2. Age of onset analysis ...... 50

3.4.2.1. Analysis of age of onset between the three genotypes using one-way ANOVA test ...... 50 3.4.2.2. Analysis of age of onset between risk allele and non-risk allele using independent samples T test ...... 52 4. Discussion ...... 55

5. Conclusion ...... 62

6. References ...... 63 List of Figures

Figure 1 Scheme of the OCD cycle...... 2 Figure 2 Illustration of Cortico–striato–thalamo–cortical circuit (CSTC) as a major site of synaptic dysfunction in OCD...... 7 Figure 3 Scheme of the serotonergic neurotransmitter system...... 8 Figure 4 The diagram shows biological relationships between obsessive- compulsive disorder and candidate gene molecules ...... 11 Figure 5 Scheme of the SLC1A1 gene with the position of the investigated SNPs; rs301443 (G/C) and rs12682807 (A/C)...... 15 Figure 6 Scheme of the DLGAP1 gene with the position of the investigated SNPs s11081062 (C/T) and rs11663827 (A/G)...... 16 Figure 7 Scheme of the GRIK2 gene with the position of the investigated SNPs s11081062 (C/T) and rs11663827 (A/G)...... 17 Figure 8 Scheme transmission disequilibrium test (TDT) or parent offspring trio test with transmitted and untransmitted allele’s dived in table...... 18 Figure 9 Context nucleotide sequence surrounding the SNP site with two SNP allele’s variants in brackets...... 26 Figure 10 Allele TaqMan SNP Genotyping discrimination assay...... 27 Figure 11 The amplification graph with two wide spread curve which indicating the uneven DNA concentration of randomly selected sample for analysis polymorphisms with TaqMan SNP allelic discrimination assay at Bio- Rad CFX program...... 28 Figure 12 Representation of SNPman data of randomly selected PCR plate of control samples...... 30 Figure 13 The SLC1A1 gene sequence of nucleotides 3 'UTR region of interest around single nucleotides polymorphisms rs301443; ...... 32 Figure 14 The SLC1A1 gene sequence of nucleotides intronic variant region of interest around single nucleotides polymorphisms rs12682807; ...... 33 Figure 15 The amplification plot with wide spread of the curves indicating the uneven DNA concentration of investigation samples for analysis polymorphisms with TaqMan SNP allelic discrimination assay at Bio-Rad CFX program...... 33 Figure 16 The DLGAP1 gene sequence of nucleotides intronic variant region of interest around single nucleotides polymorphisms rs11081062; ...... 34 Figure 17 The DLGAP1 gene sequence of nucleotides intronic variant region of interest around single nucleotides polymorphisms rs11663827; ...... 34 Figure 18 The GRIK2 gene sequence of nucleotides intronic variant region of interest around single nucleotides polymorphisms rs1556995; ...... 35 Figure 19 Distribution of the three genotypes groups against mean severity symptoms measured by the CY-BOCS scores in OCD patients at polymorphisms rs11081062 (C/T)...... 45 Figure 20 Distribution of the three genotypes groups against mean severity symptoms measured by the CY-BOCS scores in OCD patients at the four polymorphisms; rs12682807 (A/C), rs11663827 (A/G), rs1556995 (G/A), rs301443 (G/C)...... 46 Figure 21 Distribution of the two genotypes groups against mean severity symptoms measured by the CY-BOCS scores in OCD patients at polymorphisms rs11081062 (C/T)...... 48 Figure 22 Distribution of the two genotypes groups against mean severity symptoms measured by the CY-BOCS scores in OCD patients at polymorphisms rs11663827 (A/G)...... 49 Figure 23 Distribution of the three genotypes groups against age of onset in OCD patients at the all five polymorphisms; rs12682807 (A/C), rs11663827 (A/G), rs11081062 (C/T), rs301443 (G/C), rs1556995 (G/A)...... 51 Figure 24 Distribution of the two genotypes groups against mean age of onset in OCD patients at polymorphisms rs12682807 (A/C)...... 53 Figure 25 Distribution of the two genotypes groups against mean age of onset in OCD patients at polymorphisms rs11663827 (A/G)...... 54 List of Tables

Table 1 Subgroups of obsessions and compulsions in obsessive-compulsive disorder ...... 1 Table 2 International Classification of Diseases (ICD-10) criteria for obsessive-compulsive disorder ...... 4 Table 3 Principle of case-control test...... 19 Table 4 DNA extraction and purification from saliva ...... 21 Table 5 DNA extraction and purification from fresh blood ...... 21 Table 6 TaqMan SNP Genotyping Assay ...... 22 Table 7 Laboratory equipment ...... 22 Table 8 Software ...... 22 Table 9 Demographic, clinical and pathological data of obsessive-compulsive disorder patients and healthy controls...... 24 Table 10 Correlation of two reporter fluorescence dye; VIC® fluorescence dye and FAMTM fluorescence dye with generation signal and present allele in the sample...... 28 Table 11 PCR-Cycle conditions for the TaqMan® Genotyping Assays. 1. ... 29 Table 12 Genotypes distribution and Hardy - Weinberg equilibrium (HWE) in OCD patients and healthy controls for all five SNPs...... 36 Table 13 Results of case-control association test analysis for five SNPs. ... 38 Table 14 Results for male case-control association test analysis for five SNPs...... 39 Table 15 Results of transmission disequilibrium test (TDT) analysis for five SNPs...... 41 Table 16 Results of sib - transmission disequilibrium test (DFAM) analysis for five SNPs...... 42 Table 17 Results of the one-way ANOVA analysis between genotype of rs11081062 (C/T) and severity of symptoms measured by the CY-BOCS in the OCD patients...... 44 1. Introduction

1.1. Obsessive compulsive disorder

1.1.1. Definition and clinical features

Obsessive-compulsive disorder (OCD) is a neuropsychiatric condition that is characterized by uncomfortable, disturbing, unwanted, repulsive sexual or aggressive thoughts and ideas, thoughts, images and feelings that are constantly entering the mind, and manifesting with repetitive or strict ritualistic actions (Nestadt, Grados et al. 2010). OCD in the modern classification belongs to the group of anxiety disorders (Stein, Fineberg et al. 2010). Etymologically, the term of the disorder comes from the Latin word “obsessio” which meaning haunting, nagging, obsession by something, and “compulsio” which means a forcing and compelling. OCD is characterized by two major symptoms; obsession and compulsion. Commonly reported subgroup of obsessions and compulsions are shown in Table 1.

Table 1 Subgroups of obsessions and compulsions in obsessive-compulsive disorder Taken from: (Ting and Feng 2008)

Obsessions Compulsions excessive doubt about task completion checking fear of contamination or un-cleanliness washing/cleaning need for symmetry repeating fear of causing harm to others counting excessive concern over right and wrong hoarding intrusive inappropriate sexual thoughts praying

If the symptoms are not treated or if they are treated irregularly, they can last a lifetime and through life the severity and frequency of symptoms can be increased.

The common characteristic of people that have diagnosed OCD is an OCD cycle which describes the progress of the disease with chain of events. To illustrate the OCD cycle consider the Figure 1.

1

OCD is phenomenologically and etiologically heterogeneous (Katerberg, Delucchi et al. 2010). According to the phenomenological heterogeneity, people with OCD vary depending on the type of symptoms, severity and incidence of symptoms. Furthermore, etiologically heterogeneity emphasizes the complexity of this disorder and gives various possible causes of this disorder which is discussed below.

OCD can often be accompanied with other anxiety disorders, eating disorders, depression, Tourette’s syndrome, etc. (Pauls 1992; Overbeek, Schruers et al. 2002).

Figure 1 Scheme of the OCD cycle. Cycle is composed of 4 parts which are connected with sequence of events: obsessions, anxiety, compulsions and relief. Increase of anxiety which occurs during obsessive attacks results with repetitive or ritualistic actions, i.e. compulsions, which decrease anxiety and lead to relaxation. Completing these compulsions or rituals does not lead to lasting change or relief. Taken from: http://www.ocduk.org/understanding-ocd

2

1.1.2. Epidemiology of obsessive-compulsive disorder

Frequency of OCD vary considerably in various epidemiologic studies, depending on culture, study, available statistics and research methods. According to the current results, frequency of OCD is between 1% and 3%, thus, OCD represents one of the most prevalent psychiatric disorders in our society (Nestadt, Grados et al. 2010). Although OCD can develop at various ages, most often it develops in childhood, late adolescence to young adulthood. Typical age of onset in childhood is between 8 to 11 years, while the mean age of onset for adult OCD ranges from 22 to 36 years. Gender distribution tends to follow a 3:2 male to female ratio until adolescence, but at adulthood the gender ratio is approximately 1:1 (Kendurkar and Kaur 2008).

There are different types of OCD, which depends on the age when they occur. Childhood-onset and adult-onset OCD may be distinct in important ways, but far more significant is investigation in childhood-onset OCD, which is discussed in this study of genotyping early-onset paediatric OCD.

1.1.3. Diagnosing of obsessive-compulsive disorder

The majority of patients with OCD experience both obsessions and compulsions; less than 25% have only obsessions, and about 5% have only compulsions. The diagnosis of OCD is set, if obsession symptoms, compulsive acts or both, are present and last at least two weeks or longer. In order to be diagnosed, three basic conditions must be satisfied:

 Symptoms must be repeated several times in a given time (usually more than 1 hour a day)  Manifestation of anxiety and stress if there is no execution of the desired action  Significant interference with normal functioning in daily activities or usual social activities.

OCD is placed in the differential diagnosis of mental health disorders, where the cause of the patients’ symptoms is not organic but psychological. Although psychological examination gives a little clinical data, a psychiatric 3 history and observation of the patient plays an important role in the diagnosis of psychiatric disorders such as OCD. In addition, during the clinical diagnosis and selection of potential treatment is of great importance of properly classification of this disorder.

1.1.3.1. Clinical classification of obsessive-compulsive disorder

The determination of essential clinical features for OCD diagnosis is using different methods of diagnosis of which the most common used are the two major diagnostic classifications; International Classification of Diseases (ICD) and the Diagnostic and Statistical Manual of Mental Disorders (DSM). The ICD-10 of WHO (World Health Organization) is the international standard diagnostic classification for all recognized diseases and related health problems.

According to International Classification of Diseases, diagnosis is described using alphanumeric codes and descriptions of the symptoms of patients. Currently in use is the tenth edition; the ICD-10, which was developed in 1992. ICD-10 system criteria for obsessive - compulsive disorder are shown below in Table 2.

Table 2 International Classification of Diseases (ICD-10) criteria for obsessive- compulsive disorder Taken from (Walitza, Melfsen et al. 2011)

The obsessional symptoms should have the following characteristics: They are acknowledged as originating in the mind of the patient, and are not imposed by outside persons or influences. The subject tries to resist them (but if very long-standing, resistance to some obsessions or compulsions may be minimal). At least one obsession or compulsion must be present which is unsuccessfully resisted. Carrying out the obsessive thought or compulsive act is not in itself pleasurable. (This should be distinguished from the temporary relief of tension or anxiety). The thoughts, images, or impulses must be unpleasantly repetitive. *ICD-10 Classification of Mental and Behavioral Disorders, World Health Organization, Geneva, 1992.

Second commonly used classification is The Diagnostic and Statistical Manual (DSM) published by the American Psychiatric Association. This 4 classification (in Axis II Cluster C) provides a formal definition and criteria for diagnosing OCD. The first edition of DSM was published in 1952; the last edition 'DSM-5' is the publication in May 2013 where the sub-classification that helps to detailed classification and diagnosis of patients with mental illness was proposed. According to the Diagnostic and Statistical Manual of Mental Disorders IV (DSM-IV), in order to diagnose OCD, a person must have obsessions, compulsions, or both that cause marked stress (Foa, Kozak et al. 1995).

One of the most popular tests for rate the severity of OCD symptoms is the Yale-Brown Obsessive-Compulsive Scale (Y-BOCS). In the case of childhood-onset OCD, the Children's Yale-Brown Obsessive Compulsive Scale (CY-BOCS) is used (Freeman, Flessner et al. 2011). The scale was designed by Wayne Goodman and his colleagues, and it is used extensively in research and clinical practice that would be easier to determine severity of OCD and to monitor improvement during treatment. Other classifications that help in the diagnosis of OCD are The Children's Florida Obsessive- Compulsive Inventory (C-FOCA), a brief screening instrument for paediatric OCD. Furthermore, The Obsessive-Compulsive Inventory-Revised (OCI-R) measures distress associated with obsessions and compulsions, and The Child OCD Impact Scale-Revised (COIS-R) assesses OCD-related functional impairment via both parent and child self-report versions and etc.

1.1.4. Etiological factors of obsessive-compulsive disorder

Several etiological causes are hypothesized to contribute to the pathophysiology of OCD, but still its aetiology is unknown. It is assumed that the development of OCD is associated with combination of many biological, psychological and social factors, whereby making this disorder known in several branches of science.

In the literature, the most important causes of the development of OCD that have been investigated are; genetic factors, neuroanatomical and environmental factors. Below is a summary of some of the suggested theories around the cause of OCD.

5

1.1.4.1. Neuroanatomical brain alterations involved in OCD

Studying the biological causes of OCD, researchers focus on certain circuits in the brain that regulates primitive aspects of our behaviour such as aggression, sexuality, bodily excretions, etc. In 1983, the researchers Penney and Young described specific neuronal circuits called cortico–striato– thalamo–cortical (CSTC) circuit as a potential mediated circuit in development of OCD (Ting and Feng 2008). This circuit is involved in the transfer of information from the orbitofrontal cortex (front part of the brain), to the striatum, and the thalamus (deeper parts of the brain), whereby includes caudate nucleus of the basal ganglia through two different pathways: “direct” and “indirect” pathway. If there is an imbalance between these two pathways, it comes to the hyperactivity in orbitofrontal cortex, which is hypothesized to lead to the expression of OC symptoms. To illustration image which shows brain with major brain regions that make CSTC circuit and main pathways that are involved, see Figure 2.

Also, advances in brain imaging have provided the neuroanatomical data for OCD where structural imaging has shown abnormalities such as decreased volume or increased grey matter density in CSTC (Lewin, Storch et al. 2006). Imaging studies in children has supported the involvement of CSTC circuit in OCD, and could confirm the evolution of brain abnormalities in different regions. The application of brain structural imaging methods of OCD is at an early stage; nevertheless it supports other findings with different methods.

6

Figure 2 Illustration of cortico–striato–thalamo–cortical circuit (CSTC) as a major site of synaptic dysfunction in OCD. A. Illustration image of a mouse brain with major brain regions that make CSTC circuit. B. Simplified circuit diagram of the CSTC circuit in mammals showing parts of CSTC circuit (MSN medium spiny neuron; GPE-globus pallidus pars externalise; GPI-globus pallidus pars internalis; SNC-substantia nigra pars compacta; SNr-substantia nigra pars reticulate; STN- subthalamic nucleus; D1R D1-type dopamine receptor; D2R-D2-type dopamine receptor). The mechanism of activation of the circuit start with sending signals from the cortical neurons to the striatum and then they form a glutamatergic-cortico-striatal synapses onto medium spiny neurons (MSNs). In turn, GABA MSNs connect to the output structures of the basal ganglia , the globus pallidus pars internalis (GPI) and substantia nigra pars reticulata (SNR), using two different ways, the “direct” and “indirect” way. Dopamine receptor type 1 (D1R) expressing MSNs in the striatum compose the "direct pathway", whereas dopamine receptor type 2 (D2R) expressing MSNs in the striatum compose the "indirect pathway" (Ting and Feng 2008). Taken from:(Nestadt, Grados et al. 2010).

1.1.4.2. Genetic factors

The aetiology of early onset OCD is still not completely explored, but for now, the results of twin studies, family studies and segregation analysis suggest that genetic factors provide the strongest evidence in cause of OCD. Today, researchers are focused on association between genetic variations of the monoamine neurotransmitter system and pathogenesis of OCD.

Neurotransmitter system is complex network of neurons, expressing certain types of neurotransmitters like dopamine, serotonin, glutamate, histamine and others participating in the transmission of information in the nervous system. To illustrate neurotransmitter system consider the example of serotonergic system in Figure 3. The primary focus of investigation in OCD was the serotonergic system, where results of this neurotransmitter system studies (Westenberg, Fineberg et al. 2007) have shown that serotonin (5-HT) dysfunction is implicated in pathophysiology of OCD. Work on

7 polymorphisms of serotonergic system genes such as the 5-serotonin 2A receptor (HT2A), serotonin transporter (5-HTTLPR), serotonin 1D beta receptor (5HT1D beta), and the serotonin 2C receptor (5HT2C) has been published, and they proved several positive association with OCD (Nestadt, Grados et al. 2010). According to association studies, several candidate genes were found as possible risk factors for OCD from dopaminergic system (DRD4 dopamine receptor, COMT catechol-O-methyltransferase) (Liu, Liu et al. 2011) and glutamatergic system which are investigated in this study.

Figure 3 Scheme of the serotonergic neurotransmitter system. Neurotransmitter system is composed of neurotransmitter, presynaptic (yellow) neuron, postsynaptic (green) neuron, vesicle with stored serotonin, serotonin reuptake transporter, synapse cleft, and serotonin receptor. Taken from: http://www.completehealthdallas.com/Anti Depressants Natural Alternative Dallas .html)

1.1.4.3. Environmental factors

An early investigation very often mentions that environmental and psychosocial factors are responsible for the occurrence of OCD, but only few studies have investigated the nature of these factors in obsessive-compulsive phenomenology. Depending on the methodology used, the length of the duration of the study and the number of subjects, results are variable. While

8 some researchers suggest no link between negative situations through life and OCD, there are many reports by which childhood OCD has been triggered by specific, often traumatic experiences like: the death of a loved person, a divorce in the family, a change of schools, a move to a new living situation, childhood sexual abuse, illness, relationship concerns etc. Furthermore, cognitive models support the hypothesis that stress can increase intrusive thoughts, which are becoming the risk of obsessions. Taken together, these results suggest that stress or trauma can play a role in the development, contribute to the onset and maintenance of OCD (Cath, van Grootheest et al. 2008).

1.1.5. Treatment of obsessive-compulsive disorder

The two main treatments for obsessive-compulsive disorder are psychotherapy and medications. OCD that causes mild functional disturbances is usually treated with a course of psychotherapy, called cognitive behavioural therapy (CBT), which consists of two separate components: exposure and response prevention (ERP). Pharmacological treatment for OCD is focused at the monoaminergic neurotransmission, particularly at the serotonin systems.

The most effective medication for patients suffering from OCD is serotonin reuptake inhibitors (SSRIs). This specific inhibitors act by blocking the presynaptic serotonin transporter (SERT) that normally mediates in reuptake of synaptic released serotonin (Ting and Feng 2008).

Today, the "gold standard" for the treatment of OCD in both children and adults is the combination of SSRIs and CBT (Freeman, Garcia et al. 2012). Sometimes, in rare cases, other treatment options may include: electroconvulsive therapy (ECT), transcranial magnetic stimulation, deep brain stimulation and etc. (Kobak, Greist et al. 1998).

1.1.6. Heritability of OCD

Since the beginning of the twentieth century, it is considered that a hereditary factor plays an important role in the development of OCD. One of the first 9 reports in the literature was based on fifty cases treated at the Maudsley Hospital in London, where 37% of parents and 21% of siblings of cases were diagnosed with this disorder (Nestadt, Grados et al. 2010). Further, the results of Hopkins hereditary studies of OCD where 15 families were monitored, the familial transmission of OCD were confirmed.

To determine the heritability of OCD disorders today family-based studies are used. In the case of complex diseases such as OCD that occur as a combination of genetic and environmental factors, family-based studies are important, because family as a community share these common factors. Family study is based on family history of one person or, in the case of children, the mother or father providing information about all first-degree relatives (Walitza, Wendland et al. 2010). In three-generation study (Steinhausen, Bisgaard et al. 2013) it was found that first-degree relatives of patients with OCD were affected by OCD considerably more frequently than relatives of healthy control subjects (individuals in a study's comparison group who do not have OCD). Thus, family history which indicates heritability of this disorder is a strong predictor in studying OCD through family-based studies.

1.2. Genome-wide association studies

A genome-wide association studies (GWA study, or GWAS), also known as whole genome association study (WGA study, or WGAS) are often the first stage in the genetic investigation of a disorder, where is possible to identify broad genome areas of interest (Bloch and Pittenger 2010). The GWA study include computerized database tools that contain the reference of sequence, a map of human genetic variation and a set of new technologies that can quickly analyse whole-genome samples for genetic variations that contribute to the onset of a disease (Bush and Moore 2012). Therefore, the aim of GWAS is to identify candidate genes or genome regions that are associated with complex diseases or/and phenotypes using samples, in this case of related and unrelated individual genotypes with very large number of genetic variants; single nucleotide polymorphism (SNP),

10 microsatellite markers, insertion/deletions, variable-number tandem repeats (VNTRs), and copy-number variants (CNVs).

In this association study, in families with diagnosed OCD and in controls three candidate genes of glutamatergic system are selected; solute carrier family 1 member 1 (SLC1A1) gene; discs, large (Drosophila) homolog - associated 1 (DLGAP1) gene; glutamate receptor and ionotropic, kainate 2 (GRIK2) gene, for analysis association with OCD diagnosis, OCD related traits, controls together with results of obtained clinical and pathological data. The diagram that shows some of proposed candidate gene molecules and biological relationships that are involved in OCD is presented in Figure 4.

Figure 4 The diagram shows biological relationships between obsessive-compulsive disorder and candidate gene molecules (DLGAP1 and SLCA1A1 from our interest) A: Activation; CP: Chemical-protein interaction; E: Expression; L: Molecule cleavage; LO: Location; P: Phosphorylation; PD: Protein-DNA interaction; PP: Protein-protein interaction; RB: Regulation of binding; T: Transcription; UB: Ubiquitination, taken from: (Grados, Specht et al. 2013).

11

1.2.1. Single-nucleotide polymorphism (SNP)

The human genome is the complete set of hereditary information stored in the form of chemical base pairs that form DNA sequence organized into . A single nucleotide polymorphism (SNP) is a small genetic change in genome which allows us to distinguish one person from another, but also finding the genes responsible for the development of hereditary diseases. Several thousand genes can be located on a single where location of a gene on a chromosome is called the locus. Variant DNA sequences at a given locus are called allele. The existence of more alleles at one locus at a given moment of surveyed population is the result of spontaneous mutation. Mutation is a process in which disturbs the order of nucleotides. Any change in the structure of the genomic DNA which is related to the occurrence of one of the alleles at the same locus, was observed in more than 1% of the population, and is referred to as gene polymorphism. SNP is a variation in DNA sequence, in which one of the nucleotides A (adenine), T (thymine), C (cytosine) or G (guanine) is replaced by another, causing a change in the DNA sequence. SNPs can be located within the coding sequence of the gene, in regulatory region of the gene, in non-coding regions, or in intergenic regions.

The human genome has about 15 million SNP, of which 50,000 to 100,000 may change the function or gene expression and on that way can cause different diseases. In this association study, five SNPs from three selected genes were analysed; rs301443 (G/C) and rs12682807 (A/C) (SCL1A1 gene), rs11081062 (C/T) and rs11663827 (A/G) (DLGAP1 gene), rs1556995 (G/A) (GRIK1 gene) for association with OCD diagnosis, OCD related traits, controls and with results of some clinical and pathological data.

1.2.2. Glutamatergic candidate genes

The studies of genetic factors that potentially play a role in triggering of OCD are involved in different neurotransmission systems. Initial candidate gene studies are focused primarily on genes involved in the serotonin neurotransmitter systems, according to which the most effective

12 pharmacological treatment for OCD serotonin reuptake inhibitors (SSRIs) is produced (Bloch and Pittenger 2010). Besides the serotonin system, some other neurotransmission systems are also suspected to contribute to the pathology and in the development of OCD. Candidate genes of this study are involved in glutamatergic pathways.

L-glutamate is the classical neurotransmitter of glutamatergic neurons in the central nervous system that includes intracortical connections, cortical- subcortical connections, and subcortical systems. In the previous investigation (Rosenberg, MacMaster et al. 2000), elevated glutamate concentrations were found in the cerebrospinal fluid of OCD patients compared to healthy controls. Thus, it is considered that allelic variation in the glutamatergic system could account in the perturbations of glutamatergic neurotransmission whereby may contribute in pathophysiology of OCD. In the last few years research of presence of a certain SNPs in OCD glutamatergic candidate gene have started to show its potential role in the development of this disorder. So far few meta-analysis of association between OCD and certain polymorphisms in region of glutamatergic genes of interest were published (Sampaio, Fagerness et al. 2011; Grados, Specht et al. 2013; Stewart, Mayerfeld et al. 2013; Stewart, Yu et al. 2013). The results of these works have proposed a good candidate gene and statistically significant polymorphisms that are show associated with various type research of OCD. The aim of this study is to link the role of polymorphisms in this three candidate genes; SLC1A1, DGLAP1 and GRIK2, with association in early-onset paediatric OCD which is not yet explored.

1.2.2.1. SLC1A1 gene

The protein coding gene SLC1A1, full name called solute carrier family 1 (neuronal and epithelial high affinity glutamate transporter, system XAG) member 1 is also known as excitatory amino acid carrier (EAAC) 1, or excitatory amino acid transporter (EAAT) 3 gene (according to the HUGO Committee, HGNC).

13

The gene is 97.03 kb long and it is located on chromosome 9p24.2. This gene encodes for the high-affinity glutamate transporters that play an essential role in transport of glutamate across plasma membranes. Function of these glutamate transporters is terminating the postsynaptic action by rapidly removing released glutamate from the synaptic cleft and maintenance of low concentrations of extracellular glutamate below neurotoxic levels. Also, this transporter is involved in transports of L- and D-aspartate. The multi-pass membrane protein is expressed in all tissues tested including liver, muscle, testicle, ovary, retinoblastoma cell line, neurons and brain (substantia nigra, red nucleus, hippocampus, cerebral cortical layers).

First investigation genes, neuronal glutamate transporter SLC1A1 is considered as strongest biological candidate gene for development of OCD on positional linkage evidence. Researchers have found that transport defect of this transporter is implicated in the pathophysiology of few mental illnesses. For now, there is no negative candidate gene studies of SLC1A1 that have been published. Several independent research groups have reported significant associations between OCD and SNPs of SLC1A1, but not for childhood-onset OCD (Dickel, Veenstra-VanderWeele et al. 2006; Stewart, Mayerfeld et al. 2013). All SLC1A1 gene polymorphisms are located in the 3' untranslated region (3' UTR) which is the only genomic region with consistent OCD association, especially in only male probands (Stewart, Mayerfeld et al. 2013). However, a recent study found evidence of association OCD with 5' region of SLC1A1 (Samuels, Wang et al. 2011). Thus, SLC1A1 gene emerged as a good candidate OCD-related gene which use case-control and family-based approaches for investigation development of early onset OCD. The scheme of SLC1A1 candidate gene and location of investigation SNPs; rs301443 (G/C) and rs12682807 (A/C) are shown in Figure 5.

14

Figure 5 Scheme of the SLC1A1 gene with the position of the investigated SNPs; rs301443 (G/C) and rs12682807 (A/C). Exons (blue boxes), intron region (black), promoter and 3'UTR region (orange boxes)

1.2.2.2. DLGAP1 gene

The gene DLGAP1, full name called discs, large (Drosophila) homolog - associated protein 1 is also known as SAP90/PSD95 - associated protein 1 (SAPAP1) (according to the HUGO Gene Nomenclature Committee, HGNC).

The gene DLGAP1 is 959.31 kb long and it is located on chromosome 18p11.31. Function of DLGAP1 gene is in the postsynaptic scaffold in neuronal cells. Gene belongs to a family of four homologous genes encoding SAPAP (SAPAP 1 to 4) that are differentially expressed in the nervous system. SAPAP family proteins were originally identified as neuronal postsynaptic density (PSD) components that interact with the PSD95, a membrane associated guanylate kinase (MAGUK) scaffolding protein and Shank families of proteins, two other multi-domain postsynaptic scaffolding proteins at excitatory synapses (Welch, Lu et al. 2007). Together, these three groups of proteins are thought to form a key scaffolding complex that regulates the trafficking and targeting of neurotransmitter receptors and signalling molecules to the postsynaptic membrane of excitatory synapses.

In a recent association study it was found that DLGAP1 gene variants may be involved in a subtype of OCD involving pathological behaviours (Stewart, Yu et al. 2013). Also, DLGAP1 has been already shown associated with schizophrenia and a smoking-cessation phenotype (Rose, Behm et al. 2010). Other member of this gene family, DLGAP3 has been implicated in compulsive-like behaviour in mouse model. Specifically, knockout mice for the striatum-expressed SAPAP3 gene developed repetitive grooming behaviours and anxiety (Ross, Badner et al. 2011).

15

Accordingly to the previously findings of this gene and other member of this gene family, aims of this study is to confirm these previous findings as well as to find whether this gene plays a role in early onset OCD. The scheme of DLGAP1 candidate gene and location of investigation SNPs; s11081062 (C/T) and rs11663827 (A/G) are show in Figure 6.

Figure 6 Scheme of the DLGAP1 gene with the position of the investigated SNPs s11081062 (C/T) and rs11663827 (A/G). Exons (red boxes), intron region (black), promoter and 3'UTR region (orange boxes)

1.2.2.3. GRIK2 gene

Third investigated gene is GRIK2, ionotropic kainate-class glutamate receptor gene, full name called glutamate receptor, ionotropic, kainate 2 (according to the HUGO Gene Nomenclature Committee, HGNC).

The gene GRIK2 is 671.29 kb long and it is located on chromosome 6q16.3. Gene product of GRIK2 belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Further, GRIK2 is multi-pass membrane protein that is most expressed in cerebellum and in the cerebral cortex of the brain on cell membrane, cell junction, synapse and postsynaptic cell membrane. Glutamate receptors like GRIK2 which are the predominant excitatory neurotransmitter receptors are activated in a variety of normal neurophysiologic processes like synaptic transmission, synaptic plasticity and glutamate-induced neuronal degeneration in basal ganglia. Mutations in this gene have been associated with different diseases that have neurological and psychiatric manifestations, such as schizophrenia, autosomal recessive mental retardation, autism, Huntington's disease, etc.

In family based study (Sampaio, Fagerness et al. 2011) association between polymorphism rs1556995 (G/A) in GRIK2 gene and OCD was found, 16 whereby supports previously reported findings of association between GRIK2 and childhood-onset OCD. The scheme of GRIK2 candidate gene and location of investigation SNP rs1556995 (G/A) are shown in Figure 7.

Figure 7 Scheme of the GRIK2 gene with the position of the investigated SNPs s11081062 (C/T) and rs11663827 (A/G). Exons (green boxes), intron region (black), promoter and 3'UTR region (orange boxes)

1.3. Study design

In this study of genotyping association of selected genes between OCD cases, their families and controls was tested. Therefore, two different study designs were considered for this association study: family-based study and case-control study with statistical analysis methods and interpretation of results.

1.3.1. Family-based study

The family-based study analyses correlation between family collected data (genetic and phenotypic information) with genetic variant that potentially causes specific diseases. Those are several possible family-based designs ranging from simple cases of parent-offspring trios to large multigenerational pedigrees (Lewis 2002). The majority of methods use the transmission of allele or genotypes from parent to offspring.

Transmission disequilibrium test (TDT) or parent offspring trio test is the simplest test of family-based study that compares the rate of transmission of each allele from at least one heterozygous parent to an affected offspring (Benyamin, Visscher et al. 2009). To illustrate the principle of TDT consider the Figure 8. Therefore, alleles transmitted to affected offspring form the “case” genotype, whereas the untransmitted alleles are the “control”

17 genotype. Thus, TDT represent the “case-only design” where parental phenotype is not used, only their genotypes are relevant.

Figure 8 Scheme transmission disequilibrium test (TDT) or parent offspring trio test with transmitted and untransmitted allele’s dived in table. If one parent is e.g. heterozygous (genotype AB) and other is homozygous (genotype AA), the offspring can have two possible genotypes (genotype AA or AB) depending on inherited allele (allele A or allele B). In case there is no association with the disease, alleles A and B have an equal chance of being transmitted from a heterozygous parent. If, for example allele A increases risk of getting some disease, this allele is transmitted with more frequency to the offspring. Other form of this test is sibling transmission disequilibrium test (sib-TDT) or DFAM which compares the marker genotypes in affected and unaffected offspring (instead of using marker data from affected offspring and their parents). In the sib-TDT, the number of A alleles carried by affected siblings is compared with those carried by unaffected siblings.

Family-based analysis methods in these study use genome association analysis toolset in association option in PLINK v1.05 for determination statistically significant differences in genotype (P < 0.05) and allele frequencies (P < 0.05) of each of five selected polymorphisms. Sliding window approaches as implemented in PLINK used to screen for runs of genotypes in all cases and unaffected family members. Results of the TDT and sib-TDT may be combined into family based study, giving method flexibility to different family structures.

18

1.3.2. Case-control study

Case-control study analyses genetic variant in OCD patients and healthy controls, which are not related to the cases (randomly selected from the population). Basic feature of the case-control association studies is to determine if an exposure frequency of investigation genetic variation is associated with disease compared cases and controls (Lewis 2002).

In this study the prevalence of exposure frequency of SNP alleles to a potential risk factor for OCD is compared between cases with OCD and health controls (Table 3).

If there is no true association between exposure and disease, the cases and controls should have the same distribution of exposure. The odds ratio (OR) is a measure of the odds of disease in the exposed compared to the odds of disease in the unexposed (controls) and is calculated as:

a b OR = = 푎푑/푏푐 c d

Table 3 Principle of case-control test. Odds of disease in the exposed compared to the odds of disease in the unexposed (controls).

Cases Controls Total Exposed A B A + B Unexposed C D C + D Total A + C B + D A + B + C + D

The analysis methods also use association option in PLINK v1.05 for determination statistically significant differences in genotype (P < 0.05) and allele frequencies (P < 0.05) of each of five selected polymorphisms between OCD cases and unaffected controls.

19

1.4. Aim

As the involvement of the certain gene of action causing early-onset OCD is not yet clear, two types; family base study and case-control study association studies were performed to investigate the hereditary factor as well as genetic marker of action causing early-onset OCD.

The aim of this thesis is to examine whether there is an association between certain polymorphisms in the glutamatergic neurotransmitter genes; SLC1A, DLGAP or GRIK2 and the risk to developed early-onset OCD. Moreover, the influence of this polymorphism on the age of onset and severity of symptoms in OCD patients were tested.

According to previous published meta-analysis of an association between OCD and the glutamatergic neurotransmission system several genes of the system were found to play some role in triggering OCD. Thus, this study aims to confirm these previous findings as well as to find whether this play a role in early onset OCD.

From scientific aspects this study would contribute to the clarification for the role of glutamatergic neurotransmitter system in triggering OCD. These findings might help in development of potential therapies based on glutamatergic treatment.

Specific aim:

 Genotyping and determination of statistically significant differences in genotype (P < 0.05) and allele frequencies (P <0.05) of the five polymorphisms in SLC1A, DLGAP or GRIK2 gene in family base study and case-control study.  Examination of the association between age of onset and severity of symptoms to the polymorphisms tested in the case.

20

2. Materials and Methods

2.1. Materials

Table 4 DNA extraction and purification from saliva

Reagent Cat. No. Manufacturer OrageneTM DNA Purification Protocol OG-500 DNA-Genotek Ethanol 100% 410230 Merck Tris-EDTA (TE) buffer (100x) pH 8.0 A0973,0500 AppliChem 1 M Tris, 100 mM EDTA-Na2·2H2O

Table 5 DNA extraction and purification from fresh blood

Reagents Ingredients Manufacturer Lysis buffer, 1000 ml distilled water pH = 7.4 1 ml Nonidet P40 - Autoclaved 9 g NaCl 1000 ml distilled water Saline-EDTA (SE) buffer 4.383g NaCl pH = 8.0 - 50 ml 0.5M EDTA- Autoclaved solution, pH = 8.8 100 ml distilled water 1 ml 1M Tris-HCl Tris-EDTA (TE) buffer - 20 μl 0.5M Na2EDTA- solution

10% SDS (C12H26NaO4S) A2263 AppliChem Protease A3459 AppliChem Fluka Analytical NaCl solution 71381 (Sigma_Aldrich Chemie GmbH) Isopropyl alcohol A3465 AppliChem

21

Table 6 TaqMan SNP Genotyping Assay

Reagent Cat. No. Manufacturer TaqMan® 2x Universal PCR Master Mix 4304437 Applied Biosystems TaqMan® SNP Genotyping Assay 4351379 Applied Biosystems rs301443 Assay ID:C_3059691_10 TaqMan® SNP Genotyping Assay 4351379 Applied Biosystems rs12682807 Assay ID:C_25608613_20 TaqMan® SNP Genotyping Assay 4351379 Applied Biosystems rs11663827 Assay ID:C_1689941_10 TaqMan® SNP Genotyping Assay 4351379 Applied Biosystems rs11081062 Assay ID:C_1689943_10 TaqMan® SNP Genotyping Assay 4351379 Applied Biosystems rs1556995 Assay ID:C_8274405_10

Table 7 Laboratory equipment

Machine Manufacturer Heraeus Megafuge 16R Centrifuge Thermo Fisher Scientific Microlitercentrifuge Z216MK Hermle Labortechnik GmbH C1000TM Thermal Cycler / CFX384TM Real-Time Bio-Rad System Nano Vue Plus GE Healthcare Shaker Incubator Eppendorf

Table 8 Software

Software Version Manufacturer Bio-Rad CFX ManagerTM 2.0 Bio-Rad Software Project Web Hosting- Open Scource SNPman Software 1.0 Software (Sourceforge.net) http://snpman.sourceforge.net/ SPSS ® Software 21 IBM MedCalc® Software 12.5.0.0 Windows Project Web Hosting- Open Scource PLINK ® Software 1.05 Software http://pngu.mgh.harvard.edu/purcell/plink/ Excel® 2007/2010 Microsoft

22

2.2. Methods

2.2.1. Subject collection

The study sample comprised patients who had received in-patient treatment at the Departments of Child and Adolescent Psychiatry of the Universities of Würzburg, Marburg, Aachen, Freiburg or Zürich. The patients and controls were all of German origin. During of taking samples there was obtained consent of all participants on the use samples for scientific purposes, with prior getting to know with the subjects provided methods of collecting clinical material and its analysis. In case of minors, their parents gave written informed consent. The ethics committees of the Universities of Würzburg, Marburg, Aachen, Freiburg and Zürich approved the study.

This study included 622 participants who were divided into two groups; OCD cohort and control cohort. OCD cohort (n = 481) included patients with diagnosed OCD (n = 160) and their direct relatives; parents (n = 304) and siblings (n = 17). The gender distribution (male/female) is 95/65 for OCD patients, 164/140 for the parents, and 6/11 for siblings. All OCD patients were between 4 to 18 years of age with an age of onset between 3 to 17 years of age. Control cohorts (n = 141) were between 6 to 18 years of age, and gender distribution (male/female) is 82/59. All control cohorts are samples of healthy children collected in Würzburg.

Along with information about the gender of all participants, for OCD patients were collected information of age and additional clinical and pathological data, such as age of onset disease and rate the severity of symptom using the Children Yale-Brown Obsessive-Compulsive Scale (CY-BOCS).

The CY-BOCS was designed by Wayne Goodman and his colleagues, and it is used extensively in research and clinical practice that would be easier to determine severity of OCD and to monitor improvement during treatment. The scale measures obsessions and compulsions on 5 parameters which include: duration and frequency, interference in social functioning, associated distress, degree of resistance, and perceived control over obsessions or 23 compulsions (Goodman, Price et al. 1989). Each item is rated on a clinician 5 (from 0 (no symptoms) to 4 (extreme symptoms)) point scale and the numbers show the total CY-BOCS score (maximum score of 40) (Goodman, Price et al. 1989). A score of 0-7 is subclinical; 8-15 is mild, 16-23 is moderate and severe 24-31, and 32-40 is extreme. The information of demographic, clinical and pathological data of obsessive-compulsive disorder patients and healthy controls are presented in Table 9.

Table 9 Demographic, clinical and pathological data of obsessive-compulsive disorder patients (OCD) and healthy controls.

Features OCD cohort Control cohort

265 (male) 82 (male) Gender 216 (female) 59 (female) Age (years) mean (+/- SD) 12.92 (+/-2.99) 10.23 (+/-5.1) Severity (CY-BOCS) mean (+/- SD) 21.67 (+/-7.85) - Age of onset mean (+/- SD) 10.75 (+/-3.4) -

2.2.2. Extraction DNA

This study used high molecular weight genomic DNA isolated from whole fresh blood (leukocytes, the white blood cells) or saliva from all participants. After isolation DNA was stored at 4°C before further use. Below are the protocols that were used during the isolation of DNA.

2.2.2.1. DNA extraction and purification from saliva

DNA was isolated from saliva following the OrageneTM DNA protocol (OrageneTM DNA Purification Protocol, DNA Genotek). First, the saliva samples were incubated at 50°C in air incubator for minimum of 2 hours to permanently inactivate the nucleases and samples are stored at room temperature. For isolation, 500μl was transferred to a 1.5 ml microcentrifuge tube and 20μl of OrageneTM DNA purifier were added to precipitate impurities and inhibitors. Samples were mixed by vortexing for a few seconds and incubated on ice for 10 minutes. After a 5-minute centrifugation step at 21’380 g at room temperature, the supernatant was transferred to a 2 ml tube 24 and pellet was discarded. Further, 500μl of absolute ethanol was added and the mixture was gently mixed to precipitate the DNA. The samples were incubated for 10 minutes at room temperature to allow the DNA to fully precipitate. After incubation, samples were centrifuged at 21’380 g for 2 minutes at room temperature. After removing the supernatant, DNA pellet was washed with 250μl of 70% ethanol, and samples were incubated for 1 minute at room temperature. After, ethanol was removed and the DNA was let dry for the ethanol to evaporate. Thereafter, 100μl of tris-EDTA (TE) buffer were added to dissolve the DNA pellet. The samples were vortexed and stored at 4°C for before further use.

2.2.2.2. DNA extraction and purification from blood

DNA was isolated from fresh blood following the two-day protocol because the solution containing the white blood cells that needs to incubate overnight. First day, 10 mL of fresh blood was transferred to a 50 L falcon and add 30 ml lysis buffer for fresh blood in order to lyse the erythrocytes. After incubation on ice for 30 minute, leukocytes are separated by centrifugation at 2’850 g at 4°C for 15 minute. After removing the supernatant, DNA pellet was resuspended in 5 ml SE-buffer. Further, 250µl of pronase for the degradation of polypeptides were added together with 250μl 10% SDS which serves to remove the lipid molecules in the membranes. The sample was vigorously mixed and incubated over night at 37°C. Second day, 2.5 ml of SE buffer and 2.5 ml saturated NaCl solution to precipitate peptides and other cell fractions were added and solutions were mixed by vortexing for a few seconds. After a 20-minute centrifugation step at 5’700 g at room temperature, the supernatant was transferred to a new 50 ml falcon and pellet was discarded. Further, 7.5 ml isopropyl alcohol was added to precipitate the DNA and the mixture was gently mixed to precipitate the DNA. The DNA was transferred to an Eppendorf tube and let dry for 30 min at room temperature until all visible isopropyl alcohol was evaporated before being re-suspended in 500µl TE buffer. The DNA was vortexed and stored at 4°C for before further use.

25

2.2.3. DNA concentration measurement

DNA concentration was measured using the NanoVue Plus spectrophotometer. Absorbance at 260 nm (A260) and 280 nm (A280) of 1μl of samples was measured under the program’s standard parameter. Concentration was calculated according to the following formula:

Concentration in ng/μl = 50 · A26o. TE buffer was used as a blank.

2.2.4. TaqMan SNP Genotyping Assay a. Principle

In this study are used allelic discrimination assays, called Applied Biosystems TaqMan SNP Genotyping Assay to detect single-nucleotide variation (Figure 10). Assay containing two primers for amplifying the polymorphic sequence of interest and two TaqMan MGB probes for distinguishing between the two alleles. Each TaqMan MGB probe contains a reporter fluorescence dye, VIC® or FAMTM (6-carboxy-fluorescein) at the 5′ end of each probe. VIC® fluorescence dye is linked to the 5′ end of the Allele 1 probe and FAMTM fluorescence dye is linked to the Allele 2 probe (Figure 10). The context sequence for the alleles is shown in Figure 9.

ATGTCCTCGGAGTGCTGTGAGTGTC[C/T]GGCACTTCC ATCCAAAGCCAACAGT

Figure 9 Context nucleotide sequence surrounding the SNP site with two SNP allele’s variants in brackets. In the Applied Biosystems assay the first allel C (green) is associated with VIC fluorescence dye, the second allele T (blue) with FAM- fluorescence dye. At the 3′ end of each probe is a minor groove binder (MGB), modification that increases the melting temperature (Tm) for a given probe length. Furthermore, a nonfluorescent quencher (NFQ) is attached at the 3′ end of each probe, together with the MGB. When the probes are intact, the proximity of the reporter dye to the quencher dye results in quenching of the reporter fluorescence primarily by Förster-type energy transfer. During PCR, goes to the denaturation of DNA template and annealing of TaqMan MGB probes on specific site that is complementary sequence between the forward 26 and reverse primer sites. AmpliTaq Gold® DNA polymerase extends the primers moving and cleaves the probes that are hybridized to the target. The reporter dye is released from the quencher dye, what result in increased fluorescence signal by the reporter. Thus, the fluorescence signal generated by PCR amplification indicates which alleles are present in the sample (Table 10).

Figure 10 Allele TaqMan SNP Genotyping discrimination assay. 1. Demonstrating DNA template and assay components; forward primer, reverse primer, two TaqMan MGB probes for distinguishing between the two alleles (C/T) (VIC® fluorescence dye is linked to the 5′ end of the Allele 1 probe with SNP G, FAMTM fluorescence dye is linked to the Allele 2 probe with SNP A). 2. Demonstrating process of denatured template and annealing assay components on specific site that is complementary to the sequence. 3. Demonstrating process of polymerization and signal generation of VIC® fluorescence dye. Taken from: TaqMan® SNP Genotyping Assays Protocol, Applied Biosystems. After completion of the PCR run, amplification graph displayed the graph plots of the VIC fluorescence - green (for one allele) and the FAM fluorescence - blue (for the other allele) against time (cycle), two curves for each well as a resuls (Figure 11). The horizontal line (green and blue) is used for setting the fluorescence threshold that determines the threshold cycle (Ct) for each allele.

27

Table 10 Correlation of two reporter fluorescence dye; VIC® fluorescence dye and FAMTM fluorescence dye with generation signal and present allele in the sample. Taken from: TaqMan® SNP Genotyping Assays Protocol, Applied Biosystems.

Fluorescence Indicates VIC-dye fluorescence – green Homozygosis for allele 1 FAM-dye fluorescence – blue Homozygosis for allele 2 VIC- and FAM- dye fluorescence – green and Heterozygosis blue

Figure 11 The amplification graph with two wide spread curve which indicating the uneven DNA concentration of randomly selected sample for analysis polymorphisms with TaqMan SNP allelic discrimination assay at Bio-Rad CFX program. The graph plots show a colour code of two curves for each samples using relative fluorescence units (RFU): VIC-dye fluorescence – green (for allele C) and FAM-dye fluorescence – blue (for allele G) against time (cycle) and two horizontal baseline (blue and green) for setting the fluorescence threshold that determines the threshold cycle (Ct) for each sample and allele. Representation of quantification data of OCD controls samples for polymorphisms rs301443 G/C with randomly selected sample that shows a homozygosis for allele 1 result (green bold line-genotype CC). b. Procedure

Isolated DNA from saliva and blood was taken and the allelic discrimination assay was performed according to manufacturer’s instructions (Custom TaqMan® SNP Genotyping Assays Protocol, Applied Biosystems). Before starting all, DNA samples were diluted with DNase-free water to deliver a final DNA concentration of 10ng/µl. The diluted DNA samples were mixed gently and spinned down. SNP Genotyping Assay was diluted 40x with 1x TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) to a 20x working stock Genotyping Assay solutions. The experiment was carried out on a 384-well plate and a two-fold repeat of each sample. In each well 2,75µl master mix consisting of 2.50µl TaqMan Universal PCR Master Mix (2x) and 0,25µl of 28 one of the five different 20x working stock of SNP Genotyping Assay solutions. The master mix was mixed with 2.24 µl DNA sample (10ng/µl) or in case of the negative controls with 2.24µl water. The C1000 CFX384 thermal cycler from BIO-RAD Manager Software v2.0 was used to run the genotyping assay experiment according to the manufacturer’s default standard assay protocol described in the TaqMan Genotyping Assays Protocol, Applied Biosystems. The cycle conditions were set as following Table 11.

Table 11 PCR-Cycle conditions for the TaqMan® Genotyping Assays. 1. Step represents Taq activation that last 10 min on 95 °C temperature. 2. Step represents denaturation cycle that last 15 s on 92 °C. 3. Step represent process of annealing and extension of DNA template that last 1 min on 60 °C.

PCR-Cycle Time Temperature 1. Taq activation 10 min 95 °C 2. Denaturation 15 s 92 °C 3. Annealing / Extension 1 min 60 °C

2.2.5. SNPman

The SNPman program calls the genotypes of SNP from TaqMan allelic discrimination assays (Konopac, Dusatkova et al. 2011). In this study it uses SNPman software that helps on easiest way divided investigation samples to the appropriate genotype. This program accepts PCR fluorescence data exported from SNP TaqMan assays whole PCR run where the generation of the import files is described in text form. After data import, an amplification graph is displayed the graph plots where the VIC/VIC homozygous fluorescence represent one allele (purple), FAM/FAM homozygous fluorescence is for the other allele (orange) and heterozygous FAM/VIC (green) against time (cycle) for each sample in OCD and controls cohort (Figure 12).

29

Figure 12 Representation of SNPman data of randomly selected PCR plate of control samples. A. The amplification plot with a wide spread of the curves indicating the uneven DNA concentrations. B. The fluorescence graph. C. Graphs utilizing the threshold cycle. D. Difference in Ct. Colors codes show the allele calls; VIC/VIC homozygous fluorescence for one allele (purple), FAM/FAM homozygous fluorescence for the other allele (orange) and heterozygous FAM/VIC (green). Taken from: (Konopac, Dusatkova et al. 2011).

2.2.6. Statistical analysis

Hardy-Weinberg equilibrium (HWE), which is the expected frequency of genotypes was calculated with Had2Know© 2010 – 2013. In the family-based study, statistically significant differences in allele frequencies of the OCD cases and their family are tested by association option of PLINK; transmission disequilibrium test (TDT) and sib-transmission disequilibrium test (DFAM) tests. In case-control study, statistically significant differences in allele frequencies between OCD patients and healthy controls are tested by association option of PLINK by case-control association test. For polymorphisms which show a difference in the distribution, measured by odds ratio (OR) where 95% confidence interval (CI) was calculated using MedCalc software and PLINK.

ANOVA analysis uses data obtained by genotyping only the OCD cases to determine the correlation between a particular genotype and one of the clinical-pathological data. Correlations between genotypes and clinical and pathological features of patients were analysis using the one-way ANOVA 30 test analysis of variance (ANOVA) and the independent samples T test. One- way ANOVA is used to test for differences among clinical pathology characteristics of OCD patients; severity of symptoms (measured by Children Yale-Brown Obsessive-Compulsive Scale) and age-of-onset with at least three independent groups of genotypes obtained through the experimental part. Independent samples T test covered two group analysis of genotype cases (where two genotypes were pooled and compared to the third genotype) to analyse the differences between group means of clinical and pathological features of patients. Correction for multiple testing was conducted using post-hoc Bonferroni methods (P < 0.08). The P-value was set to < 0.05 as significant and value between 0.05 < P < 0.1 considered as a tendency.

31

3. RESULTS

3.1. TaqMan SNP Genotyping Assay results

In this study five selected polymorphisms were analysed in three candidate genes; SLC1A1, DLGAP1, GRIK2 that potentially could be significant as a risk factor for early-onset OCD. Four of them; rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G) and rs1556995 (G/A) are located in the intronic variant region, one, rs301443 (G/C) in the 3 'UTR region (Figure 5, Figure 6, Figure 7).

3.1.1. Analysis of polymorphisms on the SLC1A1 gene

In the SLC1A1 gene the analysed polymorphisms rs301443 (G/C) is located on chromosome 9:4.594.919 and rs12682807 (A/C) is located on chromosome 9:4.574.022. Nucleotide sequence of 3'UTR region SLC1A1 gene around polymorphism rs301443 (G/C) is presented in Figure 13. The frequency of the G allele of rs301443 (G/C) in OCD patient is 32.81%, and in healthy controls is 29.79%. The frequency of allele C in OCD patients is 67.19% and in controls is 70.21%. Nucleotide sequence of intronic variant region SLC1A1 gene around polymorphism rs12682807 (A/C) is present in Figure 14. In the polymorphism rs12682807 (A/C) the frequency of A allele in OCD cases is 88.13% and in controls is 90.78%. The frequency of allele C in patients is 11.88%, and 9.22% in controls. Polymorphisms rs301443 (G/C) and rs12682807 (A/C) were analysed by Applied Biosystems TaqMan SNP Genotyping Assay producing real-time PCR curves for genotype analysis (Figure 15).

AATTACTAGGGGTCAAGGTGGGTGTT[C/G]AGAAGAA TGGAGGCCTTGTCTGGGA

Figure 13 The SLC1A1 gene sequence of nucleotides 3 'UTR region of interest around single nucleotides polymorphisms rs301443; C - wild type allele (red) and G – minor allele (blue), g.4594919C>G (according to the Human Genome Variation Society, HGVS).

32

TGGCCACAGTCCTGACTGGGTATGTC[A/C]GACTCAAG AGAAGAGACAGAAACCT

Figure 14 The SLC1A1 gene sequence of nucleotides intronic variant region of interest around single nucleotides polymorphisms rs12682807; A - wild type allele (green) and C - minor allele (orange), g.4574022A>C (according to the HGVS).

Figure 15 The amplification plot with wide spread of the curves indicating the uneven DNA concentration of investigation samples for analysis polymorphisms with TaqMan SNP allelic discrimination assay at Bio-Rad CFX program. The graph plots show a colour code of two curves for each samples using relative fluorescence units (RFU): VIC-dye fluorescence – green (for allele C) and FAM-dye fluorescence – blue (for allele G) against time (cycle) and two horizontal baseline (blue and green) for setting the fluorescence threshold that determines the threshold cycle (Ct) for each sample and allele. Representation of quantification data of OCD patients and their family samples for polymorphisms rs301443 G/C with randomly selected sample that shows a heterozygous result (bold lines-genotype GC).

3.1.2. Analysis of polymorphisms on the DLGAP1 gene

In the DLGAP1 gene the analysed polymorphisms were: rs11081062 (C/T) located on :3.662.879 and rs11663827 (A/G) located on chromosome 18:3.663.631. Nucleotide sequence of intronic variant region DLGAP1 gene around polymorphism rs11081062 (C/T) is presented in Figure 16. The frequency of allele C in rs11081062 polymorphism of OCD patients is 76.56%, and 82.27% in healthy controls. The frequency of T allele in OCD is 23.44% and in control is 17.73%. Nucleotide sequence of intronic variant region DLGAP1 gene around polymorphism rs11663827 (A/G) is

33 presented in Figure 17. The frequency of allele A in rs11663827 polymorphism in patients is 23.13%, and 17.73% in healthy controls. The frequency of G allele in OCD patients is 76.88% and 82.27% in control. Polymorphisms rs11081062 (C/T) and rs11663827 (A/G) were analysed by Applied Biosystems TaqMan SNP Genotyping Assay (see an example of real-time PCR in Figure 15).

TACGTTGGACATATATGAGGCAAATA[C/T]CTTTTTCATA TTGAGAGGTCTTCAT

Figure 16 The DLGAP1 gene sequence of nucleotides intronic variant region of interest around single nucleotides polymorphisms rs11081062; C - wild type allele (red) and T - minor allele (blue), g.3662879C>T (according to the HGVS).

ACTGACATGTAAGGAGTCTTGAAGCC[A/G]CAAGGCTG GAGGTGCCAATTACAGG

Figure 17 The DLGAP1 gene sequence of nucleotides intronic variant region of interest around single nucleotides polymorphisms rs11663827; A minor allele (green) and G - wild type allele (orange), g.3663631G>A (according to the HGVS). 3.1.3 Analysis of polymorphisms on the GRIK2 gene

In the GRIK1 gene the analysed polymorphism was: rs1556995 (G/A) located on chromosome 6:102,317,345. Nucleotide sequence of intronic variant region GRIK2 gene around polymorphism rs1556995 (G/A) is presented in Figure 18. The frequency of allele G in rs1556995 polymorphism in OCD patients is 23.44%, and 25.53% of healthy controls. The frequency of A allele in OCD patients is 74.47% and 76.56% in control. Polymorphisms rs1556995 (G/A) was analysed by Applied Biosystems TaqMan SNP Genotyping Assay (see an example of real-time PCR in Figure 15).

34

TCTTTTGCAAACTGAATTTCCTAGAA[A/G]AGCCACAA AACCTTAAAATGCAATT

Figure 18 The GRIK2 gene sequence of nucleotides intronic variant region of interest around single nucleotides polymorphisms rs1556995; A – wild type allele (red) and G - minor allele (blue); g.102317345C>T (according to the HGVS).

3.2. Results of case–control study

In the case-control study 301 participants were analysed; OCD patients (n = 160) with gender distribution of male to female 95:65 and healthy controls (n = 141) with male/female distribution of 82/59. Using their genotypes the Hardy-Weinberg equilibrium (HWE) test, case-control association test and male association test were performed. Incomplete data of gender and age in OCD cohort samples (n = 16) and control cohort (n = 12) were omitted from the analysis. Two sample (90-25-080-001, ZH-25-36-003) were excluded from the original cohort of 622 before conducting any analysis because the genotype could not been generated.

3.2.1. Genotype distribution and Hardy-Weinberg equilibrium (HWE) test of SLC1A1, DLGAP1, GRIK2 genes polymorphisms in the case–control study

For this case-control study the Hardy-Weinberg equilibrium (HWE) test was performed in order to test that all SNPs were in equilibrium in the different groups. Frequencies and allelic distribution of investigated polymorphisms were analysis in accordance with those predicted by the HWE in OCD patients and in the control group. In this analysis participants were divided on three groups: affected (OCD patients), unaffected (controls) and all which represent total of the two groups. Genotype distribution for rs1556995 is; G/G, A/G, A/A, for rs12682807 is; C/C, A/C, A/A, for rs301443 is; G/G, C/G, C/C, for rs11081062 is; T/T, T/C, C/C, for rs11663827 is; A/A, A/G, G/G. The table of genotype distribution and Hardy-Weinberg equilibrium (HWE) of affected, unaffected and all participants is presented in Table 12. The P- value was set to < 0.05 as significant.

35

HWE was generated for the polymorphisms; rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G) and rs301443 (G/C). Polymorphism rs1556995 (G/A) in total sample (P = 0.03) and in the affected group (P = 0.026), showed deviation from HWE (Table 12). The P-values of the HWE ranged between 0.0276 for rs1556995 of affected and 0.8073 for rs12682807 of total sample (affected and unaffected) (Table 12).

Table 12 Genotypes distribution and Hardy - Weinberg equilibrium (HWE) in OCD patients and healthy controls for all five SNPs. Number of probands (n) of each group; all (n = 301), affected (n = 160), and unaffected (n = 141) having the respective genotype and P-value of HWE, calculate via PLINK© as respective genotype frequencies (in %) and P-value (in brackets) of HWE, calculate via Had2Know© for all five SNPs; rs1556995, rs12682807, rs301443, rs11081062 and rs11663827. Polymorphism rs1556995 (G/A) in all samples group (P = 0.03) and in the affected group (P = 0.026), showed deviation from HWE. HapMap-CEU represents population diversity genotype data for every genotype in each SNPs in European group. Statistical analysis was done via PLINK©, Had2Know© 2010 – 2013; HapMap-CEU (NCBI).

rs1556995 rs12682807 rs301443

G/G A/G A/A P-value C/C A/C A/A P-value G/G C/G C/C P-value

All (n) 25 97 179 0.03 3 58 240 1 28 133 140 0.789

HWE[%] 5.96 36.91 57.13 (0.0276) 1.13 19 78.87 (0.8073) 9.86 43.08 47.07 (0.6552)

Affected (n) 14 47 99 0.026 2 34 124 1 17 71 72 1

HWE[%] 5.49 35.89 58.62 (0.0217) 1.41 20.93 77.66 (0.8465) 10.77 44.09 45.14 (0.9352)

Unaffected 11 50 80 0.505 1 24 116 1 11 62 68 0.687 (n)

HWE[%] 6.52 38.03 55.45 (0.4231) 0.85 16.74 82.41 (0.8916) 8.87 41.83 49.3 (0.543)

HapMap- 3.3 36.7 60 0.9 21.2 77.9 11.7 28.3 60 CEU[%]

rs11081062 rs11663827

T/T T/C C/C P-value A/A A/G G/G P-value

All (n) 12 101 188 0.861 12 100 189 0.862

HWE [%] 4.31 32.91 62.78 (0.732) 4.24 32.71 63.05 (0.786)

Affected (n) 7 61 92 0.514 7 60 93 0.656

HWE [%] 5.49 35.89 58.62 (0.4306) 5.35 35.55 59.1 (0.4889)

Unaffected 5 40 96 0.772 5 40 96 0.772 (n)

HWE [%] 3.14 29.17 67.68 (0.7432) 3.14 29.17 67.68 (0.7432)

HapMap- 4.4 31 64.6 4.4 31 64.6 CEU[%]

36

3.2.2. Case-control association analysis

In the case-control study the association test were performed in which it was tested whether or not a statistically significant differences in allele frequencies (P <0.05) could be detected for the selected polymorphisms; rs1556995, rs12682807, rs301443, rs11081062, rs11663827 in SLC1A1, DLGAP1, GRIK2 gene between OCD cases and controls.

The case-control association analysis indicates whether there is a statistically significant difference through different variables. The results of the case- control association tests for each of the five polymorphisms were indicated as statistically significant through P-value (P), chi-square statistic (CHISQ) and odd ratios (OR) with corresponding 95% confidence intervals. The P-value was set to < 0.05, (CHISQ (χ2) ≥ 3.8419) as significant, while 0.1 < P-value > 0.05 as tendency for significance. If OR > 1, minor allele represent risk for developing the disease, while in case of OR < 1, minor allele is protective factor. The analysis results of genotyping in case – control association test of the five polymorphisms in OCD patients and healthy controls are presented in Table 13.

Results of the analysis show that difference were found for the rs11081062 (C/T) polymorphism [OR = 1.42, 95% CI (0.9518 - 2.1198), P = 0.0850], which show only a tendency for significance (0.1 < P > 0.05). Carrier of minor allele T at rs11081062 (C/T) are not associated with risk of developing OCD, in spite of OR > 1, because P – value for rs11081062 (C/T) (P = 0.0850) was not statistically significant (asymptotic P > 0.05). The OR greater than 1 can be determined for four SNPs; rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G) and rs301443 (G/C). The rs1556995 (G/A) (OR = 0.8929) have OR < 1. Chi-square statistic is distributed as a chi-squared result ranging from 0.35 for rs1556995 to 2.967 for rs11081062 (Table 13).

37

Table 13 Results of case-control association test analysis for five SNPs. A1 = minor allele; A2 = major allele; F_A = Frequency of this allele in cases; F_U = Frequency of this allele in controls; OR = odds ratio; CHISQ = chi-square statistic; P = asymptotic P – value. Case-control association analysis showed tendency for significance (P = 0.0850) for genotype rs11081062. Statistical analysis was done via PLINK [Number of probands (n); n (all) = 301, n (OCD cases) = 160, n (controls) = 141].

SNP A1 A2 F_A F_U OR CHISQ P rs1556995 G A 0.2344 0.2553 0.8929 0.3563 0.5506 rs12682807 C A 0.1187 0.0922 1.327 1.112 0.2916 rs301443 G C 0.3281 0.2979 1.151 0.637 0.4248 rs11081062 T C 0.2344 0.1773 1.42 2.967 0.0850 rs11663827 A G 0.2313 0.1773 1.396 2.667 0.1024

3.2.3. Male case-control association analysis

Stratified case-control association test was conducted in which the analysis was stratified to the male case – controls in order to investigate whether the genotypes are gender specific. In the male case-control study the association test were performed in which it was tested whether or not a statistically significant differences in allele frequencies (P <0.05) could be detected for the selected polymorphisms; rs1556995, rs12682807, rs301443, rs11081062, rs11663827 in SLC1A1, DLGAP1, GRIK2 gene between male OCD cases and male controls.

The results of the male case-control association test for each of the five polymorphisms were indicated as statistically significant through P-value (P), chi-square statistic (CHISQ) and odd ratios (OR) with corresponding 95% confidence intervals. The P-value was set to < 0.05, (CHISQ (χ2) ≥ 3.8419) as significant, while 0.1 < P-value > 0.05 as tendency for significance. If OR > 1, minor allele represent risk for developing the disease, while in case of OR < 1, minor allele is protective factor. The results of genotyping in male case – control association test of the five polymorphisms in male OCD patients and male healthy controls are presented in Table 14.

In male case – control association test polymorphism rs12682807 (A/C) demonstrates tendency for significance [OR = 1.841 95% CI (0.2676 - 1.0887), P = 0.08449]. Carrier of minor allele C at rs12682807 (A/C) is not

38 associated with risk of developing OCD (asymptotic P > 0.05). The OR, as in the previous test is greater than 1 for four SNPs; rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G), rs301443 (G/C), while polymorphisms rs1556995 (G/A) (OR = 0.7735) again demonstrates OR < 1. Chi-square statistic is distributed as a chi-squared result ranging from 0.52 for rs1556995 to 2.976 for rs12682807 (Table 14).

Table 14 Results for male case-control association test analysis for five SNPs. A1 = minor allele; A2 = major allele; F_A = Frequency of this allele in cases; F_U = Frequency of this allele in controls; CHISQ = chi-square statistic; OR = odds ratio; P = asymptotic P – value. Male case-control association analysis showed tendency for significance (P = 0.08449) for genotype rs12682807. Statistical analysis was done via PLINK [Number of probands (n); n (all) = 177, n (male OCD cases) = 95, n (male controls) = 82].

SNP A1 A2 F_A F_U OR CHISQ P rs1556995 G A 0.2263 0.2744 0.7735 1.089 0.2967 rs12682807 C A 0.1368 0.07927 1.841 2.976 0.08449 rs301443 G C 0.3474 0.311 1.179 0.5269 0.4679 rs11081062 T C 0.2421 0.2012 1.268 0.8488 0.3569 rs11663827 A G 0.2368 0.2012 1.232 0.6502 0.42

39

3.3. Results of family–based study

In family-based study only OCD cohort (n = 481) were analysed which included patients diagnosed with OCD (n = 160), their parents (n = 304) and siblings (n = 17). The gender distribution (male/female) is 95/65 for OCD patients, 164/140 for the parents, and 6/11 for siblings. Using their genotypes the transmission disequilibrium test (TDT), sib - transmission disequilibrium test (DFAM) and Mendel error test were performed. After performing Mendel error test, three families (9025043, 9025044, 9025072) and one sibling (ZH25032) were excluded as they deviated.

3.3.1. Transmission disequilibrium test (TDT) analysis

In family-based study the TDT was performed whether or not statistically significant differences in allele frequencies (P <0.05) of the five polymorphisms; rs1556995, rs12682807, rs301443, rs11081062, rs11663827 in SLC1A1, DLGAP1, GRIK2 gene between OCD patients and their parents exists.

The TDT analysis indicates whether there is a statistically significant difference through different variables. The results of the TDT for each of the five polymorphisms were indicated as statistically significant through P-value (P) and chi-square statistic (CHISQ) and odd ratios (OR) with corresponding 95% confidence intervals. The P-value was set to < 0.05, (CHISQ (χ2) ≥ 3.8419) as significant, while 0.1 < P-value > 0.05 as tendency for significance. If OR > 1, minor allele represent risk for developing the disease, while in case of OR < 1, minor allele is protective factor. The analysis results of genotyping in TDT of the five polymorphisms in OCD patients and their parents are presented in Table 15.

Polymorphism rs12682807 (A/C) as well as in case-control association test indicates a tendency for significance [OR = 1.632 CI (0.9328 - 2.019), P = 0.0887]. Carrier of minor allele T at rs11081062 (C/T) are not associated with risk of developing OCD (asymptotic P > 0.05). OR greater than 1 could be determined for four SNPs; rs12682807 (A/C), rs11081062 (C/T), rs11663827 40

(A/G) and rs301443 (G/C). In this study the rs1556995 (G/A) also indicates OR < 1 (OR = 0.904). Chi-square statistic is distributed as a chi-squared result ranging from 0.253 for rs1556995 to 2.88 for rs12682807. The results of genotyping TDT of the OCD cohort five polymorphisms are presented in Table 15.

Table 15 Results of transmission disequilibrium test (TDT) analysis for five SNPs. A1 = minor allele; A2 = major allele; OR = odds ratio; L/U95 =lower/upper 95% confidence interval for TDT odds ratio; CHISQ = chi-square statistic; P = asymptotic P – value. TDT analysis showed tendency for significance (P = 0.0887) for genotype rs12682807. Statistical analysis was done via PLINK [Number of probands (n); n (all) = 464, n (OCD cases) = 160, n (parents) = 404].

SNP A1 A2 OR L95 U95 CHISQ P rs1556995 G A 0.904 0.8824 0.9258 0.253 0.6153 rs12682807 C A 1.632 1.576 1.689 2.88 0.0887 rs301443 G C 1.167 1.14 1.194 0.615 0.4328 rs11081062 T C 1.35 1.317 1.384 2.085 0.1487 rs11663827 A G 1.385 1.35 1.42 2.419 0.1198

3.3.2. Sib - transmission disequilibrium test (DFAM) analysis

In the second family based study test, DFAM analysis was tested whether or not a statistically significant differences in allele frequencies (P <0.05) for the selected polymorphisms; rs1556995, rs12682807, rs301443, rs11081062, rs11663827 in SLC1A1, DLGAP1, GRIK2 gene between OCD patients and siblings.

The DFAM analysis indicates whether there is a statistically significant difference through different variables. The results of the DFAM for each of the five polymorphisms were indicated as statistically significant as P-value (P) and chi-square statistic (CHISQ). The P-value was set to < 0.05, (CHISQ (χ2) ≥ 3.8419) as significant, while 0.1 < P-value > 0.05 as tendency for significance. The analysis results of genotyping DFAM of the five polymorphisms in OCD patients and their siblings are presented in Table 16.

Performance of the DFAM statistic is distributed without significant results (P > 0.05) for the all five investigated SNPs. Number of observed minor alleles does show a significant difference from number of expected minor alleles. 41

The expected number of minor alleles ranges between 25.5 and 69 and observed between 31 and 73. Chi-square statistic is distributed as a chi- squared result ranging from 0.36 for rs1556995 2.373 for rs12682807 with an asymptotic P - value ranging between 0.1235 to 0.5485 for the five investigated SNPs. The results of genotyping DFAM test of the OCD cohort five polymorphisms are presented in Table 16.

Table 16 Results of sib - transmission disequilibrium test (DFAM) analysis for five SNPs. A1 = minor allele; A2 = major allele; OBS = number of observed minor alleles; EXP = number of expected minor alleles; CHISQ = chi-square statistic; P = asymptotic P – value. Statistical analysis was done via PLINK [Number of probands (n); n (all) = 177, n (OCD cases) = 160, n (siblings) = 17].

SNP A1 A2 OBS EXP CHISQ P rs1556995 G A 54 57 0.36 0.5485 rs12682807 C A 31 25.5 2.373 0.1235 rs301443 G C 73 69 0.615 0.4328 rs11081062 T C 59 52 2.042 0.153 rs11663827 A G 59 51.5 2.368 0.1238

3.4. Association of SLC1A1, DLGAP1, GRIK2 genes polymorphisms with clinical-pathological features in OCD patients

In these analyses only OCD patients were tested for the association between obtained genotypes and following clinical and pathological features of patients: age of onset and severity of symptoms (measured by the CY- BOCS). Age of onset ranged between 3 and 15 years and severity of symptoms between CY-BOCS = 6 and 38 (maximum score of 40). Incomplete data of OCD samples for age of onset analysis (n = 5) and severity of symptoms analysis (n = 8) were omitted from calculation.

The differences in clinical and pathological features between genotypes group of five selected polymorphisms; rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G), rs301443 (G/C), rs1556995 (G/A) were assessed with one-way analysis of variance (ANOVA) and independent samples T-test using the SPSS software. Independent samples T-test covered two group cases to analyse the differences between group means and clinical and

42 pathological features of patients. One-way ANOVA is used to test for differences among at least three independent groups. Correction for multiple testing was conducted using post-hoc Bonferroni method (P < 0.05).

3.4.1. Severity of symptoms analysis (measured by the CY-BOCS)

3.4.1.1. Analysis of severity of symptoms between the three genotypes using one-way ANOVA test

Separate multiple regression analyses were conducted to investigate the relationship between frequency of the three genotypes group all five polymorphisms and CY-BOCS scores. Assuming that higher average occurrence of obsessive and compulsive behavior’s ratings by CY-BOCS is associated with higher OC symptoms, than it is hypothesized that would predict higher frequency of risk allele or risk genotype. Differences in OCD severity (measured by the CY-BOCS score) between three genotype groups were assessed with one-way ANOVA for comparison.

Analysis of effects of rs11081062 (C/T) genotypes (C/C, C/T, T/T) on the severity of symptoms (according to CY-BOCS) resulted in statistically significant result (P = 0.045). The results of multiple intercommunion comparisons genotype combination divided in groups at rs11081062 (C/T) and the severity of symptoms are presented in Table 17. According to the results, carriers of genotype C/C, which is wild type at rs11081062, show statistically significant associated (P = 0.045) with worsening symptoms of the disease in compared with hetero- form up wild type and minor allele (genotypes T/C). Also, carrier of genotype T/C demonstrated statistically significant (P = 0.045) with worsening symptoms in compared with wild genotype C/C (Table 17).

43

Table 17 Results of the one-way ANOVA analysis between genotype of rs11081062 (C/T) and severity of symptoms measured by the CY-BOCS in the OCD patients. Group 1.at rs11081062 = C/C, T/T, T/C; Group 2.at rs11081062: comparison between C/C - T/T and C/C - T/C; comparison between T/T - C/C and T/T - T/C; comparison between T/C - C/C and T/C - T/T; P = asymptotic P – value. One-way ANOVA showed significant difference (P = 0.045) for rs11081062 compared to C/C and T/C genotype groups (P = 0.045).Statistical analysis was done via one-way ANOVA test with post-hoc Bonferroni method (P < 0.05). Number of probands (n); n = 152.

Group 1. Group 2. Mean difference P-value T/T 3.035 1 C/C T/C 3.338 0.045 C/C -3.035 1 T/T T/C 0.302 1 C/C -3.338 0.045 T/C T/T -0.302 1

Results of statistical analysis via one-way ANOVA test association between three different genotypes groups (C/C, C/T, T/T) at rs11081062 (C/T) and severity of symptoms (measured by the CY-BOCS) presented in a graph (Figure 19). Mean of CY-BOCS score of C/C genotype distribution (n = 86) is 22.53, mean of T/C genotype (n = 60) is around 19.19, whereas the mean of T/T (n = 6) genotype distribution is 19.5.

44

rs11081062 35 P ≤ 0.05 30

25

BOCS] - 20

15

10 Mean severity Mean[CY

5

0 C/C (86) T/T (6) T/C (60) n=152

Figure 19 Distribution of the three genotypes groups against mean severity symptoms measured by the CY-BOCS scores in OCD patients at polymorphisms rs11081062 (C/T). The severity of OC symptoms was represented as average CY-BOCS score of patients in OCD cohort. Error bars represent the standard error of the mean. One-way ANOVA showed significant difference (P = 0.045) compared the genotype groups C/C and T/C. Statistical analysis was done via one-way ANOVA test with post-hoc Bonferroni method (P < 0.05). Number of probands (n); n = 152. In the remaining four polymorphisms; rs12682807 (A/C), rs11663827 (A/G), rs301443 (G/C), rs1556995 (G/A) no effect between genotype distribution and severity of symptoms were found. Results of statistical analysis via one- way ANOVA test association between three genotypic distributions of four polymorphisms and severity of symptoms presented through the graph are presented in Figure 20. Polymorphisms rs12682807 (A/C) show C/C genotype distribution only in one analysis sample.

45

rs12682807 rs11663827 30 25

25 20

BOCS]

BOCS] - 20 - 15 15 10 10 5 5

0 0 Mean severity Mean[CY A/A (119) C/C (1) A/C (32) severity Mean[CY A/A (6) G/G (87) A/G (59) n=152 n=152

rs11556995 rs301443 30 30

25 25

BOCS]

BOCS] - - 20 20 15 15 10 10 5 5

0 0 Meanseverity [CY Mean severity Mean[CY G/G (13) A/A (94) A/G (45) G/G (15) C/C (71) C/G (66) n=152 n=152

Figure 20 Distribution of the three genotypes groups against mean severity symptoms measured by the CY-BOCS scores in OCD patients at the four polymorphisms; rs12682807 (A/C), rs11663827 (A/G), rs1556995 (G/A), rs301443 (G/C). The severity of OC symptoms was represented as average CY-BOCS score of patients in OCD cohort. Error bars represent the standard error of the mean. Statistical analysis was done via one-way ANOVA test with post-hoc Bonferroni method (P < 0.05). Number of probands (n); n = 152.

3.4.1.2. Analysis of severity of symptoms between risk allele and non- risk allele using independent samples T test

Separate regression analyses were conducted to investigate the relationship between frequencies of the two genotypes group all five polymorphisms and CY-BOCS scores. First group represent wild type genotype group, second genotype group is sum of homo- form of minor allele and hetero- form up of minor allele and wild type allele. Assuming that higher average occurrence of obsessive and compulsive behavior’s ratings by CY-BOCS is associated with higher OC symptoms, than it is hypothesized that would predict higher frequency of risk allele or risk genotype. Differences in OCD severity 46

(measured by the CY-BOCS score) between two genotype groups were assessed with independent samples T test for comparison.

Analysis of the effects of genotypes rs11081062 (C/T) (P = 0.013), rs11663827 (A/G) (P = 0.028) and severity of symptoms (according to CY- BOCS) show statistically significant differences in OCD case.

In the first polymorphisms, statistically significant differences at rs11081062 (C/T) was P = 0.013. Independent samples T test use distributed genotypes in two groups in which first group represent genotype C/C, and second group represent samples with T/T and T/C genotypes. Genotypes were divided in such a way that the first tested group is the wild-type genotype (genotype C/C); while the other two genotypes are homo- form of minor allele T (genotype T/T) and hetero- form up of minor and wild type (genotype T/C). Results of statistical analysis via independent samples T test association between two group of genotypic distribution at rs11081062 (C/T) and severity of symptoms (CY-BOCS) presented through the graph (Figure 21).

47

rs11081062

35 P ≤ 0.05

30 BOCS]

- 25 20 15 10

5 Mean severity Mean[CY 0 C/C (86) T/T, C/T (66) n=152

Figure 21 Distribution of the two genotypes groups against mean severity symptoms measured by the CY-BOCS scores in OCD patients at polymorphisms rs11081062 (C/T). The severity of OC symptoms was represented as average CY-BOCS score of patients in OCD cohort. Error bars represent the standard error of the mean. Independent samples T test showed significant difference (P = 0.013) compared the genotype groups C/C and T/T,T/C. Statistical analysis was done via independent samples T test using SPSS software. Number of probands (n); n = 152. Polymorphisms rs11663827 (A/G) showing statistically significant differences where P = 0.028. As in previous rs11081062 (C/T), genotypes distributed at rs11663827 (A/G) was divided in two groups. First group represent genotype G/G (wild type), and second group represent samples with A/A and A/G genotypes. Second group is combination of other two genotypes; homo- form of minor allele A (genotype A/A) and hetero- form of minor and wild type (genotype A/G). Results of statistical analysis via independent samples T test association between two group of genotypic distribution at rs11663827 (A/G) and severity of symptoms (CY-BOCS) presented through the graph (Figure 22).

48

rs11663827

35 P ≤ 0.05

30 BOCS]

- 25 20 15 10

5 Mean severity Mean[CY 0 G/G (87) A/A, A/G (65) n=152

Figure 22 Distribution of the two genotypes groups against mean severity symptoms measured by the CY-BOCS scores in OCD patients at polymorphisms rs11663827 (A/G). The severity of OC symptoms was represented as average CY-BOCS score of patients in OCD cohort. Error bars represent the standard error of the mean. Independent samples T test showed significant difference (P = 0.028) compared the genotype groups G/G and A/A, A/G. Statistical analysis was done via independent samples T test using SPSS software. Number of probands (n); n = 152.

49

3.4.2. Age of onset analysis

3.4.2.1. Analysis of age of onset between the three genotypes using one-way ANOVA test

Separate multiple regression analyses were conducted to investigate the relationship between frequency of the three genotypes group all five polymorphisms and second analysis clinical-pathological variables of symptom change, age of onset. In this thesis it is hypothesized that higher symptoms are connected with early age of onset, which is then predicted than lower mean age of onset in carriers of risk allele i.e. risk genotypes will occur. Differences in age of onset between three genotype groups were assessed with one-way ANOVA test for comparison.

In the second analysis, the clinical pathological data of age of onset were analysis all five polymorphisms; rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G) rs1556995 (G/A), rs301443 (G/C) without significant results at one-way ANOVA test. Results of statistical analysis via one-way ANOVA test association between three genotypic distributions of all five polymorphisms and age of onset presented through the graph are presented in Figure 23. Polymorphisms rs12682807 (A/C) show C/C genotype distribution only in two analysis samples.

50

rs12682807 rs11663827 12 12 10 10 8 8 6 6 4 4 2 2

0 0 Mean age age Meanofonset [year] Mean age age Meanofonset [year] A/A (122) C/C (2) A/C (31) A/A (6) G/G (91) A/G (58) n=155 n=155

rs11556995 rs301443 11,5 14 11 12 10,5 10 8 10 6 9,5 4 9 2

8,5 0 Mean age age Meanofonset [year] Mean age age Meanofonset [year] G/G (13) A/A (97) A/G (45) G/G (16) C/C (72) C/G (67) n=155 n=155

rs11081062 12 11,5 11 10,5 10 9,5 9 8,5

Mean age age Meanofonset [year] C/C (90) T/T (6) T/C (59) n=155

Figure 23 Distribution of the three genotypes groups against age of onset in OCD patients at the all five polymorphisms; rs12682807 (A/C), rs11663827 (A/G), rs11081062 (C/T), rs301443 (G/C), rs1556995 (G/A). The age of onset was represented as average age of onset score of patients in OCD cohort. Error bars represent the standard error of the mean. Statistical analysis was done via one- way ANOVA test with post-hoc Bonferroni method (P < 0.05). Number of probands (n); n = 155.

51

3.4.2.2. Analysis of age of onset between risk allele and non-risk allele using independent samples T test

Separate regression analyses were conducted to investigate the relationship between frequencies of the two genotypes group all five polymorphisms and age of onset. First group represent wild type genotype group, second genotype group is sum of homo- form of minor allele and hetero- form up of minor allele and wild type allele. In this thesis it is hypothesized that higher symptoms are connected with early age of onset, which is then predicted than lower mean age of onset in carriers of risk allele i.e. risk genotypes will occur. Differences in age of onset between two genotype groups were assessed with independent samples T test for comparison.

Analysis of the effects of genotypes rs12682807 (C/A) (P = 0.060), rs11663827 (A/G) (P = 0.053) and age of onset show tendency for significance differences in OCD case.

In the first polymorphisms, tendency for significance at rs12682807 (C/A) was P = 0.060. Independent samples T test use distributed genotypes in two groups in which first group represent genotype A/A, and second group represent samples with C/C and A/C genotypes. Genotypes were divided in such a way that the first tested group is the wild-type genotype (genotype A/A); while the other two genotypes are homo- form of minor allele C (genotype C/C) and hetero- form of minor and wild type (genotype A/C). Results of statistical analysis via independent samples T test association between two groups of genotypic distribution at rs12682807 (C/A) and age of onset presented through the graph (Figure 24).

52

rs12682807 12 10 8 6 4 2 0

Mean age age Meanofonset [years] A/A (122) C/C, A/C (33) n=155

Figure 24 Distribution of the two genotypes groups against mean age of onset in OCD patients at polymorphisms rs12682807 (A/C). The age of onset was represented as average age of onset score of patients in OCD cohort. Error bars represent the standard error of the mean. Independent samples T test showed tendency for significance (P = 0.060) compared the genotype groups A/A and C/C, A/C. Statistical analysis was done via independent samples T test using SPSS software. Number of probands (n); n = 155. Second polymorphisms, rs11663827 (A/G) showing tendency for significance differences where P = 0.053. Genotypes distributed at rs11663827 (A/G) was divided in two groups. First group represent genotype G/G (wild type), and second group represent samples with A/A and A/G genotypes. Second group is combination of other two genotypes; homo- form of minor allele A (genotype A/A) and hetero- form of minor and wild type (genotype A/G). Results of statistical analysis via independent samples T test association between two group of genotypic distribution at rs11663827 (A/G) and age of onset presented through the graph (Figure 25).

53

rs11663827 12 11,5 11 10,5 10 9,5 9 8,5

Mean age age Meanofonset [years] G/G (91) A/A, A/G (64) n=155

Figure 25 Distribution of the two genotypes groups against mean age of onset in OCD patients at polymorphisms rs11663827 (A/G). The age of onset was represented as average age of onset score of patients in OCD cohort. Error bars represent the standard error of the mean. Independent samples T test showed tendency for significance (P = 0.053) compared the genotype groups G/G and A/A, A/G.Statistical analysis was done via independent samples T test using SPSS software. Number of probands (n); n = 155.

54

4. Discussion

In this thesis the association between gene variations to developing early- OCD and clinical-pathological features were explored through separate multiple regression analyses family-based study and case-control study. The aim was to find significant differences (P <0.05) in genotype and allele frequencies with five selected polymorphisms; rs301443 (G/C), rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G) and rs1556995 (G/A) of glutamatergic neurotransmitter systems genes; SLC1A1, DLGAP1 and GRIK2 and OCD. These selected genetic variations have already shown some evidence that they may contribute in the pathophysiology of adult onset OCD, though their role in childhood-onset OCD was not yet explored.

First investigated gene, SLC1A1 two SNPs; rs301443 (G/C), rs12682807 (A/C) in 3'UTR region were analyse while only the SNP rs12682807 (A/C) pointed to an association with OCD.

In the case-control study, when restricted to male case–control the polymorphism rs12682807 (A/C) showed tendency in allele frequency (P = 0.08449) still, since non-significant, carrier of minor allele C at this polymorphism are not associated with risk of developing OCD. Nevertheless, this tendency support previous finding from a meta-analysis of association between OCD and 3'UTR of SLC1A1 gene, where the authors found significant association with rs12682807 in the male samples (P = 0.012) (Stewart, Mayerfeld et al. 2013). However, lack of significant in allele frequency SLC1A1 gene SNPs is not unexpected. Possible reasons can be the small sample sizes (n= 177) in our study, while above mentioned meta- analysis included many more participants (n = 491). The explanation for sex- specific findings is that course of the disorder is more chronic in males (Ravizza, Maina et al. 1997) who are also likely to view experience onset during childhood. On the other hand, males are also likely to present comorbid conditions such as tic disorder or attention-deficit/hyperactivity disorder (Fischer, Himle et al. 1996; Lensi, Cassano et al. 1996).

55

In the family-based study, analysis results from TDT at polymorphism rs12682807 (A/C), as well as in case-control association test indicates tendency (P = 0.0887), where carrier of minor allele C at rs12682807 (A/C) is not associated with risk of developing OCD because asymptotic P > 0.05. Finally, this TDT result of polymorphism rs12682807 complements the research of large family study of OCD by (Nestadt, Samuels et al. 2000) in which they substantiated that SLC1A1 gene is strongly associated with familiarity.

In conclusion, this study shows rs12682807 as promising polymorphism associationed with OCD. While the second polymorphism, rs301443 (G/C) studied did not show association, therefore it does not support previous findings for this specific SNP.

Genotype frequencies of the selected polymorphisms; rs1556995 (G/A) in the GRIK2 gene, was not in HWE in OCD cases and all participants (cases and controls). Furthermore, SNP rs1556995 did not show associated with OCD in any analyses as well as in association with clinical-pathological features. Contributing to that, value of each tested OR of allelic frequency in rs1556995 was OR < 1, which might point that the minor allele G at rs1556995 may be a protective factor against OCD. Thus, the present study did not replicate the finding of previous published family study of association between polymorphisms rs1556995 and OCD (P = 0.0027), where was found that minor allele A which have frequency of 23.8% is over-transmitted in 19 informative trios (investigated 47 trios) and have allele transmission distribution, transmitted to untrasmitted around 20:5 (Sampaio, Fagerness et al. 2011). This one significant publication of GRIK2 SNP rs1556995 may be due to a false positive result because the of the low minor allele frequency (MAF = 0.026), smaller size samples (n = 47 trios) or fact that phenotype and significant SNPs / may not directly related to this SNPs (Sampaio, Fagerness et al. 2011). It is important to notice that GRIK2 gene consists of 18 exons including three different spliced forms, each one coding a different –COOH end of the protein, where rs1556995 is located in the intronic region thereby forces us on speculate of a role individual variant GRIK2 gene in development of OC symptoms (Cai, Zhang et al. 2013). Consequently, our

56 results fits to the analysis in schizophrenia patients where no association between rs1556995 in GRIK2 was found with clozapine-induced OC symptoms (Cai, Zhang et al. 2013).

In conclusion, the present study of rs1556995 (G/A) showed no significance in any of the investigations, whereby does not support a role for common GRIK2 risk variants in OCD aetiology. Thus, further genotyping of additional polymorphisms and extensive sequencing of this gene may be helpful in clarifying its exact potential role of GRIK2 gene.

Third analysed gene DLGAP1, explored two SNPs; rs11081062 (C/T), rs11663827 (A/G) located in the intronic region. The case-control sample results of association allele frequency identified only tendency for rs11081062 (C/T) (P = 0.0850) where carrier of minor allele T at rs11081062 (C/T) are not associated with risk of developing OCD, in spite of OR > 1 (P > 0.05). Although no SNPs were identified statistical significant associated with OCD, this case-control association analysis for rs11081062 (C/T) is complement to the result of trios-case-control study of GWAS in OCD (Stewart, Yu et al. 2013). In this GWAS (Stewart, Yu et al. 2013) SNPs; rs11081062 (C/T) and rs11663827 (A/G) demonstrated very low statistical significance (both with P < 3x10-5) what suggests that these top signals may have a broad role in gene expression in the brain, and possibly role in the aetiology of OCD. Partially explanation way these SNPs have much less P – value in our study might be because of small sample size of OCD cases and especially controls [n (OCD case) = 160, n (controls) = 141)] which is less compared to implemented GWAS [n (OCD case) = 1465, n (controls) = 5557)]. It is important to notice that the GWAS result of DLGAP1 gene may premised on potentially incorrect assumptions genetic architecture, while analyses integrating data or estimates from unrelated case-control individuals and case trios (case offspring and their parents), which is used in this GWAS, can increase statistical power to identify disease susceptibility loci which might associate with such a low statistical significance of P - value (Mirea, Infante-Rivard et al. 2012). But still, DLGAP1 gene read as follows for one of the major candidate genes responsible for OC symptoms, what is confirmed through genetic analysis candidate gene for schizophrenia, disorder which

57 have overlapping symptoms with OCD (Li, Lu et al. 2013). In addition, preliminary study of association glutamate system genes and brain volume alteration in paediatric OCD identified two SNPs in DLGAP2 gene (rs6558484 and rs7014992) suggest that sequence variants of SAPAP family genes (DLGAP 1 to 4) play an important role in trigger of OCD (Wu, Hanna et al. 2013). In support the study of DLGAP3 gene, a third member of the same gene family, also expressed in the neuronal postsynaptic density complex, which has been shown to be implicated in a Sapap3-mutant mice model of OCD (Welch, Lu et al. 2007).

In conclusion, over the course of the study, we found no association between rs11663827 and OCD, while polymorphisms rs11081062 indicated tendency in case-control study, whereby suggest the need for larger individual replicate studies. In family-based study, no SNPs exceeded threshold for significance in none of the performed tests.

In an effort to identify underlying association of clinical-pathological features between genotypes of five selected polymorphisms, this study examined the effect of two process variables on symptom change; age of onset and severity of symptoms.

Analysis of severity of symptoms (CY-BOCS) between the three genotypes using one-way analysis of variance (ANOVA) test resulted with statistically significance only for the polymorphisms rs11081062 (genotypes CC, CT, TT). According to the results, carriers of genotype CC, which is wild type at rs11081062, show statistically significant associated (P = 0.045) with worsening symptoms of the disease in compared with hetero- form up wild type and minor allele (genotypes TC).

Analysis of severity of symptoms between risk allele and non-risk allele at rs11081062 (C/T) using independent samples T test confirms these opposite results, where indicated statistically significant association of wild genotype CC with higher CY-BOCS score in OCD case. This finding was replicated in analysis effects of other genotypes, rs11663827 (A/G) where results showed again opposite statistically significant differences (P = 0.028) between wild

58 genotype and severity of symptoms, i.e. higher expression symptoms, using independent samples T-test.

Assuming that higher average occurrence of obsessive and compulsive behaviours ratings by CY-BOCS is associated with higher OC symptoms, than it is hypothesized that would predict higher frequency of risk allele or risk genotype.

Results showed that mean of CY-BOCS were not statistically different between risk and non-risk genotypes in four investigated SNPs: rs301443 (G/C), rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G) and rs1556995 (G/A). Only rs11081062 (C/T) show opposite results in present study, whereby not supporting the proposed hypothesis.

In conclusion, these conflicting findings do not support the hypothesis. Analysis results suggest the need for much larger samples size that would constitute more credible study. However, the results indicated the importance of potential sub-phenotypic considerations for future genetic studies of OCD because of overlapping symptoms dimensions as a similar described phenotypes exist in different psychiatric illness (Mataix-Cols, Rosario- Campos et al. 2005). Partially explanation also can be the extensiveness of therapist, which is involved in providing the diagnosis according to CY-BOCS and interviews.

Identical analyses were conducted to determine whether second variables, age of onset OCD associated with investigation genetic factor. If we hypothesis that higher symptoms are connected with early age of onset, than it is predicted that lower mean age of onset in carriers of risk allele i.e. risk genotypes will occur.

Results suggested no significant relationship in between the three genotypes using one-way analysis of variance (ANOVA) and mean age of onset. Independent samples T test indicated anticipated tendency in associated risk allele and non-risk allele only in two SNPs; rs12682807 (C/A) (P = 0.060), rs11663827 (A/G) (P = 0.053), while the other three polymorphisms show no significant relationship.

59

In conclusion, this finding could not completely confirm the suggested hypothesis because only two SNPs show tendency. The lack of significant reduction in this age of onset variables, support assumed limit factor mentioned above from previous analysis as for example sample size, extensiveness of therapist etc.

In summary, with this thesis it was attempted to contribute to the knowledge about the importance of certain polymorphisms in glutamatergic neurotransmitter system genes in the triggering of OCD and association with two clinical-pathological variables of symptom change. The largely negative results of this analysis are not unexpected, which might be able to be explained with several limitation of this study. An important limitation is relatively small samples size of OCD and controls cohort in comparison to earlier reported studies. Selection of SNPs for inclusion in this thesis was based on whether a significant association had been reported in previously investigation (Sampaio, Fagerness et al. 2011;Stewart, Mayerfeld et al. 2013; Stewart, Yu et al. 2013). This fact is confirmed by analysis results from only negative test, DFAM where was not indicated any genetic association finding across very small number of siblings (n = 17) and OCD cases (n = 160). Second limitation, heterogeneity of this disorder at both, the genetic and phenotypic level may also have influences to detect an association in this analysis. Genetic heterogeneity given that complex disorder such as OCD is polygenic and not caused by a single genetic risk factor, it would be reasonable to assume that multiple genes especially in the same pathway or having similar functions may interact to influence the risk of developing a disorder (Liu, Zhou et al. 2011). Also, in study performed by Cai et al. (2013) it was hypothesized that SLC1A1 interaction with GRIN2B or GRIK2 gene increase risk for OC symptoms in schizophrenia patients, while the neurobiological interrelation between these genes is not clear. In other hand, combined early-onset OCD cases with adult-onset OCD cases in previously conduced study, might describe positive results as association with different mechanisms between early-onset and adult-onset OCD thus gives us a distorted comparison with our analysis. Also, in study by Stewart et al.[2013]

60 was mentioned potential limitation of this type of study where can be use different analytic method, thus on that way may effect on obtained results.

Finally, although outcome data and above limited facts in several ways, this type of study of association to OCD suggest importance of certain polymorphic forms as possible predictive and prognostic biomarkers of early- onset OCD in future research and clinic.

61

5. Conclusion

In this thesis it was attempted to contribute to the knowledge about the importance of certain polymorphisms in glutamatergic neurotransmitter system genes; SLC1A1, DLGAP1, GRIK2 gene in the triggering of early- onset OCD and association with two clinical-pathological variables of symptom change; age of onset and severity of symptoms (measured by the CY-BOCS). According to the findings, case-control samples in analysis of association allele frequency identified only tendency for rs11081062 (C/T), whereby suggest the need for larger individual replicate studies. In stratified case-controls analysis for gender-specific association, rs12682807 (A/C) report a tendency for significance in male OCD and control cases. Furthermore, in family-based study, rs12682807 (A/C) showing also a tendency for significance associated with familiarity in investigation trios, whereby suggest that further examination of this SNP will be required for more additional investigation to clarify its exact function and confirming potential roles in development of early-onset OCD. Minor allele G at polymorphisms rs1556995 (G/A) demonstrate this SNP as protective factor against OCD, implying that GRIK2 gene may not play a role in OCD aetiology. In an effort to identify underlying association of clinical-pathological features, this study found statistical significant conflict results for polymorphisms rs11081062 (C/T) which connect higher frequency of risk allele T with lower CY-BOCS scores (weaker symptoms). Separate multiple regression analyses for second clinical-pathological variables of symptom change, age of onset indicated tendency for significant differences in OCD case for genotypes rs12682807 (C/A) and rs11663827 (A/G). In summary, result of this study suggests that our samples don’t have statistical significant association between OCD and polymorphisms; rs301443 (G/C), rs12682807 (A/C), rs11081062 (C/T), rs11663827 (A/G), rs1556995 (G/A) neither in family-based study, case-control study nor in association with age of onset and severity of symptoms. Although largely negative, our imputed data suggest that above discussed limitation fact of this type of study may explain lack of association and stresses out the importance of complexity of etiological factor in OCD. 62

6. References

Benyamin, B., P. M. Visscher, et al. (2009). "Family-based genome-wide association studies." Pharmacogenomics 10(2): 181-190. Bloch, M. H. and C. Pittenger (2010). "The Genetics of Obsessive-Compulsive Disorder." Curr Psychiatry Rev 6(2): 91-103. Bush, W. S. and J. H. Moore (2012). "Chapter 11: Genome-wide association studies." PLoS Comput Biol 8(12): e1002822. Cai, J., W. Zhang, et al. (2013). "Influence of polymorphisms in genes SLC1A1, GRIN2B, and GRIK2 on clozapine-induced obsessive-compulsive symptoms." Psychopharmacology (Berl) 230(1): 49-55. Cath, D. C., D. S. van Grootheest, et al. (2008). "Environmental factors in obsessive- compulsive behavior: evidence from discordant and concordant monozygotic twins." Behav Genet 38(2): 108-120. Dickel, D. E., J. Veenstra-VanderWeele, et al. (2006). "Association testing of the positional and functional candidate gene SLC1A1/EAAC1 in early-onset obsessive-compulsive disorder." Arch Gen Psychiatry 63(7): 778-785. Fischer, D. J., J. A. Himle, et al. (1996). "Age and gender effects on obsessive- compulsive symptoms in children and adults." Depress Anxiety 4(5): 237- 239. Foa, E. B., M. J. Kozak, et al. (1995). "DSM-IV field trial: obsessive-compulsive disorder." Am J Psychiatry 152(1): 90-96. Freeman, J., C. A. Flessner, et al. (2011). "The Children's Yale-Brown Obsessive Compulsive Scale: reliability and validity for use among 5 to 8 year olds with obsessive-compulsive disorder." J Abnorm Child Psychol 39(6): 877-883. Freeman, J., A. Garcia, et al. (2012). "The Pediatric Obsessive Compulsive Disorder Treatment Study for Young Children (POTS jr): Developmental Considerations in the Rationale, Design, and Methods." J Obsessive Compuls Relat Disord 1(4): 294-300. Goodman, W. K., L. H. Price, et al. (1989). "The Yale-Brown Obsessive Compulsive Scale. I. Development, use, and reliability." Arch Gen Psychiatry 46(11): 1006-1011. Grados, M. A., M. W. Specht, et al. (2013). "Glutamate drugs and pharmacogenetics of OCD: a pathway-based exploratory approach." Expert Opin Drug Discov 8(12): 1515-1527. Hung, A. Y., C. C. Sung, et al. (2010). "Degradation of postsynaptic scaffold GKAP and regulation of dendritic spine morphology by the TRIM3 ubiquitin ligase in rat hippocampal neurons." PLoS One 5(3): e9842. Katerberg, H., K. L. Delucchi, et al. (2010). "Symptom dimensions in OCD: item-level factor analysis and heritability estimates." Behav Genet 40(4): 505-517. Kendurkar, A. and B. Kaur (2008). "Major depressive disorder, obsessive-compulsive disorder, and generalized anxiety disorder: do the sexual dysfunctions differ?" Prim Care Companion J Clin Psychiatry 10(4): 299-305. Kobak, K. A., J. H. Greist, et al. (1998). "Behavioral versus pharmacological treatments of obsessive compulsive disorder: a meta-analysis." Psychopharmacology (Berl) 136(3): 205-216.

63

Konopac, M., P. Dusatkova, et al. (2011). "SNPman: a program for genotype calling using run data from TaqMan allelic discrimination." Bioinformatics 27(16): 2306-2308. Lensi, P., G. B. Cassano, et al. (1996). "Obsessive-compulsive disorder. Familial- developmental history, symptomatology, comorbidity and course with special reference to gender-related differences." Br J Psychiatry 169(1): 101- 107. Lewin, A. B., E. A. Storch, et al. (2006). "A neuropsychiatric review of pediatric obsessive-compulsive disorder: etiology and efficacious treatments." Neuropsychiatr Dis Treat 2(1): 21-31. Lewis, C. M. (2002). "Genetic association studies: design, analysis and interpretation." Brief Bioinform 3(2): 146-153. Li, J. M., C. L. Lu, et al. (2013). "Genetic analysis of the DLGAP1 gene as a candidate gene for schizophrenia." Psychiatry Res 205(1-2): 13-17. Liu, J., G. Zhou, et al. (2011). "No association of the YWHAE gene with schizophrenia, major depressive disorder or bipolar disorder in the Han Chinese population." Behav Genet 41(4): 557-564. Liu, S., Y. Liu, et al. (2011). "Association of catechol-O-methyl transferase (COMT) gene -287A/G polymorphism with susceptibility to obsessive-compulsive disorder in Chinese Han population." Am J Med Genet B Neuropsychiatr Genet 156B(4): 393-400. Mataix-Cols, D., M. C. Rosario-Campos, et al. (2005). "A multidimensional model of obsessive-compulsive disorder." Am J Psychiatry 162(2): 228-238. Mirea, L., C. Infante-Rivard, et al. (2012). "Strategies for genetic association analyses combining unrelated case-control individuals and family trios." Am J Epidemiol 176(1): 70-79. Nestadt, G., M. Grados, et al. (2010). "Genetics of obsessive-compulsive disorder." Psychiatr Clin North Am 33(1): 141-158. Nestadt, G., J. Samuels, et al. (2000). "A family study of obsessive-compulsive disorder." Arch Gen Psychiatry 57(4): 358-363. Overbeek, T., K. Schruers, et al. (2002). "Comorbidity of obsessive-compulsive disorder and depression: prevalence, symptom severity, and treatment effect." J Clin Psychiatry 63(12): 1106-1112. Pato, M. T., C. N. Pato, et al. (2002). "Recent findings in the genetics of OCD." J Clin Psychiatry 63 Suppl 6: 30-33. Pauls, D. L. (1992). "The genetics of obsessive compulsive disorder and Gilles de la Tourette's syndrome." Psychiatr Clin North Am 15(4): 759-766. Pittenger, C., M. H. Bloch, et al. (2011). "Glutamate abnormalities in obsessive compulsive disorder: neurobiology, pathophysiology, and treatment." Pharmacol Ther 132(3): 314-332. Ravizza, L., G. Maina, et al. (1997). "Episodic and chronic obsessive-compulsive disorder." Depress Anxiety 6(4): 154-158. Rose, J. E., F. M. Behm, et al. (2010). "Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score." Mol Med 16(7-8): 247-253. Rosenberg, D. R., F. P. MacMaster, et al. (2000). "Decrease in caudate glutamatergic concentrations in pediatric obsessive-compulsive disorder patients taking paroxetine." J Am Acad Child Adolesc Psychiatry 39(9): 1096-1103. 64

Ross, J., J. Badner, et al. (2011). "Genomewide linkage analysis in Costa Rican families implicates chromosome 15q14 as a candidate region for OCD." Hum Genet 130(6): 795-805. Sampaio, A. S., J. Fagerness, et al. (2011). "Association between polymorphisms in GRIK2 gene and obsessive-compulsive disorder: a family-based study." CNS Neurosci Ther 17(3): 141-147. Samuels, J., Y. Wang, et al. (2011). "Comprehensive family-based association study of the glutamate transporter gene SLC1A1 in obsessive-compulsive disorder." Am J Med Genet B Neuropsychiatr Genet 156B(4): 472-477. Stein, D. J., N. A. Fineberg, et al. (2010). "Should OCD be classified as an anxiety disorder in DSM-V?" Depress Anxiety 27(6): 495-506. Steinhausen, H. C., C. Bisgaard, et al. (2013). "Family aggregation and risk factors of obsessive-compulsive disorders in a nationwide three-generation study." Depress Anxiety 30(12): 1177-1184. Stewart, S. E., J. A. Fagerness, et al. (2007). "Association of the SLC1A1 glutamate transporter gene and obsessive-compulsive disorder." Am J Med Genet B Neuropsychiatr Genet 144B(8): 1027-1033. Stewart, S. E., C. Mayerfeld, et al. (2013). "Meta-analysis of association between obsessive-compulsive disorder and the 3' region of neuronal glutamate transporter gene SLC1A1." Am J Med Genet B Neuropsychiatr Genet 162B(4): 367-379. Stewart, S. E., D. Yu, et al. (2013). "Genome-wide association study of obsessive- compulsive disorder." Mol Psychiatry 18(7): 788-798. Ting, J. T. and G. Feng (2008). "Glutamatergic Synaptic Dysfunction and Obsessive- Compulsive Disorder." Curr Chem Genomics 2: 62-75. Walitza, S., S. Melfsen, et al. (2011). "Obsessive-compulsive disorder in children and adolescents." Dtsch Arztebl Int 108(11): 173-179. Walitza, S., J. R. Wendland, et al. (2010). "Genetics of early-onset obsessive- compulsive disorder." Eur Child Adolesc Psychiatry 19(3): 227-235. Welch, J. M., J. Lu, et al. (2007). "Cortico-striatal synaptic defects and OCD-like behaviours in Sapap3-mutant mice." Nature 448(7156): 894-900. Westenberg, H. G., N. A. Fineberg, et al. (2007). "Neurobiology of obsessive- compulsive disorder: serotonin and beyond." CNS Spectr 12(2 Suppl 3): 14- 27. Wu, K., G. L. Hanna, et al. (2013). "Glutamate system genes and brain volume alterations in pediatric obsessive-compulsive disorder: a preliminary study." Psychiatry Res 211(3): 214-220.

65