Virus Reviews and Research Journal of the Brazilian Society for Virology
Volume 20, October 2015, Supplement 1 Annals of the XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil Editors Edson Elias da Silva Fernando Rosado Spilki
BRAZILIAN SOCIETY FOR VIROLOGY BOARD OF DIRECTORS (2015-2016)
Officers Area Representatives
President: Dr. Bergmann Morais Ribeiro Basic Virology (BV) Vice-President: Dr. Célia Regina Monte Barardi Dr. Luciana Jesus da Costa, UFRJ (2015 – 2016) First Secretary: Dr. Fernando Rosado Spilki Dr. Luis Lamberti Pinto da Silva, USP-RP (2015 – 2016) Second Secretary: Dr. Mauricio Lacerda Nogueira First Treasurer: Dr. Alice Kazuko Inoue Nagata Environmental Virology (EV) Second Treasurer: Dr. Zélia Inês Portela Lobato Dr. Adriana de Abreu Correa, UFF (2015 – 2016) Executive Secretary: Dr Fabrício Souza Campos Dr. Jônatas Santos Abrahão, UFMG (2015 – 2016
Human Virology (HV) Fiscal Councilors Dr. Eurico de Arruda Neto, USP-RP (2015 – 2016) Dr. Viviane Fongaro Botosso Dr. Paula Rahal, UNESP (2015 – 2016) Dr. Davis Fernandes Ferreira Dr. Maria Ângela Orsi Immunobiologicals in Virology (IV) Dr. Flávio Guimarães da Fonseca, UFMG (2015 – 2016) Dr. Jenner Karlisson Pimenta dos Reis, UFMG (2015 – 2016)
Plant and Invertebrate Virology (PIV) Dr. Maite Vaslin De Freitas Silva, UFRJ (2015 – 2016) Dr. Tatsuya Nagata, UNB (2015 – 2016)
Veterinary Virology (VV) Dr. João Pessoa Araújo Junior, UNESP (2015 – 2016) Dr. Marcos Bryan Heinemann, USP (2015 – 2016)
Address Universidade Feevale, Instituto de Ciências da Saúde Estrada RS-239, 2755 - Prédio Vermelho, sala 205 - Laboratório de Microbiologia Molecular Bairro Vila Nova - 93352-000 - Novo Hamburgo, RS - Brasil Phone: (51) 3586-8800 E-mail: F.R.Spilki - [email protected] http://www.vrrjournal.org.br Organizing Committee Dr. Adriana de Abreu Correa, UFF Dr. Aguinaldo Roberto Pinto, UFSC Dr. Alice Kazuko Inoue Nagata, EMBRAPA Dr. Bergmann Morais Ribeiro, UNB - President of SBV Dr. Carlos Roberto Zanetti, UFSC Dr. Célia Regina Monte Barardi, UFSC – President of XXVI CBV Dr. Clarice Weis Arns, UNICAMP Dr. Cláudia Maria Oliveira Simões, UFSC Dr. Daniel Santos Mansur, UFSC Dr. Davis Fernandes Ferreira, UFRJ Dr. Eurico de Arruda Neto, USP Dr. Fernando Rosado Spilki, FEEVALE Dr. Flávio Guimarães da Fonseca, UFMG Dr. Jenner Karlisson Pimenta dos Reis, UFMG Dr. João Pessoa Araújo Junior, UNESP Dr. Jônatas Santos Abrahão, UFMG Dr. Luciana Jesus da Costa, UFRJ Dr. Luis Lamberti Pinto da Silva, USP Dr. Maite Vaslin de Freitas Silva, UNB Dr. Marcos Bryan Heinemann, USP Dr. Maria Ângela Orsi, LANAGRO Dr. Mauricio Lacerda Nogueira, FAMERP Dr. Paula Rahal, UNESP Dr. Tatsuya Nagata, UNB Dr. Viviane Fongaro Botosso, BUTANTAN Dr. Zélia Inês Portela Lobato, UFMG
Hélio Gelli Pereira Award Committee Fernando Spilki - President Davis Fernandes Ferreira Aguinaldo R. Pinto Luciana Barros de Arruda
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 Financial Support General Information
CAPES Secretary Office Hours Coordenação de Aperfeiçoamento de Pessoal de Nível Superior October, 11 th - 3:00 p.m. - 8:30 p.m. CNPQ October, 12 th - 8:30 a.m. - 8:30 p.m. October, 13 th - 8:00 a.m. - 8:00 p.m. Tecnológico October, 14 th - 8:00 a.m. - 1:00 p.m. FAPESCConselho Nacional de Desenvolvimento Cientifico e Fundação de Amparo à Pesquisa do Estado de Santa Catarina Name Badge FAPESP Name Badges will be required for access in all activities, Fundação de Amparo à Pesquisa do Estado de São Paulo including lunch.
Exhibitors Media Desk (for lecturers only) QIAGEN The media desk will be openned as scheduled for the SARSTEDT BIOCLIN be delivered at the media desk at least 2 hours before the SÍNTESE BIOTECNOLOGIA scheduledsecretary of time the formeeting. the presentation. Data - files with Please presentations note that personal - must computers will not be allowed in lectures. Presentations will be copied and made available to members of SBV after the Sponsors meeting at the institutional homepage unless not authorized Silver Sponsorship - Lobov and Roche by the speakers. Bronze Sponsorship - Bio-Rad, Biovet, Greiner Bio-One and Sigma-Aldrich Certificates
Organizers meeting.Certificates of attendance will be available on line at http:// Office Marketing Eventos www.sbv.org.br/congresso 15 days after the end of the Travel Agency
have an exclusive desk at the venue, offering some tours. The official agency America do Sol Turismo e Eventos will Poster Presentations The posters must be exposed from 8:30 a.m. until the end of the session, and then removed.
POSTER SESSION 1: MONDAY – 12 OCTOBER, 6:00 - 7:30 P.M. Human Virology Immunobiologicals in Virology • Plant and Invertebrate Virology • POSTER• SESSION 2: TUESDAY- 13 OCTOBER, 6:00 – 7:30 P.M. Basic Virology Environmental Virology • Veterinary Virology • •
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 XXVI Brazilian Congress of Virology Scientific Program
TIME ACTIVITY São Miguel Room Round Table 1 - Biotechnological applications 1. Sergio Moraes Aoki, DNAPTA Biotecnologia Ltda, São Paulo, SP, Brazil – Sensor to detect dengue virus 2. Rosa Amalia Fireman Dutra, Universidade Federal de Pernambuco, Recife, Pernambuco, Brazil – Nanobiosensors based on carbon allotropes for health applications 3. João Pessoa Araujo Junior, UNESP Botucatu, SP, Brazil – News methods to diagnosis of canine distemper virus – (Chair) Ilha das Flores Room Round Table 2 - Publication Policies in Virology 1. Benjamin Johnson, Biomed Central, Londres, UK – Virology Journal 2. Adeilton Alves Brandão, Fiocruz, Rio de Janeiro, RJ, Brazil – Memorias IOC 3. Maurício Lacerda Nogueira, FAMERP, São José do Rio Preto, SP, Brazil – Brazilian Journal of Microbiology 4. Fernando Rosado Spilki, Novo Hamburgo, RS, Brazil – Virus Reviews and Research – (Chair) 4:30 – 6:00 P.M. Ilha do Pico Room Round Table 3 - Wild Animal Virus 1. Nelson Rodrigo da Silva Martins viruses in Brazilian wild birds 2. Edison Durigon , UFMG, Belo Horizonte, MG, Brazil – Identification of 3. Daniel Ferreira de Lima Neto, UNICAMP, Campinas, SP, Brazil – Diversity of viruses in bats from the urban area of, USP,Campinas-SP São Paulo, Brazil SP, Brazil using – metagenomic Influenza in migratory analyses birds
Sunday, October 11 October Sunday, 4. Helena Lage Ferreira, USP, Pirassununga, SP, Brazil – Newcastle disease virus in wild birds
– (Chair) Ilha Faial Room Round Table 4 - New Wave of Plant Virology 1. Gaus Silvestre de Andrade Lima, Universidade Federal de Alagoas, Maceió, AL, Brazil – Characterization, diversity and genetic structure of Badnavirus in tropical crops 2. Juliana Freitas-Astua, Embrapa-APTA, Cruz das Almas, BA, Brazil – Cross talk between signaling pathways in response to leprosis 3. Claudine Marcia Carvalho, UFV, Viçosa, MG, Brazil – Cowpea mild mottle virus 4. Alice Kazuko Inoue Nagata, EMBRAPA Hortaliças, Brasília, DF, Brazil – (Chair) São Miguel Room Opening Ceremony - CONFERENCE 1 7:00 - 9:00 P.M. 1. Donald Pinkston Francis, Global Solutions for Infectious Diseases, San Francisco, CA, USA – 30 Years of HIV 2. Célia Regina Monte Barardi, UFSC, Florianópolis, Santa Catarina, Brazil – (Chair) Vila do Porto 9:00 - 10:00 P.M. Cocktail recepcion and Visit to Exhibits
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 TIME ACTIVITY São Miguel Room CONFERENCE 2 9:00 - 10:00 A.M. 1. Elizabeth Fontes, Universidade Federal de Viçosa, Viçosa, MG, Brazil – NIK1-Mediated Translation Suppression Functions as a Plant Antiviral Immunity Mechanism 2. Alice Kazuko Inoue Nagata, EMBRAPA Hortaliças, Brasília, DF, Brazil – (Chair) Vila do Porto 10:00 - 10:30 A.M. Coffee break and Visit to Exhibits São Miguel Room Round Table 5 - Viral persistence 1. Udeni Balasuriya, University of Kentucky, Lexington, KY, USA – Persistent Infection of Arteriviruses: Association of Equine CXCL16 Gene Variants with Establishment of Equine Arteritis Virus Carrier State in Stallions 2. Lindomar José Pena, FIOCRUZ, Recife, PE, Brazil – Cutting-edge approaches toward novel foot- and-mouth disease vaccines 3. Cláudio Wageck Canal, UFRGS, Porto Alegre, RS, Brazil – Genetic diversity and bovine pestivirus persistant infections – (Chair) Ilha do Pico Room Round Table 6 - Virus-cell interaction 1. José Luiz Proença Módena, UNICAMP, Campinas, SP, Brazil – Restriction of Orthobunyavirus by Type I Interferon Signaling Pathways 10:30 - 12:00 A.M. 2. Juliano Bordignon lymphocytes to dengue virus infection 3. Enrique Mario Boccardo, ICC/Fiocruz, Pierulivo Paraná,, USP, São PR, Paulo, Brazil SP, – Susceptibility Brazil – HPV: anda major response cause ofof human cancers. Do they have an Achilles heel? – (Chair) Ilha das Flores Room Round Table 7 - Plant Virus-Host Interaction 1. Antonia dos Reis Figueira, UFLA, Lavras, MG, Brazil – Interaction and Subcellular localization of Coffee ringspot virus (CoRSV) proteins 2. Richard Kormelink, Wageningen University, Wageningen Netherlands – Virus-host and virus- vector interactions 3. Miguel Aranda Rugles elements regulating host range and cap-independent translation of plant virus mRNAs Monday, October 12 October Monday, 4. Tatsuya Nagata, University, Consejo of Brasília, Superior Brasília, de Investigaciones DF, Brazil – (Chair) Científicas, Murcia, Spain – HRNA Ilha da Flores Room Mini-course 1 Antônio Augusto Fonseca Júnior, Laboratório Nacional Agropecuário de Minas Gerais, Belo Horizonte, MG, Brazil – Viral phylogeny and sequence analysis Ilha• Faial Room Mini-course 3 12:00 - 1:00 P.M. Luciano Kleber de Souza Luna, USP, São Paulo, SP, Brazil and Roberta Vieira de Morais Bronzoni, UFMT, Cuiabá, MT, Brazil – Molecular diagnosis of viruses and performance validation Ilha• do Pico Room Mini-course 4 Fernando Lucas Melo, UNB, Brasília, DF, Brazil – Next generation sequencing technologies for viral metagenomic analyses • 12:00 - 2:00 P.M. Lunch break São Miguel Room SESSION 1 – Human Virology Luis Lamberti e Luciana Jesus da Costa – (Chairs) 18 - GENETIC AND GEOGRAPHICAL ANALYSIS OF ZIKA VIRUS (ZIKV) ISOLATED FROM AN • 2:00 - 3:30 P.M. AUTOCHNOUS CASE IN SÃO PAULO STATE, BRAZIL, 2015 Oral presentations Cunha, M.S.; Pereira, R.S.; Maeda, A.Y.; Silva, F.G.; Rocco, Y.M.; Angerami, R.N.; Pereira, F.C.; Santos, C.S.; Sessions 1 to 4 Nogueira, J.S.; Katz, G.; Macedo, F.L.L.; Oliveira, A.L.R.; Suzuki, A. 82 - MIMIVIRUS IN HOSPITAL ENVIRONMENT: ASSESSMENT OF DISTRIBUTION AND BIOLOGICAL, MOLECULAR AND STRUCTURAL DIVERSITY OF VIRAL ISOLATED Silva, L.K.S.; Rodrigues, R.A.L.; Arantes, T.S.; Silva, L.C.F.; Boratto, P.V.M.; Kroon, E.G.; Clemente, W.T.; Abrahão, J.S.
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 TIME ACTIVITY 132 - BIOLOGICAL CHARACTERIZATION OF TWO DENV-1 LINEAGES CO-CIRCULATING IN SÃO JOSÉ DO RIO PRETO, SP, BRAZIL Nogueira, M.L.; Pinheiro, T.M.; Watanabe, A.S.A.; Biselli-Périco, J.M.; Ribeiro, M.R.; Chaves, B.A.; Pimenta, P.F.P.; Batista, I.C.A.; Calzavara-Silva, C.E.; Vedovello, D. 242 - HIV-1 GENETIC DIVERSITY AND DRUG RESISTANCE MUTATIONS AMONG PATIENTS FAILING COMBINED ANTIRETROVIRAL THERAPY IN RIO DE JANEIRO, BRAZIL Marques, B.C.L.; Silva-de-Jesus, C.; Francini, M.; Francisco, R.B.L.; Rachid-de-Lacerda, M.C.; Veloso, V.; Morgado, M.G.; Couto-Fernandez, J.C. 406 - SEROPREVALENCE OF SAINT LOUIS ENCEPHALITIS VIRUS AMONG HUMANS AND HORSES FROM MINAS GERAIS, BRAZIL Costa, G.B.; Marinho, P.E.S.; Vilela, A.P.P.; Crispim, A.P.C.; Saraiva-Silva, A.T.; Ferreira, P.C.P.; Nogueira, M.L.; Kroon, E.G.; Trindade, G.S. Ilha Faial Room SESSION 2 – Plant and Invertebrate Maite Vaslin e Flávio Guimarães da Fonseca – (Chairs) 28 - MIXED INFECTIONS AFFECT THE EVOLUTIONARY DYNAMICS OF PEPINO MOSAIC VIRUS, AN EMERGING• RNA PLANT VIRUS Gómez, P.; Juárez, M.; Sánchez-Pina, M.A.; García-Villalba, J.M.; Alcaide, C.; Aranda, M.A. 191 - THE BETABACULOVIRUS-DERIVED GP64 HOMOLOG IS A FUNCTIONAL ENVELOPE FUSION PROTEIN Daniel, M.P.Ardisson-Araújo; Rollie, J.Clem; Fernando, L.Melo; José, L.C.Wolff; Bergmann, M.Ribeiro 196 - THE SW-5 GENE CLUSTER: ANALYSIS OF TOMATO RESISTANCE AGAINST TOSPOVIRUSES De Oliveira, A.S.; Kormelink, R.; Resende, R.O. 246 - DISCOVERY OF POTENTIAL ENTOMOPATHOGENIC RNA VIRUSES IN THE WHITEFLY (BEMISIA TABACI) USING NEXT GENERATION SEQUENCING Nakasu, E.Y.T.; Melo, F.L.; Nagata, T.; Michereff Filho, M.; Souza, J.O.; Ribeiro, B.M.; Ribeiro, S.G.; Lacorte, C.; Pereira, J.L.; Inoue-Nagata, A.K. 273 - BIOLOGICAL AND MOLECULAR CHARACTERIZATION OF TWO OLD-WORLD-LIKE BEGOMOVIRUSES 2:00 - 3:30 P.M. INFECTING THE NON-CULTIVATED PLANT SIDA ACUTA IN BRAZIL Oral presentations Xavier, C.A.D.; Godinho, M.T.; Trindade, A.T.; Lima, A.T.M.; Silva, J.P.; Zerbini, F.M. Sessions 1 to 4 Ilha do Pico Room SESSION 3 – Veterinary Virology
Monday, October 12 October Monday, Zélia Lobato e Clarice Arns – (Chairs) 99 - INFECTIONS AND COINFECTIONS BY RESPIRATORY VIRUSES IN SHELTER DOGS, RS, BRAZIL Monteiro,• F.L.; Cargnelutti, J.F.; Martins, M.; Anziliero, D.; Erhardt, M.M.; Weiblen, R.; Flores, E.F. 109 - IMMUNOGENICITY AND EFFICACY ASSESSMENT OF AN INACTIVATED RABIES-BASED CANINE DISTEMPER VACCINE Budaszewski, R.F.; Canal, C.W.; Schnell, M.J.; von Messling, V. 351 - FIRST REPORT OF SENECAVIRUS A IN PIGS OF DIFFERENT AGES WITH VESICULAR DISEASE IN BRAZIL Leme, R.A.; Diniz, J.A.; Alcântara, B.K.; Possati, F.; Molinari, B.L.D.; Lorenzetti, E.; Favero, L.M.; Oliveira, M. V.;
355 - DETECTION AND CHARACTERIZATION OF INFLUENZA A VIRUS ENDEMIC CIRCULATION IN SUCKLING ANDAlfieri, NURSERY A.F.; Alfieri, PIGS A.A. IN COMMERCIAL FARMS USING INFLUENZA VACCINE Dias, A.S.; Gauger, P.C.; Vincent, A.L.; Kitikoon, P.; Baker, R.B.; Zhang, J. 369 - GENETIC HETEROGENEITY OF THE VP6 GENE AND PREDOMINANCE OF G6P[5] GENOTYPES IN BRAZILIAN FIELD STRAINS OF PORCINE ROTAVIRUS C Possatti, F.; Lorenzetti, E.; Molinari, B.L.D.; Leme, R.A.; Massi, R.P.; Otonel, R.A.A.; 427 - CIRCULATION OF ALPHA- AND BETACORONAVIRUS SUBGROUP C IN BATS FROM BRAZILIAN’S URBAN AND ATLANTIC FOREST BIOME Alfieri, A.A.; Alfieri, A.F. Góes, L.G.B.; Campos, A.C.A.; Ceara, C.C.; Ambar, G.; Souza, M.C.P.; Crispin, L.A.C.; Neto, A.P.C.; Queiroz, L.; Durigon, E.L. Ilha das Flores Room SESSION 4 – Environmental Virology Jonatas Abrahão e Fernando Rosado Spilki – (Chairs) 92 - PAN-GENOME ANALYSIS OF BRAZILIAN LINEAGE A AMOEBAL MIMIVIRUSES Assis,• F.L.; Bajrai, L.; Abrahao, J.S.; Kroon, E.G.; Dornas, F.P.; Andrade, K.R.; Borato, P.V.M.; Pilotto, M.R.; Robert, C.; Benamar, S.; La Scola, B.; Colson, P.
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 TIME ACTIVITY 102 - DETECTION OF COMMON, EMERGING AND UNCOMMON VP4 AND VP7 HUMAN GROUP A ROTAVIRUS GENOTYPES FROM URBAN SEWAGE SAMPLES IN URUGUAY Tort, L.F.L.; Victoria, M.; Lizasoain, A.; Berois, M.; Cristina, J.; Leite, J.P.G.; Gómez, M.M.; Miagostovich, M.P.; Colina, R. 180 - PRESENCE OF ADENOVIRUS AND CORRELATION WITH PHYSICO-CHEMICAL AND BACTERIOLOGICAL 2:00 - 3:30 P.M. PARAMETERS IN ARROIO PINHAL CAXIAS DO SUL MUNICIPALITY (BRAZIL) Oral presentations Goulart, N.; Hahn, R.C.; Girardi, V.; Magrini, F.E.; Bortolin, T.A.; Schneider, V.E.; Paesi, S. Sessions 1 to 4 341 - ACQUISITION, STABILITY AND INACTIVATION OF ENTERIC VIRUSES IN OYSTERS CRASSOSTREA GIGAS Pilotto, M.R.; Souza, D.S.M.; Dominot, A.F.A.; Barardi, C.R.M. 409 - GOLDEN MARSEILLEVIRUS-LIKE: A NEW AMOEBAL GIANT VIRUS Santos, R.N.; Campos, F.S.; Albuquerque, N.R.M.; Ortiz, L.C.; Arantes, T.S.; Assis, F.L.; Abrahão, J.; Roehe, P.M.; Franco, A.C. Vila do Porto 3:30 - 4:00 P.M. Coffee break and Visit to Exhibits São Miguel Room CONFERENCE 3 4:00 - 5:00 P.M. 1. Douglas Grant McFadden, University of Florida, Florida, USA – The Curious Road from Poxvirus Tropism to Oncolytic222 Virotherapy 2. Claudio Antonio Bonjardim, UFMG, Brazil – (Chair) Monday, October 12 October Monday, Ilha das Flores Room 5:00 - 5:30 P.M. Technical Session Roche Felipe Braga, Virology lab developed tests - How to guarantee the quality of the process São Miguel Room Round• Table 8 (Mini Conference) - Eradication and prophylaxis of preventable viral diseases 1. Alexandre Linhares, Instituto Evandro Chagas, Belém, PA, Brazil – Sustained Decrease in 5:00 - 6:00 P.M. Gastroenteritis-related Deaths and Hospitalizations After the Introduction of Rotavirus Vaccination in Brazil 2. Edison Luiz Durigon, USP, São Paulo, SP, Brazil – (Chair) Vila do Porto Poster Session 1 - Praça de Exposição and Visit to Exhibits 6:00 - 7:30 P.M. Human Virology Immunobiologicals in Virology • Plant and Invertebrate Virology • TIME • ACTIVITY São Miguel Room CONFERENCE 4 9:00 - 10:0 A.M. 1. Jônatas Santos Abrahão, UFMG, Brazil – An Ancient Relationship: Giant Viruses and Acanthamoeba Interactions 2. Célia Regina Monte Barardi, UFSC, Florianópolis, Santa Catarina, Brazil – (Chair) Praça de Exposição 10:00 - 10:30 A.M. Coffee break and Visit to Exhibits Ilha das Flores Room Round Table 9 - Invertebrate, fungi and amoeba infecting viruses 1. Maria Carla Saleh, Institute Pauster, Paris, France – Of insects and viruses: the role of small RNAs in insect defence 2. Massimo Turina, Institute of Plant Virology, National Research Council, Roma, Italy – Micovirus 3. Bergmann Morais Ribeiro, UNB, Brasília, DF, Brazil – (Chair) Ilha do Pico Room
Tuesday, October 13 October Tuesday, 10:30 - 12:00 A.M. Round Table 10 - Emerging virus in the environmental and risk assessment 1. Albert Bosch, University of Barcelona, Barcelona, Spain – Enteric Viruses 2. Rosa M. Pintó Solé, University of Barcelona, Barcelona, Spain – Molecular basis of hepatitis A virus stability in the environment 3. Carmen Baur Vieira, FIOCRUZ, Rio de Janeiro, RJ, Brazil – Risk Assessment of Viral Infections Due to Water Exposures 4. Caroline Rigotto, FEEVALE, Novo Hamburgo, RS, Brazil – Microbial versus Chemical parameters in water quality: is there a relationship? 5. Adriana de Abreu Corrêa, UFF, Rio de Janeiro, RJ, Brazil – (Chair) XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 TIME ACTIVITY Ilha Terceira Room Round Table 11 - Emerging and reemerging viral diseases 1. Rejane Schaefer interface 2. Maria Isabel Maldonado, EMBRAPA, Coelho Concórdia, Guedes SC,, UFMG, Brazil Belo– Influenza Horizonte, A virus MG, in Brazil swine – Vacciniaand the human-swinevirus: update on its epidemiology and pathogenesis 3. Ana Carolina Diniz Matos, UFMG, Belo Horizonte, MG, Brazil – Bluetongue in Brazil: insights into a hidden disease and an unexplored virus 4. Zélia Inês Portela Lobato, UFMG, Belo Horizonte, MG, Brazil – (Chair) São Miguel Room Round Table 12 - Vaccine 1. Arturo Reyes-Sandoval, University of Oxford, Oxford, UK – Viral vector platforms for the development of malaria vaccines 2. Lindomar José Pena vaccines 10:30 - 12:00 A.M. 3. Flávio Guimarães Fonseca, FIOCRUZ,, UFMG, Recife, Belo PE, Horizonte, Brazil – Genome MG, Brazil shuffling – Dengue as a Vaccine:novel strategy Looking for Out influenza of the Box – (Chair) Ilha da Flores Room Mini-course 1 Antônio Augusto Fonseca Júnior, Laboratório Nacional Agropecuário de Minas Gerais, Belo Horizonte, MG, Brazil – Viral phylogeny and sequence analysis Ilha• Faial Room Mini-course 3 Luciano Kleber de Souza Luna, USP, São Paulo, SP, Brazil and Roberta Vieira de Morais Bronzoni, UFMT, Cuiabá, MT, Brazil – Molecular diagnosis of viruses and performance validation Ilha• do Pico Room Mini-course 4 Fernando Lucas Melo, UNB, Brasília, DF, Brazil – Next generation sequencing technologies for viral metagenomic analyses 10:30 - 12:00 A.M. Lunch• break São Miguel Room
Tuesday, October 13 October Tuesday, SESSION 5 – Basic Virology Davis Fernandes Ferreira e Luciana Jesus da Costa – (Chairs) 206 THE MECHANISM OF CD4 DOWNREGULATION BY HIV-1 NEF REVEALS DISTINCT ROLES FOR γ1 and γ2 ADAPTINS• IN INTRACELLULAR TRAFFICKING Tavares, L.A.; da Silva, E.M.; Carvalho, J.V.; Dasilva, L.L. 234 HIGH MOBILITY GROUP BOX 1 (HMGB1) IS IMPORTANT FOR HUMAN PAPILLOMAVIRUS- TRANSFORMED CELLS SURVIVAL Silva, A.M.; Montenegro, A.; Abjaude, W. da S.; Morale, G.M.; Lino, V. de S.; Boccardo, E. 280 BOVINE LACTOFERRIN INHIBITS HUMAM RHINOVIRUS 14 INFECTION Denani, C.B.; Santos, R.A.; Hohn, A.R.; Carvalho, C.A.M.; Rocha, V.P.; Silva, J.L.; Oliveira, A.C.; Gomes, A.M.O.; Gonçalves, R.B. 2:00 - 3:30 P.M. 283 MINIGENOME ACTIVITY WITHIN THE BUNYAVIRUS SIMBU SEROGROUP AND IMPLICATIONS FOR Oral presentations GENOME REASSORTMENT Sessions 5 to 8 Acrani, G.O.; Tilston-Lunel, N.L.; Elliott, R.M. 370 IDENTIFICATION OF MICRORNAS AND CELLULAR FACTORS MODULATED BY OROPOUCHE INFECTION Geddes, V.E.V.; Ribeiro-Alves, M.; Arruda, E.; Aguiar, R.S. 381 MULTIPLE EFFECTS OF TOXINS ISOLATED FROM CROTALUS DURISSUS TERRIFICUS ON HEPATITIS C LIFE CYCLE Shimizu, J.F.; Batista, M.N.; Campos, G.R.F.; Bittar, C.; Cintra, A.C.O.; Sampaio, S.V.; Aquino, V.H.; Rahal, P.; Jardim, A.C.G. 432 MAYARO VIRUS REPLICATION IN PRIMARY HUMAN MYOBLASTS AND MICE MUSCLE IN VIVO: IMPLICATIONS IN THE PATHOGENESIS OF MYALGIA AND MYOSISTIS INDUCED BY ALPHAVIRUS Figueiredo, C.M.; Neris, R.L.; Ladislau, L.; Benjamim, C.F.; Assunção-Miranda, I. Ilha Terceira Room SESSION 6 – Human Virology Viviane Fongaro Botosso e Daniel Santos Mansur – (Chairs)
•
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 TIME ACTIVITY 197 MIMIVIRUS: GENOME AND NEUTRALIZATION ANTIBODIES DETECTION IN RURAL BRAZILIAN HUMANS Dornas, F.P.; Costa, G.B.; Silva, L.C.F.; Boratto, P.V.M.; Kroon, E.G.; Scola, B.; Trindade, G.; Abrahao, J.S. 204 IN SILICO DIVERSITY ANALYSIS OF HUMAN ENDOGENOUS RETROVIRUS W TRANSCRIPTS REVEALS DISTINCT PATTERNS OF EXPRESSION IN BLOOD AND BRAIN SAMPLES OF MULTIPLE SCLEROSIS PATIENTS Nali, L.H.S.; Urbano, P.R.P.; Olival, G.S.; Silva, D.F.; Penalva de Oliveira, A.C.; Romano, C.M. 248 HUMAN RHINOVIRUS REPLICATION IN LYMPHO-MONONUCLEAR CELLS FROM HUMAN TONSILS Martins Júnior, R.B.; Criado, M.F.; Gagliardi, T.B.; Jesus, B.L.S.; Cardoso, R.S.; Silva, M.L.; Carenzi, L.R.; Tamashiro, E.; Valera, F.C.P.; Anselmo-Lima, W.T.; Arruda, E. 418 SERUM FROM DENGUE-VIRUS INFECTED PATIENTS WITH AND WITHOUT PLASMA LEAKAGE DIFFERENTLY AFFECT ENDOTHELIAL CELLS FUNCTION IN VITRO Cardozo, F.T.G.S.; Baimukanova, G.; Bio, L.V.; Pannuti, C.S.; Pati, S.; Romano, C.M.; Sabino, E.C. 423 REASSORTMENT OF POLYMERASE SEGMENTS IN INFLUENZA VIRUS A (H1N1) PDM09 AND H7N9 HUMAN INFLUENZA VIRUS Borges, L.G.A.; Veiga, A.G.V.; Albrecht, R.A.; García-Sastre, A.; Tripathi, S. São Miguel Room SESSION 7 – Veterinary Virology Maria Angela Orsi e Flávio Guimarães – (Chairs) 24 PHYSICO-CHEMICAL AND BIOLOGICAL PROPERTIES OF TYPE O FOOT AND MOUTH DISEASE STRAINS ISOLATED• FROM SOUTH AMERICAN OUTBREAKS (2006 TO 2011 Galdo Novo, S.; Espinoza, A.M.; Cardillo, S.; Maradei, E.; Guinzburg, M.; Lago Aladro, E.; Perez Beascoechea, C. 72 HIGH SEROPOSITIVITY OF ORTHOPOXVIRUS IN BUFFALOES LIVING IN GEOGRAPHICAL ISOLATION, MARAJÓ ISLAND, BRAZIL 2:00 - 3:30 P.M. Luiz, A.P.M.F.; Pereira, A.F.; de Oliveira, C.H.S.; Barbosa, J.D.; Oliveira, D.B.; Bonjardim, C.A.; Ferreira, P.C.P.; Oral presentations Trindade, G. de S.; Abrahão, J.S.; Kroon, E.G. Sessions 5 to 8 79 UNIQUE COMBINATION OF BVDV-1, BVDV-2 AND HOBI-LIKE PESTIVIRUSES PRESENT IN BRAZIL Silveira, S.; Weber, M.N.; Mósena, A.C.S.; da Silva, M.S.; Streck, A.F.; Pescador, C.A.; Flores, E.F.; Weiblen, R.; Driemeier, D.; Ridpath, J.F.; Canal, C.W. 399 BOVINE VACCINIA: TESTING AN INACTIVATED VACCINE IN CATTLE Matos, A.C.D.; Villani, F.N.A.; Galinari, G.C.F.; Rehfeld, I.S.; Costa, A.G.; Rosa, J.C.C.; Costa, E.A.; Silva, N.L.; Rodrigues, T.V.; Lage, A.P.; Guedes, M.I.M.C.; Lobato, Z.I.P. Ilha Faial Room Tuesday, October 13 October Tuesday, SESSION 8 – Immunobiologicals, Human Virology Aguinaldo Pinto e Viviane Fongaro – (Chairs) 160 LEVELS OF NS1 ANTIGENEMIA AND ITS CORRELATION WITH VIREMIA AND IMMUNE STATUS A MARKER• FOR DISEASE SEVERITY IN DENGUE PATIENTS FROM RIO DE JANEIRO De Santis, B.; Lima, M.R.Q.; Cabello, P.H.; Nogueira, R.M.; de Filippis, A.M.B. 315 MOLECULAR ANALISYS OF INFLUENZA A VIRUS IN THE NORTH AND NORTHEAST OF BRAZIL Santos, M.C.; Barbagelata, L.S.; Sousa-Júnior, E.C.; Ferreira, J.A.; Souza, E.M.A.; Medeiros, R.; Mello, W.A. 208 IMMUNIZATION WITH A DENGUE 3 E PROTEIN-FUNCTIONALIZED GOLD NANORODS IMMUNOGEN INDUCES HIGH AMOUNTS OF PROINFLAMMATORY CYTOKINES Versiani, A.F.; Souza, H.L.; Bueno, L.L.; Fujiwara, R.T.; Ladeira, L.O.; da Fonseca, F.G. 252 VALIDATION OF THE SEROLOGICAL TESTING FOR HUMAN IMMUNODEFICIENCY VIRUS TYPE 1/2 FROM POST-MORTEM BLOOD Loiola, D.S.; Sampaio, T.L.; Rodrigues, I.P.; Victer, T.N.F.; Lima, D.S.; Pontes, D.F.S.; Báo, S.N. 257 CONSTRUCTION OF CHIMERIC DENGUE VIRUS PROTEINS TO DEVELOP A NEW VACCINE AND/OR DIAGNOSIS TEST Batista, I.C.A.; Dangelo, L.C.D.; Oliveira, E.S.; Ferreira, J.G.G.; Rocha, E.S.O.; Kroon, E.G.; Corrêa-Oliveira, R.; Oliveira, J.G.; Quinan, B.R.; Calzavara-Silva, C.E. São Miguel Room Round Table 13 - Emergent plant viruses, NGS and Biotechnology 1. Arvind Varsani, University of Canterbury, South Island, New Zealand – New geminiviruses 2:00 - 3:30 P.M. 2. Thor Vinícius Martins Fajardo, Embrapa Uva e Vinho, Bento Gonçalves, RS, Brazil – Recent advances
3. José Antonio Daròs, Instituto de Biología Molecular y Celular de Plantas, Valencia, Spain – Biotechnologicalin the discovery and devices identification derived from of grapevine plant viruses viruses – (Chair) obtained by next generation sequencing Vila do Porto 3:30 - 4:00 P.M. Coffee break and Visit to Exhibits
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 TIME ACTIVITY São Miguel Room CONFERENCE 5 4:00 - 5:00 P.M. 1. Matthew B. Sullivan, University of Arizona, Tucson, AZ, USA – Tracking Viruses in Nature: Towards a Genome- and Population-based Viral Ecology 2. Eurico de Arruda Neto, USP, Ribeirão Preto, SP – (Chair) São Miguel Room 5:00 - 6:00 P.M. Helio Gelli Pereira Award Oral Presentations Vila do Porto Poster Session 2 - Praça de Exposição and Visit to Exhibits 6:00 – 7:30 P.M. Basic Virology Tuesday, October 13 October Tuesday, Environmental Virology • Veterinary Virology • 9:00 - 12:00 P.M. Party • TIME ACTIVITY São Miguel Room CONFERENCE 6 9:00 - 10:0 A.M. 1. John Jack Johnson, The Scripps Research Institute, La Jolla, California, USA – Biophysical Studies of Virus Particles and their Maturation 2. Tatiana Domitrovic, UFRJ, Brazil – (Chair) Vila do Porto 10:00 - 10:30 A.M. Coffee break and Visit to Exhibits São Miguel Room 10:30 - 12:00 A.M. SBV Business Meeting Ilha da Flores Room Mini-course 1 Antônio Augusto Fonseca Júnior, Laboratório Nacional Agropecuário de Minas Gerais, Belo Horizonte, MG, Brazil – Viral phylogeny and sequence analysis Ilha• Faial Room Mini-course 3 12:00 - 1:00 P.M. Wednesday, October 14 October Wednesday, Luciano Kleber de Souza Luna, USP, São Paulo, SP, Brazil and Roberta Vieira de Morais Bronzoni, UFMT, Cuiabá, MT, Brazil – Molecular diagnosis of viruses and performance validation Ilha• do Pico Room Mini-course 4 Fernando Lucas Melo, UNB, Brasília, DF, Brazil – Next generation sequencing technologies for viral metagenomic analyses 12:00 - 2:00 P.M. Lunch• break FREE AFTERNOON
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 Hélio Gelli Pereira Award
Hélio Gelli Pereira Award GENOME SEQUENCE OF PERIGONIA LUSCA SINGLE NUCLEOPOLYHEDROVIRUS (PELUSNPV): INSIGHTS ON THE EVOLUTION OF A 1 NUCLEOTIDE METABOLISM ENZYME IN THE FAMILY BACULOVIRIDAE Ardisson-Araújo, D.M.P.; Lima, R.N.; Melo, F.L.; Clem, R.; Huang, N.; Báo, S.N.; Sosa-Gómez, D.R.; Ribeiro, B.M. NEF NEUTRALIZES THE ABILITY OF EXOSOMES FROM CD4+ T CELLS TO ACT AS DECOYS DURING HIV-1 INFECTION de Carvalho, J.V.; de Castro, R.O.; da Silva, E.Z.M.; Silveira, P.P.; da Silva-Januário, M.E.; Arruda, E.; Jamur, M.C.; Oliver, C.; Aguiar, R.S.; da Silva, L.L.P. AN IMMUNOGEN COMPOSED BY GOLD NANORODS FUNCTIONALIZED WITH DENGUE VIRUS PROTEINS GENERATES HIGH LEVELS OF HUMORAL AND CELLULAR RESPONSES IN MICE Versiania, A.F.; Souza, H.L.; Mendes, T.A.O.; Caires, A.J.; Barboza, A.P.M.; Bueno, L.L.; Fujiwara, R.T.; Bartholomeu, D.C.; Ladeira, L.O.; Barbosa-Stancioli, E.F.; da Fonseca, F.G. MIMIVIRUS FIBRILS ARE IMPORTANT FOR VIRAL ATTACHMENT TO MICROBIAL WORLD BY GLYCOSIDE 2 INTERACTION São Miguel Room
5:00 p.m - 6:00 p.m 5:00 p.m Rodrigues, R.A.L.; Silva, L.K.S.; Dornas, F.P.; Oliveira, D.B.; Magalhães, T.F.F.; Santos, D.A.; Costa; A.O.; Farias, L.M.; Magalhães, F.P.; Bonjardim, C.A.; Kroon, E.G.; La Scola, B.; Cortines, J.R.; Abrahão, J.S. DENGUE VIRUS SURVEILLANCE: EMERGENCE OF DENV-4 IN THE CITY OF SÃO JOSÉ DO RIO PRETO, SP, BRAZI Colombo, T.E.; de Araujo, G.C.; de Souza, F.P.; Mazaro, C.C.P.; Vedovello, D.; Lopes, J.C.C.; Araújo Jr., J.P.; dos Santos, I.N.P.; Reis, A.F.N.; Rocha, E.S. de O., Kroon, E.G.; Nogueira, M.L. IMPACT OF SINGLE AND MULTIPLE MORPHOTYPES ON GENOME-WIDE SELECTION IN BACULOVIRUS Fernandes, J.E.A.; Andrade, M. de S.; Ribeiro, B.M.; Melo, F.L.
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 Oral Presentation
SESSION 1 – Human Virology HV18 - GENETIC AND GEOGRAPHICAL ANALYSIS OF ZIKA VIRUS (ZIKV) ISOLATED FROM AN AUTOCHNOUS CASE IN SÃO PAULO STATE, BRAZIL, 2015 Cunha, M.S.; Pereira, R.S.; Maeda, A.Y.; Silva, F.G.; Rocco, Y.M.; Angerami, R.N.; Pereira, F.C.; Santos, C.S.; Nogueira, J.S.; Katz, G.; Macedo, F.L.L.; Oliveira, A.L.R.; Suzuki, A. HV82 - MIMIVIRUS IN HOSPITAL ENVIRONMENT: ASSESSMENT OF DISTRIBUTION AND BIOLOGICAL, MOLECULAR AND STRUCTURAL DIVERSITY OF VIRAL ISOLATED Silva, L.K.S.; Rodrigues, R.A.L.; Arantes, T.S.; Silva, L.C.F.; Boratto, P.V.M.; Kroon, E.G.; Clemente, W.T.; Abrahão, J.S. HV132 - BIOLOGICAL CHARACTERIZATION OF TWO DENV-1 LINEAGES CO-CIRCULATING IN SÃO JOSÉ DO RIO PRETO, SP, BRAZIL Nogueira, M.L.; Pinheiro, T.M.; Watanabe, A.S.A.; Biselli-Périco, J.M.; Ribeiro, M.R.; Chaves, B.A.; Pimenta, P.F.P.; Batista, I.C.A.; Calzavara-Silva, C.E.; Vedovello, D. São Miguel Room
2:00 p.m - 3:30 p.m 2:00 p.m HV242 - HIV-1 GENETIC DIVERSITY AND DRUG RESISTANCE MUTATIONS AMONG PATIENTS FAILING COMBINED ANTIRETROVIRAL THERAPY IN RIO DE JANEIRO, BRAZIL Marques, B.C.L.; Silva-de-Jesus, C.; Francini, M.; Francisco, R.B.L.; Rachid-de-Lacerda, M.C.; Veloso, V.; Morgado, M.G.; Couto- Fernandez, J.C. HV406 - SEROPREVALENCE OF SAINT LOUIS ENCEPHALITIS VIRUS AMONG HUMANS AND HORSES FROM MINAS GERAIS, BRAZIL Costa, G.B.; Marinho, P.E.S.; Vilela, A.P.P.; Crispim, A.P.C.; Saraiva-Silva, A.T.; Ferreira, P.C.P.; Nogueira, M.L.; Kroon, E.G.; Trindade, G.S. SESSION 2 – Plant and Invertebrate PIV28 - MIXED INFECTIONS AFFECT THE EVOLUTIONARY DYNAMICS OF PEPINO MOSAIC VIRUS, AN EMERGING RNA PLANT VIRUS Gómez, P.; Juárez, M.; Sánchez-Pina, M.A.; García-Villalba, J.M.; Alcaide, C.; Aranda, M.A. PIV191 - THE BETABACULOVIRUS-DERIVED GP64 HOMOLOG IS A FUNCTIONAL ENVELOPE FUSION PROTEIN Daniel, M.P.Ardisson-Araújo; Rollie, J.Clem; Fernando, L.Melo; José, L.C.Wolff; Bergmann, M.Ribeiro PIV196 - THE SW-5 GENE CLUSTER: ANALYSIS OF TOMATO RESISTANCE AGAINST TOSPOVIRUSES De Oliveira, A.S.; Kormelink, R.; Resende, R.O. PIV246 - DISCOVERY OF POTENTIAL ENTOMOPATHOGENIC RNA VIRUSES IN THE WHITEFLY (BEMISIA TABACI) USING Ilha Faial Room Ilha Faial Monday, October 12 October Monday, NEXT GENERATION SEQUENCING 2:00 p.m - 3:30 p.m 2:00 p.m Nakasu, E.Y.T.; Melo, F.L.; Nagata, T.; Michereff Filho, M.; Souza, J.O.; Ribeiro, B.M.; Ribeiro, S.G.; Lacorte, C.; Pereira, J.L.; Inoue- Nagata, A.K. PIV273 - BIOLOGICAL AND MOLECULAR CHARACTERIZATION OF TWO OLD-WORLD-LIKE BEGOMOVIRUSES INFECTING THE NON-CULTIVATED PLANT SIDA ACUTA IN BRAZIL Xavier, C.A.D.; Godinho, M.T.; Trindade, A.T.; Lima, A.T.M.; Silva, J.P.; Zerbini, F.M. SESSION 3 – Veterinary Virology VV99 - INFECTIONS AND COINFECTIONS BY RESPIRATORY VIRUSES IN SHELTER DOGS, RS, BRAZIL Monteiro, F.L.; Cargnelutti, J.F.; Martins, M.; Anziliero, D.; Erhardt, M.M.; Weiblen, R.; Flores, E.F. VV109 - IMMUNOGENICITY AND EFFICACY ASSESSMENT OF AN INACTIVATED RABIES-BASED CANINE DISTEMPER VACCINE Budaszewski, R.F.; Canal, C.W.; Schnell, M.J.; von Messling, V. VV351 - FIRST REPORT OF SENECAVIRUS A IN PIGS OF DIFFERENT AGES WITH VESICULAR DISEASE IN BRAZIL Leme, R.A.; Diniz, J.A.; Alcântara, B.K.; Possati, F.; Molinari, B.L.D.; Lorenzetti, E.; Favero, L.M.; Oliveira, M. V.; A.A. Alfieri, A.F.; Alfieri, VV355 - DETECTION AND CHARACTERIZATION OF INFLUENZA A VIRUS ENDEMIC CIRCULATION IN SUCKLING AND NURSERY PIGS IN COMMERCIAL FARMS USING INFLUENZA VACCINE
Ilha do Pico Room Ilha do Pico Dias, A.S.; Gauger, P.C.; Vincent, A.L.; Kitikoon, P.; Baker, R.B.; Zhang, J 2:00 p.m - 3:30 p.m 2:00 p.m VV369 - GENETIC HETEROGENEITY OF THE VP6 GENE AND PREDOMINANCE OF G6P[5] GENOTYPES IN BRAZILIAN FIELD STRAINS OF PORCINE ROTAVIRUS C Possatti, F.; Lorenzetti, E.; Molinari, B.L.D.; Leme, R.A.; Massi, R.P.; Otonel, R.A.A.;
VV427 - CIRCULATION OF ALPHA- AND BETACORONAVIRUS SUBGROUP C Alfieri,IN BATS A.A.; FROM Alfieri, BRAZILIAN’S A.F. URBAN AND ATLANTIC FOREST BIOME Góes, L.G.B.; Campos, A.C.A.; Ceara, C.C.; Ambar, G.; Souza, M.C.P.; Crispin, L.A.C.; Neto, A.P.C.; Queiroz, L.; Durigon, E.L.
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 SESSION 4 – Environmental Virology EV92 - PAN-GENOME ANALYSIS OF BRAZILIAN LINEAGE A AMOEBAL MIMIVIRUSES Monteiro, F.L.; Cargnelutti, J.F.; Martins, M.; Anziliero, D.; Erhardt, M.M.; Weiblen, R.; Flores, E.F. EV102 - DETECTION OF COMMON, EMERGING AND UNCOMMON VP4 AND VP7 HUMAN GROUP A ROTAVIRUS GENOTYPES FROM URBAN SEWAGE SAMPLES IN URUGUAY Dort, L.F.L.; Victoria, M.; Lizasoain, A.; Berois, M.; Cristina, J.; Leite, J.P.G.; Gómez, M.M.; Miagostovich, M.P.; Colina, R. EV180 - PRESENCE OF ADENOVIRUS AND CORRELATION WITH PHYSICO-CHEMICAL AND BACTERIOLOGICAL PARAMETERS IN ARROIO PINHAL CAXIAS DO SUL MUNICIPALITY (BRAZIL) Goulart, N.; Hahn, R.C.; Girardi, V.; Magrini, F.E.; Bortolin, T.A.; Schneider, V.E.; Paesi, S. EV289 - METAGENOMICS OF VIRUSES RESIDENT IN DAIRY CATTLE RUMEN 2:00 p.m - 3:30 p.m 2:00 p.m Monday, October 12 October Monday, Souza, F.O.; Vidigal, P.M.P,; Silva, J.C.F.; Mantovani, H.C.; Alfenas-Zerbini, P. Ilha das Flores Room Ilha das Flores EV341 - ACQUISITION, STABILITY AND INACTIVATION OF ENTERIC VIRUSES IN OYSTERS CRASSOSTREA GIGAS Pilotto, M.R.; Souza, D.S.M.; Dominot, A.F.A.; Barardi, C.R.M. EV409 - GOLDEN MARSEILLEVIRUS-LIKE: A NEW AMOEBAL GIANT VIRUS Santos, R.N.; Campos, F.S.; Albuquerque, N.R.M.; Ortiz, L.C.; Arantes, T.S.; Assis, F.L.; Abrahão, J.; Roehe, P.M.; Franco, A.C. SESSION 5 – Basic Virology BV206 - THE MECHANISM OF CD4 DOWNREGULATION BY HIV-1 NEF REVEALS DISTINCT ROLES FOR ?1 AND ?2 ADAPTINS IN INTRACELLULAR TRAFFICKING Tavares, L.A.; da Silva, E.M.; Carvalho, J.V.; Dasilva, L.L. BV234 - HIGH MOBILITY GROUP BOX 1 (HMGB1) IS IMPORTANT FOR HUMAN PAPILLOMAVIRUS-TRANSFORMED CELLS SURVIVAL Silva, A.M.; Montenegro, A.; Abjaude, W. da S.; Morale, G.M.; Lino, V. de S.; Boccardo, E. BV280 - BOVINE LACTOFERRIN INHIBITS HUMAM RHINOVIRUS 14 INFECTION Denani, C.B.; Santos, R.A.; Hohn, A.R.; Carvalho, C.A.M.; Rocha, V.P.; Silva, J.L.; Oliveira, A.C.; Gomes, A.M.O.; Gonçalves, R.B. BV283 - MINIGENOME ACTIVITY WITHIN THE BUNYAVIRUS SIMBU SEROGROUP AND IMPLICATIONS FOR GENOME REASSORTMENT Acrani, G.O.; Tilston-Lunel, N.L.; Elliott, R.M. 2:00 p.m - 3:30 p.m 2:00 p.m
Ilha das Flores Room Ilha das Flores BV370 - IDENTIFICATION OF MICRORNAS AND CELLULAR FACTORS MODULATED BY OROPOUCHE INFECTION Geddes, V.E.V.; Ribeiro-Alves, M.; Arruda, E.; Aguiar, R.S. BV381 - MULTIPLE EFFECTS OF TOXINS ISOLATED FROM CROTALUS DURISSUS TERRIFICUS ON HEPATITIS C LIFE CYCLE Shimizu, J.F.; Batista, M.N.; Campos, G.R.F.; Bittar, C.; Cintra, A.C.O.; Sampaio, S.V.; Aquino, V.H.; Rahal, P.; Jardim, A.C.G. BV432 - MAYARO VIRUS REPLICATION IN PRIMARY HUMAN MYOBLASTS AND MICE MUSCLE IN VIVO: IMPLICATIONS IN THE PATHOGENESIS OF MYALGIA AND MYOSISTIS INDUCED BY ALPHAVIRUS Figueiredo, C.M.; Neris, R.L.; Ladislau, L.; Benjamim, C.F.; Assunção-Miranda, I. SESSION 6 – Human Virology Tuesday, October 13 October Tuesday, HV197 - MIMIVIRUS: GENOME AND NEUTRALIZATION ANTIBODIES DETECTION IN RURAL BRAZILIAN HUMANS Dornas, F.P.; Costa, G.B.; Silva, L.C.F.; Boratto, P.V.M.; Kroon, E.G.; Scola, B.; Trindade, G.; Abrahao, J.S. HV204 - IN SILICO DIVERSITY ANALYSIS OF HERV-W TRANSCRIPTS REVEALS DISTINCT PATTERNS OF EXPRESSION IN BLOOD AND BRAIN SAMPLES OF MULTIPLE SCLEROSIS PATIENTS Nali, L.H.S.; Urbano, P.R.P.; Olival, G.S.; Silva, D.F.; Penalva de Oliveira, A.C.; Romano, C.M. HV248 - HUMAN RHINOVIRUS REPLICATION IN LYMPHO-MONONUCLEAR CELLS FROM HUMAN TONSILS Martins Júnior, R.B.; Criado, M.F.; Gagliardi, T.B.; Jesus, B.L.S.; Cardoso, R.S.; Silva, M.L.; Carenzi, L.R.; Tamashiro, E.; Valera, F.C.P.; Anselmo-Lima, W.T.; Arruda, E. HV418 - SERUM FROM DENGUE-VIRUS INFECTED PATIENTS WITH AND WITHOUT PLASMA LEAKAGE DIFFERENTLY Ilha Terceira Room Ilha Terceira 2:00 p.m - 3:30 p.m 2:00 p.m AFFECT ENDOTHELIAL CELLS FUNCTION IN VITRO Cardozo, F.T.G.S.; Baimukanova, G.; Bio, L.V.; Pannuti, C.S.; Pati, S.; Romano, C.M.; Sabino, E.C. HV423 - REASSORTMENT OF POLYMERASE SEGMENTS IN INFLUENZA VIRUS A (H1N1) PDM09 AND H7N9 HUMAN INFLUENZA VIRUS Borges, L.G.A.; Veiga, A.G.V.; Albrecht, R.A.; García-Sastre, A.; Tripathi, S.
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 SESSION 7 – Veterinary Virology VV24 - PHYSICO-CHEMICAL AND BIOLOGICAL PROPERTIES OF TYPE O FOOT AND MOUTH DISEASE STRAINS ISOLATED FROM SOUTH AMERICAN OUTBREAKS (2006 TO 2011) Galdo Novo, S.; Espinoza, A.M.; Cardillo, S.; Maradei, E.; Guinzburg, M.; Lago Aladro, E.; Perez Beascoechea, C. VV72 - HIGH SEROPOSITIVITY OF ORTHOPOXVIRUS IN BUFFALOES LIVING IN GEOGRAPHICAL ISOLATION, MARAJO ISLAND, BRAZIL Luiz, A.P.M.F.; Pereira, A.F.; de Oliveira, C.H.S.; Barbosa, J.D.; Oliveira, D.B.; Bonjardim, C.A.; Ferreira, P.C.P.; Trindade, G. de S.; Abrahão, J.S.; Kroon, E.G. VV79 - UNIQUE COMBINATION OF BVDV-1, BVDV-2 AND HOBI-LIKE PESTIVIRUSES PRESENT IN BRAZIL Silveira, S.; Weber, M.N.; Mósena, A.C.S.; da Silva, M.S.; Streck, A.F.; Pescador, C.A.; Flores, E.F.; Weiblen, R.; Driemeier, D.; Ridpath, J.F.; Canal, C.W. Ilha do Pico Room Ilha do Pico 2:00 p.m - 3:30 p.m 2:00 p.m VV175 - IDENTIFICATION OF CANINE KOBUVIRUS RNA IN FECAL SAMPLES FROM DOMESTIC DOGS IN BRAZIL Ribeiro, J.; Silva, A.P.; Moraes, N.R.; Diniz; J.A.; Campanha, J.E.T.; Lorenzetti, E.; Silva, R.O.S; D’Elia, M.L.; Almeida, L.R.; A.A.; Alfieri, VV399Alfieri, - BOVINE A.F. VACCINIA: TESTING AN INACTIVATED VACCINE IN CATTLE Matos, A.C.D.; Villani, F.N.A.; Galinari, G.C.F.; Rehfeld, I.S.; Costa, A.G.; Rosa, J.C.C.; Costa, E.A.; Silva, N.L.; Rodrigues, T.V.; Lage, A.P.; Guedes, M.I.M.C.; Lobato, Z.I.P. SESSION 8 – Immunobiologicals, Human Virology HV160 - LEVELS OF NS1 ANTIGENEMIA AND ITS CORRELATION WITH VIREMIA AND IMMUNE STATUS AS A MARKER
Tuesday, October 13 October Tuesday, FOR DISEASE SEVERITY IN DENGUE PATIENTS FROM RIO DE JANEIRO De Santis, B.; De Santis, B.; Lima, M.R.Q.; Cabello, P.H.; Nogueira, R.M.; de Filippis, A.M.B. HV315 - MOLECULAR ANALISYS OF INFLUENZA A VIRUS IN THE NORTH AND NORTHEAST OF BRAZIL Santos, M.C.; Barbagelata, L.S.; Sousa-Júnior, E.C.; Ferreira, J.A.; Souza, E.M.A.; Medeiros, R.; Mello, W.A. IV208 - IMMUNIZATION WITH A DENGUE 3 E PROTEIN-FUNCTIONALIZED GOLD NANORODS IMMUNOGEN INDUCES HIGH AMOUNTS OF PROINFLAMMATORY CYTOKINES Versiani, A.F.; Souza, H.L.; Bueno, L.L.; Fujiwara, R.T.; Ladeira, L.O.; da Fonseca, F.G. IV252 - VALIDATION OF THE SEROLOGICAL TESTING FOR HUMAN IMMUNODEFICIENCY VIRUS TYPE 1/2 FROM POST- Ilha Faial Room Ilha Faial
2:00 p.m - 3:30 p.m 2:00 p.m MORTEM BLOOD Loiola, D.S.; Sampaio, T.L.; Rodrigues, I.P.; Victer, T.N.F.; Lima, D.S.; Pontes, D.F.S.; Báo, S.N. IV257 - CONSTRUCTION OF RECOMBINANT DENGUE PROTEINS CONTAINING CAPSIDE, ENVELOPE, MEMBRANE AND NS1 EPITOPES USEFUL TO DENGUE VACCINE AND DIAGNOSIS Batista, I.C.A.; Dangelo, L.C.D.; Oliveira, E.S.; Ferreira, J.G.G.; Rocha, E.S.O.; Kroon, E.G.; Corrêa-Oliveira, R.; Oliveira, J.G.; Quinan, B.R.; Calzavara-Silva, C.E..
XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology, Florianópolis, Santa Catarina, Brazil Virus Reviews and Research, Volume 20, Supplement 1, 2015 HELIO GELLI PEREIRA AWARD XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazill
17 Helio Gelli Pereira Award
GENOME SEQUENCE OF PERIGONIA LUSCA SINGLE by certain baculoviruses could be related to accelerating NUCLEOPOLYHEDROVIRUS (PELUSNPV): INSIGHTS virus replication. The hypothetical mechanism is likely ON THE EVOLUTION OF A 1 NUCLEOTIDE METABOLISM related to synchronizing the cell cycle state, controlling ENZYME IN THE FAMILY BACULOVIRIDAE Ardisson-Araújo, D.M.P.; Lima, R.N.; Melo, F.L.; Clem, altering the expression or function of cellular nucleotide the cellular nucleotide pool size (dUTP/dTTP ratio), or R.; Huang, N.; Báo, S.N.; Sosa-Gómez, D.R.; Ribeiro, metabolism enzymes. FAPDF, CNPq, CAPES. B.M. NEF NEUTRALIZES THE ABILITY OF EXOSOMES 1. LABORATORY OF BACULOVIRUS, CELL FROM CD4+ T CELLS TO ACT AS DECOYS DURING HIV- BIOLOGY DEPARTMENT, UNIVERSITY OF 1 INFECTION BRASÍLIA de Carvalho, J.V.; de Castro, R.O.; da Silva, E.Z.M.; 2. DIVISION OF 7 BIOLOGY, KANSAS STATE Silveira, P.P.; da Silva-Januário, M.E.; Arruda, E.; UNIVERSITY Jamur, M.C.; Oliver, C.; Aguiar, R.S.; da Silva, L.L.P. 3. EMBRAPA SOJA 1. DEPARTMENT OF CELL AND MOLECULAR The genome of a novel group II alphabaculovirus, BIOLOGY, RIBEIRÃO PRETO MEDICAL Perigonia lusca single nucleopolyhedrovirus (PeluSNPV), SCHOOL, UNIVERSITY OF SÃO PAULO was sequenced and shown to contain 132,831 bp with 2. MOLECULAR VIROLOGY LABORATORY, 145 putative ORFs (open reading frames) encoding DEPARTMENT OF GENETICS, FEDERAL polypeptides with at least 50 amino acid residues. Among UNIVERSITY OF RIO DE JANEIRO the 145 ORFs, 18 were found to be unique and, based on alignment with the concatenated sequences of 37 Nef is an HIV-1 accessory protein that promotes viral baculovirus core genes, we found that the closest relative replication and pathogenesis. A key function of Nef to PeluSNPV was Clanis bilineata nucleopolyhedrovirus, is to ensure sustained depletion of CD4 and MHC-I another sphingid-infecting alphabaculovirus. An molecules in infected cells by inducing targeting of interesting feature of this novel genome was the these proteins to multivesicular bodies (MVBs), and presence of a putative nucleotide metabolism enzyme- ultimately to lysosomes for degradation. Nef also affects cellular ecretory routes promoting its own secretion via encoding gene (pelu112). The pelu112 gene was exosomes. To better understand the effects of Nef on predicted to be a fusion of thymidylate kinase (tmk) the exocytic pathway, we investigated whether this viral and deoxyuridine triphosphatase (dut), and this fused genes appears to have also been acquired convergently by T lymphocytes. We showed that both CD4 and MHC-I by two other distantly related baculoviruses. Moreover, factor modifies the composition of exosomes released phylogenetic analysis indicated that baculoviruses molecules are secreted in exosomes from T cells and that the expression of Nef reduces the amount of these have independently acquired tmk and dut several times during their evolution from different sources. In order proteins in exosomes. To investigate the functional role for this novel activity of Nef, we performed in vitro HIV-1 to test whether the expression of a tmk-dut fusion gene by a baculovirus that naturally lacks it would result infection assays in the presence of distinct populations in an adaptive gain, we inserted two homologs of the of exosomes. We demonstrated that exosomes released tmk-dut fusion gene into the Autographa californica HIV-1 infection in vitro. Because CD4 is the main multiple nucleopolyhedrovirus (AcMNPV) genome. by CD4+ T cells, but not CD4- T cells, efficiently inhibit The recombinant baculoviruses produced viral DNA, receptor for HIV-1 infection, these results suggest that virus progeny, and some viral proteins earlier during CD4 molecules displayed on the surface of exosomes can bind to envelope proteins of HIV-1 hindering virus in vitro infection and the yields of viral occlusion bodies were increased 2.5-fold when compared to the interaction with target cells and infection. Importantly, parental virus. Interestingly, both enzymes appear to CD4-depleted exosomes released by CD4+ T cells retain their active sites, based on separate modeling expressing Nef have a reduced capacity to inhibit HIV-1 using previously solved crystals tructures. We therefore infection in vitro. These results provide evidence that Nef promotes HIV-1 infection by reducing the expression of suggest that the retention of these tmk-dut fusion genes October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Helio Gelli Pereira Award XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazill
18 Helio Gelli Pereira Award
CD4 in exosomes from infected cells, besides the original MIMIVIRUS FIBRILS ARE IMPORTANT FOR VIRAL role of Nef in reducing the CD4 levels at the cell surface. ATTACHMENT TO MICROBIAL WORLD BY GLYCOSIDE 2 INTERACTION AN IMMUNOGEN COMPOSED BY GOLD NANORODS Rodrigues, R.A.L; Silva, L.K.S.; Dornas, F.P.; Oliveira, FUNCTIONALIZED WITH DENGUE VIRUS PROTEINS D.B.; Magalhães, T.F.F.; Santos, D.A.; Costa; A.O.; Farias, GENERATES HIGH LEVELS OF HUMORAL AND L.M.; Magalhães, F.P.; Bonjardim, C.A.; Kroon, E.G.; La CELLULAR RESPONSES IN MICE Scola, B.; Cortines, J.R.; Abrahão, J.S. Versiania, A.F.; Souza, H.L.; Mendes, T.A.O.; Caires, A.J.; Barboza, A.P.M.; Bueno, L.L.; Fujiwara, R.T.; 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS Bartholomeu, D.C.; Ladeira, L.O.; Barbosa-Stancioli, 2. INSTITUTO DE MICROBIOLOGIA PAULO DE E.F.; da Fonseca, F.G. GÓES 3. AIX MARSEILLE UNIVERSITE UNIVERSIDADE FEDERAL DE MINAS GERAIS Acanthamoeba polyphaga mimivirus (APMV) is a giant Dengue is currently the most important infectious virus from the Mimiviridae family. It 28 has many disease in Brazil in terms of epidemiological impact. unusual features, such as a pseudo-icosahedral capsid Consequently, the development of an effective vaccine is considered a high priority. Indeed, many studies are through which the ~1.2 Mb dsDNA is released. It also being developed towards this goal and some encouraging that presents a starfish shape 29 in one of its vertices, results have been obtained by different groups. capsid that has not yet been functionally characterized. Nonetheless, no vaccine is yet available to the population. has a dense 30 glycoprotein fibril layer covering the are not essential for viral replication, they are 32 truly involving chemistry, engineering, biology and medicine, necessary31 Here, for we viral verified adhesion that to although amoebae, these its natural structures host. andNanotechnology potential applications is a field ofinclude interdisciplinary the development research of methods of detection, diagnosis and treatment for an attachment to the Acanthamoeba castellanii surface. This array of different diseases. Gold Nanorods (AuNR) are of In the absence of fibrils, 33 APMV had a significant lower particular interest, especially considering their optical and N-acetylglucosamine (a monomer 35 of chitin and properties, the chemistry of their surfaces and their low peptidoglycan),34 adhesion is mediated both of whichby glycans, are largely specifically distributed mannose in toxicity in biological systems. Here we design and test nature as structural 36 components of several organisms. a new immunogen against Dengue virus. In this article Indeed, APMV was able to attach to different organisms, we describe the development and characterization of 37 such as Gram-positive bacteria, fungi, and arthropods, Gold Nanorods (GNRs) covalently functionalized with a but not to Gram-negative bacteria. This 38 prompted us recombinant DENV3 envelope protein (GNRpE). Upon to predict that i) arthropods, mainly insects, might act mice immunization with the experimental immunogen, as mimivirus dispersors 39 and ii) by attaching to other high levels of anti-IgG and anti-DENV neutralizing microorganisms, APMV could be concurrently ingested antibodies were detected, as well as important dengue by 40 amoebae, leading to the successful production of viral progeny. To date, this mechanism has 41 never been described in the virosphere. remainedspecific cell elusive and despite cytokine the responses. many efforts Such and results the use are of differentquite significant vaccine strategies as an effective and approaches. dengue vaccine has
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Helio Gelli Pereira Award XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazill
19 Helio Gelli Pereira Award
DENGUE VIRUS SURVEILLANCE: EMERGENCE OF serotype in a new region and reiterate the importance of DENV-4 IN THE CITY OF SÃO JOSÉ DO RIO PRETO, SP, surveillance programs to detect and trace the evolution BRAZI of DENV. Keywords: Dengue. Serotypes. Genotype. Viral Colombo, T.E.; de Araujo, G.C.; de Souza, F.P.; Mazaro, proteins. C.C.P.; Vedovello, D.; Lopes, J.C.C.; Araújo Jr., J.P.; dos IMPACT OF SINGLE AND MULTIPLE MORPHOTYPES Santos, I.N.P.; Reis, A.F.N.; Rocha, E.S. de O., Kroon, ON GENOME-WIDE SELECTION IN BACULOVIRUS E.G.; Nogueira, M.L. Fernandes, J.E.A.; Andrade, M. de S.; Ribeiro, B.M.; 1. ACULDADE DE MEDICINA DE SÃO JOSÉ DO Melo, F.L. RIO PRETO (FAMERP) 2. UNIVERSIDADE ESTADUAL PAULISTA “JÚLIO DEPARTMENT OF CELL BIOLOGY, UNIVERSITY DE MESQUITTA E FILHO” OF BRASILIA 3. LABORATÓRIO DE VIROLOGIA DO The baculoviruses are a group of insect viruses with INSTITUTO DE BIOCIÊNCIAS DE BOTUCATU large dsDNA genomes, and their primary infection is - UNIVERSIDADE ESTADUAL PAULISTA triggered by rod-shaped enveloped virions embedded 4. PREFEITURA DE SÃO JOSÉ DO RIO PRETO, in a crystalline protein matrix. Each virion may contain DEPARTAMENTO DE VIGILÂNCIA EM SAÚDE one (single phenotype, SNPV) or more nucleocapsid 5. DEPARTAMENTO DE MICROBIOLOGIA, UNIVERSIDADE FEDERAL DE MINAS GERAIS (multiple phenotype, MNPV) within an envelope, depending on the viral species. The MNPVs experience an Dengue is the most common arbovirus infection obligatory co-infection event during primary infection, worldwide and is caused by four distinct serotypes which may increase the likelihood of recombination, of the Dengue virus (DENV). In the present study, we complementation and the levels of competition within assessed DENV transmission in São José do Rio Preto the infected cell. Although it is generally assumed (SJRP) from 2010 to 2014. We analyzed blood samples from febrile patients who were attended at health care evolution of baculoviruses, only limited evidence has centers in SJRP. DENV detection was performed using beenthat provided co-infection to support have significantlythese claims. impactedTherefore, thewe multiplex RT-PCR, using Flavivirus generic primers, investigate the impact of these two morphotypes on based on the genes of the non-structural protein (NS5), baculoviruses evolution using available genomic data primers. We analyzed 1549 samples, of which 1389 were positivefollowed for by NS1 nested-PCR by rapid test. assay One with thousand species-specific and eight- onsampled the genome-wide both at the intraspecific patterns instead and interspecific of on individual level. We estimated the dN/dS for each gene and we focused that the MNPVs have a more heterogeneous selection seven samples (78%) were confirmed as positive by genes. At the intraspecific level, our analysis shows multiplex RT-PCR: DENV-4, 48.5% (528/1087); DENV-1, 41.5% (449/1087); DENV-2, 9.5% (104/1087); and co- observedprofiles than for the the two SNPVs. phenotypes. However, Taken at the together, interspecific these infection (5 DENV-1/DENV-4, 1 DENV-1/DENV-2), 0.5% resultslevel no suggest differences that the in heterogeneity the selection observed profiles at were the genotype(6/1087). and Phylogenetic the showed analysis a relationship of the DENV-4between grouped isolates fromthe isolates SJRP and identified isolates from in this the study northern with region the American of South response time to selection rather than distinct selection America. Amino acid substitutions found in proteins E, intraspecific dataset may be the result of a differential NS1, NS3, and NS5 of DENV-4 were considered common viral co-infection may increase the time to purge slightly among samples from SJRP, and these changes did not coefficients. Actually, several studies have shown that occur in regions of interaction, or in the active sites of impact of nucleocapsid aggregation on the genome-wide viral proteins described in the literature, suggesting that selectivedeleterious patterns mutations. in baculoviruses.This is the first Keywords: evidence ofDNA the these changes in the primary sequence of the protein virus, evolution; selection, baculovirus; SNPV and MNPV. cannot interfere with their functions. Taken together, our data shows the detection and emergence of new dengue
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Helio Gelli Pereira Award ORAL PRESENTATION XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
21 Oral Presentation
HV18 - GENETIC AND GEOGRAPHICAL ANALYSIS OF sequenced, revealing a phylogenetic tree locating the ZIKA VIRUS (ZIKV) ISOLATED FROM AN AUTOCHNOUS CASE IN SÃO PAULO STATE, BRAZIL, 2015 clade, coupled with samples from Micronesia, Cambodia, new Brazilian sample at base of the Asiatic/Polynesian Cunha, M.S.; Pereira, R.S.; Maeda, A.Y.; Silva, F.G.; Canada and Easter Island. This association supports Rocco, Y.M.; Angerami, R.N.; Pereira, F.C.; Santos, C.S.; that this strain is part of the recent global introduction Nogueira, J.S.; Katz, G.; Macedo, F.L.L.; Oliveira, A.L.R.; Suzuki, A. from an autochthonous case after blood transfusion inof ZIKV.São Paulo Here State, we report Brazil, the during first isolationa major dengueof Zika virusfever 1. INSTITUTO ADOLFO LUTZ 2. UNIVERSIDADE ESTADUAL DE CAMPINAS 3. CENTRO DE VIGILÂNCIA EPIDEMIOLÓGICA epidemic,HV82 - MIMIVIRUS confirmed by IN specific HOSPITAL RT-PCR ENVIRONMENT: and sequencing. Zika virus (ZIKV) is an emerging arthropod-borne virus, ASSESSMENT OF DISTRIBUTION AND BIOLOGICAL, member of the genus Flavivirus, family Flaviviridae MOLECULAR AND STRUCTURAL DIVERSITY OF that belongs to the Spondweni serocomplex. A previous VIRAL ISOLATED genetic study using nucleotide sequences derived from Silva, L.K.S.; Rodrigues, R.A.L.; Arantes, T.S.; Silva, the NSP5 gene indicated three ZIKV lineages: East African, L.C.F.; Boratto, P.V.M.; Kroon, E.G.; Clemente, W.T.; West African and Asian, but a more recent plylogenetic Abrahão, J.S. analysis with more sequenced strains revealed the UNIVERSIDADE FEDERAL DE MINAS GERAIS existence of two major ZIKV lineages: African and Asian. In 1992, during a pneumonia outbreak, a giant virus was from a rhesus monkey in the Zika forest near Entebbe, isolated from cooling towers in England. This new virus, Although the virus was first isolated in Uganda in 1947 called Acanthamoeba polyphaga mimivirus (APMV), recently, with sporadic human infections reported in infects Acanthamoeba amoebas, and is the prototype virus Africaonly a fewand confirmedAsia, and also human in travelers. cases were However, described in Apriluntil of Mimivirus genus, which belongs to the group of Nucleo- Citoplasmatic Large DNA Virus (NCLDVs). Pneumonia is in Yap State, Federated States of Micronesia, and in 2013 a leading cause of death related to infection throughout a2007 large it wasepidemic reported was the reported first documented in several ZIKVislands outbreak of the the world, however, about 20 to 50% of the cases present unknown etiology. Studies have pointed out some virus Due to high similarity with dengue fever and cross of the Mimivirus genus (mimivirus) as putative agents of French Polynesia, with imported cases confirmed latter. pneumonia in humans. Consering this background, this ZIKV may have been misdiagnosed during the last years. study aimed to evaluate the distribution of mimivirus in Anreactivity acute serumbetween sample other from flavivirus, a patient infections presenting caused fever by different areas of the Hospital das Clínicas (HC) in Belo after receiving a blood transfusion was sent to the Núcleo Horizonte UFMG. For this, 242 hospital dust samples de Doenças de Transmissão Vetorial, Centro de Virologia were collected, processed, and subjected to real-time of the Adolfo Lutz Institute, São Paulo, for dengue virus PCR and isolation. Some of the isolated viruses were (DENV) diagnosis, and therefore DENV fourplex real- time RT-PCR (RT-qPCR), IgM antibody capture enzyme- (sequencing and phylogenetic analysis), biological characterizationpurified and subjected (resistance to assays, molelular multiplication characterization curve, assaylinked (IFA) immunosorbent were performed. assay MAC-ELISA (MAC-ELISA) and and RT-qPCR C6/36 tests (morphometric, transmission and scan electron gene expression profile) and structural characterization werecell isolation negative followedfor DENV by while indirect IFA immunofluorescentwas positive using microscopy and analysis of structural proteins). As experimental control, samples were also collected from various facilities of the Instituto de Ciências Exatas flavivirus polyclonal antibodies. An RT-PCR targeting (ICEX) of UFMG. The results demonstrated a differential positiveFlavivirus results. NSP5 Samplegene and from latter the a blood specific donor one wasfor ZIKVthen distribution of mimivirus in the hospital, revealing sentwere to then the performedlaboratory, to with confirm positive cell RT-PCR isolation, and both IFA. with The a higher number of positive samples in respiratory products generated in the RT-PCR reactions were directly isolation facility than in other analyzed environments. October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
22 Oral Presentation
UFMG. In general, biological, molecular and structural the same isolates. Later, qPCR was used to detect these characterizationIt was not possible of new to isolate isolates any showed virus fromsome thesimilarity ICEX/ virusesC57BL/6 in mice supernatants have been of experimentally cells and in body infected and headwith between these viruses and mimiviruses group A, as samples of mosquitoes. FACS was used to analyze mice the APMV prototype. However some differences in spleen cells. In silico epitope prediction was performed the multiplication curve, nucleotide composition of to evaluate the binding of B and T cell receptors to viral RNA helicase gene and in the expression of genes epitopes of the E gene using bioinformatics tools. involved in the translation were observed suggesting Analysis of the growth curves showed that L1 replicated the existence of some biological differences in new viral at higher level comparably to L6 in all cell lines tested isolates. The volume of evidence linking the mimivirus as well as in Ae. aegypti mosquitoes. L1 presented with nosocomial pneumonia is increasing and our than L6 in both populations and exhibited statistically association between the site occupied by patients with a viral cDNA copies number significantly increased pneumoniawork is the and first isolated to demonstrate APMV. Our a significantresults reinforce spatial Competence) and DIR (Disseminated Infection Rate). IR the need to control the presence of these viruses in the variedsignificant from greater 92.5% rates to 100% of IR (L1)(Infection and 37.5% Rate), toVC 73.33% (Vector hospital. Financial Support: CNPq, FAPEMIG, CAPES. (L6). VC ranged from 85.01% to 100% (L1) and 30% to 43.34% (L6). DIR oscillated from 91.9% to 100% (L1) HV132 - BIOLOGICAL CHARACTERIZATION OF TWO and 59.1% to 80% (L6). L1 had more antigenic potential DENV-1 LINEAGES CO-CIRCULATING IN SÃO JOSÉ DO to B and T cells in silico. L6 seemed to suppress B cells RIO PRETO, SP, BRAZIL activation while L1 was a T cells activator in vivo. These Nogueira, M.L.; Pinheiro, T.M.; Watanabe, A.S.A.; Biselli-Périco, J.M.; Ribeiro, M.R.; Chaves, B.A.; T-test) in their biological properties. Despite the more Pimenta, P.F.P.; Batista, I.C.A.; Calzavara-Silva, C.E.; two lineages showed significant differences (Student’s Vedovello, D. immune response while L6 with a lower growth rate fitness with better growth rate, L1 can elicit a better 1. UNIVERSIDADE ESTADUAL PAULISTA “JÚLIO can evade better the immune system, leading to an DE MESQUITA FILHO” equilibrium and co-circulation of these lineages. Further 2. FACULDADE DE MEDICINA DE SÃO JOSÉ DO analyses should be conducted to better understand how RIO PRETO these characteristics correlate with epidemiological 3. CENTRO DE PESQUISAS RENÉ RACHOU Dengue virus comprises four distinct serotypes (DENV- findingsHV242 in - subsequent HIV-1 GENETIC years. Financial DIVERSITY Support: AND FAPESP. DRUG 1-4). Viral genetic has increased and some of which RESISTANCE MUTATIONS AMONG PATIENTS FAILING appear associated with greater epidemic potential. COMBINED ANTIRETROVIRAL THERAPY IN RIO DE Within the serotype 1, previous studies demonstrated JANEIRO, BRAZIL Marques, B.C.L.; Silva-de-Jesus, C.; Francini, M.; genotypes. Phylogenetic analysis of the Envelope gene Francisco, R.B.L.; Rachid-de-Lacerda, M.C.; Veloso, V.; sequencesthe existence showed of different that two lineageslineages of grouped DENV-1 into (L1 and five Morgado, M.G.; Couto-Fernandez, J.C. L6) co-circulated in São José do Rio Preto, São Paulo, at least, between 2010 and 2012. This study has compared 1. OSWALDO CRUZ INSTITUTE biological properties of these two lineages to provide 2. DEPARTMENT OF STD, AIDS AND VIRAL HEPATITIS, BRAZILIAN MINISTRY OF HEALTH HepG2)information have into been the infected epidemiological with two fitnessDENV-1 of isolates DENV. 3. RIO DE JANEIRO STATE HEALTH representativesFive cell lines (C6/36,of each lineage Aag-2, at Vero an MOI E6, LLC-MK2of 0.1 until and 72 SECRETARIAT 4. NATIONAL INSTITUTE OF INFECTOLOGY Additionally, one hundred forty adult female Ae. aegypti The Brazilian Ministry of Health established free fromhpi for two growth populations curves, (PPCampos measuring andviral Dom fitness Pedro) in vitro. and universal access to combined antiretroviral therapy
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
23 Oral Presentation
(cART) and the HIV-1 genotyping test through the Public HV406 - SEROPREVALENCE OF SAINT LOUIS Health System-SUS, to support the treatment strategies ENCEPHALITIS VIRUS AMONG HUMANS AND HORSES for patients with therapy failing. However, the complexity FROM MINAS GERAIS, BRAZIL Costa, G.B.; Marinho, P.E.S.; Vilela, A.P.P.; Crispim, of drug resistance mutations are increasing, due to A.P.C.; Saraiva-Silva, A.T.; Ferreira, P.C.P.; Nogueira, of the genetic diversity of HIV-1 subtypes and the profile the introduction of non-B subtypes and the expanding M.L.; Kroon, E.G.; Trindade, G.S. of the cART in Brazil. This study was done to evaluate the dynamic of HIV-1 subtypes and the prevalence of 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. FACULDADE DE MEDICINA DE SÃO JOSÉ DO resistance mutations in Rio de Janeiro State over the RIO PRETO last 11 years; help to support the prevention, assistance and treatment. Between 2002 and 2013, blood Saint Louis encephalitis virus (SLEV) is a mosquito- samples from 3,829 patients with failing cART, were borne virus that causes human and animal encephalitis received from the Rio de Janeiro State and genotyped in the Western hemisphere. SLEV is a member of the Flavivirus genus (Flaviviridae family), together with Network for HIV-1 Genotyping. Results: Evaluation several important pathogens such as West Nile virus, ofin theHIV-1 laboratory drug resistance of FIOCRUZ/RJ, was done member in 3,299 of Brazilianpatients. Japanese encephalitis virus, Dengue virus and Yellow fever virus. Viral life cycle is enzootic and birds are the natural as subtype B (85%), followed by subtype F (7%), BF amplifying host. Other vertebrates (e.g. wild animals, recombinantThe majority formsof the (5%)genotyped and subtype samples C were (1.5%). classified HIV-1 horses and humans) are considered accidental hosts. subtype A1, D, G and CRF02_AG, were detected in few Human infections with SLEV are mostly asymptomatic. analyzed patients (<0.5%). However, an increase in prevalence of subtype C was observed in recent years. In like symptoms. Severe cases are clinically characterized Infected individuals can present mild malaise or flu- addition, inter-subtype unique recombinant forms BC, by high fever, neurological dysfunction, altered consciousness and headache, which are accompanied the nucleoside reverse transcriptase inhibitors (NRTI), by encephalitis or meningoencephalitis. In Brazil, evidencedCF and AF weretimidine found. mutations The drug (TAMs)resistance and profile M184V for mutation as being the most prevalent (69%). A total of region in the following years. Furthermore, serological confirmed outbreaks of SLEV were reported in southeast 45% of the samples showed resistance mutations to screenings showed recent viral circulation among NRTIs, 78% to non-nucleoside RTIs (NNRTIs) and 23% horses from several regions. In this way, our objective to the protease inhibitors (PIs). In conclusion, among was to investigate evidences of SLEV circulation in cART failing patient we observed a large proportion of rural Minas Gerais, Brazil. We retrospectively analyzed HIV-1 subtype B and some of subtype C. We detected 240 human and 216 equids serum samples. To detect HIV-1 samples of African origin circulating in the capital neutralizing antibodies anti-SLEV a plaque reduction and inner cities, suggesting a continuous introduction neutralizing test was chosen. The positive samples were drug resistance was observed, mainly to RTIs. Low in virus control (positive control). Human population those which reduced ≥80% the number of plaques found prevalenceof this non-B of resistance subtype. to A the significant new generation proportion of PIs of comprises 127 men (52.9%) and 113 women (47.1%), and to NNRTIs was observed. The maintenance of HIV- aged from 5 to 90 years, located in rural areas from Serro 1 genotyping programs has substantially contributed to city. Equids from different species, ages and genders are from numerous locations around MG state, in which 74 and rescue. Also, the evaluation of HIV-1 genotypic data belongs to rural Serro city. A total of 11 human (4,6%) isthe useful management for molecular of ART epidemiology in failure patients, studies both and first-line in the and 41 horses (27,3%) were seropositive for SLEV early detection of newly emerging non-B viral lineages neutralizing antibodies, with titers ranging from 100 in Brazil. Financial Support: Oswaldo Cruz Foundation- seroprevalence of SLEV in human population, although to 300 neutralizing units/ml. Here, we showed the first Brazilian Ministry of Health. in equids are described extensively. Our results indicate IOC/FIOCRUZ, Dept. of STD, AIDS and Viral Hepatitis, that SLEV may circulate widely in Brazil, suggesting October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
24 Oral Presentation the presence of asymptomatic or subclinical infections microscopy preliminary results based on RNA in situ in human and animals, even though outbreaks had hybridization indicate that both PepMV types are able been reported. In conclusion, data presented here are to infect the same cell types, and likely to co-infect the particularly important because many non-Dengue same cells. These results suggest that mixed infections could be contributing to increasing viral diversity and undiagnosed in Brazil. Keywords: SLEV, seroprevalence, shaping the genetic structure and dynamics of PepMV epidemiology,or other flaviviruses human, horses, acute Brazil. febrile Financial illnesses Support: remain populations, having major implications for the disease CNPq, CAPES, UFMG. control.
PIV28 - MIXED INFECTIONS AFFECT THE PIV191 - THE BETABACULOVIRUS-DERIVED GP64 EVOLUTIONARY DYNAMICS OF PEPINO MOSAIC HOMOLOG IS A FUNCTIONAL ENVELOPE FUSION VIRUS, AN EMERGING RNA PLANT VIRUS PROTEIN Gómez, P.; Juárez, M.; Sánchez-Pina, M.A.; García- Daniel, M.P.Ardisson-Araújo; Rollie, J.Clem; Fernando, Villalba, J.M.; Alcaide, C.; Aranda, M.A. L.Melo; José, L.C.Wolff; Bergmann, M.Ribeiro 1. CENTRO DE EDAFOLOGIA Y BIOLOGIA 1. UNIVERSITY OF BRASÍLIA APLICADA DEL SEGURA 2. KANSAS STATE UNIVERSITY 2. UNIVERSIDAD MIGUEL HERNANDEZ 3. MACKENZIE PRESBITERIAN UNIVERSITY Individual plants are often infected in nature with more Baculovirus are insect viruses commonly used as than one related or unrelated virus, and ecological theory biological control agents and expression vectors. The predicts that co-infections may have large consequences family is divided into four genera, two of them, alpha and for the evolutionary dynamics of these viruses and hence important epidemiological outcomes. However, Recently, a betabaculovirus (DisaGV) was isolated from the extent to which mixed viral infections can affect the Diatraeabetabaculovirus, saccharalis are (Lepidoptera: infectious to mothsCrambidae), and butterfly. one of the most important insect pest of the sugarcane culture conditions remains unclear. Here, we studied the spatio- in brazil. The complete genome sequence of DisaGV was temporalgenetic structure dynamics of viral of Pepinopopulations mosaic under virus natural (PepMV), field determined using the 454-pyrosequencing method. a recently emerged RNA virus known to cause severe surprisingly, a gp64 homolog gene (disa118) was found. economic losses in tomato crops (Solanum lycopersicum GP64 is an envelope fusion protein (EFP) only found in L.) worldwide. Our phylogenetic analysis showed that PepMV populations in Southeastern Spain are a mixture species harboring this gene. In this work, we have of two types (PepMV-CH2 and PepMV-EU) of isolates, shownalphabaculoviruses. that this homolog DisaGV is ais functionalthe first betabaculovirus EFP and could which co-circulate in tomato crops after 10 years from enable infection and fusogenicity abilities of a gp64- the introduction of the later viral type. By using two null prototype alphabaculovirus. Therefore, gp64 could molecularly cloned isolates belonging to each PepMV be evolving to complement or even to taking over the regular EFP of betabaculovirus. Keywords: Baculovirus, than the EU isolate in single infections. However, in mixed Diatraea saccharalis, envelope fusion protein, GP64, infections,type, we found there that was the an CH2antagonistic isolate had interaction a higher amongfitness Betabaculovirus. Financial Support: FAPDF, CNPq, PepMV isolates, resulting in the asymmetric represion CAPES. of the CH2 isolate accumulation that may explain how EU isolates are maintained in the PepMV populations. We also found that the viral interaction held among both the presence of other tomato viruses (i.e., Cucumber mosaicPepMV typesvirus was neither host-specific nor affected by when co-infecting, CMV), the suggestingsame plant. aFurthermore, specific strain- our competition for shared plant and/or viral resources October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
25 Oral Presentation
PIV196 - THE SW-5 GENE CLUSTER: ANALYSIS OF PIV246 - DISCOVERY OF POTENTIAL TOMATO RESISTANCE AGAINST TOSPOVIRUSES ENTOMOPATHOGENIC RNA VIRUSES IN THE De Oliveira, A.S.; Kormelink, R.; Resende, R.O. WHITEFLY (BEMISIA TABACI) USING NEXT GENERATION SEQUENCING 1. UNIVERSIDADE DE BRASÍLIA 2. WAGENINGEN UNIVERSITY Nakasu, E.Y.T.; Melo, F.L.; Nagata, T.; Michereff Filho, M.; Souza, J.O.; Ribeiro, B.M.; Ribeiro, S.G.; Lacorte, C.; Tomato spotted wilt virus (TSWV) causes substantial Pereira, J.L.; Inoue-Nagata, A.K. losses on crop production around the world. So far only two natural resistance sources are available for 1. EMBRAPA HORTALIÇAS commercial plant breeding against TSWV and other 2. UNIVERSIDADE DE BRASÍLIA tospovirus species. One of them is the Sw-5b gene 3. EMBRAPA RECURSOS GENETICOS E BIOTECNOLOGIA which encodes a CC-NB-ARC-LRR protein able to halt tospovirus infections in Solanum peruvianum L. and Bemisia tabaci) is one of the most bred S. lycopersicum L., wild and commercial tomato devastating agricultural pests worldwide, due to its high species, respectively. Here we show that the cell-to-cell reproductionThe whitefly rates, ( polyphagy, and its ability to vector dozens of plant viruses. Control methods largely rely the avirulence determinant (Avr) of the Sw-5b-mediated on chemical pesticide use, which is environmentally resistance.moment protein The transient (NSM) of expression TSWV has of been the NSMidentified protein as detrimental and invariably leads to the development triggers a clear hypersensitive response (HR) in tomato of insecticide resistant populations. The use of insect and Nicotiana benthamiana L. harboring the Sw-5b gene. pathogens as biocontrol agents, such as RNA viruses Moreover, it is shown that a high accumulation of the Sw- belonging to Dicistroviridae, Flaviviridae and Reoviridae 5b protein in N. benthamiana leaves achieved by its co- families, is a potential alternative to the current control expression with RNA silencing suppressors (RSS) leads methods. Here we used Illumina next generation to auto-HR in the absence of NSM. In a similar approach sequencing to discover novel RNA viruses infecting B. Sw-5a, the highest conserved paralogous protein of Sw-5b tabaci. Nymphs were collected in commercial crops in from S. peruvianum, also triggered auto-HR while a Sw-5 Goiás and Distrito Federal, from February to November, orthologous protein from susceptible S. lycopersicum, 2014. Samples were extracted and treated with DNase named Sw-5aS, did not. None of those last two proteins, I and RNase A in order to remove non-encapsidated however, were able to trigger a NSM-dependent HR. Truncated and mutated versions of the Sw-5 proteins 286,182nucleic acids. reads Total generated RNA waswere purified trimmed from and the assembled extract, triggering and seems to be suppressed by the CC domain. usingamplified CLC and software, sequenced and inthe an resulting Illumina 108sequencer. contigs All were the revealed that the NB-ARC domain is sufficient for HR- compared against a virus RefSeq database using Geneious auto-HR activity within the NB-ARC domain of the Sw- software. Based on tBLASTx analysis, two contigs were 5aSFurthermore, protein. When a single the mutationlatter was was fused sufficient to the Sw-5b to restore LRR domain, NSM-dependent HR triggering was regained, identity with Aphid lethal paralysis virus, and the second but not in the presence of its own Sw-5aS LRR domain. presentingsimilar to cripaviruses: 61% identity the withfirst sharingBlack queen 33% aminocell virus acid; Finally, subcellular localization studies revealed that the and two other contigs were similar to aparaviruses, Sw-5b protein has a nucleocytoplasmic distribution and presenting 54 and 33% identity with Israeli acute its CC domain signalizes nuclear import. A model for the paralysis virus and Solenopsis invicta virus-1, respectively. activation of the Sw-5b protein and the functionality of Both genera belong to the Dicistroviridae ssRNA virus the other Sw-5 homologs will be discussed. Financial family, carrying a poly-A tail. Therefore, a cDNA was Support: CNPq, FAPDF, CAPES, UnB, WUR. generated by reverse transcription with an oligo-dT
primer using the whitefly RNA sample. PCR targeting stepthe fourtowards contig discovering sequences and confirmed characterizing the presencethese novel of the viruses in the sample. This work represents a first October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
26 Oral Presentation viruses in order to assess their use as biological control recombination event between a OW-like begomovirus agents. Financial Support: CNPq, EMBRAPA. and a divergent geminivirus. Further characterization of cssDNA viruses infecting non-cultivated hosts may PIV273 - BIOLOGICAL AND MOLECULAR shed additional light into their origin, and may lead us to CHARACTERIZATION OF TWO OLD-WORLD-LIKE reconsider the division of begomoviruses into NW and BEGOMOVIRUSES INFECTING THE NON-CULTIVATED OW viruses. Financial Support: CAPES, CNPq, FAPEMIG. PLANT SIDA ACUTA IN BRAZIL Xavier, C.A.D.; Godinho, M.T.; Trindade, A.T.; Lima, VV99 - INFECTIONS AND COINFECTIONS BY A.T.M.; Silva, J.P.; Zerbini, F.M. RESPIRATORY VIRUSES IN SHELTER DOGS, RS, BRAZIL UNIVERSIDADE FEDERAL DE VIÇOSA Monteiro, F.L.; Cargnelutti, J.F.; Martins, M.; Anziliero, The genus Begomovirus (family Geminiviridae) D.; Erhardt, M.M.; Weiblen, R.; Flores, E.F. is comprised of viruses with one or two circular, single-stranded DNA (cssDNA) genomic components 1. UNIVERSIDADE FEDERAL DE SANTA MARIA 2. FACULDADE MERIDIONAL transmitted by the Bemisia tabaci sibling species group to dicotyledonous plants, and includes important Canine infectious respiratory disease (CIRD) is plant pathogens responsible for severe losses in many associated with single or mixed virus infections, caused economically important crops worldwide. Begomoviruses by pathogens that replicate sequentially or in synergism. are divided into New World (NW) and Old World (OW) The main viral agents involved in CIRD include Canine groups based on genomic organization and phylogenetic distemper virus (CDV), Canine parainfluenza (cPIV); relationships. In this study, we performed the biological Canine adenovirus type 2 (CAdV-2) and Canid herpesvirus and molecular characterization of Sida yellow spot virus 1 (CaHV-1). These infectious are especially important in (SiYSV) and Sida golden yellow mosaic virus (SiGYMV), places with high animal density and constant movement. two OW-like begomoviruses isolated from samples of the Although these viruses are distributed worldwide, non-cultivated plant Sida acuta collected in Viçosa, state little information is available about them in Brazil. The of Minas Gerais, in December 2011. The viral genome objective of this study was to investigate the occurrence of respiratory viruses in dog shelters in Rio Grande do clones (DNA-A and DNA-B) were generated to perform Sul state (RS), Brazil, trying to correlate their occurrence thewas amplifiedbiological by characterization. RCA, cloned and sequenced.The two Infectiousgenomic with the environmental conditions. For this, nasal components of both viruses are phylogenetically related secretions were collected from asymptomatic and sick to NW begomoviruses. Nevertheless, their DNA-A animals from three shelters of RS (Cachoeira do Sul #1 components exhibited a highly divergent 5’ half, including and 3; Passo Fundo #2) and tested by PCR for each virus, part of the intergenic region, the CP gene, and an AV2- followed by nucleotide sequencing of the amplicons. like gene (which is present only in OW begomoviruses). Samples of shelters #1 and #3 were obtained during The deduced amino acid sequences of the CP and AV2- the cold season. Shelter #1 presented poor sanitary and like proteins had very low identities with either NW nutrition conditions, high animal density and constant or OW begomoviruses, having greater similarity with a apple trees in China. The presence of conserved motifs in contact among dogs. In this shelter 78% (58/74) of the thedivergent CP and monopartite Rep coding geminivirusregions which recently are characteristic identified in Sheltersrespiratory #2 samplesand #3 presented were positive, satisfactory being 35% sanitary (26/74) and of OW begomoviruses was also detected. Both viruses nutritionin single conditions, infections andwith 43% large (32/74) outdoors in exercise coinfections. areas infected plants in the Malvaceae and Solanaceae families (#2) and animal separation by groups (#3). In shelter does not seem to be transmitted by B. tabaci MEAM1, a(the result latter that with is notvery entirely low efficiency). unexpected Interestingly, considering SiYSV the were#2, 8% positive (5/35) to of CAdV-2 the samples and 1% were to positiveCDV. The to sequences cPIV and high level of divergence of its CP. Our results indicate 6% to CaHV-1; in the shelter #3, 8% (7/77) samples that the origin of SiYSV and SiGYMV involves an ancient to 100% identity with sequences deposited in GenBank obtained from the amplified products resulted in a 98 October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
27 Oral Presentation for the nucleoprotein gene of cPIV and CDV, E3 gene Three weeks after the second immunization, the animals of CAdV-2 and glycoprotein B gene of CaHV-1. Our will be challenged with the 5804p strain and the clinical results demonstrate that respiratory viral infections, course of disease will be followed. The extent of virus replication in peripheral blood mononuclear cells will be and less frequently CaHV-1, are common in dog shelters inespecially RS state, involving Brazil and cPIV their and/or frequency CAdV-2 is related and/or to CDV,dog be analyzed by in vitro proliferation assay. We expect to density, sanitary and nutrition conditions, and year gainquantified new insights and the in severity the relevance of immunosuppression of genetic changes will in season. Financial Support: CNPq – Conselho Nacional de of the rabies virus vector as vaccine platform. Financial Support:the H protein CAPES, for DAAD. vaccine efficacy and in the potential DesenvolvimentoVV109 - IMMUNOGENICITY Científico e Tecnológico. AND EFFICACY ASSESSMENT OF AN INACTIVATED RABIES-BASED VV351 - FIRST REPORT OF SENECAVIRUS A IN PIGS CANINE DISTEMPER VACCINE OF DIFFERENT AGES WITH VESICULAR DISEASE IN Budaszewski, R.F.; Canal, C.W.; Schnell, M.J.; von BRAZIL Messling, V. Leme, R.A.; Diniz, J.A.; Alcântara, B.K.; Possati, F.; Molinari, B.L.D.; Lorenzetti, E.; Favero, L.M.; Oliveira, 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL M. V.; Alfieri, A.F.; Alfieri, A.A. 2. THOMAS JEFFERSON UNIVERSITY UNIVERSIDADE ESTADUAL DE LONDRINA 3. PEI-EHRLICH INSTITUT Senecavirus A (SenA) is the single representative species Rabies and canine distemper viruses are important of Senecavirus genus, Picornaviridae family. Studies canine pathogens and included in routine vaccination conducted in North America have suggested that SenA schedules. While rabies vaccines are inactivated, canine infection might be associated with a vesicular disease distemper virus (CDV) vaccines are live-attenuated, which in pigs known as porcine idiopathic vesicular disease carries the inherent risk of vaccine induced distemper (PIVD). Here we report the molecular detection of SenA in wild carnivore species with higher sensitivity to the in PIVD outbreaks in pigs of Southern Brazilian region. virus. Many of these species are close to extinction, and From February to June, 2015, eight pig farms located the lack of a safe CDV vaccine poses a great challenge for in Paraná and Santa Catarina states reported PIVD conservation efforts. In addition, the genetic divergence outbreaks. Pig population in these farms varied of 200 of circulating CDV strains from the vaccine strains has to 5,000 animals and morbidity rates ranged of 20% been continuously increasing, and an update with a to 90%. Weaned pigs and sows presented claudication, more recent isolate may become necessary. However, the selection and licensing of a new live-attenuated vaccine strain will be time-consuming and costly. To persistedfluid-filled inand the ruptured affected vesicles, animals and for ulcerative approximately lesions address these issues, we generated recombinant rabies 2on weeks coronary and band, then hoovesdisappeared. and/or However, snout. Clinical other signspigs viruses carrying the CDV fusion (F) and attachment started to present the symptoms. Swabs (n=7), scrapings (H) protein of the vaccine strain Onderstepoort or the of ruptured vesicles and ulcerative lesions (n=5) and recent wild type strain 5804p in addition to the rabies n=4) were collected from PIV-affected pigs of the eight farms. In order to evaluate asymptomatic ultracentrifugation and subsequently inactivated with pigsvesicular for SenA fluids infection, ( 14 PIVD non-affected animals virus glycoprotein (G). These viruses were purified by within the same farms also were sampled with scrapings different vaccine candidates, groups of ferrets were of skin. A total of 30 samples were collected from PIVD- beta-propriolactone. To investigate the efficacy of the immunized twice with either the CDV wild type or the affected farms. Additionally, cutaneous tissue samples vaccine envelope protein carrying viruses or with the (n=38) were collected from clinically healthy pigs of 5 CDV Onderstepoort H protein alone. In addition to PIVD non-affected pig herds. Nucleic acid extraction was following the neutralizing and total anti-CDV antibody kinetics, the rabies antibody titers were also analyzed. performed using a combination of phenol/chloroform/ October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentationisoamyl alcohol and silica/guanidinium isothiocyanate XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
28 Oral Presentation methods. RT-PCR assays were performed to detect vaccination in the breeding females were selected. Dams
Teschovirus A,specific Sapelovirus amplicons A, Enterovirus of viral G, agentsPorcine associatedcircovirus-2 withand andwere C4-H3N2 previously viruses. vaccinated One withweek a commercialprior to onset influenza of the Porcinevesicular parvovirus and/or cutaneous. A set of diseases primers such were as designed to sampling,vaccine, which an autogenous contained δ-2subunit H1N1, product γ-H1N1, containing C1-H3N2
Samples were collected every other week, for a total andamplify scraping 542 bp of product ruptured size vesicle of VP3/VP1 and ulcerative region of lesion SenA H3-C4, H1-δ and H1-γ was used to vaccinate all dams. samplesgenome. fromSenA PIVD-affectedwas detected frompigs; allall thesamples vesicular collected fluid swab samples were collected from 12-17 day-old pigs from asymptomatic pigs of PIVD-affected and non- byof eightlitter in samplings. each sampling A hundred and each and farm, thirty for fivea total nasal of
the same group of pigs after transport to the nursery assay;affected phylogenetic herds did notevaluation show amplificationshowed isolates products. from at4320 approximately samples. Oral four fluid weeks samples of age, were for collecteda total of from158 Sequence analyses confirmed the specificity of RT-PCR samples. All samples were submitted to real time PCR in North America. The results suggest that SenA was (Vet MAXTM Gold SIV Detection) and subtyping (Vet theBrazil etiological clustered agent with ofsimilar the vesicular strains ofdisease SenA outbreaksidentified MAXTM SIV Subtyping RNA). Virus viability of positive samples on real time PCR was assessed by virus infection in clinically affected pigs outside of North isolation. Complete genome sequencing was performed America.in evaluated Keywords: pig herds. Picornavirus This is the firstinfections, report ofswine, SenA on positive samples by virus isolation and genetic Seneca valley virus, vesicular skin disease. Financial
PR. sequences of influenza isolates were compared with Support: FINEP, CAPES, CNPq, and Fundação Araucária/ respectively.vaccine strains. H1N2 Influenza subtype A wasvirus the was most detected prevalent in 2.2% for VV355 - DETECTION AND CHARACTERIZATION OF and 31% of pooled nasal swabs and oral fluid samples, INFLUENZA A VIRUS ENDEMIC CIRCULATION IN Two nasal swab samples were submitted to complete SUCKLING AND NURSERY PIGS IN COMMERCIAL genomenasal swab sequencing, and oral which fluid samples,revealed they followed were by a human H3N2. FARMS USING INFLUENZA VACCINE Dias, A.S.; Gauger, P.C.; Vincent, A.L.; Kitikoon, P.; from TRIG H3N2 isolated in 1998 and M segment from Baker, R.B.; Zhang, J. pandemicH1N2-δ1 subtype H1N1 virus. with PB1,HA gene PB2, was PA, 97.6%NS e NP and segments 97.5% 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS similar to the nucleotide and amino acid sequences 2. IOWA STATE UNIVERSITY 3. NATIONAL ANIMAL DISEASE CENTER/ respectively. Results suggest that suckling and nursery UNITED STATES DEPARTMENT OF pigscompared were susceptible to the H1-δ to virus IAV circulating in the subunit in the vaccine, farms AGRICULTURE and suckling pigs may serve as reservoir of IAV, despite reducing clinical disease, but their ability to protect Support: FAPEMIG, CNPq. Influenza vaccines in the United States have helped of influenza vaccination in breeding females. Financial against infection has been inconsistent, and reservoirs VV369 - GENETIC HETEROGENEITY OF THE VP6 GENE that allow the viral circulation are unknown. The AND PREDOMINANCE OF G6P[5] GENOTYPES IN objectives of this study were to evaluate the level of BRAZILIAN FIELD STRAINS OF PORCINE ROTAVIRUS C influenza infection in suckling and nursery pigs on Possatti, F.; Lorenzetti, E.; Molinari, B.L.D.; Leme, R.A.; farms using influenza vaccination in breeding females, to Massi, R.P.; Otonel, R.A.A.; Alfieri, A.A.; Alfieri, A.F. theirdetermine phylogenetic the influenza relationship subtype(s) with present the vaccine in these strains pigs UNIVERSIDADE ESTADUAL DE LONDRINA and to compare the influenza sequences isolated and used in the herd. Four farms from the same production Porcine rotavirus C (RVC) is an important cause of enteritis in piglets, and has been considered an systemOctober 2015 in Midwest Volume 20 United – Supplement States 1 - usingAbstracts/Posters influenza - virusOral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
29 Oral Presentation emergent pathogen. Besides, a high incidence of this VV427 - CIRCULATION OF ALPHA- AND infection has been demonstrated in Brazilian pig herds. BETACORONAVIRUS SUBGROUP C IN BATS FROM The aim of this study was to investigate the genetic BRAZILIAN’S URBAN AND ATLANTIC FOREST BIOME diversity of porcine RVC strains detected in suckling Góes, L.G.B.; Campos, A.C.A.; Ceara, C.C.; Ambar, G.; piglets during 2011 to 2014 in six states, which are in Souza, M.C.P.; Crispin, L.A.C.; Neto, A.P.C.; Queiroz, L.; three distinct geographical regions. The VP6, VP7, and Durigon, E.L. 1. UNIVERSIDADE DE SÃO PAULO 2. UNIVERSIDADE ESTADUAL PAULISTA andVP4 the genes phylogeny of 15 wild was typeanalyzed RVC strainsin comparison identified with in 3. UNIVERSIDADE DE SANTO AMARO otherdiarrheic RVC fecal sequences samples werethat amplifiedare available and sequenced,in public Epidemiological and phylogenetic studies indicate VP7, and VP4 genes, with nucleotide cut-offs of 87%, that four out of six coronavirus (CoV) capable of 85%,databases. and 83%, The recentlyrespectively, proposed was adopted classification to determine of VP6, infecting humans are the result of CoV spillover by the the genotypes of the analyzed strains. The VP6 gene transmission of virus from bats to humans. Over the past analysis demonstrated a considerable heterogeneity 13 years, two highly pathogenic CoV were isolated from between the 15 RVC strains, which showed 83.2 to 98% humans, CoV-SARS (Severe Acute Respiratory Syndrome) of nucleotide identity to each other. In the phylogenetic and the CoV-MERS (Middle East Respiratory Syndrome) with a mortality rate of 10 and 37%, respectively. three distinct porcine genotypes (I1, I5, and I6). Analysis oftree the the VP7 Brazilian gene revealed porcine that RVC all field strains strains from clustered this study in CoV in bats, including CoV with high genetic similarity Subsequent studies have identified a great diversity of belonged to the G6 genotype and shared high nucleotide with CoV-MERS and CoV-SARS and some capable to identity with each other (88.3-98.4%). The highest use the same human cell receptor. Despite the great genetic heterogeneity was detected in the VP4 gene diversity of CoV in bats, the large number of bat species analysis. The nucleotide identity between the 15 RVC in Brazil, the recent history of CoV emergence and the strains ranged from 61.4 to 98.4%. Only one strain (UEL- has analyzed the circulation of bat coronavirus (BatCoV) genotypesclassification in ofBrazilian’s Brazil as bats.a Hotspot The presentregion, fewstudy studies aims high77) was heterogeneity classified as in thethe P[4]VP6 gene,genotype, which while is considered all of the to evaluate the occurrence and diversity of CoV in bats aother conserved strains gene. were theHowever, P[5] genotype. the VP7 Theand resultsVP4 genes showed had from different disturbance gradients of Atlantic Forest Biome (AFB), Brazil, covering different species, feeding the most commonly (n=14) detected in strains from the habits and habitats. Intestine tissues from 401 Brazilian Brazilianlow diversity. pig herds The genotypeevaluated, combination indicating its G6P[5] probable was bats distributed in 17 species were screened for CoV predominance in this country regardless of temporal by Nested PCR assay targeting the RNA polymerase or geographical distribution, similar to Japanese pig RNA dependent gene. CoV RNA were detected in 15 herds. This combination was also detected in the USA individuals from eight bat species including Artibeus in the RV143 strain, showing that it is circulating in lituratus (3), Carollia perspicillata (3), Eumops glaucinus Asia and the Americas. The molecular data from this (1), Glossophaga soricina (1), Molossus rufus (2), Myotis study contributes information on the ecology, evolution nigricans (1), Myotis riparus (1) and Sturnira lilium and diversity of the RVC strains circulating throughout the world. Furthermore, to our knowledge this is the Phylogenetic analysis indicate the circulation of the six Alphacoronavirus(3) showing the general prevalence of Betacoronavírus3,7% (15/401). from porcine RVC strains in South America. Keywords: (α-CoV) and two Diarrhea,first study Genotypes,reporting the Piglets, VP6, VP4,RVC. andFinancial VP7 genotypes Support: Sturnira(β-CoV) and lineages, Eumops including genera. 3CoV new sequences genotypes. obtained CoV fromlineages bats where of same detected genera for presentedthe first time high in nucleotidespecies of CAPES, CNPq, and Fundação Araucária (FAP/PR). similarity between each other (e.g. Artibeus, Glossophaga, Carollia, Molossus, Myotis and Sturnira), even when October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
30 Oral Presentation
bona fide orthologous genes RNA where detected in two bat species and sequences shared among mimi-BR and representatives of Mimi-G1 detected from bats of geographical distant regions. β-COV lineagestool was usedA-C, tousing define the the reciprocal best hits strategy of CoV-MERS. Our results indicate the great coronavirus with 1e-3, 30% and 70% as thresholds for the BLASTp clustered together with β-CoV subgroup “C”, same clade e-value, identity and coverage of amino acid sequences, of CoV from same clade and genera of highly human respectively. The OrthoMCL tool was used to identify pathogenicdiversity in batsCoV fromreinforcing Brazil andthe confirmnecessity the of circulation expanded the paralogous families of each mimi-BR proteins. The and continuous surveillance of CoV in Brazilian’s bat BLASTclust program was used to estimate the pan- genome size of mimi-BR. The genome of mimi-BR presented a similarity of 97-99% among them, taking fauna.EV92 Financial - PAN-GENOME Support: FAPESP ANALYSIS 2013/11006-0. OF BRAZILIAN out the Kroon virus, that showed a low similarity (90- LINEAGE A AMOEBAL MIMIVIRUSES 91%) with others mimi-BR. A total of 3,877 proteins Assis, F.L.; Bajrai, L.; Abrahao, J.S.; Kroon, E.G.; encoded by mimi-BR were grouped into 974 orthologous Dornas, F.P.; Andrade, K.R.; Borato, P.V.M.; Pilotto, clusters. Indeed, we were able to identify 3 new ORFans M.R.; Robert, C.; Benamar, S.; La Scola, B.; Colson, P. in Kroon virus genome. The true transcription of these 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. AIX-MARSEILLE UNIVERSITÉ phylogeneticaly grouped into mimivírus group 1 lineage 3. UNIVERSIDADE FEDERAL DE SANTA A.ORFans The future were works confirmed about bythe qPCR. diversity All of mimi-BR mimi-BR were can CATARINA help us to elucidate some questions about mimivirus life cycle and its clinical importance. Keywords: Mimiviridae, The family Mimiviridae is comprised by large DNA viruses infecting amoebal species (Group 1), which is Brazilian mimivirus, giant viruses, pan-genome. subdivided into lineages from A to C, and a distantly Financial Support: CNPq, FAPEMIG, CAPES, MAPA, PRPq. related mimivirus, named Cafeteria roenbergensis virus EV102 - DETECTION OF COMMON, EMERGING (Group 2), which infects a marine heterotrophic bi- AND UNCOMMON VP4 AND VP7 HUMAN GROUP A ROTAVIRUS GENOTYPES FROM URBAN SEWAGE SAMPLES IN URUGUAY prospectionflagellate. Since of mimivirusthe discovery from of Sambadifferent virus environmental in 2011, the Tort, L.F.L.; Victoria, M.; Lizasoain, A.; Berois, M.; conditions.first Brazilian The mimivirus, aim of this our work team was has tobeen sequence engaged and in Cristina, J.; Leite, J.P.G.; Gómez, M.M.; Miagostovich, analyze the pan-genome of Brazilian mimivirus (mimi- M.P.; Colina, R. BR), besides evaluate their diversity and phylogeny. The viruses described in this work were isolated from (1) 1. UNIVERSIDAD DE LA REPUBLICA Amazonia virus (AMAV): water samples of Negro river, 2. INSTITUTO OSWALDO CRUZ Amazon forest, in 2011; (2) Kroon virus (KROV): water Environmental approach has proven to be a useful sample of an urban lake on Lagoa Santa city, Minas tool for epidemiological studies demonstrating Gerais State in 2012; and (3) Oyster virus (OYTV): oyster through environmental studies the diversity of viruses samples farmed on the Atlantic coast, Florianópolis, circulating in a given population. The aim of this study Santa Catarina state, in 2013. The genomes were was to perform a phylogenetic characterization of the sequenced by the Illumina MiSeq instrument. The group A rotavirus (RVA) G- and P-genotypes obtained sequence reads were assembled de novo using ABYSS from sewage samples (n = 116) collected in six cities of software. The gene predictions were performed using Uruguay during March 2011 to April 2013. A worldwide GenemarkS tool. The functional annotations were standardized Semi-Nested Multiplex RT-PCR protocol inferred by BLAST searches against the GenBank NCBI directed against VP4 and VP7 genes were conducted non-redundant protein sequence database (e-value <1e- for RVA detection and consensual DNA fragments 3), and by searching specialized databases implemented by Blast2GO platform. The collinearity between mimi-BR genotype was successfully determined by phylogenetic was checked using MAUVE program. The Proteinortho analysiswere submitted in 61% (n to = nucleotide37) of the positive sequencing. samples P and/orobtained G
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
31 Oral Presentation by Semi-Nested Multiplex RT-PCR (n = 61). The RVA to physico-chemical and bacteriological parameters, the genotypes were as follow: G1 (n = 2), G2 (n = 14), G3 (n = AdV) had the highest rates of thermotolerant coliforms Interestingly, through phylogenetic analysis, emerging first collection point (with three positive samples for and5), G12 uncommon (n = 2), P[4] human (n = 4), genotypes P[8] (n = 16)could and be P[3] detected. (n = 2). 2 Results obtained from the comparison of RVA genotypes in(1002000MNP relation to other / 100ml), points. However, total suspended the presence solids of (31.2 AdV detected in the current study and Uruguayan RVA strains didmg /not L) and show biochemical statistical oxygen correlation demand among (38.4 mgevaluated O / L) previously described for contemporary clinical pediatric physico-chemical and bacteriological parameters. cases showed that monitoring sewage may be a good These results suggest that viral analysis should be screening option for a rapid and economical overview included in the water quality evaluation required by of the circulating genotypes in the surrounding human applicable regulation, which currently is based only population and a useful approximation to study RVA on bacteriological parameters. The presence of AdV in epidemiology in a future vaccine monitoring program. sewage, showing the impact generated by urbanization that describes the phylogenetic diversity of RVA from andArroio the Pinhal importance samples of confirmed virological the analysis contamination in water. by urbanThe present sewage study samples. represents Financial the first reportSupport: in UruguayProjeto Financial Support: UCS, ISAM.
ALI-2009-1-1603, Projeto CSIC I+D 2010 (Uruguay), EV341 - ACQUISITION, STABILITY AND INACTIVATION PoloCAPES: de PCPPDesarrollo 023/2011, Universitario Projeto ANII(PDU, (Uruguay): UDELAR-Salto, ANII- OF ENTERIC VIRUSES IN OYSTERS CRASSOSTREA Uruguay). GIGAS Pilotto, M.R.; Souza, D.S.M.; Dominot, A.F.A.; Barardi, EV180 - PRESENCE OF ADENOVIRUS AND C.R.M. CORRELATION WITH PHYSICO-CHEMICAL AND UNIVERSIDADE FEDERAL DE SANTA CATARINA BACTERIOLOGICAL PARAMETERS IN ARROIO PINHAL CAXIAS DO SUL MUNICIPALITY (BRAZIL) Goulart, N.; Hahn, R.C.; Girardi, V.; Magrini, F.E.; started to be required by the Brazilian government with The process of shellfish purification through depuration Bortolin, T.A.; Schneider, V.E.; Paesi, S. the establishment of the Hygienic Control Program of Bivalve Mollusks in 2012, but further recommendation UNIVERSIDADE DE CAXIAS DO SUL The Adenovirus (AdV) is an enteric virus that causes has not been suggested. More stable and prevalent in gastroenteritis and may be used as indicator for water environmentalon how it should samples be performed than bacteria, or on enteric its efficiency viruses contamination by industrial and domestic sewage. are generally related to gastroenteritis outbreaks Arroio Pinhal belongs to Caí River Watershed, and has associated with the consumption of contaminated its source in the urban area of Caxias do Sul municipality oysters. However, virus detection methods are usually (Brazil). This stream is being affected by antropic actions based on genome detection rather than infectious virus detection. Therefore, this work aimed at evaluating: i) the treatment. The main goal of this study was to evaluate the accumulation of viral pathogens on oysters Crassostrea AdVmainly presence due to inthe Arroio discharge Pinhal of and effluents correlate without its presence proper gigas with physico-chemical and bacteriological parameters. pathogens in controlled conditions of temperature Five collections were performed from July 2013 to May artificially contaminated; ii) the stability of these 2014 in three different sites of the stream. Samples were viruses. Human adenovirus type 2 (HAdV-2) and concentrated and subsequently submitted to nucleic acid murineand iii) norovirus the depuration type 1 efficiency (MNV-1) in were inactivating used, as thesewell as detection methodologies of infectious viruses. The Mini Kit - Invitek®) and further analyzed by polymerase behavior of the viruses was different in the oyster’s extraction with a commercial kit (RTP® DNA / RNA Virus analyzed samples nine were positive for AdV (60%), reaching its peak of viral uptake after 8h, and the MNV-1 thosechain were reaction all collected (PCR) for during amplification. fall and winter. Out In of relation fifteen afterartificial 24h. bioaccumulationThe two viruses were process, stable with for the96 hours HAdV-2 in
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
32 Oral Presentation oysters maintained under 4°C, but they were completely and centrifuged before supernatant collection. Cultures inactivated in steamed oyster samples cooked for up to of Acanthamoeba polyphaga were cultivated in PYG 9 minutes at 100°C. Although theoretically the HAdV-2 is medium in 24-well microplates, inoculated with the more stable than the MNV-1, once DNA viruses are more supernatants, incubated at 30 ºC and examined daily in resistant than RNA viruses, this was not observed during search for cytopathic effect (CPE) up to 72 hours after the depuration process. The HAdV-2 was completely inoculation. When CPE was evident, the supernatants inactivated after 12h by the U.V. light, and after 24h no more infectious virus was observed in the tank without 25% sucrose gradient. Five out of sixteen pools induced U.V. light too. However, after 72h of depuration, the MNV- clearwere CPEcollected, and one clarified of the andisolates ultracentrifuged was submitted through to DNA a 1 was still detected in both tanks, with only a 1,1 log extraction and complete sequencing of the viral genome reduction until this time. This is probably a consequence in a NGS apparatus (Illumina Miseq). The genome of of the interaction of the virus with the oyster’s tissue. It the virus tentatively named Golden marseillevirus-like is well known that the human noroviruses can interact consists of a single DNA molecule of 360,189 bp, with with oyster’s cells and for that reason, the virus release a G+C content of 43.1%. The preliminary analysis of the translated nucleotide sequence shows viral proteins occur. If there is also an interaction between the MNV- match with other members of Marseilleviridae such as 1during and the the oyster’s filter feeding cells, this process can result is more in the difficult need toof marseillevirus, lausanevirus and cannesvirus, indicating longer periods of depuration to remove this virus from that this newly described virus is part of this family. This the tissue of infected oysters. Thus, it is important to know which pathogens oysters can be in contact with giant virus from golden mussels and indicates that these at the harvesting area, to establish the secure period of virusesis the first are likely study ubiquitous that demonstrates in environmental the isolation samples. of a time that ensures a clean and safe product in the end. Financial Support: CAPES, FINEP, CNPq, FAPERGS.
BV206 THE MECHANISM OF CD4 DOWNREGULATION FinancialEV409 - Support: GOLDEN CNPq MARSEILLEVIRUS-LIKE: 472804/2013-8. A NEW BY HIV-1 NEF REVEALS DISTINCT ROLES FOR Γ1 AND AMOEBAL GIANT VIRUS Γ2 ADAPTINS IN INTRACELLULAR TRAFFICKING Santos, R.N.; Campos, F.S.; Albuquerque, N.R.M.; Ortiz, Tavares, L.A.; da Silva, E.M.; Carvalho, J.V.; Dasilva, L.L. L.C.; Arantes, T.S.; Assis, F.L.; Abrahão, J.; Roehe, P.M.; 1. RIBEIRÃO PRETO MEDICAL SCHOOL - Franco, A.C. UNIVERSITY OF SÃO PAULO 1. UNIVERSIDADE FEDERAL DO RIO GRANDE 2. OKLAHOMA MEDICAL RESEARCH DO SUL FOUNDATION 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS discovery of Acanthamoeba polyphaga mimivirus. In SyndromeThe Human (AIDS) Immunodeficiency and has a worldwide Virus (HIV) distribution. is the 2007,In 2003, the giant Acanthamoeba viruses were polyphaga first described marseillevirus with the Duringetiologic its agentlife cycle, of HIV the promotes Acquired changes Immunodeficiency in host-cell (APMAV) was isolated from water samples collected from a cooling tower in Paris. Such viruses have been found escape defense mechanisms. A key mediator of these mainly in environmental water samples, are protist- changesprotein traffickingis Nef, a virally to optimize encoded virus accessory replication that and binds to associated and are included in a major monophyletic to a number of molecules that control protein sorting. group known as nucleocytoplasmic large DNA viruses. Among the several functions of Nef, the most prominent Aiming the investigation of the presence of giant viruses is the downregulation of surface proteins implicated in in mussels that inhabit the Guaiba lake, Porto Alegre, immune responses, such as the CD4 receptor. It is now brazil, golden mussels (Limnoperna fortunei) were clear that the activity of Nef leads to degradation of CD4 collected and prepared as follows. Forty specimens were in lysosomes, but the molecular mechanisms involved pooled in groups of 5 specimens (internal water and are not entirely elucidated. Nef binds to the adaptor body, totalizing sixteen pools), homogenized with PBS protein 2 (AP2) complex and the cytosolic tail of CD4
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
33 Oral Presentation in clathrin-coated pits, forcing CD4 endocytosis and compatibility. The objective of this study was to identify directing it to lysosomes. However, Nef also interacts and characterize R. solani in Zoyzia grass and to detect with AP1, suggesting that this complex may also play a the presence of the mycovirus in it. The fungal isolation role in Nef-mediated intracellular retention of CD4. To investigate this possibility, we separately knockdown medium and non-ionic cellulose chromatography the expression of the two isoforms of the large subunit of from infected turfgrass tissue, its culture in specific samples collected in the municipalities of São Paulo, Cotia,extraction Bragança of virus Paulista, isolation Ilhabela were performed and Itapetininga. on 25 field All preventsAP1, the adaptins the decrease γ1 and of γ2,CD4 in surface HeLa cells. levels Flow by Nef.cytometry Under isolates of R. solani originated dark brown colonies after theseanalysis conditions, showed reduction that depletion of total oflevels AP1-γ2 of CD4 partially by Nef 30 days at 25°C, aerial hyphae, multinucleated cells, no was also impaired, as revealed by western blot analysis. zonation or sclerotial formation and varying degrees expression of Nef leads to the accumulation of CD4 in late in all fungal isolates was displayed a similar pattern endosomes,In addition, indicatingwe observed that that anterograde in AP1-γ2 transport depleted of cells, CD4 of dsRNA virulence bands to Zoyzia whose grass. numbers By electrophoretic and size ranged profile from to lysosomes is compromised. Interestingly, depletion of three to six bands, larger than 2 Kb and larger than 10 Kb in size. In all of them it was possible to visualize CD4. To test whether a form of AP1 complex comprising the formation of dsRNA bands about 10 kb, consistent AP1-γ1 did not affect the Nef-induced downregulation of with dsRNA size of Hypovirus and Endornavirus genres. Although the molecular characterization of dsRNA is subunitγ2 is required of AP-1 for(AP1-µ1). CD4 downregulation, We observed that rather depletion than ofγ2 µ1 alone, also wecompromises knockdown Nef-induced expression downregulation of the medium of virus, the presence of dsRNA bands larger than 10 of CD4. Therefore, we identify that targeting of CD4 for kbnecessary may indicate for the the correct occurrence identification of Endornavirus of the species in the evaluated isolates, since it is very common in R. solani. Moreover, the formation of dsRNA bands larger than 2 lysosomal degradation induced by Nef requires AP1-γ2, kb can indicate the presence of species of Totiviridae, ofbut AP-1 not AP1-γ1. complexes Together with ourdifferent data also functions provide in evidence protein Chrysoviridae, Partitiviridae families, since isometric sorting.that γ1 and Financial γ2-adaptins Support: may composeThe São two Paulo distinct Research forms particles of approximately 35 to 50 nm in diameter were Foundation (FAPESP). visualized in transmission electron microscopy. The constant presence of dsRNA in R. solani isolates from BV234 HIGH MOBILITY GROUP BOX 1 (HMGB1) Zoyzia grass is a strong indication of mixed infection IS IMPORTANT FOR HUMAN PAPILLOMAVIRUS- by mycovirus, since they are ubiquitous in R. solani, TRANSFORMED CELLS SURVIVAL however they have not been associated with different Silva, A.M.; Montenegro, A.; Abjaude, W. da S.; Morale, degrees of virulence in the pathogenicity tests, as it was G.M.; Lino, V. de S.; Boccardo, E. obtained in this work. INSTITUTO BIOLÓGICO BV280 BOVINE LACTOFERRIN INHIBITS HUMAM In recent years, there has been a growing interest RHINOVIRUS 14 INFECTION in biological control with mycoviruses, viruses that Denani, C.B.; Santos, R.A.; Hohn, A.R.; Carvalho, parasites fungi and may interfere with the pathogenicity C.A.M.; Rocha, V.P.; Silva, J.L.; Oliveira, A.C.; Gomes, of them. Rhizoctonia solani, a phytopathogenic fungi that A.M.O.; Gonçalves, R.B. causes a serious disease in Zoyzia japonica (Zoyzia grass) in climatic conditions of low temperatures and humidity 1. UNIVERSIDADE FEDERAL DO RIO DE increase, known as Large Patch, is affected by mycovirus. JANEIRO 2. UNIVERSIDADE FEDERAL DO ESTADO DO The disease is common everywhere this turfgrass is RIO DE JANEIRO cultivated. In Brazil, Zoyzia grass corresponds to 74% of total marketed lawn. R. solani is a complex species, made Rhinovirus, the causative agent of the common cold, up of groups and sub-groups with a variety of somatic is responsible for enormous damages to the world
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
34 Oral Presentation economy and health. Lactoferrin (Lf), a glycoprotein present in mucosal secretions of mammals, is widely due to the possibility of the emergence of a virus with studied for its antiviral activity. The mechanisms of Lf increasedsegmented pathogenicity.viruses and can Our have studysignificant investigates implications the antiviral activity already described include intracellular limits of occurrence of reassortment between different biochemical processes, interaction with cell surface viruses within the Orthobunyavirus Simbu serogroup and competition for virus receptors. Our aims are to (Oropouche, Perdoes, Leanyer, Oya, Schmallenberg, and study the interaction of lactoferrin with HeLa H1 cells, Akabane viruses). Using a minigenome assay we have how it interferes with the virus infection cycle and if analysed viruses from the human and ruminant Simbu this protein has an antiviral activity against HRV14. We clades along with the family prototype Bunyamwera used confocal microscopy to observe the interaction virus (Bunyamwera serogroup). We constructed between lactoferrin and HeLa-H1 cells and to investigate respective virus minigenomes using the M segment the dynamic of internalization of this protein. Antiviral activity of lactoferrin was investigated by plaque assay By transfecting cells with expression plasmids for a UTR of each virus flanking a Luciferase reporter gene. assays showed that Lf was able to protect the cells against proteins along with the minigenome of a different viraland fluorescence infection, mainly confocal when microscopy. we incubated Reduction lactoferrin plaque virus,specific we viral used nucleocapsidLuciferase activity (N) andas an polymerase indication that (L) and cells during this infection. Time-lapse microscopy a potential genomic rearrangement between the tested experiments showed that Lf is observed bound to the viruses could occur in nature. We found that the M cell membrane, in cytoplasmic regions and also with a UTR sequence appears to be a contributing factor that restricts reassortment, since the L and N proteins of a were infected in the presence of Lf, formation of blebs, given virus are able to recognize and use different UTRs characteristicperinuclear distribution structures of at viral specific infection, times. was When reduced. cells as a promoter. We also demonstrate that for luciferase activity to occur it is essential that the L and N proteins microscopy suggest that antiviral activity of lactoferrin were from the same virus, reinforcing the hypothesis mayPlaque be caused reduction by interfering assay and with fluorescence early to intermediate confocal that the S and L segments of Bunyaviruses segregate as a stages of the viral infection cycle. Antiviral activity of pair during genomic reassortment. Our results shed light lactoferrin may suggest this protein as an alternative on the possible mechanisms of genomic reassortment treatment of common colds and stimulate its study for between different Simbu viruses and the importance of other viruses. Financial Support: FAPERJ, CNPq, FINEP, correct UTR sequences for this process to occur. This is CAPES. to predict possible reassortment between different BV283 MINIGENOME ACTIVITY WITHIN THE Bunyaviruses,the first time thatand acan minigenome contribute assayto understand has been virus used BUNYAVIRUS SIMBU SEROGROUP AND IMPLICATIONS evolution in this important viral family. Financial FOR GENOME REASSORTMENT Support: NLTL supported by Medical Research Council Acrani, G.O.; Tilston-Lunel, N.L.; Elliott, R.M. postgraduate studentship (1101085), RME supported by 1. FMRP - UNIVERSIDADE DE SAO PAULO Wellcome Trust Senior Investigator Award (99220), and 2. MRC-UNIVERSITY OF GLASGOW CENTRE FOR VIRUS RESEARCH GOA supported by FAPESP BEPE grant 2013/02798-0. Bunyaviruses have a negative sense RNA genome coded in three single stranded segments called L (large), M (medium) and S (small). When two of these genetically related viruses infect the same susceptible cell at the same time the possibility for a combined viable virus progeny with a varied mixture of L, M and S RNAs from the two parental viruses can arise. This phenomenon, known as genomic reassortment, is common with all
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
35 Oral Presentation
BV370 IDENTIFICATION OF MICRORNAS AND pathways include genes related to neuropathogenesis, CELLULAR FACTORS MODULATED BY OROPOUCHE transcription, antiviral restriction, innate immunity INFECTION factors, ubiquitylation, apoptosis and cap snatching all Geddes, V.E.V.; Ribeiro-Alves, M.; Arruda, E.; Aguiar, relevant for OROV pathogenesis. Taken together, our R.S. results show that miRNAs screening is a powerful tool to identify new host factors involved in replication and 1. UNIVERSIDADE FEDERAL DO RIO DE pathogenesis of emerging viruses with no information JANEIRO 2. FUNDAÇÃO OSWALDO CRUZ - of prospective research targets to better elucidate OROV BIOMANGUINHOS interactionsregarding its withviral hostbiology. cells. Our Financial findings Support: open a myriad CNPq, 3. FACULDADE DE MEDICINA DA UNIVERSIDADE DE SÃO PAULO - RIBEIRÃO CAPES, FAPERJ. PRETO BV381 MULTIPLE EFFECTS OF TOXINS ISOLATED The Oropouche Virus (OROV) causes a fever disease FROM CROTALUS DURISSUS TERRIFICUS ON considered the second most prevalent arbovirosis HEPATITIS C LIFE CYCLE in northern Brazil, behind Dengue fever. The virus is Shimizu, J.F.; Batista, M.N.; Campos, G.R.F.; Bittar, C.; transmitted by mosquitoes belonging to Culicidae family Cintra, A.C.O.; Sampaio, S.V.; Aquino, V.H.; Rahal, P.; and the human infections are associated to severe cases Jardim, A.C.G. of fever and encephalitis. OROV are enveloped virus with three negative single strand RNAs molecule as genome 1. GENOMICS STUDY LABORATORY, INSTITUTE OF BIOSCIENCE, LANGUAGE AND EXACT belonging to Bunyaviridae family. The virus was isolated SCIENCE, SÃO PAULO STATE UNIVERSITY in 1955, however several steps of its replicative cycle are 2. LABORATORY OF VIROLOGY, INSTITUTE unknown. In this study, we aimed to evaluate differential OF BIOMEDICAL SCIENCE, FEDERAL expression of cellular miRNAs in OROV infected cells UNIVERSITY OF UBERLÂNDIA, UBERLÂNDIA in order to identify new cell factors relevant to virus pathogenesis. Initially, we evaluate the susceptibility Hepatitis C virus (HCV) is a public health problem of several cell models (lymphocytes, monocytes, worldwide. It is one of the main causes of liver disease astrocytes, endothelial cells and hepatocytes) to OROV and transplantation. There is no vaccine for HCV. The infection in attempt to identify to best model to be used. current interferon-based therapy is expensive, not The hepatocyte cell line Huh-7 was highly susceptible effective for all treated patients and presents many to OROV infection reaching up to 90% infected cells side effects. Although the development of new direct- acting antivirals (DAAs) such as the NS3 protease miRNAs using panels for 754 human miRNAs with inhibitors has improved therapeutic options, the high Taqmanat MOI 1.0.technology. We identified Only two 14 deregulated differentially miRNAs expressed were costs, additional side effects and the described viral selected: miR-576-3p (2.5x upregulated in infected resistance to its treatment demonstrate the need of more cells) and miR-217, expressed only in infected cells. The two miRNAs were used to predict 195 possible regulated treatment. In this context, natural sources can provide efficient antivirals, or combination of therapies for HCV mRNAs targets using 6 microRNA database banks. Our results demonstrated enrichment in pathways related with therapeutic potential. Compounds isolated from an alternative approach to the identification of products to cell metabolic and regulation processes, as well in toxins of animal venoms have shown antiviral activity pathways related to mRNA processing, synthesis and for other viruses as dengue, yellow fever and measles regulation suggesting that OROV infection modulate virus. Therefore, this study aims to evaluate the effects of the toxins (crotoxin, crotapotin and PLA -CB) extracted RNA pathways. The modulation of 90 target genes 2 were validated in OROV infected cells by RT-qPCR. We from Crotalus durissus terrificus on HCV life cycle. Huh found 39 differentially expressed targets genes, with 7.5 cells were infected with HCVcc JFH-1strain in the 26 genes presenting lower expression levels in infected presence or absence of the toxins and titration was cells corroborating the miRNA regulation pathway. The performed by focus formation units assay. Toxins were
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
36 Oral Presentation added to the cells in different time points depending on the stage of life cycle to be evaluated: before, during and replication was determined by plaque assay on BHK-21. after infection for pre-treatment, entry and replication At different hours post-infection the efficiency of viral assays, respectively. In virucidal assay, virus was pre- detection in culture. Cell viability was assessed by MTT incubated with toxins for 1 h before infecting Huh-7.5 assayImmunofluorescence and cell integrity was was performed determined for by viral the antigenrelease cells and to viral release analysis, intra and extracellular of enzyme lactate dehydrogenase (LDH) in conditioned medium. A129 mice, knockout for receptor of type I showed that treatment with PLA2-CB presented a interferon, were infected subcutaneously in the left hind reductionlevels of HCV of RNAapproximately were quantified 70% byof qPCR.virus Thereplication results footpad with 2 x 105 PFU of virus. At different days post- and blocked 97,3% of viral entry Pre-treatment of cells infection, serum and muscle tissues were collected for reduced 73% of infectivity and virucidal effect was subsequently analysis of viral titer by plaque assay. Our 97%. No effect as observed on virus release. Crotoxin results demonstrate that myoblasts are susceptible to inhibited 85% of HCVcc entry, presenting 76,5% of MAYV infection. MAYV replication reached the maximum virucidal effect and showed an inhibition of 78% in HCV peak of viral replication 30 hours post-infection, were release, although no inhibitory effect on HCV replication viral load increased 3 log of input. At this moment, it and pre-treatment was observed. Crotapotin reduced was possible to detect the alphavirus E1 protein by 50% of HCV release but had no effect on blocking entry, as virucidal, by pre-treating cells or on replication. Our increase in viral load, infection promoted a reduction data demonstrated that toxins extracted from C. durissus inimmunofluorescence cell viability in about microscopy. 60 % which Concomitant correlates to with the terrificus presented multiple effects on HCV life cycle an increase in LDH release of 50%. Infection of A129 and could be used as a future anti-HCV treatment, or as a mice resulted in a systemic replication. MAYV was template to the development of new antivirals. Financial infection, reaching a title of 107 CAPES. infectiousdetected at MAYV high levelswas detected in serum very on theabundantly first day in post- the Support: FAPESP (2011/11753-4) e (2013/03897-1), gastrocnemius muscle and thigh musclePFU/ml. tissue Furthermore, with title BV432 MAYARO VIRUS REPLICATION IN PRIMARY of 107 HUMAN MYOBLASTS AND MICE MUSCLE IN VIVO: that myoblasts, as well the muscle tissue of the mouse IMPLICATIONS IN THE PATHOGENESIS OF MYALGIA model are PFU/g prime of targets tissue. of This MAYV. study Replication provides on evidence muscle AND MYOSISTIS INDUCED BY ALPHAVIRUS cells promotes an extensive cell damage that could be Figueiredo, C.M.; Neris, R.L.; Ladislau, L.; Benjamim, associated with muscle symptoms in patients. Moreover, C.F.; Assunção-Miranda, I. high titers of MAYV in the muscle indicate that this tissue UNIVERSIDADE FEDERAL DO RIO DE JANEIRO can contribute to the improvement of viremia. Financial Support: CAPES. Mosquito-borne Mayaro virus (MAYV) belongs to the family togaviridae, genus alphavirus. MAYV infection is HV197 MIMIVIRUS: GENOME AND NEUTRALIZATION characterized by febrile illness, accompanied by muscle ANTIBODIES DETECTION IN RURAL BRAZILIAN and joint pain that can persist for months or years. HUMANS Molecular mechanisms of alphavirus pathogenesis Dornas, F.P.; Costa, G.B.; Silva, L.C.F.; Boratto, P.V.M.; are not well understood. The extent and persistence Kroon, E.G.; Scola, B.; Trindade, G.; Abrahao, J.S. of symptoms can be associated with viral replication in the infected target cells. The aim of this study was 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS to investigate muscle susceptibility to MAYV infection. 2. AIX MARSEILLE UNIVERSITE Thereby, we performed in vitro experiments in primary The proposed order Megavirales comprises giant human myoblasts. In addition, we conducted in vivo viruses that infect hosts from different taxas. The free- studies in mouse model of infection. MAYV infection of living amoebas from genus Acanthamoeba have showed myoblast was assessed at a multiplicity of infection of 5. The cells were incubated for 2 hours at 37 °C in a 5% CO . known about infections in other hosts. In the last years, 2 host specificity from new species, however, little is October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
37 Oral Presentation the giant viruses from the family Mimiviridae have been HV204 IN SILICO DIVERSITY ANALYSIS OF HUMAN researched as infectious agents in humans as well in wild ENDOGENOUS RETROVIRUS W TRANSCRIPTS and domestic animals including positive detection in Bos REVEALS DISTINCT PATTERNS OF EXPRESSION taurus. Although the veterinary relevance of these data IN BLOOD AND BRAIN SAMPLES OF MULTIPLE still needs to be investigated, we believe that humans SCLEROSIS PATIENTS that occupationally handle bovines may be at risk of Nali, L.H.S.; Urbano, P.R.P.; Olival, G.S.; Silva, D.F.; mimivirus exposure. Considering these possibilities, Penalva de Oliveira, A.C.; Romano, C.M. our group researched the circulation of mimiviruses in serum of human from different rural areas of Minas 1. INSTITUTO DE MEDICINA TROPICAL 2. IRMANDADE SANTA CASA DE MISERICÓRDIA Gerais State, Brazil (n=285). Aiming the detection of DE SÃO PAULO mimiviruses in human serum samples, the specimens 3. INSTITUTO DE CIÊNCIAS BIOMÉDICAS each sample) from individual belonging to the two areas Multiple Sclerosis (MS) is an autoimmune disease of (n=117).were grouped All the in pools pools were of 4 tosubjected 5 samples to a(20 real - 25time μL PCR for assay, targeting the conserved helicase viral gene. Thirty Endogenous Retrovirus-W (HERV-W) may play a role unknown etiology. Several findings suggest that Human of the 117 pools (25.6%) were positive for mimivirus in triggering MS autoimmunity. As example, the higher in PCR assays, 22 (22.5%) from area 1 and 8 (42.1%) HERV-W expression in MS than in healthy individuals, of them from area 2. A total of 10 positive pools serum HERV-W env protein detection in MS brain lesion and samples were chosen for helicase gene sequencing and induction of Experimental Allergic Encephalomyelitis analysis as well for the alignment and for phylogenetic (EAE), the animal model of MS, after exposure to tree construction. A neighbor joining phylogenetic tree HERV-W env protein. In addition, NGS data from our based on the helicase gene revealed that all the samples group revealed that MS patients present higher source amplicons clustered together with mimivirus lineage A of HERV-W expression when compared to healthy isolates. Concomitantly with molecular analysis, all the subjects (p=0.01). We also noted that MS patients real time PCR-positive pools and some PCR-negative with higher Expanded Disability Status Scale (EDSS) pools were submitted to a virus neutralization test (VN) present more active HERV-W loci compared to patients with the serum dilution 1:20. Afterward, VN-positive with lower EDSS. Here, we determined the diversity of samples had the neutralizing antibodies titrated in A. HERV-W transcripts of MS patients in different biological castellannii cells. The VN results showed that 26 of the samples. We gathered 320 sequences of HERV-W env 30 PCR-positive pools contained neutralizing antibodies gene expressed in blood and 24 HERV-W env gene against mimivirus with 20 (90.9%) from area 1 and 6 sequences from brain samples, all sequences were (75%) from area 2, while 12 PCR-negative pools were available on GenBank. These two groups were aligned also negative for VN. Here, we described the evidence separately to perform distance analysis. We calculated of mimivirus circulation in humans from Brazilian the overall mean distance on Mega6 software with rural areas. In Brazil, there are no reports of mimivirus Tamura-nei substitution model and gamma rates. A detection in humans, however recent data showed diversity of 35% was found among HERV-W transcripts the viral isolation of mimivirus group A in respiratory from brain, whereas transcripts from blood were more facility areas in a Brazilian hospital. In conclusion, the detection of antibodies against mimivirus and its homogeneous, (5% of diversity). This finding is one of DNA might indicate that these patients may be at risk among different tissues. HERV-W env protein, which the first steps to clarify the dynamics of HERV-W diversity of opportunistic infections, as previously suggested. is highly immunogenic, and myelin oligodendrocyte Financial Support: FAPEMIG, CAPES, CNPq. glycoprotein, present in myelin, shares some domains so that the autoimmunity process could be caused by cross response in a process known as molecular mimicry. This tissue-dependent expression diversity strengthens this theory. T lymphocytes, that cross the Blood Brain Barrier, might be stimulated by distinct HERV-W env October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
38 Oral Presentation
or CD8+, and that HRV-16, but not HRV-1A, infected leading ultimately to immunopathogenic response to CD20+ B cells, while only HRV-1A can infect CD11+ cells. theantigens, myelin which sheath. might Financial lead toSupport: a non-specific FAPESP response,Project#: However, neither HRV-1A nor HRV-16 infected DCs. Our results indicate that adenoids of patients without ARI symptoms may harbor human HRV productive infection, 2013/24223-9.HV248 HUMAN RHINOVIRUS REPLICATION IN and CD3+ T-cells (both CD4+ and CD8+), CD11+ and LYMPHO-MONONUCLEAR CELLS FROM HUMAN CD20+ B-cells are susceptible to HRV-16 or HRV-1A TONSILS in primary cultures of human LMNC. HRV infection of Martins Júnior, R.B.; Criado, M.F.; Gagliardi, T.B.; long-lived immune cells generating low virus titers is Jesus, B.L.S.; Cardoso, R.S.; Silva, M.L.; Carenzi, L.R.; Tamashiro, E.; Valera, F.C.P.; Anselmo-Lima, W.T.; This is strong evidence that the persistence of HRV in Arruda, E. humanconsistent tonsils with is persistence/latencyrelated to prolonged ininfection tonsillar of LMNCs.tissues. FACULDADE DE MEDICINA DE RIBEIRÃO PRETO Financial Support: FAPESP and CNPq. Human rhinoviruses (HRVs) are the most common HV418 SERUM FROM DENGUE-VIRUS INFECTED agents of upper acute respiratory infections (ARI), and PATIENTS WITH AND WITHOUT PLASMA LEAKAGE are also associated with more severe diseases, such as DIFFERENTLY AFFECT ENDOTHELIAL CELLS acute otitis media, exacerbations of asthma, wheezing FUNCTION IN VITRO and sinusitis. In a previous study, we detected HRV by Cardozo, F.T.G.S.; Baimukanova, G.; Bio, L.V.; Pannuti, qPCR in tonsillar tissues from 38% of children with C.S.; Pati, S.; Romano, C.M.; Sabino, E.C. chronic tonsillar hypertrophy, without ARI symptoms, and immunohistochemistry showed presence of HRV 1. UNIVERSITY OF SÃO PAULO both in epithelia and in lymphoid tissue. Taken together, 2. BLOOD SYSTEMS RESEARCH INSTITUTE Dengue pathogenesis is complex and multifactorial, we sought to determine the phenotypes of lympho- involving both viral and host factors. Although most of mononuclearthis could reflect cells HRV (LMNCs) persistence. infected In inthe vitro present with studyHRV- cases of dengue infections are asymptomatic or mild 16 and HRV-1A, and to analyze the progeny production symptomatic some individuals present warning signs in these cells, in order to document cell susceptibility progressing to severe dengue in which plasma leakage and permissiveness. Real-time RT-PCR, indirect is a hallmark. The lack of accurate in vitro models representing satisfactorily the immunopathology of 50 were the main methods used. LMNCs were generated dengue in humans has been limiting the advances in immunofluorescence and virus titration by TCID understanding the disease mechanisms as well as the dissociation and Ficoll density centrifugation. Presence development of therapeutic drugs. The aim of this work offrom HRV-infected hypertrophic LMNCs tonsils of the using phenotypes dispase-I/collagenase CD3+, CD4+, was to assess the effect of serum samples from DENV-2- CD8+, CD20+ and CD11+ was investigated by dual- infected patients with different degrees of severity in the in vitro vascular permeability of endothelial cells using dendritic cells (DC) were generated from LMNC cultures ECIS® (Electric Cell-substrate Impedance Sensing) usinglabel indirecttreatment immunofluorescence with GMCSF and IL-4 (IIF). to In test addition, their instrumentation. HUVEC (Human umbilical vein susceptibility to HRV. All infectivity assays were done endothelial cells) were grown in ECIS 96W10E+ arrays at MOI=1. Fifteen of 104 adenoid tissues (14.4%) were positive for HRV by qPCR. The detection rate of HRV in Afterward, HUVECs were treated with 10 % of human nasopharyngeal swabs (NPS) was 21.1%, and in four serum(Applied diluted Biophysics) in culture until media. confluence Three groups was of reached.samples patients HRV was detected both in in adenoid and NPS. were tested (n=14 per group): (i) dengue-positive Intracellular replication of HRV measured by TCID50 in patients with plasma leakage, (ii) dengue-positive patients without plasma leakage, and (iii) dengue- then decreased at 48 hours post infection. IIF showed negative blood donors. Samples from dengue-positive thatHeLa the cells susceptible increased cells modestly were CD3+in the T-cells, first 24 either hours, CD4+ and patients were collected at 3-5 days of symptoms. The
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
39 Oral Presentation
Trans-Endothelial Electrical Resistance data, obtained at viruses could be a threat for a novel pandemic virus. The 30 and 120 min, were expressed as Percentage of Change aim of this study was to investigate the outcome of the of Normalized Resistance (PCNR) in relation to control reassortment of polymerase gene segments between wells receiving media-only. The obtained PCNR values at 30 min were: Group (i) 11.51±2.49; (ii) 17.67±1.35; and (iii) 19.56±1.57. At 120 min the PCRN values were influenza virus A (H1N1) pdm09 and 2013 H7N9 human even lower: Group (i) 1.50±0.81; (ii) 7.66±2.88; and influenza viruses. Sixteen different combinations of pDZ- 37ºCPA, -PB1, on HEK293T-PB2, -NP ofcells A/Anhui/1/2013 using lipofectamine2000 (H7N9) and and A/ test, p<0.05) show that PCRN for the group (i) was Cal/04/2009 (H1N1) were prepared and transfected at (iii) 10.12±2.34. Statistical analysis (ANOVA/Tukey’s was made using three different incubation conditions for either of the other two groups in both time points. pRLTK-Renilla and pPolI-FF/Luc. A second transfection Theresignificantly was no smaller statistical than difference the mean in TEERserum increasesalbumin concentration nor viral load between the dengue groups analysis(33/37/39ºC) was performed for combinations to check the of contribution pDZ-PA and of -NP PA (i and ii). Cytokine analysis showed respectively positive and NP. -NP/-PA The polymerase of H7N9. Anactivity additional was measured dose-response using and negative correlation (Pearson test p<0.0001, r2> the luciferase assay system. MTT assay was done using 0.45) between resistance and levels of the chemokine a gradient of concentration for pDZ-PA and -NP. The reporter gene assay showed that H7N9 PA as well as NP protein 10 (IP-10, CXCL10). Results suggest that these increases the activity of H1N1 polymerase up to 150% chemokinesC-X-C motif ligandmight 1be (CXCL1)involved and in changes the IFN-γ-inducible in vascular and 100% respectively when compared to H1N1 wild- permeability, inhibiting and inducting endothelial type (WT). The higher polymerase activity was also increase the understanding in dengue pathogenesis barrier dysfunction, respectively. These findings may Theconfirmed MTT assay at all did temperatures not show evidence used and of cytoxicity an increase for Keywords: severe dengue, plasma leakage, endothelial PAwas and observed NP. All mainly combinations at 33ºC forin the-PA/-NP reassortment combination. that celland havebarrier implications function, forchemokines. therapy/diagnosis Financial of Support: dengue. include NP or PA genes contribute to the activity of H1N1 polymerase on 293T cells in vitro. However PB1 and PB2 of H7N9 did not seem to contribute for the FAPESP (Project number: 2013/01690-0); CNPq (FTGSC polymerase activity of a new virus. A reassortment of Post doc Scholarship: 151180/2013-0); FAPESP (LVB H1N1 and H7N9 polymerase seems to be more effective ScientificHV423 REASSORTMENT Initiation Scholarship: OF POLYMERASE 2014/17007-0). SEGMENTS than H1N1 WT or H7N9 WT polymerases at low or high IN INFLUENZA VIRUS A (H1N1) PDM09 AND H7N9 temperatures. Financial Support: CAPES. HUMAN INFLUENZA VIRUS Borges, L.G.A.; Veiga, A.G.V.; Albrecht, R.A.; García- VV24 PHYSICO-CHEMICAL AND BIOLOGICAL Sastre, A.; Tripathi, S. PROPERTIES OF TYPE O FOOT AND MOUTH DISEASE STRAINS ISOLATED FROM SOUTH AMERICAN 1. UNIVERSIDADE FEDERAL DE CIENCIAS DA OUTBREAKS (2006 TO 2011 SAUDE DE PORTO ALEGRE 2. ICAHN SCHOOL OF MEDICINE AT MOUNT Galdo Novo, S.; Espinoza, A.M.; Cardillo, S.; Maradei, SINAI E.; Guinzburg, M.; Lago Aladro, E.; Perez Beascoechea, C. 1. SERVICIO NACIONAL DE SANIDAD Y AlthoughThe present it was century easily has controlled reaffirmed after the one significance year, a CALIDAD AGROALIMENTARIA of infections from reassorted influenza A viruses. 2. BIOGENESIS BAGO pdm09 quickly spread globally and infected thousands Foot and mouth disease (FMD) virus is a non- oftriple humans. reassortment A less transmittable of the influenza human virus virus A of (H1N1) avian- enveloped single-stranded RNA virus belonging to the origin (H7N9) has caused aggressive, localized disease Aphthovirus genus, Picornaviridae family. It produces in infected patients. A new reassortment from both a highly contagious disease that affects cloven-hoofed
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
40 Oral Presentation animals producing clinical signs such as fever, vesicles VV72 HIGH SEROPOSITIVITY OF ORTHOPOXVIRUS IN in mouth and hooves. South America has implemented BUFFALOES LIVING IN GEOGRAPHICAL ISOLATION, FMD control and eradication programs and no MARAJÓ ISLAND, BRAZIL outbreaks have been reported since 2012. The threat Luiz, A.P.M.F.; Pereira, A.F.; de Oliveira, C.H.S.; of introduction of FMD has been greatly increased in Barbosa, J.D.; Oliveira, D.B.; Bonjardim, C.A.; Ferreira, recent years due to expansion of FMD free areas and P.C.P.; Trindade, G. de S.; Abrahão, J.S.; Kroon, E.G. increasing movement of animals and products. In this sense, FMD reference laboratories and antigen banks 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. UNIVERSIDADE FEDERAL DE GOIÁS are continuously monitoring if FMD viruses from new 3. UNIVERSIDADE FEDERAL DO PARÁ outbreaks are matched by vaccine strains available. In addition, it is relevant to study and select new vaccine Viruses belonging to the genus Orthopoxvirus (OPV) strain candidates that show improved properties for are related to zoonotic diseases worldwide. During vaccine production to be included in the collection of the last few decades, reports about zoonotic OPV have vaccine and antigen banks. For that purpose, FMD virus increased. In Brazil, Vaccinia virus (VACV) has been strains isolated from outbreaks occurred from 2006 to reported to affect mainly dairy cattle and rural workers. 2011 in South America were characterized for infectivity Serologic evidence of OPV circulation in Brazil showed in BHK 21 cells at different multiplicities of infection a positivity around 20% in cattle, humans, monkeys (MOI), cytopathic effect (CPE), lethality to suckling and rodents. Although OPV seropositivity has been mice, susceptibility to temperature (37ºC) and antigen described in buffalo herds in southeastern Brazil, no high seropositivity have been described in places where there were no reported outbreaks of VACV. This study aimed payload yield. The viruses evaluated were O Corrientes/ to investigate the positivity of anti-OPV antibodies in Arg/06 (O-Corr), O/Napo/Ecu/46-10 (O-Ecu) and O/ Brazilian buffalo herds living in geographical isolation, showedSan Pedro/Par/11 that the adaptation (O-Par); in comparisonof all the strains with currently to BHK Marajó Island, Pará State, Brazil. We investigated for the used vaccine strain O1 Campos/Bra/58 (O1C). Results presence of OPV-neutralizing antibodies and VACV DNA except for O-Corr which had a less clear CPE. Complete in 150 buffaloes sera samples. Of the 53 dairy buffalo cell21 cells detachment occurred was in observedthe first passagewithin a with14 hour typical period CPE, at serum samples, 40 (75%) contained OPV neutralizing detachment in less than 14 hs for both, MOI 0.001 and antibodies; of these, 24 (60%) had titers of 100 NU/ MOI 0.0001,0.001. Indeed, indicating O/Ecu a rapid virus adaptation produced tocomplete BHK 21. cell In ml, five(12.5%) had titers of 200 NU/ml, seven (17.5%) regard to thermal stability, at 6 hours at 37ºC, 65% of had titers of 400 NU/ml and four (10%) had titers of reduction of the initial infectivity titer was detected for had antibodies to OPV; of these, 42 (66.7%) had titers 800 NU/ml. Of the 97 beef buffaloes, 63 sera (65%) O-Ecu followed by O1C with 45%, being the other strains less stable with lower than 38% of the initial infectivity. of 100 NU/ml, 12 (19%) had titers of 200 NU/ml, seven When antigen payload of 140S particles after inactivation ml.(11.1%) So the had buffalo titers ofherd 400 showed NU/ml, a one seropositity (1.6%) had of a 70%. titer Weof 800 hypothesize NU/ml and that one the (1.6%) high seropositivityhad a titer of 1600may haveNU/ thesewas measured, results showed O-Ecu achievedthat O-Ecu the displayed highest (9 optimal µg/ml) physical-chemicaland O-Par the lowest and (less biological than 1 µg/ml). properties Taken as together, vaccine the herd for many decades. More research needs to be favored VACV maintenance and spread efficiently among candidate equivalent to the current O1C vaccine strain. done to understand OPV in herds of buffalo. Financial Further antigenic studies are necessary to consider these Support: CNPq, CAPES and FAPEMIG. viruses in strain collections as potential vaccine strains.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
41 Oral Presentation
VV79 UNIQUE COMBINATION OF BVDV-1, BVDV-2 VV399 BOVINE VACCINIA: TESTING AN INACTIVATED AND HOBI-LIKE PESTIVIRUSES PRESENT IN BRAZIL VACCINE IN CATTLE Silveira, S.; Weber, M.N.; Mósena, A.C.S.; da Silva, M.S.; Matos, A.C.D.; Villani, F.N.A.; Galinari, G.C.F.; Rehfeld, Streck, A.F.; Pescador, C.A.; Flores, E.F.; Weiblen, R.; I.S.; Costa, A.G.; Rosa, J.C.C.; Costa, E.A.; Silva, N.L.; Driemeier, D.; Ridpath, J.F.; Canal, C.W. Rodrigues, T.V.; Lage, A.P.; Guedes, M.I.M.C.; Lobato, Z.I.P. 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. UNIVERSIDADE FEDERAL DE MATO GROSSO Bovine vaccinia (BV), caused by Vaccinia virus (VACV), 3. UNIVERSIDADE FEDERAL DE SANTA MARIA is a zoonosis characterized by exanthematic lesions in 4. UNITED STATES DEPARTMENT OF the teats of dairy cows and milkers hands. Due to the AGRICULTURE occurrence of many BV outbreaks in dairy farms in all Brazilian regions, since 1999, there is a need to improve economic losses worldwide, with manifestations the control and prevention measures of the disease. Pestivirus infections in ruminants result in significant ranging from mild clinical signs to serious outcomes, Vaccination is the major tool to prevent viral diseases, and such as reproductive losses and death. The etiological it could be an alternative for BV prevention. Therefore, agents are three species from the genus Pestivirus, family a VACV inactivated vaccine using the VACV-GP2 strain, Flaviviridae, including Bovine Viral Diarrhea Virus type previously characterized, was developed. After previous 1 (BVDV-1), BVDV-2, Border Disease Virus (BDV), and tests in vitro and in vivo, using a murine model, a clinical an atypical pestivirus named HoBi-like pestivirus. In trial in bovines was performed. Sixteen heifers, aged the present study, eighty-nine pestivirus isolates that 12-18 months, seronegative for Orthopoxvirus, were were collected in Brazil between 1995 and 2014 and randomly divided into two groups: control group (CG) originated from either as cell culture contaminants, and vaccinated group (VG). The vaccination scheme fetal bovine serum (FBS) or cattle were genetically was a prime dose followed by a booster dose 21 days characterized. Sequences of 5’ untranslated regions later. Serum samples were collected at the 30th day post pro (5’UTR), N-terminal autoprotease (N ) and envelope vaccination (dpv), and neutralizing antibodies (NA) were glycoprotein 2 (E2) were analyzed using the Maximum titrated by plaque reduction neutralization test (PRNT). Likelihood method in MEGA6 software. Of these isolates, At the 30th dpv, four animals from each group were selected and challenged with the homologous virus, as BVDV-2 and 12.4% as HoBi-like pestivirus. Most 53.9% of the sequences were classified as BVDV-1, 33.7% frequent subgenotypes detected were BVDV-1a (35.9%) each teat was inoculated with 5x105 plaque forming and BVDV-2b (31.4%), whereas BVDV-1b, 1d, 2c and 1e unitsVACV-GP2. (PFU) The of VACV-GP2.teats were Thescarified animals with were sandpaper monitored and were detected less frequently, with 10.1%, 6.7%, 2.2% and the teats examined daily up to the 24th day post and 1.1% of isolates, respectively. This combination of inoculation (dpi). Additionally, at the 4th dpi, blood pestiviruses is unique to Brazil and represents one of the greatest genetic diversities that has been described cytometry. The PBMCs were separated and labeled with thus far in the world. This information may serve as a antibodiessamples were anti-CD21, collected CD4, for immunophenotypingCD8 and CD25. At the 30byth flow dpi foundation for designing and evaluating diagnostic all heifers from the VG presented NA, with titers ranging tools and in the development of more effective vaccines; from 20 to 320. No seroconversion was observed in the therefore, it may potentially contribute towards the heifers from the CG. After the VACV inoculation, lesions development of future pestivirus control programs. compatible with VACV were observed in all heifers from Keywords: Pestivirus, Cattle, Phylogeny, BVDV, HoBi-like the CG, with a pattern of disease evolution similar to pestivirus. Financial Support: CAPES, CNPq, FAPERGS previous reports. In contrast, the vaccinated animals showed only small scabs until the 8th dpi, mostly related and Propesq/UFRGS. cells was slightly higher in the VG than the CG at the 4th to the scarification process. The percentage of CD21+ October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation dpi. The mean intensity of fluorescence (MIF) of the anti- XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
42 Oral Presentation
CD25 molecule, on the CD21+, CD4+ and CD8+ cells was (p=0.627), age (p=0.542), number of days from the higher in the PBMC of VG animals, when comparing with disease onset (p=0.086) nor severity (p=0,101). In our the CG, demonstrating more activation of these cells. The casuistic, results indicated that NS1 antigenemia varied vaccine developed in the present study was immunogenic according to infecting serotype, immune response and and could protect the vaccinated animals against the challenge with the VACV homologous strain.Keywords: Bovine vaccinia, immune response, vaccine, Vaccinia NS1gender, antigenemia but was notwas significantlynot a marker relatedfor disease with severity; clinical virus. Financial Support: CAPES, CNPq, FAPEMIG. othersmanifestation. parameters Our associated findings suggestor individual that thefeatures levels may of play a role in the dynamic of severe dengue. This is the HV160 LEVELS OF NS1 ANTIGENEMIA AND ITS CORRELATION WITH VIREMIA AND IMMUNE STATUS parameters with disease severity in a population A MARKER FOR DISEASE SEVERITY IN DENGUE exposedfirst study to analyzingdifferent dengue the association serotypes of in three the state virological of Rio PATIENTS FROM RIO DE JANEIRO de Janeiro over a period of 27 years. Financial Support: De Santis, B.; Lima, M.R.Q.; Cabello, P.H.; Nogueira, R.M.; de Filippis, A.M.B. CNPq (grant no.304872/2012-6) and FAPERJ (grants no. 1. INSTITUTO OSWALDO CRUZ E-26/110.663/2013HV315 MOLECULAR and ANALISYS E/-25/010.001558/2014). OF INFLUENZA A 2. FUNDAÇÃO OSWALDO CRUZ VIRUS IN THE NORTH AND NORTHEAST OF BRAZIL Dengue is the most prevalent viral vector-borne disease Santos, M.C.; Barbagelata, L.S.; Sousa-Júnior, E.C.; worldwide, with around half the world’s population Ferreira, J.A.; Souza, E.M.A.; Medeiros, R.; Mello, W.A. estimated to be at risk of infection. Interactions among patient’s immune status, age, comorbidities, 1. INSTITUTO EVANDRO CHAGAS and many other factors contribute to the disease’s 2. NÚCLEO DE MEDICINA TROPICAL complexity. Particularly, levels of NS1 antigenemia has DAUNIVERSIDADE FEDERAL DO PARÁ been associated with disease severity, immune status, infecting serotype and viremia. This retrospective a highly contagious disease that affects the respiratory observational study aimed to correlate levels of NS1 tract.Influenza These viruses viruses are have the high etiologic genetic agents variability, of influenza, favored antigenemia, viremia and immune status as a virological especially by the segmented nature of its genome, which marker for disease severity. Sera from 221 patient’s facilitates the occurrence of mutations that happen in from Rio de Janeiro infected by DENV-1, 2, 3 or 4, a more often on surface glycoproteins, hemagglutinin ages ranging from two to 81 years old were analyzed. (HA) and neuraminidase (NA). These mutations may According to WHO guidelines, cases were separated in two groups: with warning signs and without warning In addition, mutations on NA can generate strains which arenegatively resistant impact to antiviral the effectiveness drugs used of influenzain the treatment vaccine. adapting PlateliaTM Dengue NS1 Ag-ELISA kit (Bio-Rad Laboratories).signs. NS1 antigenemia Viremia quantificationlevels were determined was performed by qRT- by PCR and immunological status by an in house IgG EIA. In supportof influenza. to programs Therefore, aiming the continuousat preventing monitoring and control of our results the patients infected with DENV-3 presented ofmutations infections of for influenza instance, viruses the development is worth to beof effective done in the highest circulating NS1 median titers (1:15625), followed by DENV-1 (1:3125), DENV-2 (1:625) and A virus strains circulating in Northern and Northeastern DENV-4 (1:25) (p <0.0001). Furthermore, circulating statesvaccine of formulations. Brazil, with the In purposeorder to ofcharacterize a preparing Influenza vaccines NS1 levels were higher in patients with primary infection including prevalent strains, as well of analyzing the (1:3125) than in patients with secondary infection occurrence of mutations in NA gene associated with (1:125), regardless the infecting serotype (p=0.001). Curiously, male patients presented higher antigenemia samples were analyzed. These samples were collected (1:3125) than female patients (1:1875) (p=0.019). fromresistance January to antiviral, to December 238 samples2014 in Influenzastates of Athe positive North NS1 antigenemia was not associated with viremia and Northeast of Brazil. The analysis of the samples
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
43 Oral Presentation involved extraction of viral nucleic acid followed by RT- properties, chemistry of surface and their low toxicity in biological systems. We have used an experimental immunogen based on AuNRs functionalized with samples,PCR for amplification 82 were A(H1N1) of the pdm09 HA and and NA 156 genes A(H3N2). and their The dengue virus (DENV) envelope (E) glycoprotein – HAsubsequent gene analysis sequencing. of both Among subtypes the Influenzashowed the A positives genetic an immunodominant protein that generates strong in the North and Northeast regions as compared to mice. Our previous data showed that this immunogen thesimilarity vaccine of strains. the Influenza All the Aanalyzed virus strains A(H1N1) circulating pdm09 serotype-specific neutralizing antibodies – to immunize strains belonged to the 6B phylogenetic group and A(H3N2) samples to 3C group. The analysis of the NA antibodiesinduces significantly and higher higher response total anti-dengue in cell proliferation IgG titers, and the A(H1N1) pdm09 strains showed no amino acid experimentsan increase onwhen the compared production to of the specific group neutralizingimmunized substitution associated with decreased sensitivity to immunized through a prime-boost-boost protocol and samples, the replacement I222V, which translates into a with the DENVE only. For this work, C57BL/6 mice were moderateantiviral drugs. reduction However in sensitivity it was verified to Oseltamivir. in the A(H3N2) When splenocytes culture with or without DENVE stimulus. The comparing our strains with these circulating in previous supernatantsthe cytokine profile were collected was analyzed up to 72in theh after supernatant stimulation of years, there appears to be a decrease in the diversity of and the amount of secreted cytokines was measured using the BDTM to a single phylogenetic group at each subtype. Moreover theinfluenza demonstration viruses, since of aminoacidic all analyzed substitutions strains grouped related in Cytometric Bead Array (CBA) Mouse Th1/ to antiviral resistance observed in this study reinforces inTh2/Th17 the AuNR-DENVE Cytokine Kit. group Among in thecomparison cytokines toevaluated, DENVE the importance of continuously monitoring the genetic groupIFN-γ, IL-10(p<0.01). and IL-17This elicited exhibited pattern levels ofstatistically cytokines higher tends virus, variability, antiviral resistance. Financial Support: by inducing an antiviral state in cells. In addition, other diversity of Influenza viruses. Keywords: Influenza A studyto Th1 has and shown Th17 the cell association responses. of IFN-γ this iscytokine responsible with generation of neutralizing antibodies against dengue IEC/SVS/MS/OMS.IV208 IMMUNIZATION WITH A DENGUE 3 E PROTEIN- virus. Therefore, our immunogen is a promising FUNCTIONALIZED GOLD NANORODS IMMUNOGEN vaccine candidate because it has obtained cellular and INDUCES HIGH AMOUNTS OF PROINFLAMMATORY humoral immune responses – activation of both arms CYTOKINES of the immune system has been suggested to be more Versiani, A.F.; Souza, H.L.; Bueno, L.L.; Fujiwara, R.T.; protective than just the production of neutralizing Ladeira, L.O.; da Fonseca, F.G. antibodies against dengue virus. Further experiments UNIVERSIDADE FEDERAL DE MINAS GERAIS are being conducted in order to better evaluate the full potential of this new immunogen. Financial Support: Dengue is currently the most important infectious CAPES, CNPq, INCTV. disease in Brazil in terms of epidemiological impact. Consequently, the development of an effective vaccine is considered a high priority. Indeed, many studies are being developed towards this goal and some encouraging results have been obtained by different groups. Nonetheless, no vaccine is available to the population yet. involving chemistry, engineering, biology and medicine. ItsNanotechnology potential applications is a field include of interdisciplinary methods of detection, research diagnosis and treatment for an array of diseases. Amongst several types of nanoparticles, Gold Nanorods (AuNRs) are of particular interest due to their optical
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
44 Oral Presentation
IV252 VALIDATION OF THE SEROLOGICAL TESTING SE and PPV of 100% (n=10) when 1:500 proportion of FOR HUMAN IMMUNODEFICIENCY VIRUS TYPE 1/2 spiked samples were tested, and showed SE 0% (n=10) FROM POST-MORTEM BLOOD Loiola, D.S.; Sampaio, T.L.; Rodrigues, I.P.; Victer, presented SE of 0% at 1:500 (n=12) and SE 0% at 1:5000 at 1:5000 proportion. Anti-HIV 1/2 Interkit validation T.N.F.; Lima, D.S.; Pontes, D.F.S.; Báo, S.N. (n=10) proportions. Conclusion: ECLIA Elecsys Roche
1. DEPARTMENT OF CELL BIOLOGY, serum, when compared to Architect Abbott results and UNIVERSITY OF BRASÍLIA, BRASÍLIA, BRAZIL seems to be a useful test for anti-HIV 1/2 in cadaver 2. FEDERAL INSTITUTE OF BRASÍLIA less sensitive when 1:5000 dilution spiked samples 3. TRANSPLANT COORDINATION CENTER OF ELISAs. ELISA anti-HIV 1/2 Murex and Wama were DISTRITO FEDERAL, BRASÍLIA, BRAZIL tests should be improved to have higher sensitivity for 4. BRASILIA BLOOD CENTER FOUNDATION, were tested. The fourth-generation anti-HIV 1/2 ELISA BRASíLIA, BRAZIL cadaveric serum for reducing the risk of transmission
Brazil’s public health system is internationally recognized Keywords: HIV, tissue transplantation, donors, tissue as being a leader in organ and tissue transplantation. banks,of HIV serologic 1/2 through test. Financial organ and Support: tissue National transplantation. Agency for Health Surveillance (ANVISA) and National Counsel factorSeropositivity for organ forand humantissue donation immunodeficiency and thus must virus be screenedtype 1/2 for. (HIV Only 1/2) the is chemiluminescence an automatically disqualifying test (CLIA) for Scientific and Technological Development (CNPq) (grantsIV257 CONSTRUCTION #440181/2014-3 OF and CHIMERIC 440029/2014-7). DENGUE VIRUS PROTEINS TO DEVELOP A NEW VACCINE AND/OR electro-chemiluminescencefrom Abbott is approved for (ECLIA) testing cadavericand enzyme- serum/ DIAGNOSIS TEST plasma. The serology anti HIV-1/2 is tested by CLIA, linked immusorbent assay (ELISA) immunoassays. The Batista, I.C.A.; Dangelo, L.C.D.; Oliveira, E.S.; Ferreira, J.G.G.; Rocha, E.S.O.; Kroon, E.G.; Corrêa-Oliveira, R.; still required. The objective of this study is to verify the Oliveira, J.G.; Quinan, B.R.; Calzavara-Silva, C.E. validation of the serological tests for anti-HIV-1/2 is serum. Materials and Methods: Serum from 97 cadavers 1. FIOCRUZ MINAS 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS wasvalidation collected patterns after ofreceiving anti-HIV family 1/2 testsauthorization. in cadaveric All Dengue virus (DENV) belongs to the Flaviviridae (Abbott, Germany) for control. The tests ECLIA anti- family and consists of four distinct serotypes, DENV- samples were tested by the anti-HIV 1/2 Architect 1 to -4. No safe human vaccines have been approved (DiaSorin), Wama (Wama Diagnóstica) and Interkit yet since it demands a balanced tetravalent immune (InterteckHIV1/2 Elecsys Katal) were (Roche, validated Swiss) by spiking and ELISA the samples Murex response. To address the balanced immune response, we hypothesized that chimeric proteins with potential concentrations which give low- and high-positive results immunogenic epitopes from the four DENV serotypes with anti-HIV 1/2 standard sera (NIBSC 95/522) in 7.8% (n=64). Elecsys, when compared to Architect for the marker. Results: The prevalence of HIV 1/2 was namedcan be usedqDV, theto develop most potentially a safe dengue immunogenic vaccine and/or regions an of positive predictive value (PPV) and negative predictive proteinsefficient diagnosticderived from system. envelope, To design capsid, the membrane first chimera, and Abbott, presented a sensitivity (SE), specificity (SP), non-structural protein 1 (NS1) from all DENV serotypes compared to Elecsys Roche presented ES and NPV´s of were in silico selected using the BepiPred algorithm. High 100%value (NPV) (n=34). of Due 100% to the (n=64). reduced Anti-HIV number 1/2 of Murextrue positive when homology regions among the four DENV serotypes were preferentially included, but antigenic regions from single performed by spiking seronegative samples with 1:500 or pairs of DENV serotypes were also used. Our chimera andsamples 1:5000 of anti-HIV (standard 1/2, sera: Murex cadaver validation serum) assays resulting were qDV was constructed by adding non immunogenic amino in SE of 98%, 7% and PPV of 100%, 100% (n=59) acid residues between the selected sequences, named spacer residues, thus the expressed epitopes structure respectively.October 2015 Volume Anti-HIV 20 – Supplement 1/2 Wama 1 - validationAbstracts/Posters presented - Oral Presentation XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
45 Oral Presentation
was back translated and the nucleotide sequence was optimizedwas maintained. using theThe LETO final chimeric1.0 algorithm amino (Entelechon). acid sequence In were constructed using a similar methodology. But, to increaseaddition tothe the strength first chimera, of our other prediction, ten chimeric the BepiPred proteins tool was used with the score threshold of 0.7 (two fold the default parameters) and epitope predictions were performed using only the E and NS1 consensus sequence to each DENV serotype. We selected eight non-conserved epitopes (four from NS1 protein and four epitopes from the envelope). These epitopes were combined to construct ten chimeric proteins composed by: (1) four non-conserved epitopes from each DENV serotype (four chimeric proteins containing envelope epitopes and four chimeric proteins containing NS1 epitopes), (2) one chimeric protein containing four consensus epitopes from the envelope protein and (3) one chimeric protein containing four consensus epitopes from the NS1 protein. All the eleven chimeric proteins were produced using the expression vectors pQE-9 and pET- or21a, diagnosis transformed tools. in OurE. coli preliminary BL21, and purifiedresults byshowed Nickel- a affinity chromatography to be tested as vaccine and/ specific antibody response to the qDV in dengue infected orpatients diagnostic sera, indicatingtools for infectious that artificial diseases. proteins Financial can be designed to be used in the development of vaccines and/
Support: CAPES/CNPq/ FIOCRUZ.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Oral Presentation BASIC VIROLOGY - BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
47 Basic Virology: BV
BV11 - EVALUATION OF OXIDATIVE STRESS AND are needed to better understanding of the relationships ANTIOXIDANT DEFENCE IN HEPG2 CELLS INFECTED between endogenous ROS, other antioxidant enzymes WITH THE CARAPARU VIRUS (BUNYAVIRIDAE) Almeida, L.T.; Camini, F.C.; Caetano, C.C.S.; Magalhães, Keywords: Antioxidant defense, Caraparu Virus, HepG2 and anti-inflammatory mediators on CARV infection. J.C.; Magalhães, C.L.B. cells and oxidative stress. Financial Support: FAPEMIG, UFOP, CNPq and CAPES. 1. UNIVERSIDADE FEDERAL DE OURO PRETO 2. UNIVERSIDADE FEDERAL DE SÂO JOÃO DEL REI BV12 - INFECTION BY MAYARO VIRUS (TOGAVIRIDAE) Caraparu virus (CARV) is a member of group C of the IN HEPG2 CELLS INCREASE REACTIVE OXYGEN Bunyaviridae family. In South American countries, group SPECIES, OXIDATIVE STRESS BIOMARKER AND C bunyaviruses are among the common agents of human SUPEROXIDE DISMUTASE ACTIVITY febrile illness and have caused multiple outbreaks Camini, F.C.; Caetano, C.C.S.; Almeida, L.T.; Castro, of human disease in recent decades; nevertheless, C.P.M.; Magalhães, J.C.; Magalhães, C.L.B. little is known about the pathogenic characteristics of UNIVERSIDADE FEDERAL DE OURO PRETO these viruses. Since previous studies have suggested that oxidative stress, as part of the host cell response, Mayaro virus (MAYV) is an arbovirus belonging to might play an important role in the pathogenesis of a the Togaviridae family. It causes the Mayaro Fever variety of RNA viral infections, recently we examined and symptoms such as arthralgia, myalgia, headache, the hepatic pathogenesis of CARV in mice and the eye pain, rash, vomiting and diarrhea. Because these involvement of oxidative stress and antioxidant defenses symptoms are similar to those of Dengue, are often on this pathology. In this model, CARV did not alter the mistaken leading to underreporting of Mayaro Fever. biomarkers of oxidative stress but caused alterations on It is known that during viral cell infection there is antioxidants parameters. Thereby, this work aimed to generation of Reactive Oxygen Species (ROS) with continue the studies in order to better characterize the the task of combating these agents, however, the CARV infection using HepG2 liver human cells. Reactive excess ROS can cause potential damage to the cells. To Oxygen Species (ROS), Superoxide Dismutase (SOD) prevent such damage there is the antioxidant defense activity and Malondialdehyde (MDA) were evaluated in system that controls the concentration of ROS. The HepG2 cells infected by CARV, in different times. ROS production increased in infected cells in times 12, 24 is the superoxide anion (O2-), which is metabolized to first ROS produced in the reduction pathway of oxygen and 48 hours post infection (hpi). Additionally, CARV hydrogen peroxide (H2O2) by superoxide dismutases infection altered the activity of SOD, an important enzymes (SOD). Glutathione and Catalase then detoxify component of the cellular antioxidant machinery that H2O2 by generating water and oxygen. Any imbalance in the production of ROS and the body’s inability to detoxify superoxide anion (O2-). In infected cells, there detoxify these ROS is referred to as oxidative stress. However, at 12 and 24 hpi, the SOD activity in CARV- Oxidative stress has been implicated in the pathogenesis infectedwas a significant cells showed increase a decrease, in SOD with activity levels increasing at 6 hpi. of numerous RNA virus infection and can contribute again at 48 hpi. Despite the increase in ROS levels and to several aspects including apoptosis, loss of immune the reduction of SOD activity at 12 and 24 hpi, no evident oxidative stress was observed since levels of MDA Therefore, the purpose of this study was to investigate function, viral replication, and inflammatory response. (an end product of lipid peroxidation and biomarker the effect of MAYV infection on balance oxidants and of oxidative stress) were similar between infected antioxidants in HepG2 cells. ROS, malondialdehyde and control cells. These results in HepG2 cells are in (MDA) and SOD activity were evaluated in HepG2 cells accordance with the results obtained in liver of CARV- infected by MAYV, at various times post infection (pi). infected mice, where total SOD activity was lower on day ROS production increased in infected cells, at all times 3 pi, however, without evident oxidative stress. Thus, it analyzed (1, 2, 4, 6, 12, 24 and 48 hours). Additionally, was possible to broaden the knowledge of the aspects of the infection caused by CARV; however, further studies (an end product of lipid peroxidation and biomarker MAYV infection induced a significant increase of MDA October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
48 Basic Virology: BV
of oxidative stress) in times 15, 24 and 48 hours pi, as 50 = 55.27
50 = 54.10 ± 15, 24 and 48 hours. The highest SOD activity may be 59.09 ± 2.49 µg/mL) followed by hexanic (CC well as a significant increase in SOD activity in times 6, ± 4.93 µg/mL) and dichloromethanic (CC 2-, resulting in against 500 TCID 50 of DENV-2, with EC50 values of 10.62 µg/mL). The extracts showed antiviral activity H2O2 andrelated catalase, to increased excessive detoxification H2O2 accumulation of O leads to the formation. If not properly detoxified by glutathione 9.10 ± 0.57 µg/mL for ethanolic, 3.32 ± 1.47 µg/mL for release of other potent pro-oxidative mediators in the extract. The Selectivity Indexes (CC50 50) were 6.49, extracellular environment, contributing to oxidative 16.26dichloromethanic and 5.50, andrespectively. 10.05 ± 2.21The µg/mLdichloromethanic for hexanic /EC stress. Then, further studies are need to determine the extract was found to be the most effective, with lower EC50 effect of MAYV infection on antioxidants Glutathione and higher Selectivity Index. Chromatographic studies may not only elucidate the bioactive (s) component (s) oxidative homeostasis upon MAYV infection, which may, of the plant as well as allow the continuity research of inand part, Catalase. explain This the ispathogenesis the first report of this of anvirus. alteration Financial of antiviral action’s mechanisms. Keywords: Dengue virus, Support: FAPEMIG, UFOP, CNPq and CAPES. Aristolochia, antiviral.
BV17 - ANTIVIRAL ACTIVITY OF BV20 - SEROPREVALENCE RESEARCH, SEROTYPE ARISTOLOCHIACYMBIFERA EXTRACTS AGAINST AND JAK-1 GENES AND CD -209 IN OURO BRANCO DENGUE VIRUS TYPE 2 / MG / BR IN A MULTICENTER STUDY OF GENETIC Ferraz, A.C.; Cecilio, S.G.; Ferraz, A.C.; Totola, A.H.; AND SEROLOGICAL FACTORS IN PREDISPOSING TO Magalhães, C.B.L.; Ferreira, J.M.S.; Magalhães, J.C. SEVERE FORMS OF DENGUE 1. UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL REI Moraes, T.F.S.; Gomes, A.V.B.T.; Coelho, L.F.L.; 2. UNIVERSIDADE FEDERAL DE OURO PRETO Magalhães, C.L.B.; Ferreira, J.M.S.; Magalhães, J.C. Emerging and re-emerging viral diseases represent a 1. UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL REI major threat to public health. Dengue, the most important 2. UNIVERSIDADE FEDERAL DE ALFENAS 3. UNIVERSIDADE FEDERAL DE OURO PRETO arthropod borne viral disease in Brazil, is caused by four serotypes of Dengue virus, and is transmitted to humans Dengue is an endemic disease in 112 countries, and the by vectors from genus Aedes. There is no vaccine or World Health Organization (WHO) indicates that 40% of the world population lives in risk areas. The serotypes to the discovery of antiviral drugs against the virus, (DENV1-4) can cause from asymptomatic infections and whichtherapy can available be obtained yet. The through scientific research community on medicinal aspires classical fever (DF) to the dengue hemorrhagic fever plants. Aristolochia spp. (Aristolochiaceae family) is a (DHF). Local aspects (geographic and economic) and well known genre used in folk medicine, commonly others inherent to the virus or to the host are related to applied in the treatment of diarrhea and abdominal the development of the severe forms of the disease. This pain. Phytochemical studies revealed the presence of work is part of a major study involving several cities in be promising compounds in antiviral activity. Aerial of dengue. The main issue is to investigate serological alkaloids, flavonoids and aristolochic acids, which may andthe Minas genetic Gerais/Brazil, factors related with to greater the predisposition or lesser incidence to the dichloromethane or hexane for three weeks. Ethanol development of severe forms of dengue and its different andparts hexane (stem were /wood) removed were on macerated a rotary evaporator with ethanol, (35- prognoses. In Ouro Branco, city focused in this study, the number of cases, natives, and imported, has been increasing in recent years, although it is relatively and40°C/60-110 titration ofmmHg) the virus and anddichloromethane mammalian cells in a (VERO)chapel. low compared to other cities in study. Thus, between Mosquitoes cells (C6/36) were used for multiplication 2013 and 2014, whole blood samples were collected for the searchof cytotoxic concentration 50 (CC50) and effective concentration 50 (EC50) of the extracts by methyl- thiazol-tetrazolium (MTT) colorimetric’s method. As a result, the less toxic extract was the ethanolic (CC = orderfrom to 300 determine volunteers seroprevalence in Ouro Branco and serotyping, and the firstand 50 approaches aimed to outline the volunteers’ profile, in October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
49 Basic Virology: BV to study the occurrence of SNPs of CD209 and JAK-1 to adapt to different niches are factors that explain, (genes related to the developing of DHF). The studies at least in part, the maintenance, emergence and were made using immunochromatography, serum reemergence of some viruses. Some previous studies neutralization, and real-time PCR, respectively. A serum have already reported the natural infection of rodents prevalence of 4.67% for dengue among the participants the convalescent stage. Genetic analysis showed the smalland bats mammals. with zoonoticA collection flaviviruses. of organs and The sera aim of of small this existencewas detected, of predisposing with primary and protectors infection and/orgenotypes after to mammalswork was towas investigate used (animals flaviviruses were previouslyin naturally collected infected the DHF in the JAK-1 and CD209 genes. The AG and GG in a rural area of Rio Pomba, Atlantic Forest in Minas genotypes of JAK-1 were detected in 91 patients (30.33% Gerais, from October 2012 to August 2013). A total of of the population) and the percentage for the CD-209 115 serum samples and 54 liver samples were kept in was 47.66% of the population. However, no association RNAlater at -70°C and then submitted to RNA extraction using Viral RNA Midkit (QIAGEN, USA), followed by cDNA or in combination with the genus distribution and the synthesis (Superscript - Invitrogen). cDNA samples were evidencewas observed of dengue between symptoms the genotypes in patients. individually This study, and/ tested for the presence of DENV, YFV, SLEV, WNV and when concluded in parallel with the other cities, will help JEV by real time PCR targeting the NS5 gene. One liver to identify greatest risk areas of severe dengue cases in sample from one rodent, Calomys sp., was PCR positive the state, and it can be an additional tool of control and (possibly SLEV, DENV-1, 3 or 4), but no amplicons were prevention of the disease, assisting the organization of obtained from sera sample, indicating the absence of public policies of control. Keywords: Dengue virus, Ouro viremia or low viremia. This rodent sample was collected Branco, DHF, Epidemiology, Real-Time PCR. in a transition area between the wild and peridomestic environment. The amplicon is going to be sequenced to BV23 - PROSPECTING FLAVIVIRUSES IN SMALL MAMMALS, IN MINAS GERAIS, BRAZIL Rezende, I.M.; Amaral, C.D.; Sacchetto, L.; Miranda, confirm the results. These results indicate that Calomys J.B.; Borges, I.A.; Vieira, F.N.; Alves, P.A.; Paglia, A.P.; sp. can be naturally infected with flaviviruses and Trindade, G.S.; Drumond, B.P. this species may have a role in the maintenance and/ or flavivirus transmission chains in nature. Financial 1. UNIVERSIDADE FEDERAL DE JUIZ DE FORA 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS Support:BV43 - FAPEMIG, MAYARO CNPq, VIRUS CAPES, INFECTION UFJF, PROPESQ/UFJF. ENHANCES REACTIVE OXYGEN SPECIES AND MALONDIALDEHYDE The members of genus Flavivirus can cause febrile LEVELS IN J774 CELLS illness, hemorrhagic fevers, hepatitis and encephalitis Caetano, C.C.S.; Camini, F.C.; Almeida, L.T.; Rocha, V.A.; in humans. Flaviviruses of major importance to public Magalhães, J.C.; Magalhães, C.L.B. health are Dengue virus (DENV), Yellow fever virus (YFV), West Nile virus (WNV), Japanese encephalitis virus 1. UNIVERSIDADE FEDERAL DE OURO PRETO (JEV) and Saint Louis encephalitis virus (SLEV). Minas 2. UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL REY Gerais state has three of the major biomes found in Mayaro virus (MAYV) is member of the family Togaviridae, Brazil (Cerrado, Atlantic Forest and Caatinga) that are genus Alphavirus. MAYV is phylogenetically related to considered hotspots of biodiversity. The Atlantic Forest Chikungunya virus (CHIKV) and causes outbreak of in Minas Gerais has been under strong anthropogenic febrile disease with articular involvement in the Amazon pressure, causing fragmentation and reduction of wild region. Despite the public-health importance of MAYV, animal habitats in southeastern Brazil. This habitat there is little information regarding the pathogenic fragmentation may be related to the occurrence and characteristics of this virus. Since previous studies have increased incidence of infectious diseases, caused by suggested that oxidative stress, as part of the host cell pathogens that can be maintained in animals, including response, might play an important role in the pathogenesis small mammals. The great diversity of rodent species; of a variety of viral infections, the purpose of this study its remarkable reproductive potential and their ability was to examine the involvement of oxidative stress in
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
50 Basic Virology: BV infection by MAYV. Macrophage lineage cells were chose of a probiotic (named LST) in VACV infection in a murine because has been described that macrophages are an groups according to infection with VACV-WR (106 P.F.U indicating an involvement of this cell in the pathogenesis bymodel. intranasal Four week infection) old Balb/C and micetreatment were dividedwith probiotic in four ofimportant the arthritis component induced by of alphaviruses. the inflammatory Reactive infiltrate, oxygen (108 C.F.U. via gavage). Groups not infected or not treated species (ROS) and malondialdehyde (MDA), an end received saline buffer instead of virus or probiotic. product of lipid peroxidation and biomarker of oxidative The groups were named PBS (neither infection nor stress, were evaluated in murine macrophages J774 treatment); LST (treatment without infection); VACV infected by MAYV at multiplicity of infection (moi) of 1 (infection without treatment) and LST-VACV (infection and treatment). Viral titers in lungs, liver and brains measurement, J774 cells were loaded with 5-(and-6)- were analyzed in BSC-40 cells. Cytokines were measured and/or 5, at various hours post infection (pi). For ROS in lung samples by ELISA essay (TNF-alpha, IL-17 and (carboxy-H2DCFDA) for 45 minutes and treated with IFN-gamma) or qPCR (IFN-alpha, IFN-beta, IFN-lambda tert-butylcarboxy-2',7'-dichlorodihydrofluorescein hydroperoxide (an inducer of ROS production) diacetate and interferon stimulated genes such as PKR and OAS). or infected with MAYV at moi of 5. At various time Results were plotted using student´s t-test.Lung samples were also submitted to histological analysis which measured. To evaluate the biomarker of oxidative stress, J774points cells (1, were2, 3, 4,infected 6, 12 and with 24 MAYV hours) at moifluorescence of 1 or 5 wasand according to lesion extent and severity. Results showed cell supernatants were harvested at 6, 15, 24 and 48 h thatclassified treatment the infection with probiotic in mild, decreased moderate lethality or severe in pi to measure malondialdehyde (MDA) by colorimetric lung, brain and liver of LST-VACV group. Treatment ROS at 6, 12 and 24 hours pi. In MAYV infected cells, there 50% and reduced significantly the titers of VACV in assay. MAYV infection induced a significant increase of such as TNF-alpha(20%), IFN-gamma(45%) and IL- and 48h pi in comparison with control cells. This study 17(29,5%).Levelsalso reduced the expression of antiviral ofcytokines inflammatory expression cytokines such suggestswas a significant the implication increase of in infection MDA in MAYV times inof increased6, 15, 24 as IFN-alpha, IFN-beta and IFN-lambda, in addition production excessive of ROS and their damage the J774 of ISGs, OAS and PKR were maintained in LST-VACV cells. These results may be related to the effect of the group. Besides that, histological analysis showed that MAYV on the activation of phagocytic cells, resulting in animals from VACV group developed severe lung lesions, increased ROS and consequent induction of oxidative stress. Financial Support: FAPEMIG, UFOP, CNPq and LST-VACV group presented moderate or mild focal CAPES. alveolar collapse and inflammatory cell infiltrate, while and partial preservation of alveolar air spaces.Taken BV67 - INTERFERENCE OF A PROBIOTIC IN VACCINIA together,lesions, with results less showed prominent that interstitialthe daily intake inflammation of LST VIRUS SYSTEMIC SPREAD AND LETHALITY IN VIVO resulted in reduction of viral spread, attenuation of lung Andrade, A.C.S.P.; Lima, M.T.; Oliveira, G.P.; Calixto, R.S.; Leite, C.M.A.; Martins, F.S.; Ferreira, J.M.S.; with VACV. Elucidation of the mechanisms used by this Oliveira, D.B.; Souza, D.G.; Kroon, E.G.; Abrahão, J.S. probioticinflammation during and VACV decreased infection lethality can contribute in mice infected to the 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS research for alternative treatments, which can minimize 2. UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL REY the damage caused by these infections. Financial Vaccinia virus (VACV) is the prototype of the Support: CAPES, CNPq, FAPEMIG, MAPA, PRPq-UFMG. Orthopoxvirus (OPV) genus, a group that comprises important pathogens which cause worldwide disease outbreaks. Although many studies have shown important relationships between probiotics and microorganisms, its activity in OPVs infections is completely unknown. For that reason, this work aims to investigate the effects
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
51 Basic Virology: BV
BV70 - IMODULATION OF THE EXPRESSION OF BV78 - HPV-TRANSFORMED CELLS SURVIVAL ARE MIMIVIRUS-ENCODED TRANSLATION-RELATED DEPENDENT ON DNA DAMAGE REPAIR PATHWAYS GENES IN RESPONSE TO NUTRIENT AVAILABILITY Abjaude, W.; Prati, B.; Montenegro, A.; Lino, V. DURING ACANTHAMOEBA CASTELLANII INFECTION UNIVERSIDADE DE SÃO PAULO Boratto, P.V.M.; Boratto, P.V.M.; Silva, L.C.; Almeida, Persistent infection with some HPV types is associated G.M.; Assis, F.L.; Albarnaz, J.D.; Dornas, F.P.; Andrade, with increased risk of developing carcinomas at different K.R.; La Scola, B.; Kroon, E.G.; da Fonseca, F.G.; anatomic sites. During malignant transformation Abrahão, J.S. viral oncoproteins induce structural and numerical 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS chromosome alterations and modulate cellular response 2. AIX MARSEILLE UNIVERSITÉ do DNA damage. On the other hand, DNA repair The complexity of giant virus genomes is intriguing, machinery is essential in some steps of HPV life cycle especially the presence of genes encoding components and crucial for tumor cells survival. These observations of the protein translation machinery such as transfer suggest that cellular DNA repair machinery may play a RNAs and aminoacyl-tRNA-synthetases; these features dual role in hpv biology and pathogenesis. Therefore, we are uncommon among other viruses. Although hypothesize that HPV-transformed cells are dependent on some DNA damage repair pathways. To address one can hypothesize that having these translation- this question, we set our goal to identify genes that are orthologues of these genes are codified by their hosts, essential for HPV transformed cells survival. We have infection. Therefore, the aim of this study was to systematically silenced 116 genes involved in DNA repair evaluaterelated genes the expression might represent of translation-related a gain of fitness genes during by and 73 tumor suppressors with a redundancy great than mimivirus during infection of Acanthamoeba castellanii under different nutritional conditions. In silico analysis delivered shRNA to HeLa, SiHa and Primary Human of amino acid usage revealed remarkable differences Keratinocytesor equal to five cell shRNA lines for and each viability gene. Lentiviral was evaluated vectors between the mimivirus isolates and the A. castellanii by Alamar Blue reduction. Statistical analyses were host. Relative expression analysis by quantitative performed by student's unpaired t-test using Graphpad PCR revealed that mimivirus was able to modulate Prism Software (Graphpad Software, La Jolla, CA). We the expression of eight viral translation-related genes according to the amoebal growth condition, with a higher induction of gene expression under starvation. Some viability.identified Futhermore, 22 genes which silencing down-regulation of four of theseaffects genes HPV- mimivirus isolates presented differences in translation- reducedtransformed clonogenic cervical and cancer proliferative derived cells capacity proliferation/ of HeLa related gene expression; notably, polymorphisms in the and SiHa when compared to normal Primary Human promoter regions correlated with these differences. Two Keratinocytes. This approach may contribute to mimivirus isolates did not encode the tryptophanyl- identify genes that are essential for HPV-transformed tRNA in their genomes, which may be linked with low cells survival and has the potential to contribute to conservation pressure based on amino acid usage the development of anti-viral therapies to treat HPV- analysis. Taken together, our data suggest that mimivirus associated diseases. Financial Support: FAPESP (Grant can modulate the expression of translation-related genes in response to nutrient availability in the host cell, allowing the mimivirus to adapt to different hosts # 2010/20002-0, 2012/16512-8, 2014/21361-4), CNPq growing under different nutritional conditions. Financial and INCT-HPV # 573799/2008-3. Support: CAPES, FAPEMIG, CNPq, MAPA.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
52 Basic Virology: BV
BV83 - CYTOTOXICITY OF THE CORAL MUSSISMILIA BV93 - DISPLAY OF PEPTIDE L2 FROM HUMAN BRAZILIENSIS EXTRACT IN MT-2 CELLS PAPILLOMAVIRUS (HPV) ON VIRUS-LIKE PERMANENTLY INFECTED WITH HTLV -1 PARTICLES OF BACTERIOPHAGE PP7: STRUCTURAL Carvalho, L.D.; Martins,C.P.S.; Reis, J.K.P.; França, J.P.; CHARACTERIZATION OF A POTENTIAL VACCINE Gadelha, S.R.; Marin, L.J.; França, L.P.; Franco,G.M.; PLATFORM Resende, C.F.; Bueno, B.L.; Pellinzzoni, T.A.; Gadelha, Santos, A.C.V.; Oliveira, E.G.; Peabody, D.S.; Silva, J.L.; A.N. Gomes, A.M.O.; Oliveira, A.C. 1. UNIVERSIDADE ESTADUAL DE SANTA CRUZ 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. UNIVERSITY OF NEW MEXICO 3. FACULDADE DE VETERINÁRIA Virus-like particles (VLPs) are valuable tools in The human T lymphotropic virus 1 (HTLV-1) is a nanobiotechnology. These particles are obtained by self- retrovirus that infects humans and has a high prevalence assembly, either in vivo or in vitro, of structural proteins in some regions of the world. It is known that HTLV-1 of viral capsids. VLPs make good vaccines because of the regularity of capsid structure, presenting viral epitopes as dense repetitive arrays, which are highly stimulatory causes leukemia / lymphoma adult T cells (ATL), HTLV- to B-cells. Here we describe the engineering of VLPs of associated myelopathy / tropical spastic paraparesis PP7, a bacteriophage of Pseudomonas aeruginosa, for an(HAM empirical / TSP), treatment and other is performed inflammatory to treat conditions. symptoms At the purposes of peptide display. The folding of the coat usingthis time, steroids, there isinterferon no specific andtreatment antiretroviral to be used drugs and protein of the RNA phage PP7 does not normally tolerate usually used to treat patients with AIDS. The Mussismilia insertions in its AB-loop, but an engineered single-chain braziliensis is the coral endemic in the coast of Bahia dimer readily accepts them as long as they are restricted State, Brazil. Studies indicate that extracts obtained from to one of its two halves. These virus-like particles (VLP)- various species of coral are rich sources of bioactive based vaccines display short peptides from the HPV molecules to the human population, with important minor capsid protein L2 and elicit high-titer and broadly pharmacological properties including antitumor, protective antibody responses. Here we characterize antimicrobial and antiviral allowing the development the effects of the insertion on the stability of PP7 VLPs of new drugs. In a pilot study MT-2 cells permanently displaying L2 peptides from three different HPV types in infected with HTLV-and Jurkat cells (control ) were an AB-loop of the coat protein single-chain dimer. These treated with different concentrations of Mussismilia effects were assessed by dynamic light scattering (DLS) braziliensis extract. The cytotoxicity of the extract and circular dichroism (CD). We analyzed the morphology Mussimilia braziliensis was evaluated by MTT assays of VLPs by transmission electron microscopy. In addition, at concentrations ranging from 10 mg to 100 mg in 24 we predicted the structure of the coat protein containing h. The results showed that the coral extract has low the different inserts by using I-tasser server. The VLPs toxicity to MT2 and Jurkat cells (about 4% cytotoxicity displaying L2 showed similar diameters on different pH compared to control cell) in the tested concentrations. values, and do not seem to suffer aggregation at acidic Although more research is needed, these preliminary data showed that the Mussimilia brasiliensis extract can changes in secondary structure of the VLPs under high be a potential candidate for an antiviral drug. Keywords: concentrationor basic pH. CD of urea. measurements Our results indicate demonstrate no significant that the HTLV-1, antiviral, Mussimilia braziliensis. Financial VLPs containing the insertions behave slightly different Support: HTLV-1, antiviral, Mussimilia braziliensis. from the ones assembled from native coat protein. The stability of a VLP is an important consideration for its use in nanobiotechnology. Our work aims to contribute for the characterization of this potential pan-HPV vaccine based on VLPs. Keywords: Virus like particles, Human Papillomavirus, vaccine. Financial Support: FAPERJ,
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV CNPq, CAPES, INBEB/CNPq. XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
53 Basic Virology: BV
BV94 - EVALUATION OF THE EFFECT OF NATURAL compounds act on HCV replication. Keywords: Antiviral; AND SYNTHETIC COMPOUNDS IN HEPATITIS C VIRUS Hepatitis C virus; Natural and synthetic compounds. REPLICATION IN VITRO Financial Support: FAPESP. Machado, R.R.G.; Bittar, C.O.; Campos, G.R.F.; Lima, BV106 - EVALUATION OF HANTAVIRUS INFECTION C.S.; Jardim, A.C.G.; Regasini, L.O.; Rahal, P. IN HUMAN AND RODENTS IN RIO DE JANEIRO STATE, 1. UNIVERSIDADE ESTADUAL PAULISTA "JÚLIO DE BRAZIL MESQUITA FILHO" – INSTITUTO DE BIOCIÊNCIAS, Strecht, L.; Oliveira, R.C.; Guterres, A.; Fernandes, J.; LETRAS E CIÊNCIAS EXATAS 2. UNIVERSIDADE FEDERAL DE UBERLÂNDIA - Teixeira, B.R.; Bonvicino, C.R.; D`Andrea, P.S.; Lemos, INSTITUTO DE CIÊNCIAS BIOMÉDICAS E.R. Hepatitis C virus (HCV) affect around three percent of 1. INSTITUTO OSWALDO CRUZ the world population. Chronic infection can progress 2. INSTITUTO NACIONAL DO CÂNCER to liver cirrhosis and hepatocellular carcinoma, which Hantavirus pulmonary syndrome (HPS) has been is the leading cause of liver transplants in the world. registered in Brazil since 1993 and transmission to Currently, there is no effective vaccine for prevention of humans occurs through inhalation of viral particles HCV infection and the treatment commonly employed present in aerosols from excreta of infected rodents. In consists of a triple therapy, based on pegylated interferon Brazil, nine viral genotypes characterized from rodents (IFN) plus ribavirin (RBV) and a drug of direct action (DAA). However, this therapy already has viral resistance and severe side effects. These demonstrates the need for withand/or wide humans distribution have among been most described, Brazilian six states of them and the development of new antivirals, which have greater highpathogenic. lethality. Over Hantavirus 1.600 humanpulmonary cases syndrome were confirmed, presents as an acute febrile illness characterized by severe natural and synthetic compounds can represent an cardiovascular and respiratory compromise. Patients alternativeefficiency insource the treatmentfor the development of hepatitis of C. new Therefore, drugs. may exhibit a wide variety of clinical manifestations, Thus, this study aims to evaluate the effect in vitro on HCV where signs and symptoms can be confused with replication of two natural and two synthetic compounds. other diseases. Thus the differential diagnosis of HPS The natural compounds were extracted from Pterogyne is necessary from other illnesses with similar clinical nitens leaves and consists of the ethanol extract (EE), and manifestations, such as dengue. There are no reports its acetate fraction (F.AcetOH). The synthetic compounds of human cases in Rio de Janeiro state, until now, but and C.A I). Using Huh 7.5 cells continuously expressing circulating pathogenic hantavirus among wild rodents anare HCV two subgenomicchrysins acetylated replicon, in luciferase different regionsand MTT (C.A assays 4/5 inserologic Parque Nacional evidence da in Serra humans dos Órgãos and confirmation in Teresopolis, of were performed to access viral replication and cell related to the rodent Oligoryzomys nigripes were viability, respectively. Among the data obtained so far found. In this scenario, this study aimed to evaluate hantavirus infection in human, wild and synanthropic reduction in viral replication and 85% cell viability. The rodents samples from different municipalities in Rio chrysin C.A 4/5 showed promising results, with a 35% de Janeiro state. Serum samples from 497 dengue fever results. Studies indicate that chrysin has anticancer seronegative patients, from 25 municipalities provided activity,other compounds antioxidant tested and did hepatoprotective not present significant action, but there are no data on its action in HCV replication. from seven municipalities, were analyzed by enzyme- These properties are extremely important, since HCV linkedby the LACEN/RJ,immunosorbent and 235 assay serum for samples detection from rodents,of anti- hantavirus antibodies of IgM and IgG (IgM and IgG ELISA) and molecular tests. Five human samples, from Valença, is a hepatotropic virus. Thereby, the C.A 4/5 compound Vassouras and Nova Friburgo municipalities, presented decreasewill be subjectedthe rate of to viral structural replication. and/or In addition, purifications more IgM antibodies against hantavirus. A rodent species O. studiesmodifications are necessary in order to tobetter increase understand cell viability how these and nigripes was found to be ELISA-reactive for IgG in the city
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
54 Basic Virology: BV of Valença. The absence of RNA in human samples made assays revealed that isolates from 2009 and 2010 formed it impossible to perform unable to achieve molecular comet tails smaller than those of CTGV CM-01, whereas GJT-05 formed comet tails equal or larger than CTGV CM- but the sample of the reactive rodent made it possible 01. To analyze virus spread in cell culture, we infected totests detect for characterization the variant viral and Juquitiba. identification In conclusion, of the virus, the BSC-40 cells with low MOI of each clinical specimen, and Juquitiba hantavirus in harvested cells 0, 24, 48, and 72 hpi for virus titration by wild rodents and serological evidence of infection in plaque assay. All clinical isolates showed similar growth humanidentification samples of in pathogenic this study reinforce the importance and need for surveillance of HPS in the state of Rio de Janeiro. Keywords: Antiviral; Hepatitis C virus; Natural intranasallycurves. Virulence infected assays with we 5x105 first performedPFU of each using virus two or mock-infectedviral clones of with URU-07 PBS. and After GJT-05. 14 days Balb/c post-infection mice were CNPq. we observed that only the neurovirulent control strain and synthetic compounds. Financial Support: FIOCRUZ/ BV107 - BIOLOGICAL CHARACTERIZATION AND The assay is currently being performed using higher VIRULENCE OF CLINICAL SPECIMENS OF CANTAGALO dosesVACV-WR of virus.led to Oursignificant results weight show lossimportant of infected biological mice. VIRUS ISOLATED IN RONDÔNIA DURING OUTBREAKS differences between clinical isolates circulating in RO, OF POXVIRUS-RELATED DISEASE IN DAIRY COWS thus demonstrating the need for further investigation Rezende, B.C.; Damaso, C. of these isolates. Genome sequencing of URU-07 and UNIVERSIDADE FEDERAL DO RIO DE JANEIRO GJT-05 is in progress. Financial Support: CAPES, CNPq, Ministério da Defesa and Faperj. Cantagalo virus (CTGV) is a strain of vaccinia virus (VACV; Poxviridae) isolated from pustular lesions in dairy cattle BV110 - ANTIVIRAL SCREENING OF MEDICINAL in 1999 in Rio de Janeiro. The disease has spread to several PLANTS WITH POTENTIAL ANTI-HERPES ACTIVITY Boff, L.; Kratz, J.M.; Mair, C.E.; Rollinger, J.M.; Schenkel, E.P.; Simões, C.M.O. introducedstates of Brazil in 2009.and have However, resulted the in substantialbiological features,financial differenceslosses, especially in virulence in Rondônia and the (RO), genetic where diversity CTGV was of first the 1. UNIVERSIDADE FEDERAL DE SANTA CATARINA 2. UNIVERSITY OF VIENNA viruses circulating in RO are currently unknown. In this work, we studied seven clinical isolates obtained from In the therapeutic context, most of the planet's 2009 to 2012. To evaluate virus plaque phenotype that biodiversity has not been adequately explored yet. Active
BSC-40 cells with each clinical isolate for 48 hours and the discovery of new drugs, especially against infectious measuredreflect the de radial diameter spread of of40 therandom infection, viral plaques. we infected We diseases.compounds Hence, of natural the development origin have greatof new significance biologically in observed that CTGV isolate CM-01 (reference CTGV active natural compounds remains a research topic from 1999) had a mean diameter of 397.3 µm, while of practical relevance. In this report, we describe a specimens collected in Urupá (URU-07) in 2009 and in screening approach aiming at the evaluation of the anti- Jaru, Governador Jorge Teixeira, Espigão D’Oeste, Campo HSV-1 (KOS and 29-R strains, sensitive and resistant Novo de Rondônia and Ji-Paraná in 2010 presented to acyclovir, respectively) and HSV-2 (333 strain) mean diameters of 306.3 µm, 313.3 µm, 309.9 µm, 324.2 activities of extracts, fractions and isolated compounds µm, 330.7 µm and 344.8 µm respectively. Interestingly, from medicinal plants. A total of 103 samples were isolates from Governador Jorge Teixeira in 2012 (GJT- collected, acquired from local vendors or obtained via 05) presented plaques with mean diameter of 638.1 µm. partnership with national and international research To evaluate qualitatively the production and the long distance spread of extracellular virus, we performed comet tail assays. BSC-40 cells were infected with 50 groups (hERGscreen Project - http://www.uibk. PFU and after adsorption, the monolayers were tilted at usingac.at/pharmazie/pharmakognosie/hergscreen). the sulforhodamine B assay. Anti-HSV activity was The 5o for 4 days when viral plaques were visualized. These investigatedcytotoxicity wasby plaque preliminarily number reductionverified on assay. Vero Through cells by
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
55 Basic Virology: BV non-linear regression analyses, we estimated the agents, our research group has been evaluating the concentrations of samples at which cell viability (CC50 antiviral activity of several Brazilian biodiversity taxons. values) and viral replication (IC50 values) were reduced In this study, we evaluated the cytotoxicity on Vero cells by 50%. The ratio between CC50 and IC50 characterizes as well as the anti-HSV-1 (KOS and 29-R strains, sensitive the selectivity index (SI), indicating how promising each and resistant to acyclovir, respectively) and anti-HSV-2 sample is. To determine the cytotoxicity, samples were (333 strain) activities of the ethyl acetate standardized
50 values were bark extract (EASBE) of Strychnos pseudoquina A. determined for those samples for which cell viability St. Hil. (Loganiaceae), popularly known as quina-do- wasfirstly reduced. screened In at 100order ug/mL. to evaluate Then, the anti-HSV CC activity, cerrado a preliminary screening was performed with non- cytotoxic concentrations. For the samples that inhibited This plant, along was withselected two based isolated on compoundsa preliminary [quercetin antiviral 3-O-methyl ether (3MQ) and strychnobiflavone (SBF)]. HSV replication at least by >40%, the IC50 values were screening carried out in our laboratory. The cytotoxicity estimated by concentration-response curves. For HSV- was evaluated by using the sulforhodamine B assay, and 1 (KOS strain), 33 samples inhibited virus replication the anti-HSV-1 and HSV-2 activities were investigated by by >40%; 21 samples for HSV-1 (29-R strain); and 22 plaque number reduction assay. Results were expressed samples for HSV-2 (strain 333). Based on the calculated as 50% cytotoxic concentrations (CC50) and 50% of
SI values, it was possible to select the samples with viral replication inhibitory concentrations (IC50) as well the greatest anti-herpes potential, which are already as the selectivity index (SI) of each sample (CC50 50), being submitted to various in vitro strategies in order which indicates how promising they are. 3MQ exhibited to elucidate their mechanism of action. Keywords: HSV, the highest toxic effects on Vero cells (7.35 µM),/IC and natural products, medicinal plants, antiviral activity. Financial Support: CCNPq, CAPES and Marie Curie while SBF was well tolerated (424.1 µM). Regarding the Foundation, International Research Staff Exchange antiviralEASBE presented activity, moderatethe best resultstoxic effects were (53.77obtained µg/mL), with Scheme – IRSES - 7th Framework European Programme. SBF against HSV-2 and HSV-1 (KOS strain) presenting SI values of 42.33 and 22.61, respectively. Concerning BV112 - STRYCHNOS PSEUDOQUINA A. ST. HIL.: A BRAZILIAN MEDICINAL PLANT WITH PROMISING IN VITRO ANTIHERPES ACTIVITY EASBE activity, the SI values were 3.84 [HSV-1 (KOS Boff, L.; Silva, I.T.; Farias, L.M.; Kratz, J.M.; Leite, J.P.V.; ourstrain)], tested 3.05 conditions. [HSV-1 (29-RCurrently, strain)] experiments and 6.22 to [HSV-2clarify Simões, C.M.O. the(333 mechanism strain)]. 3MQ of actionhad no of significant SBF and antiviralEASBE are action being at 1. UNIVERSIDADE FEDERAL DE SANTA CATARINA conducted in our laboratory. Keywords: HSV, natural 2. UNIVERSIDADE FEDERAL DE VIÇOSA products, Strychnos pseudoquina. Financial Support: Nowadays, it is estimated that 60-95% of the adult CNPq and CAPES. population worldwide is infected with at least one BV114 - VIRULENCE, IMMUNOGENICITY AND Herpes Simplex Virus (HSV-1 or HSV-2). This fact turns GENOMIC ANALYSIS OF THE BRAZILIAN SMALLPOX HSV infections into an important public health problem, VACCINE STRAIN IOC especially due to HSV ability to cause acute and recurrent Medagila, M.L.G.; Moussatché, N.; Nitsche, A.; infections as well as the capacity to become resistant to Dabrowski, P.W.; Li, Y.; Damon, I.K.; Lucas, C.O.; commonly used antiherpes drugs. In this context, natural Arruda, L.B.; Damaso, C.R. products provide an important source of biologically active substances, playing a key role in the research 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO and development (R&D) of novel antiherpes products. 2. UNIVERSITY OF FLORIDA 3. ROBERT KOCH INSTITUTE Actually, natural products and natural-derived scaffolds 4. CENTERS FOR DISEASE CONTROL AND PREVENTION have been usually considered in R&D of antiviral agents, accounting for 57% of the small molecules released in the Smallpox accounted for millions of deaths throughout pharmaceutical market. In the search for new antiviral human history. It was eradicated in 1980 due to
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
56 Basic Virology: BV worldwide vaccination with vaccinia virus (VACV). BV126 - ANTIVIRAL ACTION OF METHANOLIC Nevertheless, the possible reemergence of the disease EXTRACT OF GEOPROPOLIS FROM SCAPTOTRIGONA led to the maintenance of smallpox vaccine stockpile POSTICA AGAINST HERPESSIMPLEX VIRUS (HSV-1) and routine vaccination for restricted personnel in some REPLICATION countries. However, the high rates of complications Barbosa, T.F.; Figueiredo, C.A.; Negri, G.; Fernandes- following vaccination demand the development of Silva, C.C.; Coelho, G.R.; Oliveira, M.I.; Curti, S.P.; safer vaccines. The isolation of attenuated clones from Zucatelli, R.M.; Villar, K.S.; Taniwaki, N.N. 1. INSTITUTO ADOLFO LUTZ against smallpox is an interesting approach. VACV strain smallpox vaccine strains known to efficiently protect 2. INSTITUTO DE BIOCIÊNCIAS IOC (VACV-IOC) was the seed strain of the smallpox 3. INSTITUTO BUTANTAN vaccine manufactured by Instituto Oswaldo Cruz-RJ Propolis is a resinous material comprising plant during the smallpox eradication program. However, exudates and wax used by bees for sealing the hive little is known about the biological and immunological and as protection against microorganisms. The studies about chemical composition and biological activity of propolis had focused mainly on species forfeatures further of characterization. this first-generation Both clones vaccine. showed Hereto, similar we Apis mellifera L. (Hymenoptera: Apidae). The uncommon propolis viralplaque yield purified and comparabletwo clones of levels VACV-IOC, of extracellular B141 and B388,virus collected by stingless bees of the Meliponini tribe is a titers in BSC-40 cells. B141 production of actin tails mixture of resin, wax, and soil known as geopropolis. per infected cell was 1.3-fold lower than that of B388; Stingless bees are widely found in tropical and however, both clones produced actin tails of comparable subtropical areas worldwide. There are few studies about the uncommon propolis collected by stingless bees of the Meliponini tribe known as geopropolis The andsize. neutralizing Mice immunized antibodies by tail 21 scarificationdays post-immunization with either geopropolis from Scaptotrigona postica was collected (4,000VACV-IOC and clones 1:30, respectively).produced similar Moreover, levels ofimmunization specific IgG in the region of Barra do Corda, Maranhão state,Brazil. The Vero cells were infected with HSV-1 (herpes simplex virus) strain (McIntyre) at a concentration of cellwith subsets.clones B141 Mice and survived B388 inducedintranasal priming infection of IFN-γ, with 10-7 and monitored for cytopathic effects during 3 days. dosesTNF-α oras IL-2high producing as 107 PFU T cells, of eitheras well VACV-IOC as polyfunctional clones. Geopropolis was added to the cells at 3 h prior to virus B388-infected mice showed a 10% weight loss and at infections, 1 h after virus infection, and virucida. These most two of the scored clinical signs of disease, whereas antiviral screenings were repeated independently three B141-infected mice did not lose weight or showed any times with three concentrations of geopropolis (96, clinical signs of disease. Nevertheless, replication of 24, and 8 B141 and B388 was limited to trachea and lungs and did µ geopropolis effect on the infected cells was carried out not spread to spleen and liver. Immunization with either using Real-TimePCR.g/mL). After The this,chemical the determination analysis of ethanolic of the B141 or B388 conferred full protection of mice against extract of this geopropolis was carried out through a lethal challenge, comparable to immunization with the licensed vaccine strain ACAM2000 and the original pool of VACV-IOC. Full genome sequencing revealed the catechinHPLC-DAD-ESIMS/MS derivatives and and hydroxycinnamic the main constituents acid amidefound presence of several fragmented virulence genes in B141 were flavones-C-glycosides, together with alkaloids, and B388 genomes that are probably non-functional, showed reduction of about 98% in all conditions and e.g., F1L, B13R and C10L. The virulence genes K3L and concentrationderivatives. Quantification tested of the of geopropolis viral DNA extract. from HSV-1 The C3L are fragmented only in B141 genome, which might results obtained were corroborated by transmission partially explain the differences in virulence between electron microscopy, in which the images did not show clones B141 and B388. Financial Support: CAPES, CNPq, particle or viral replication complex .The antiviral FAPERJ and InPeTAm.
activity of C-glycosyl flavones was reported for a variety October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
57 Basic Virology: BV of viruses, being observed at different points in the viral replication. Financial Support: CAPES. The G2 clones presented exclusive genetic and biological markers,confirmed distinct the co-circulation to reference of isolates, two VACV-BR including lineages. VACV- BV127 - FROM LESIONS TO VIRAL CLONES: BIOLOGICAL AND MOLECULAR DIVERSITY AMONGST with both G1 and G2 features based on the molecular AUTOCHTHONOUS BRAZILIAN VACCINIA VIRUS analysisWestern Reserve.of A56R, TwoA26L clones and C23Lpresented genes. a mosaic Indeed, profile, some Oliveira, G.P.; Mota, B.E.F.; Assis, F.L.; Almeida, G.M.; SNPs and INDELs in A56R nucleotide sequences were Albarnaz, J.D.; Lima, M.T.; Andrade, A.C.P.; Calixto, observed among clones of the same virus population. R.S.; Oliveira, C.H.S.; Barbosa, J.D.; Trindade, G.S.; These results provide information about the diversity Ferreira, P.C.P.; Kroon, E.G.; Abrahão, J.S. 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS to VACV evolution and maintenance in the environment. 2. UNIVERSIDADE FEDERAL DO PARÁ Keywords:profile in VACV Vaccinia populations, virus; clones; highlighting diversity; its importance evolution. Vaccinia virus (VACV) has had an important role for Financial Support: CAPES, CNPq, FAPEMIG. humanity because of its use during the smallpox BV140 - THE “IN VITRO” EFFECT OF TIZOXANIDE ON eradication campaign. VACV is the etiologic agent of the DENGUE VIRUS-2 REPLICATION bovine vaccinia (BV), an emerging zoonosis that has Ferreira, D.; Yamamoto. K.; Meneses, M.; Salles, T.; been associated with economic, social, veterinary and Campos, R.; Goshe, M.; Blackburn, K.; Vancini, R.; public health issues. Despite the current and historical Soares, M.; Brown, D. VACV importance, there is little information about its circulation, prevalence, origins and maintenance in the 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO environment, natural reservoirs and diversity. Brazilian 2. NORTH CAROLINA STATE UNIVERSITY VACV (VACV-BR) are grouped into at least two groups: Dengue virus is a leading cause of illness and death in group 1 (G1) and group 2 (G2). In this study, we went to the tropics and subtropics with no available antiviral treatment or vaccine to cure or prevent infection. from lesions. Two viruses were isolated from swabs of the field and investigated VACV clonal diversity directly control the virus. Tizoxanide (TIZ) is the active compound Bahia and Minas Gerais states and eight viruses were ofTherefore, Nitazoxanide other (NTZ), approaches a thiazolide are anti-infective needed to fight licensed and isolatedvesicular from fluids scabs collected obtained of milkers’ from hands,cattle’s obtained teats, two in for the treatment of parasitic gastroenteritis. In this study, obtained from Bahia state, two from Para state, two the anti-DENV-2 activity of TIZ was evaluated in Vero from Goiás state, one from Minas Gerais state and one cell culture. Neutral red dye uptake method was used from Espírito Santo state. The samples were collected to evaluate the cytotoxicity of TIZ and the replication of during BV outbreaks that occurred between 2005 and DENV in the mock- and TIZ-treated cells was examined 2011. A total of 48 viral clones were selected. Biological by virus titration. TIZ was also administered at different and molecular assays were performed to compare the time points of infection to determine the stage at which isolated clones. Plaque phenotype assays demonstrate it affected DENV replication. TIZ inhibited the replication the co-circulation of VACV with distinct plaque-size of DENV in cell culture in a dose-dependent manner with phenotypes in the same VACV population. The large TCID50% 50% plaque clones exhibited an increase of 2–4 logs when reduced valueup to 90%,of 0.36 compared µg/ml (CC to mock-treated=1.75 µg/ml; cells. IS=4.8 TIZ virulence differences between large plaque and small showedµg/ml). Thelittle viral or none yields antiviral of the TIZ-treatedeffect in other cells stages pi were of plaquecompared viruses. to the Our small results plaque demonstrate clones. Was that confirmed the VACV- the viral replication (virucidal, pre-treatment, adsorption, BR-G1 were more frequently isolated, since 92% of the penetration, virus release). Our results corroborate with isolated clones were grouped in G1 while only 8% were Shi et al (2014) study, which indicated that NTZ has anti- grouped in G2. Furthermore, was co-detected the two Japanese encephalitis virus activity, acting at the early- variants (G1 and G2) in the same sample. Molecular and mid stage of viral replication. These results also suggest biological analysis corroborated previous reports and
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology:the potential BV application of NTZ/TIZ in the treatment of XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
58 Basic Virology: BV
Therefore, APS could be used as a potential antiviral or as a template to the development of future drugs carriedflavivirus out infection. in order Proteomic to elucidate ongoing the changes analysis in using cell cultureshotgun by and this SDS-PAGE molecule LC-MS/MSand the mechanism approach of is action being on Dengue replication. Financial Support: CNPq, CAPES, against HCV. Financial Support: PROGRAD/DIREN-UFU FAPERJ, INBEB (2014PBG000832), CNPq (445021/2014-4), FAPESP (2011/11753-4).BV145 - DIFFERENTIAL SUBCELLULAR LOCATION BV143 - EFFECTS OF THE EXTENDED TREATMENT OF THE VP3 PROTEIN OF AVIAN GYROVIRUS 2 IN WITH THE NATURAL OCCURING ALKALOID APS ON NORMAL AND TUMOR CELLS AND ITS RELATION HEPATITIS C VIRUS REPLICATION WITH SELECTIVE PRO-APOPTOTIC FUNCTION Shimizu, J.F.; Silva, S.; Shimizu, J.F.; Santos, V.A.F.F.M.; Costa, C.S.; Knak, M.B.; Costenaro, J.G.; Campos, F.S.; Felippe, L.G.; Furlan, M.; Rahal, P.; Jardim, A.C.G. Franco, A.C.; Roehe, P.M. 1. SÃO PAULO STATE UNIVERSITY – INSTITUTE OF UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL BIOSCIENCE, LANGUAGE AND EXACT SCIENCE – One of the three proteins encoded by avian gyrovirus 2 IBILCE. DEPARTMENT OF BIOLOGY 2. LABORATORY OF VIROLOGY, INSTITUTE OF (AGV2) is the VP3, which is homologous to the apoptin BIOMEDICAL SCIENCE, FEDERAL UNIVERSITY OF protein of chicken infectious anemia virus (CAV). Several UBERLÂNDIA studies have shown the selective pro-apoptotic potential 3. DEPARTMENT OF ORGANIC CHEMISTRY, INSTITUTE of apoptin in tumor cells, and our group has sought to OF CHEMISTRY, SÃO PAULO STATE UNIVERSITY assess whether AGV2 VP3 presents the same property. The hepatitis C virus (HCV) infection is one of the major It is known that the differential subcellular location of causes of liver diseases. It is estimated that approximately apoptin in tumor and normal cells is directly related to its 3% of the population is infected with this virus. There function and activation of apoptotic pathways by apoptin is no vaccine and the current treatment is expensive seems to be related to its accumulation in the nucleus of and presents many side effects. It emphasizes the tumor cells. With the objective to verify the subcellular distribution of VP3-AGV2 in both tumor and non tumor antiviral to abrogate HCV replication. In this context, cells, human pulmonary carcinoma cells (A549) and compoundsconstant research extracted to develop from plants a safer have and demonstrated more efficient to possess several biological activities including antiviral transduced with recombinant adenoviruses expressing properties. Brazil has a large plant biodiversity and threehuman variants lung fibroblasts of AGV2 cells VP3 (MRC-5), fused to respectively, the V5 peptide were with an M.O.I of 30. Thirty hours post-transduction, an antivirals. Here we evaluated the effects of the extended- treatmentbioactive compounds with the naturallyisolated fromoccurring its flora alkaloid may act APS as antibody was performed and the cell nuclei were stained on HCV replication. Huh-7.5 cells stably expressing indirect immunofluorescence with a primary anti-V5 subgenomic replicon genotype 2a (SGR-FEO-JFH1) location of recombinant proteins was analyzed by were treated with APS at the effective concentration with Hoechst 33342 (2µg/ml). Subsequently, subcellular of 90% (EC90 = 9.4 uM) for 21 days. DMSO was used have shown that the three variants of the AGV2 VP3 have as non-treated control and cyclosporine A (CsA) as theconfocal same fluorescencesubcellular distribution microscopy. pattern. The results In A549 obtained tumor control of inhibition. Culture medium containing APS or cells, VP3-AGV2 was found mainly in the cell nuclei controls was replaced every 3 or 4 days and cells were forming granular pellets. Regarding the MRC-5 cells, the harvested for analysis. Replication levels were obtained protein was preferentially accumulated in the cellular by normalizing the luminescence levels from luciferase cytoplasm; however it could also be detected, to a lesser extent, in the nuclei. These results differ from what was by Bradford method. Therefore, cytotoxicity did not already described for apoptin expression in non tumor interfereassay with with amount the results. of proteins Our indata the indicated lysates quantified that APS cells, and they may be related to the differences found previously in the amino acid sequences and protein sustained its antiviral effects by the end of treatment. significantly reduced viral replication up to 98.6 % and October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
59 Basic Virology: BV structure of AGV2 VP3 and CAV apoptin. Financial BV153 - PERSPECTIVE OF CAFFEINE AS POTENTIAL Support: CNPq and FINEP. ANTIVIRAL AGAINST HEPATITIS C Batista, M.N.; Carneiro, B.M.; Braga, A.C.S.; Rahal, P. BV151 - HSPB1 PROTEIN HAS ANTIVIRAL ACTIVITY AGAINST HCV INSTITUTO DE BIOCIÊNCIAS LETRAS E CIÊNCIAS EXATAS Akinaga, M.M.; Braga, A.C.S.; Carneiro, B.M.; Batista, Hepatitis c is a liver infection caused by hepatitis c M.N.; Rahal, P. virus (HCV) which, in approximately 80% of patients, INSTITUTO DE BIOCIÊNCIAS, LETRAS E CIÊNCIAS progresses to a chronic condition. Pegylated interferon- EXATAS alpha (PEG-INF) in association with ribavirin (RBV) has been the standard treatment for most patients with Several cellular proteins are known to interact with chronic HCV infection in the last decade, however, it the HCV or being necessary to the viral replication process, such as the superfamily of heat shock proteins most recent approved drugs, the direct acting antivirals (HSP). The Hsp are usually translated in response to (DAA),has low have efficacy high cost against and somesevere HCV side-effects. genotypes Therefore, and the cellular stress such as heat shock, nutrient deprivation new treatments have been sought. Caffeine has been and bacterial or viral infections. Among Hsps, HspB1 associated to liver diseases improvement, including liver belongs to a family of small heat shock proteins and has shown antiviral activity in hepatitis B virus (HBV) and the progression of cirrhosis. Caffeine belongs to a group knownabnormal as biochemistrykinases camp asdependents well as fibrosis blockers; and anddelay HCV in have observed an increased expression of HspB1 in uses some kinases for its replication cycle. Our group cellshuman containing immunodeficiency an HCV subgenomic virus (HIV). replicon Other compared studies recently showed caffeine effect on HCV replication but to the cells without the replicon. In patients with there is no a relationship between caffeine and other HCV hepatocellular carcinoma, high expression of HspB1 is replication cycle steps. Thus, the current study proposed associated with HCV presence. Thus, the present study to establish a direct relationship between caffeine and aimed to evaluate in vitro whether HSPB1 has antiviral hepatitis c virus replication cycle. For this purpose, this activity for subgenomic HCV replicon (SGR-JFH1 FEO) and in complete virus (JFH1). For this, human hepatoma line. Viable concentrations of caffeine were determined Huh7.5 cells containing the SGR-JFH1 FEO subgenomic onstudy huh-7.5 used theby MTTfull-length assay. repliconThe effect jfh-1 of caffeineand huh-7.5 on viral cell replicon were transfected with a siRNA to HspB1 mRNA expression was evaluated by focus forming unit assay and and viral replication was assessed 12, 24 and 48 hours qPCR. Caffeine showed to be tolerated (> 80% viability) after transfection. The same process was applied to up to 4 mm on 24 h incubation. Caffeine demonstrated the full-length replicon - JHF1. For SGR-JFH1 FEO, at 30% of inhibition on viral entry on host cells when all times HCV replication was greater when HspB1 was tested in combination with infectious supernatant. knocked down (135%, 117% and 115% respectively). This inhibition increased two fold when particles were We observed similar results at all times for JFH1, siRNA exposed to caffeine previously to introduction on cell HspB1 treated cells showed increased viral replication culture, indicating an interaction between caffeine and (109%, 111% and 119% respectively). These data any of viral glycoproteins. Moreover, caffeine showed suggest that Hsp27 protein represents a cellular defense mechanism, playing an antiviral activity in presence of around 30 % of release inhibition on 4 mm concentration. HCV. Financial Support: FAPESP and CNPq Insignificant conclusion, influence caffeine on antiviralviral secretion effect process,allied to reaching caffeine hepatoprotective effects represents a potential therapy, acting on major steps of viral replication cycle and could be used as support care pre or post liver transplantation, as well as a complement to standard treatment. Financial Support: CAPES; FAPESP.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
60 Basic Virology: BV
BV155 - PHYLOGENETIC AND STRUCTURAL 3c-pro in the picorna-like virus superfamily and, also, ANALYSIS OF THE PROTEASE 3C OF THE PICORNA- the motif 1 and 2 sequences and inter-motif distances in LIKE SUPERFAMILY THROUGH YOUR 4 MOTIFS 3c-pro phylogenetic analysis. Financial Support: CNPq. CONSERVED BV158 - GA-HECATE PEPTIDE INHIBITS REPLICATION Golin, R.O.; Cañedo, A.D.; Barcelos, C. de L. ON HCV GENOTYPE 2A AND 3 UNIVERSIDADE FEDERAL DO PAMPA Batista, M.N.; Sanches, P.R.S.; Carneiro, B.M.; Braga, The viruses of the picornaviridae family and picorna-like A.C.S.; Cilli, E.M.; Rahal, P. virus represent the largest class of known viruses, having 1. INSTITUTO DE BIOCIÊNCIAS LETRAS E CIÊNCIAS a broad host range. The strategy is based on infection EXATAS protease 3c-pro, which is able to cleavage the viral 2. INSTITUTO DE QUÍMICA polyprotein, as well as host proteins. Most picornavirus Hepatitis C is a liver infection arising from hepatitis c phylogenetic studies are performed based on the rdrp virus (HCV). Often it evolves to chronic conditions and and s3h protein sequence and there is a gap for the has been considered the major world cause of cirrhosis 3c-pro philogeny. By the time, phylogenetic studies of and hepatocellular carcinoma. Standard treatment for this protease brought no conclusive data due to the large chronic HCV infection in the last decade, using PEG- variability in 3c-pro protein sequences. In this study we have determined conserved domains, observing 4 genotypes and the most recent approved drugs have high motifs and also, through distance between the motif, costIFN and severe ribavirin side-effects. has low efficacyTherefore, against new treatments some HCV was established standards for viral 3c-pro proteases. have been sought. Some alkyl gallates are powerful By determining conserved sites phylogenetic trees were anti-viral agents used against several pathogens of constructed by the method of maximum likelihood and clinical and veterinary importance. The classical alkyl- even a parsimony tree using the distances between the gallate derivatives, such as epigallocatechin-3-gallate conserved motif. The region of conserved motifs 1 and have showed activity against hepatitis c. In that context 2 demonstrated a better robustness of the phylogenetic the studies demonstrated that gallic acid affects HCV tree, with the best clustering of families and having entry however it has not showed HCV replication a greater resemblance to the tree constructed from inhibition. The peptide synthesis is a new approach for the rdrp. On other hand, we submit 3cpro sequences some infectious diseases therapy and the interaction at conserved domain database (cdd), . The sequences with these small peptides can change some chemical were recognizes as pfam00548 (present in 25 of the properties of some compounds and vice-versa. Thus, studied viruses) wens motif 1 and 2 were separated by the aim of this study was to evaluate the effect of gallic 3 aminoacids, when separation was r larger this domain acid coupled to the Hecate peptide on HCV replication. was not detected, in these case were obtained the For this purpose, huh7.5 cells stable transfected with domains with cl02893 code (present in 16 of the studied the subgenomic replicon SGR-FEO-JFH-1 and S52-LUC viruses), cl13774 (present in 7 of the studied viruses) were evaluated for peptide cytotoxicity by MTT and for or it was not possible to detected any type of peptidase HCV replication by luciferase assay. The hecate peptide domain (7 the studied viruses). The tree obtained using without gallic acid and pure gallic acid (GA) were used for comparative analysis to ga-hecate peptide. For hecate viruses grouped in with your family, but mixing family peptide, the maximum viable concentration on S52-LUC inter-motif distances shown a classification where most picornavirus. These conserved regions of the protease members of iflaviridae and dicistroviridae and some 3c-pro may be the start to establish a relationship Thecells cytotoxicitywas around 0.025was slightly mg/mL, lower while onfor HCVGA-hecate genotype and between proteases of the picornavirus and picorna-like 2apure cells. GA The concentrations peptide’s effect of 0.05 was mg/mldose-dependent. are tolerated. GA- viruses to understand the mechanism of viral infection hecate presented on maximum viable concentration, and also an alternative study for other sequences with around 85% of HCV genotype 3 replication inhibition, high variability. Our datas propose the use of motif 1 while Hecate inhibited around 60% of HCV replication. and 2 weigh matrix provided a great tool for recognize October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
61 Basic Virology: BV
The pure GA presented no inhibition of HCV replication, CLUSTAL W program using the templates found. After as previous described in literature. For genotype 2a, that, the templates with the highest quality were selected GA-hecate peptide presented an inhibition slightly for model building. The models were built based on lower than to genotype 3, reaching 80% of replication the target–template alignments using Swiss-Model inhibition. Thus, we conclude that chemical changes in program. Finally, the global model quality was evaluated the GA-hecate coupling imply in changes in the properties using Qualitative Model Energy Analysis (QMEAN) and for both compounds, once Hecate becomes less toxic and Ramachandram plot generated by RAMPAGE online gallic acid acquire a high antiviral property. This is an portal. As a result, ten models were built through initial study with good perspectives, once peptides are different templates. The best model was obtained using synthetic compounds which can be changed according to E1 glycoprotein of Chikungunya Virus (PDB code 3N41F) as a template. This model had a QMEAN value of -1,89, Financial Support: CAPES. the highest value among the models. This model showed the found effects, being a promising field to be explored. 96% of its amino acid residues in favorable regions and BV161 - HOMOLOGY MODELING OF THE E1 4% in allowed regions. The secondary structure of the GLYCOPROTEIN OF MAYARO VIRUS FOR ANTIVIRAL model consists of 19 beta sheets and 12 alpha-helix. DRUG DESIGN The E1 glycoprotein structure is a promising target for Ferreira, P.G.; Figueiredo, J.E.; Ferraz, A.C.; Taranto, the development of antiviral drugs against MAYV, since A.G.; Magalhães, C.L.B.; Ferreira, J.M.S.; Magalhães, it acts at early stage of the infection. Further molecular J.C. dynamics and docking simulations will be performed 1. UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL REI to search inhibitors through inverse virtual screening 2. UNIVERSIDADE FEDERAL DE OURO PRETO approach. Keywords: Mayaro virus, antiviral, drug design, Mayaro virus (MAYV) is an arboviruses closely related homology modeling. Financial Support: FAPEMIG, CNPq. to Chikungunya virus circulating in South America. BV167 - EFFECT OF THE YELLOW FEVER VIRUS Even a few years ago, it was considered as a circulating INFECTION ON THE CELLULAR SPLICING MECHANISM virus restricted to moist forest areas of South America, Ribeiro, M.R.; Terzian, A.C.B.; Gavioli, A.F.G.C.; with only outbreaks in coastal communities outside Nogueira, M.L. of large urban centers. However, in recent years, it has been widely documented outbreaks in endemic tropical 1. UNIVERSIDADE ESTADUAL PAULISTA JULIO DE areas of South America, reaching metropolitan areas. MESQUITA FILHO 2. FACULDADE DE MEDICINA DE SÃO JOSE DO RIO The Mayaro fever provokes a highly debilitating clinical PRETO condition, characterized by rashes and severe arthralgia. Until the present moment, there are no therapy and Yellow fever virus (YFV) is considered a reemerging vaccine available for Mayaro virus. In this context, a new viral agent and remains enzootic in tropical regions. antiviral targets validation becomes of great importance. Interactions between viral and cellular proteins as well E1 glycoprotein is transmembrane protein responsible as biochemical changes that affect the virus replication for fusion of the viral envelope with the endosomal and the cellular processes are unknown. One of these membrane of the host cell. The three-dimensional processes is the Alternative Splicing which is essential (3D) E1 glycoprotein structure is not yet available in any database. In this work, our goal was to create a interactions. The NS5 protein is the largest and highly to diversify gene expression and may influence proteins template by homology modeling in order to analyze the conserved viral protein and it is critical for many characteristics of the E1 protein to help in the future functions, including replication RNA capping and virus- process of novel drug design. Initially, the primary host interactions. The nuclear protein hSlu7 presents sequence of E1 glycoprotein of MAYV was retrieved from a nuclear localization signal and plays a role in the NCBI's protein database, of access code AAL35780.1. second step of the alternative splicing. Previous studies The search by template was performed using Blast hSlu7 and NS5 interaction by the two-hybrid method software. Multiple alignments were generated by the in yeast. The purpose of this study was to characterize
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
62 Basic Virology: BV the interaction between the hSlu7 and NS5 of YFV, transmitted resistance mutations and the dynamic of and evaluate its effect on the alternative splicing. The subtypes and recombinants forms, in a cohort of drug- interaction was evaluated by Co-IP and IF assays. Flow naïve HIV-1 recently diagnosed individuals, from Rio de citometry assay was used to analyze the effect of the YFV Janeiro, Brazil. A total of 159 HIV-1 infected individuals infection on the alternative splicing based on replicons (atualizar numero 12-14), including 36 blood donors, expressing transcripts isoform mRNA of the cellular were genotyped during 2009 to 2014 in all Rio de proteins. Evaluation of isoforms of endogenous XBP-1 protein were also performed. The Co-IP results indicated evaluated using the Calibrated Population Resistance that YFV NS5 protein interacts with hSlu7 and although, (CPR)Janeiro software State. Theavailable profiles by Stanford of TDR mutationswebsite and were the hSLU7 is a nuclear protein, IF assays showed that this subtype determination through the Brazilian Algorithm protein translocated to the cytoplasm of YFV-infected cell, the replication site of the virus. This interaction by phylogenetic analysis. Overall, TDR mutations were detectedfor HIV Drugin 12.5% Resistance (CI95%, Interpretation 6.95% to 17.05%) and confirmed of the sequences analyzed. Resistance to the protease inhibitors mightcan influence represent the a metabolismmechanism ofof viralcellular control RNA in once cellular the (PIs) was 4.4% (CI95%, 1.21% to 7.59%). The prevalence genetranslocation expression of by proteins change between the alternative nucleus/cytoplasm splicing and to the nucleoside reverse transcriptase inhibitors (NRTI) viral replication. The results show that the presence of was 5.6% (CI95%, 2.03% to 9.17%) and 2.5% (CI95%, YFV may alter cellular splicing through hSlu7 regulation. 0.07% to 4.93%) of the isolates, carried mutation The evaluation of replicons suggest that in hSlu7 splicing associated to the non-nucleoside inhibitors (NNRTI). dependent and independent regulation occurs viral acting on weak splice sites and that the interaction as subtype B (80.0%), followed by C (5.1%), F (3.1%) hSlu7-NS5 can change directly or indirectly to regulate andThe unique majority recombinant of genotyped forms samples (URF) composed were classified by BF trans- acting. Financial Support: CAPES, CNPq, FAPESP. (3.1%), BC (2.5%) and FC (0.6%) sequences mosaic. The
BV172 - SURVEILLANCE OF TRANSMITTED HIV- subject. This work tried to study the trend of TDR in Rio 1 DRUG RESISTANCE IN NEWLY DIAGNOSED infection associated to subtype A1 was identified in one INDIVIDUALS FROM RIO DE JANEIRO, BRAZIL Brazil. Our results demonstrated an accumulation over Neves, M.; Silva-de-Jesus, C.; Ravasi, G.; Grinsztejn, B.; thede Janeiro last years state, of thethe second resistance major associated HIV/AIDS to epidemic the NRTIs, in Tanuri, A.; Morgado, M.G.; Couto-Fernandez, J.C. which could be a risk for the long-term usage of these 1. OSWALDO CRUZ INSTITUTE-IOC/FIOCRUZ, LABORATORY OF AIDS AND MOLECULAR and second lines therapy in Brazil. The present study IMMUNOLOGY analogs nucleosides in antiretroviral regimens for first 2. PAN-AMERICAN HEALTH ORGANIZATION- C among recently diagnosed HIV-1 infected individuals PAHO, WORLD HEALTH ORGANIZATION-WHO, inconfirms Rio de anJaneiro. increasing The infectionin the prevalence of HIV-1 ofsubtype the subtype A1 in WASHINGTON DC 3. NATIONAL INSTITUTE OF INFECTOLOGY- IPEC/ Rio de Janeiro, suggest the recent introduction these FIOCRUZ, RJ viruses in Brazil. Further monitoring studies are needed 4. LABORATORY OF MOLECULAR VIROLOGY, DEPT. to determine the consequences of TDR for treatment OF GENETIC, FEDERAL UNIVERSITY OF RIO DE JANEIRO (UFRJ) regimens. Financial Support: Oswaldo Cruz Foundation- The transmitted HIV-1 drug resistance (TDR) has been outcome and to ensure adequate selection of first-line increased in non-treated infected individuals over the last decade in some Brazilian region, especially Rio de IOC/FIOCRUZ, Dept. of STD, AIDS and Viral Hepatitis-MS. Janeiro. In this study, we investigate the time trend in the epidemiology of TDR and distribution of HIV-1 subtypes, followed the last national survey (2008) performed in Rio de Janeiro, Brazil. Evaluate the prevalence of HIV-1
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
63 Basic Virology: BV
BV173 - SEARCH FOR A POST TRANSLATIONAL BV187 - EFFECTS OF EPSTEIN-BARR VIRUS STRAINS MODIFICATION ON THE HUMAN RESPIRATORY M81 AND B95.8 IN THE BEHAVIOR OF IMMORTALIZED SYNCYTIAL VIRUS NUCLEOPROTEIN AND MALIGNANT EPITHELIAL CELLS IN VITRO Ogawa, J.K.; Oliveira, A.P.; Simabuco, F.M.; Eléouët, J.F. Müller-Coan, B.G.; Elgui de Oliveira, D. Ventura, A.M. UNIVERSIDADE ESTADUAL PAULISTA "JÚLIO DE 1. UNIVERSIDADE DE SÃO PAULO MESQUITA FILHO" 2. UNIVERSIDADE ESTADUAL DE CAMPINAS The Epstein Barr virus (EBV) is a ubiquitous gamma 3. INSTITUT NATIONAL DE LA RECHERCHE herpesvirus that infects mainly B-lymphocytes and AGRONOMIQUE epithelial cells. EBV is associated with many human The Human Respiratory Syncytial Virus (HRSV) is one cancers, notably the african burkitt lymphoma and of the main causes of respiratory illness particularly in undifferentiated nasopharyngeal carcinoma. EBV life newborns, babies, children and immunocompromised cycle is divided into lytic and latent phases, and different patients. Its genome encodes eleven proteins and instance, the EBV M81 strain is more capable to infect cell is important to understand virus biology and propose viral strains may show specific biological features. For identification of their interactions with targets in host therapeutic targets. In a previous work we found that reactivation compared to the B95-8 strain. Some EBV nucleoprotein (N) interacts with cellular proteins Hsp70, productsepithelial may cells participate and to deflagratein carcinogenesis, spontaneous notably lytic the PRMT5 and WDR77 in HEK293 cells. In this work we viral LMP1 protein, which disrupt critical intracellular the methylosome. N has arginine residues exposed on MAPKs. This study aimed to evaluate the effects of EBV focus in N interaction with PRMT5/WDR77 which forms the surface that are potential targets of methylation and strainssignaling M81 pathways, and B95-8 such on as the NF-kB, behavior PI3k/AKT, of epithelial STATs, cells and in vitro using two cell lines, NP69SV40T (nasopharyngeal immortalized cells) and SW480 (colorectal carcinoma this modification could be important for the processes N-methylosome interaction also in Hep2 cells infected cells). The cells were transiently transfected with a of transcription and replication. Recently we confirmed by HRSV A2 strain extracts by co-immunoprecipitation. vector encoding the complete viral genome for either Another evidence of interaction we got was co- EBV M81 or B95-8, and then evaluated for their in vitro localization of N and PRMT5 during replication process in behavior, including cell migration rates, assessed with inclusion bodies in a HRSV minigenome system in BSRT7 conventional scratch assays. Cells transfected with either cells. In this report we present the successful expression EBV strain showed around 6% decrease cell viability of PRMT5+WDR77 in bacteria, forming a high molecular and 35% lower cell count when compared to non- weight complex resembling the methylosome. We could transfected cells. NP69 cells transfected with EBV M81 demonstrate that this complex is able to interact with or B95-8 strains had 2 and 2,2 times increased migration the viral N protein also expressed in bacteria. With this rates, respectively, compared to non-transfected cells, cumulative evidence of N-methylosome interaction we asked if N protein immunoprecipitated from infected cells. When comparing B95-8 with M81 transfected cells would have methylated arginine residues. This NP69but no cells, significant B95-8 had differences 8% higher were migration found for rates SW480 and protein was submitted to mass spectrometry analysis M81 had 7,8% lower cell count. Overall, the results are and we found an indication of dimethyl arginine in in line with the reported higher potential of EBV M81 to the residue 232, positioned in the surface according to published structural data. We got also reactivity cells. Furthermore, the higher in vitro migration rates of immunoprecipitated N with anti-methyl arginine founddeflagrate for NP69lytic cycle cells andtransfected cytopathic with effects the EBV in epithelial genome antibodies. Our conclusion is the reinforcement that the compared to non-transfected cells is in agreement with inhibition of PRMT5 activity is a potential target to block published data showing that several viral products HRSV replication. Financial Support: FAPESP and CAPES. modulates cell migration, such as the viral LMP1 protein. Our research group is currently investigating this issue further, in order to contribute to the understanding of October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
64 Basic Virology: BV the effect of those viral strains in the progression of EBV- Adenovirus, Orf virus, Human Herpesvirus, Tembusu associated cancers. Financial Support: FAPESP Proc. MS virus and Hepatitis delta virus. In these animals were detected endogenous viruses, animal viruses and anthropozoonotic viruses suggesting that the studied 2014/15678-5.BV188 - USE CNPq OF PYROSEQUENCING Proc. 830059/2011-3. FOR VIROME EVALUATION IN DIFFERENT SPECIES OF BATS of the animal and their alimentary habits. Finally, the CAPTURED IN PARÁ, BRAZIL viromesbats feature studies, diversified employing viromes the methodology according to theof NGS, species can Andrade, A.A.S.; Nunes, M.R.T.; Vianez Junior, J.L.S.G. assist in the determination of viral biodiversity, as well INSTITUTO EVANDRO CHAGAS as the detection of potential medical concern or animal pathogens. Financial Support: CNPq. Studies have shown that bats are a major source of viruses that cause serious diseases both in animals and BV193 - USE OF LOW-COST PROGRAMMING in humans and those bats are natural reservoirs for TO OBTAIN GENOMES USING DATA FROM NEW several zoonotic viruses as the Filoviridae Ebola and GENERATION SEQUENCERS. CASE STUDY: Marburg; Rabies virus; Paramyxovirus Nipah virus and MONITORING OF DENGUE VIRUS IN BRAZIL Costa, J.D.D.; Vianez Junior, J.L.S.G. characterization of genetic information directly from samples,Hendra and without others. the Metagenomics need to perform can be culture.defined asUsing the INSTITUTO EVANDRO CHAGAS the Next Generation Sequencing actually has proven to Dengue fever is a world common arboviral disease, transmitted by mosquitoes of the genus Aedes (main The viral metagenomics came to prominence with vector Aedes aegypti). Complete genomes of dengue thebe an advancement efficient tool of for NGS, the the realization large volume of this of approach. data and fever viruses (along with prevalence data) can be used costs more affordable made the study of viral diversity to unravel the spatial and temporal dispersion process of for metagenomics approach quite attractive. This study the pathogen trough the globe, allowing the production of maps indicating the region from wich the virus was in bats captured in the Brazilian Amazon; perform the imported and also the pinpoint of its introduction date. aim to characterize, for the first time, viral biodiversity This type of approach can be employed to guide the differences in viral communities from different samples planning of countermeasures to control the disease, if ofidentification the same ofbat viral species species; and check of different whether species. there are A it is possible to generate and analyse the genomic data pool of salivary glands, gut and brain by individual of in a timingly manner. However, assembling genomes each species (Carollia perspicillata, Artibeus lituratus e from next generation sequencing data requires several Desmodus rotundus) where each passed by extraction of RNA, cDNA synthesis and sequencing. Data analysis was performed using the SortMeRNA program v 2.0, in order scriptscomputational allows stepsto perform and may the use required a significant analysis amount more of quicklytime. The and development with less errors. and use The of efficient objetives computational of this work The non-ribosomal data followed for the Assembly were to develop python scripts to: (1) alert the completion usingto filter De data novo for method prokaryotes in MIRA and v 4.0.2eukaryotic and then ribosomal. MEGAN of sequencing runs; (2) monitor and manage available program to generate the graph of diversity. As results, computer resources in the network in order to assemble the Carollia perspicillata Dengue virus genomes and (3) to perform the genome as related to the virus: Human mammary tumor virus, assembly. The scripts were implemented in the low-cost Mouse Mammary tumor viralvirus, contigs Reticuloendotheliosis were identified programming raspberry-pi boards and validated in the virus, Feline calicivirus, Avian spleen necrosis virus, routine analysis of the Bioinformatics core of the Center Fowlpox virus and Human betaretrovirus. Artibeus for Technological Innovations, a laboratory that is part lituratus, the possible viral contigs were all associated of the Brazilian Ministry of Health. The implemented with the Mouse mammary tumor virus. Desmodus steps were as follows: (1) Scanning the network for rotundus available computers and determination of CPU usage virus, Curionopolis virus (Rhabdovirus not grouped), viruses identified were: Feline leukemia October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology:of the BV comptures, (2) Transfer of the files containing XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
65 Basic Virology: BV the raw sequencing reads to the selected computer; (3) tested by real-time PCR in subgenomic HCV replicon cells (SGR-JFH-1), JFH-1 infected cells (both genotype the raw reads by removing possible contaminants and 2a) and subgenomic S52 cells (genotype 3) context. The redundancy;Creation of an (4) organized removal structure of low quality, of folders; small (3) or filtering highly HSPB8 and DNAJC5B genes showed values of expression homopolimeric reads; (5) genome assembly (using consistent with qPCR Array results. These results may NEWBLER and CELERA) and (6) scaffold generation help in understanding the mechanisms involved in HCV and gap closing procedures. These steps decreased CPU replication. Financial Support: FAPESP. time usage and increased the assembly quality and read BV202 - SCREENING OF NATURAL AND SYNTHETIC genome assembly routine was implemented in other COMPOUNDS OF NAPHTHOQUINONE DERIVATIVES laboratoriesclassification. even Also, whenthe final the product staff did permited not have that deep the WITH ANTIVIRAL ACTIVITY AGAINST DENGUE VIRUS Silveira, P.F.; Brandão, G.C.; Silva, B.M. the developed implementation may be used as a way of UNIVERSIDADE FEDERAL DE OURO PRETO sharingtraining inbioinformatics bioinformatics/sequence protocols among data analysis. laboratories, Thus, The Dengue virus (DENV) has four distinct serotypes in order to guarantee reproducible research. Financial that are mainly transmitted by the mosquito Aedes Support: CNPq. aegypti. Infection results in the pathogenesis of dengue, BV201 - DIFFERENTIAL EXPRESSION OF HEAT SHOCK which is an epidemic of global proportions. Despite the PROTEINS IN HCV INFECTED CELLS efforts, there is still no effective vaccine against the four Braga, A.C.S.; Carneiro B.M.; Batista, M.N.;Akinaga, of patients. Therefore, several studies have been M.M.; Rahal P. conductedserotypes asto wellsearch as for efficient drugs drugs with inantiviral the treatment activity INSTITUTO DE BIOCIÊNCIAS, LETRAS E CIÊNCIAS EXATAS widely studied compounds are the naphthoquinones, Hepatitis C is a disease caused by hepatitis C virus whichagainst are DENV secondary and other metabolites flaviviruses. produced Among by the algae, most (HCV), and it is estimated that about 3% of world fungi, plants and animals. These compounds, that can population are infected with the virus. During infection be extracted mainly from Tabebuia genus plants (family HCV interacts with several cellular proteins to promote Bignoniaceae), are characterized for presenting activities viral replication. Studies have shown that many heat The objective of this work is to promote the screening in the presence of the virus and some HSPs interact as anti-inflammatory, anti-cancer, antiviral, and others. directlyshock proteins with HCV (HSPs) proteins. have an This altered increase expression or decrease profile antiviral activity against DENV. For this, a screening was in HSPs expression may assist in understanding the performedof synthetic by and reduction natural of naphthoquinones MTT (3-(4,5-dimethylthiazol- with specific mechanisms involved in viral replication and provide 2-yl)-2,5-diphenyl tetrazolina bromide) to assess the potential target for virus therapy. Thus the present study aimed to evaluate in vitro the expression levels of heat in the calculation of cytotoxicity (CC50) ranging from shock proteins in the presence and absence of HCV. For cytotoxic activity of five compounds in BHK-21 resulting this, human hepatoma Huh7.5 cells were electroporated drugs to be used in subsequent tests. From these test with the virus replicon HCV JFH-1 and maintained until concentrations0.150 to .0188 of (ug/ml)0.005, 0.019, and 0.019, the concentrations 0.009 and 0.009 of approximately 90% of the cells were infected by the virus. These cells were subjected to RNA extraction and respectively (name omitted due to intellectual property cDNA synthesis. The differential expression of 84 HSPs protection)(µg/ml) of were the compoundsselected for further A4, A5, testing. A6, A7 Next, and BHK- A8 and chaperones was assessed by qPCR Array comparing 21 cells were pre incubated with compounds in non-toxic uninfected and infected cells. The results demonstrate concentrations in different dilutions and then infected
2 with DENV serotypes 1 and 2 in multiplicity of infection (MOI) 0.05 and 0.2 for serotypes 1 and 2 respectively. thesethat five results, genes the showed ten differentially increased expressionexpressed genes (over wereLog The antiviral activity was measured by the analysis 2), while five others had reduced expression. To validate October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
66 Basic Virology: BV of reduction of MTT. Our preliminary results indicate replication of JFH-1 by approximately 70 %, while Fac-5 that these drugs did not show antiviral activity in the showed 90 % of inhibition, however Fac5 is considerably concentration range tested until now. New assays are in cytotoxic. No effect was observed on virus entry. The course by using different concentrations of these drugs expression of the viral protein NS5A was evaluated by together with additional positive controls as well as the western-blot assay and was undetectable in both Fac- cytotoxic activity of other drugs have being analyzed to 4 and Fac-5 treated samples, corroborating previous be tested at virus protection assays. Molecules that show results. Some acridones are known to intercalate in antiviral activity are subsequently used in assays carried dsRNA molecules, which are replication intermediates, out by real-time PCR to investigate the mechanisms of disrupting replication. We performed a dsRNA viral inhibition. This research, at this moment, is well intercalation assay in order to test if this is the mode of action of these compounds. Fac4 and Fac5 showed new compounds with antiviral activity against DENV no intercalation activity. Further experiments are in adjusted to perform the screening and identification of progress to evaluate how these compounds interfere CNPq, CAPES and UFOP. in HCV replication. Financial Support: CAPES; Fapesp with accuracy and fidelity. Financial Support: FAPEMIG, BV203 - INHIBITION OF HEPATITIS C VIRUS IN VITRO REPLICATION BY ACRIDONES (2014/22198-0).BV211 - USING A NONENVELOPED INSECT VIRUS TO Campos, G.R.F.; Bittar, C.; Jardim, A.C.G.; Shimizu, J.F.; DELIVER RNA INSIDE CELLS Paganini, E.R.; Regasini, L.O.; Rahal, P. Domitrovic, T.; Alves, L.F.G.S.; Johnson, J.E. 1. INSTITUTO DE BIOCIÊNCIAS, LETRAS E CIÊNCIAS 1. UNIVERSIDADE FEDERAL DO RIO DE JANEIRO EXATAS 2. THE SCRIPPS RESEARCH INSTITUTE 2. INSTITUTO DE CIÊNCIAS BIOMÉDICAS In this study we evaluated the ability of a Nudaurelia Hepatitis C Virus (HCV) is a global health problem. The capensis omega virus current treatment, based on Interferon and the new Direct icosahedral virus, to act as RNA carrier to target cells. Acting Antivirals, has a high cost and variable response (NωV), a nonenveloped rates according to the virus genotype. Acridones, a group Lepidoptera and are non-patogenic to humans. The of compounds extracted from natural sources, showed capsidNωV is is a assembledtetravirus that from infects 240 copies insect of larvae the same of the protein order potential antiviral actions against HCV, however their and pack a genome of about 8 kbp divided into two single possible antiviral activity have been poorly explored in cell culture. Thus, this study aims to evaluate the (VLPs) can be generated with high yields by expressing thestranded capsid positive-sense protein in insect RNAs. cells NωV using virus the like baculovirus particles cycle. The compounds were screened using Huh 7.5 cell lineinfluence expressing of a panel the HCVof 16 subgenomic synthetic acridones replicon onSGR-JFH1- HCV life and present lytic activity against cellular membranes. FEO. Cells were incubated in the presence and absence expression system. The purified VLPs pack random RNA of compounds for 72 hours. Cell viability and replication directly through the plasma membrane, avoiding the levels were accessed by MTT and luciferase assays, endocyticThis characteristic pathway, possiblywhich usually allows leads NωV to to degradation enter cells respectively. The Acridone Fac-4 presented a replication inhibition of approximately 90 % at 50 µM and 100 % can protect encapsulated RNA from degradation after a of cell viability, while acridone Fac-5 presented about treatmentof transported with molecules. RNAse. Using We observedconfocal microscopy,that NωV VLPs we 75 % of replication inhibition at 50 µM, however this compound showed only 50 % of cell viability. The susceptible to the virus. Also, RT-PCR analysis indicated difference between Fac-4 and Fac-5 is the position of a thatobserved RNAs that derived NωV VLPsfrom could VLPs penetrate could be cellsdetected that are inside not hydroxyl group. Both compounds were selected for the treated cells even days after incubation. Together, these follow-up experiments. The effect of Fac-4 and Fac-5 was evaluated in the replication and entry steps using Huh nanocontainer for therapeutical RNA delivery. Financial 7.5 cells infected with JFH-1 HCVcc. Fac-4 inhibited the Support:results confirm CNPq and that FAPERJ. NωV can be further explored as a
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
67 Basic Virology: BV
BV212 - UNDERSTANDING THE LACK OF SIMEPREVIR variant structure. In addition, the variant amino acid K80 DRUG-RESISTANCE Q80K DETECTION IN HCV displayed a higher distance from the catalytic residue SUBTYPE 1A CLADE 2 SEQUENCES: INSIGHTS FROM D81, which could impair NS3 proteolytic capacity and MOLECULAR DYNAMICS AND NETWORK ANALYSIS Peres-da-Silva, A.; Antunes, D.; Torres, A.L.Q.; make it difficult to Q80K variants arise in clade 2 viral Caffarena, E.R.; Lampe, E. explain the lack of detection of simeprevir inhibitor drug-resistancepopulations. These Q80K preliminary in HCV-1a findings clade 2 dominantcould partially viral FUNDAÇÃO OSWALDO CRUZ populations. Financial Support: CAPES. Hepatitis C virus subtype 1a (HCV-1a) isolates can be separated into two distinct clades (1 and 2), with BV224 - STUDY ON MYCOVIRUS IN RHIZOCTONIA potentially different phenotypic characteristics. Of note, SOLANI AS A BIOLOGICAL CONTROL STRATEGY TO the simeprevir inhibitor drug-resistance Q80K was only RHIZOCTONIA DISEASE OF TURFGRASS detected in HCV-1a clade 1 sequences but not in clade Picarelli, M.A.S.C.; Gobatto, D.; Patricio, F.R.A.; Rivas, 2. Several informative sites for this clade distinction are E.B.; Harakava, R.; Colariccio, A. located proximal to or within codons associated with INSTITUTO BIOLÓGICO aim of this study was to identify if any clade informative In recent years, there has been a growing interest sitesresistance are in to contact NS3 serine with protease the Q80 inhibitors. residue. The The web first in biological control with mycoviruses, viruses that serve RING was used to generate a two-dimensional parasites fungi and may interfere with the pathogenicity network of non-covalent, hydrogen bonds and van der of them. Rhizoctonia solani, a phytopathogenic fungi that Waals interactions, based on PDB 2O8M structure. We causes a serious disease in Zoyzia japonica (Zoyzia grass) in climatic conditions of low temperatures and humidity in direct contact with Q80 amino acid in the Cytoscape increase, known as Large Patch, is affected by mycovirus. 3.2identified program, and including selected aone subset residue of 9 from residues the proteaseinvolved The disease is common everywhere this turfgrass is catalytic triad (Asp 81) and one clade informative cultivated. In Brazil, Zoyzia grass corresponds to 74% of residue (N174). Subsequently, as only HCV-1a clade 2 total marketed lawn. R. solani is a complex species, made sequences present the amino acid glycine (G) at position up of groups and sub-groups with a variety of somatic 174, we aimed to simulate the implications that hinder compatibility. The objective of this study was to identify the emergence of Q80K in clade 2 sequences presenting and characterize R. solani in Zoyzia grass and to detect the nonpolar G174. Based on the protein information the presence of the mycovirus in it. The fungal isolation of the HCV-1a clade 2 sequence (EU155345), manual medium and non-ionic cellulose chromatography mutations were performed on the tri-dimensional NS3- from infected turfgrass tissue, its culture in specific 4A protein (PDB 2O8M) using the program PyMOL samples collected in the municipalities of São Paulo, to obtain wild-type and mutant proteins. Molecular extraction of virus isolation were performed on 25 field dynamics (MD) simulations were performed with Cotia, Bragança Paulista, Ilhabela and Itapetininga. All isolates of R. solani originated dark brown colonies after program package. Long-range nonbonded interactions 30 days at 25°C, aerial hyphae, multinucleated cells, no wereGROMOS96 treated 53a6 by particle-mesh force field employing Ewald summation. the GROMACS The zonation or sclerotial formation and varying degrees Berendsen scheme was used to maintain temperature in all fungal isolates was displayed a similar pattern (300K) and pressure by weak coupling to an external of virulence to Zoyzia grass. By electrophoretic profile bath. During simulation, the root mean square deviation of dsRNA bands whose numbers and size ranged from (RMSD) serves as a measure for conformational stability three to six bands, larger than 2 Kb and larger than 10 Kb in size. In all of them it was possible to visualize the formation of dsRNA bands about 10 kb, consistent backboneand flexibility RMSD of of the the protease wild-type structure, protease with observed larger with dsRNA size of Hypovirus and Endornavirus genres. RMSDs indicating increasing structural flexibility. The Although the molecular characterization of dsRNA is a shorter equilibration time than backbone RMSD of over time showed larger final values, amplitudes and October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology:necessary BV for the correct identification of the species XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
68 Basic Virology: BV of virus, the presence of dsRNA bands larger than 10 kb may indicate the occurrence of Endornavirus in the have a predisposition to induce apoptosis and others evaluated isolates, since it is very common in R. solani. tostranded induce RNA autophagy. (POLY I:C) We confirms also constructed that some epithelialcell lines Moreover, the formation of dsRNA bands larger than 2 cells expressing VACV virulence factors to complement kb can indicate the presence of species of Totiviridae, the previous analysis. To evaluate the involvement of Chrysoviridae, Partitiviridae families, since isometric PKR in this process we used siRNA strategy and we particles of approximately 35 to 50 nm in diameter were also expressed a dominant negative form of PKR. By visualized in transmission electron microscopy. The constant presence of dsRNA in R. solani isolates from LC3 puncta (an indicative of autophagy) during infection Zoyzia grass is a strong indication of mixed infection whenimmunofluorescence, PKR is depleted. we observedTo analyze a drastic how inhibition autophagy of by mycovirus, since they are ubiquitous in R. solani, interferes with apoptosis, we silenced epithelial cells however they have not been associated with different for beclin-1 or atg7 that are crucial genes for autophagy. degrees of virulence in the pathogenicity tests, as it was We observed that infection led to apoptosis earlier when obtained in this work. autophagy was impaired. These data reinforce that epithelial cells undergo autophagy and it seems to delay BV231 - AUTOPHAGY DURING POXVIRUS INFECTION apoptosis. We are currently deepening our analysis of the Schnellrath, L.C.; Damaso, C. intercommunication between autophagy and apoptosis UNIVERSIDADE FEDERAL DO RIO DE JANEIRO during vaccinia virus infection. Financial Support: CNPq, FAPERJ, CAPES. Poxviruses, which the family prototype is vaccinia virus (VACV), encode a wide variety of virulence factors BV259 - MICROBIOTA PROTECTS SWISS MICE that interferes with host-range restriction and also AGAINST LETHAL PULMONAR INFECTION BY pathogenicity. Many of these factors are involved in VACCINIA VIRUS the antiviral pathway triggered by interferons. This Lima, M.T.; Andrade, A.C.S.P.; Calixto, R.S.; Oliveira, response leads to an increased expression of PKR G.P.; Oliveira, D.B.; Mattos, M.S.; Martins, F.S.; Kroon, (double-stranded RNA-dependent protein kinase), E.G.; Abrahão, J.S. inhibiting cellular protein synthesis during infection. VACV encodes proteins that antagonize this pathway and UNIVERSIDADE FEDERAL DE MINAS GERAIS the absence of these factors causes loss of pathogenicity The microbiota is involved in several aspects of normal and also host restriction. Previous data showed that wild-type vaccinia virus does not induce apoptosis pathogens, shape innate and adaptive host immunity. or autophagy in infected cells. However, we recently Remainhost physiology unknown andthe microbiota has a significant impact during benefit infections against observed that the absence of virulence factors during by several viral groups. Among these viruses highlight the VACV infection results in autophagy and late apoptosis in Poxviridae family. Vaccinia virus (VACV), the type virus of epithelial cells. In contrast, infection of others cell types Orthopoxvirus genus, is associate with bovine vaccinia do not induce autophagy, but apoptosis is observed early outbreaks that affect bovines and humans. To determine during infection. Many studies show that the pathways leading to autophagy and apoptosis may interact and caused by VACV, a comparative study using murine components of these pathways balance survival and cell modelthe influence was performed. of microbiota Germ-free in development (GF) Swiss ofNIH disease mice death. Therefore, our goal is to evaluate how autophagy and conventional (CV) Swiss mice at 7 weeks-old were is induced during vaccinia virus infection in the absence infected with Vaccinia virus Western Reserve (VACV- of virulence factors and how this phenomenon interferes WR) strain by two inoculation pathways, intranasal with cell death through apoptosis. We observed that cell type is determinant for the launch of autophagy: cell types 106pfu of VACV-WR per animal, which was multiplied and tail scarification. The infections were done using virus replication, late apoptosis and autophagy induction animals each, were inoculated by intranasal via. The earlyof similar in infection. origin induce The addition the same of profilea synthetic of restricted double- GFand animals titrated inoculated in vero cells. with Four VACV-WR groups, showed containing clinical five
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
69 Basic Virology: BV
from this organelle, caspase activation, and subsequent back and weight loss, resulting in death of two animals. cell externalization of phosphatidylserine (PS). Annexins CVsignals mice such inoculated as periocular with alopecy,VACV-WR ruffling and control fur, arching groups of are a family of proteins, which bind to PS to identify (inoculated only with phosphate buffered saline 0.9%) the apoptotic cells. In healthy cells, PS is located along the cytosolic side of the plasma membrane, but upon on day ten p.i and were collected their organs and blood. initiation of apoptosis, it translocate to the extracellular Viraldid not infectious show clinical particles signs. were All detected animals only were in sacrificedlungs and spleen (~104 labeled annexin V. This study aims to prove that infection detected in organs collected from conventional mice and withmembrane, adenovirus which serotype is detectable 40 (HAdV-40) with is able fluorescently to induce control. Plaque pfu/g). reduction No viral neutralization infectious particles test (PRNT) were apoptosis in A-549 cells. In this way, the experiment was showed sera neutralizing activity only in sera collected conducted for labeling the apoptotic cells using annexin V. A-549 cells infected with HAdV-40 and uninfected cells were treated with Annexin V-FITC®. The cells were withfrom GFVACV-WR group. Fourdeveloped groups lesions, containing following five animals of scabs each 5 were submitted to tail scarification. Groups inoculated and did not developed clinical signs. Viral titers in lesions nm.observed The resultswith a fluorescenceshowed that microscope after 30 hr Axio of infection,Scope A1 weredays post similar scarification. among CV In theseand GFgroups, groups all mice ten surviveddays p.i it(Carl was Zeiss) possible with to bright observe field that and most wavelength of the cells 495/525 were (~106 inoculated with VACV-WR exhibited neutralizing activity. Despitepfu/g). the microbiota The sera submitted has no demonstrated to PRNT from essential groups fluorescently labeled, suggesting that the cells were in apoptosis.BV266 -Financial NEW Support: INSIGHTS FAPEG ON / CNPq. OROPOUCHE data demonstrated that the micriobiota is essential in REPLICATION CYCLE REGARDING VIRUS ASSEMBLY effectivenessplay to viral immune elimination response in tail assemble scarification in Swiss via mice our AND BUDDING IN MAMMALIAN CELLS inoculated with VACV by intranasal route controling Barbosa, N.S.; Mendonça, L.L.R.; Criado, M.; Arruda, the virus in lungs, the initial site of infection. Financial E.; Da Silva, L.L.P. Support: CAPES, CNPq, FAPEMIG, PRPQ-UFMG. FACULDADE DE MEDICINA DE RIBEIRÃO PRETO - UNIVERSIDADE DE SÃO PAULO BV260 - INDUCTION OF APOPTOSIS IN A-549 CELLS INFECTED WITH ADENOVIRUS SEROTYPE 40 Oropouche virus (OROV) is the etiologic agent of Oropouche fever, the second most frequent arboviral Badr, K.R.; Guissoni, A.C.P.; Soares, C.M.A.; Cardoso, infection in Brazil, after dengue. Despite its importance D.D.P. for public health, most molecular mechanisms of OROV 1. INSTITUTE OF TROPICAL PATHOLOGY AND PUBLIC replicative cycle are not understood. Thus, the aim of HEALTH/FEDERAL UNIVERSITY OF GOIAS this study was to identify the intracellular pathway and 2. INSTITUTE OF BIOLOGICAL SCIENCE/FEDERAL host factors involved in OROV assembly and budding UNIVERSITY OF GOIAS in mammalian cells. To monitor the dynamics of viral Adenovirus infection usually causes metabolic changes one-step replication cycle, HeLa cells were inoculated for the host cell like cell stress and furthermore with OROV (M.O.I = 1) and analyzed at different time subsequent apoptosis. During viral infection, these changes occur not only as a result of viral replication 50 assay) but also due to the interaction between viral proteins werepoints continuously post-infection reduced (p.i.). and During were the barely first detected 6 h p.i., and the regulatory factors of the host cell. Apoptosis atintracellular 6 h p.i., indicating viral titers virus (quantified eclipse. This by TCIDwas followed is process of cell death which can occur by a variety of by a rapid increase in viral titers in cell lysates and stimulus through activating a controlled biochemical culture supernatants, reaching peak levels at 24h p.i. process that requires energy. Different biochemical Accordingly, viral proteins were detected by immunoblot events occurring in apoptosis as: mitochondrial in cell lysates at 9 h p.i and in culture supernatants at membranes permeabilization with leakage of molecules 24 h p.i. Regarding the intracellular distribution, OROV
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
70 Basic Virology: BV
3´ end) with 15 nt-overlapping the middle region of p.i. After 3h p.i., OROV staining was spread through the the genome. The 5´ end and 3´ end were cloned into cytoplasmlocalized to and early presented and late endosomes a reticular duringpattern, the showing first 3h the vector pCR4 TOPO TA (Invitrogen) and the genome partial colocalisation with endoplasmic reticulum (ER) resident proteins. From 5 to 24 h p.i., OROV staining full length genome assembly these two genomic regions was progressively concentrated at granular, vesicle-like, sequence was confirmed by Sanger sequencing. For the structures that retained RE-resident proteins, and are possibly related to viral factories. Interestingly, OROV inand vitro plasmid recombination vector backbone was performed (modified using pcDNA3.1) Gibson staining remained physically segregated from Golgi Assemblywere amplified (New England using Phusion Biolabs). DNA In advance, polymerase pcDNA3.1 and cisternae, stained with anti-Giantin antibody, throughout the infection. Immuno-EM analysis of infected cells adding Hepatite D virus ribozyme sequence. Then, the (at 12 h p.i.) revealed large multivesicular endosome- reporterwas modified gene ofremoving Green Fluorescent Neomycin proteinresistance was geneadded and by like structures that contained virus particles and were another Gibson Assembly procedure in the replication- often associated with the ER. This prompted us to polyprotein gene reproducing cleavage site of proper verify a possible role for the ESCRT (Endosomal Sorting Complexes Required for Transport) machinery in viral HuNoV-GFP replicon by Sanger sequencing, the plasmid constructionviral protease. was After transfected confirming to human the construction Caco-2 cells of strong reduction in OROV production compromised the using Lipofectamine 2000 (Invitrogen). The GFP signals formationreplication. of Knockdownprominent viral of Tsg101/ESCRT-I factories, as intracellular led to a were visualized by the confocal microscopy. This system OROV staining remained restricted to small puncta we developed showed the strong GFP signals and the dispersed throughout the cytoplasm. Together our data strongest GFP signals was obtained when 2 µg of the indicate that the Golgi apparatus is not the main site construct was transfected using 1.5 µl Lipofectamine at for OROV assembly and that ESCRT-I activity may play 24 hours post-transfection. These results indicate the a role in this process. Financial Support: The São Paulo active gene expression of the virus, however, not directly Research Foundation (FAPESP). replication yet. This way, the development of Norovirus replicon system will provide useful tools to elucidate BV294 - NOROVIRUS REPLICON SYSTEM TO STUDY the steps of viral infection process still then unknown. VIRAL RNA REPLICATION Financial Support: CAPES, FAPDF. Oliveira, L.M.; Blawid, R.; Andrade, B.Y.G.; Silva, J.M.F.; Nagata, T. BV306 - DETECTION OF DENGUE VIRUS BY USING GOLD NANOPARTICLES FUNCTIONALIZED WITH UNIVERSIDADE DE BRASILIA ANTIBODIES Human norovirus (HuNoV) is the main cause of acute Ribeiro, M.C.E.; Moreira, I.N.S.; Ferreira, C.S.; Jesus, gastroenteritis worldwide being responsible for at least A.C.; de Leite, C.F.; Fonseca, F.G.; da Ladeira, L.O.; 20% of all cases. The viral RNA genome has 7.6 kb in Silva, B.M. length and is organized into three or four open reading frames (ORFs). The details of replication mechanism 1. UNIVERSIDADE FEDERAL DE OURO PRETO 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS are unknown due to the lack of culturing system in vitro. For such reason, the reverse genetics of HuNoV Dengue is transmitted by the Aedes aegypti and it’s will offer useful tools to elucidate the viral infection caused by Dengue virus (DENV) of the Flaviviridae process and replication mechanisms. An original HuNoV family. It is known as the most important arboviral, with GII.4 subtype Sydney was provided from the Fundação about half of the population in areas of imminent risk of transmission. The absence of effective vaccines and The RNA extraction was performed and cDNA was synthesizedOsvaldo Cruz using (Dr. SuperScript Tulio M ® Fumian,III Reverse IOC/FIOCRUZ). Transcriptase diagnosis of this disease become necessary, enabling (Invitrogen). After, the genomic cDNA was synthesized appropriatespecific treatments and premature to Dengue clinical an early interventions and accurate to by PCR dividing into two genomic regions (5´ end and prevent severe morbidity and mortality. In this context,
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
71 Basic Virology: BV new materials with unique chemical and physical 1, DENV-2, DENV-3 and DENV-4. The viral genome properties, such as gold nanoparticles (AuNPs) have been consists of a single positive sense RNA (ssRNA +) with used as biomarkers. These nanoparticles have unique approximately 11 kb. The viral protein is translated into physicochemical properties, such as collective oscillation a single polyprotein encoding three structural (C, pr-M, E) and seven nonstructural polypeptides (NS1, NS2A, (SPR) which can be easily adjusted. Thus, the detection NS2B, NS3, NS4A, NS4B and NS5). NS1 has 46-55 kDa of biomoleculeselectrons, classified such as as proteins a surface and plasmon antibodies resonance bound in size, depending on the glycosylation state, and can be to the AuNPs can be made from its absorption spectrum. secreted into the extracellular environment as hexameric Therefore, the aim of this study was to develop and analyze lipo-particle (sNS1), associated with the cell membrane the effectiveness of functionalization methodologies of (mNS1), or with intracellular vesicular compartments nanoparticles with anti-DENV and anti-flavivirus induced by the virus. This glycoprotein can be detected in antibodies and its connection to the antigens. For this, blood samples from patients with primary or secondary specific infection during the acute phase of infection, suggesting initially the gold nanoparticles (AuNPs) were tested toimmunoglobulins determine the werebest concentrationspurified by affinity use ofcolumn reagents: and or pathogenesis of dengue. Therefore, this protein can cysteamine (0.5mM) and polyethyleneimine (0.3%) and bean used involvement as a marker of this of proteinearly and in late viral DENV infection infection. and/ In this work, immunogenic NS1 peptides derived from analyzed by reading a plasmon resonance scanning UV- the four DENV serotypes were produced employing a Visantibodies spectrometer (0,4μg and / ml)a shift to in be wavelength used. The was results observed were new method of expression by recombinant baculovirus in every functionalization when compared with non- system in insect cells, aiming a new diagnostic method functionalized AuNPs and previously characterized. for DENV infection. The DNA sequences of one antigenic When the AuNPs were incubated in solution containing region of the NS1 protein derived from all DENV the Dengue virus a strong shift was observed within the and fused to the gene of the major occlusion body Mayaro virus (Alphavirus) displacement was observed proteinserotypes (polyhedrin) were amplified of bythe polymerase baculovirus chain Autographa reaction onlyfirst minutesin the presenceof contact. of However, high concentration when incubated of virus, with californica multiple nucleopolyhedrovirus (AcMNPV). which is not found in natural samples, demonstrating the Recombinant baculoviruses were engineered and used to infect insect cells. The expressed recombinant proteins that the gold nanoparticles can be used for a diagnosis ofspecificity low production of the antibodies cost and used. be faster, Thus, moreit is suggested accurate used to both antiserum production in rats and input and convenient than the existing techniques. Financial forwere dengue purified infection-derived by sucrose gradient antibody centrifugation detection. The and Support: CNPq, FAPEMIG, UFOP. chimeric recombinant proteins were used in an indirect ELISA with sera from human patients infected and non- BV307 - ANALYSIS OF AN NS1-DERIVED infected with DENV and were able to detect infection in IMMUNOGENIC PEPTIDE OF DENGUE VIRUS the human sera positive for all the serotypes. Moreover, EXPRESSED BY RECOMBINANT BACULOVIRUS we are still working on the production of antibodies in Baggio, M.P.D.; Domingues, R.A.S.; Ardisson-Araújo, rats for the direct ELISA. Therefore, the recombinant D.M.P.; Nagata, T.; Ribeiro, B.M. proteins have the potential to be used for development UNIVERSIDADE FEDERAL DE BRASÍLIA of a diagnostic kit for early and late DENV infection. Keywords: diagnostic kit, glicoprotein NS1, occlusion Dengue virus (DENV) is the major virus transmitted body. Financial Support: FAPDF - Fundação de Apoio a by arthropods in tropical and subtropical regions, Pesquisa do Distrito Federal. for dengue fever, an important disease and causes publicclassified health as aissue human in terms arbovirus. of morbidity DENV isand responsible mortality. This virus belongs to the Flaviviridae family, Flavivirus genus,October 2015 which Volume is classified 20 – Supplement into 1 four - Abstracts/Posters serotypes: DENV- - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
72 Basic Virology: BV
BV321 - EVIDENCE FOR ASSEMBLY OF HUMAN data showed that directly transmitted viruses have RESPIRATORY SYNCYTIAL VIRUS (HRSV) NOT mutation rates around of 5E-03 and the vector-depended ASSOCIATED WITH THE PLASMA MEMBRANE IN viruses have mutation rates about 10-4. Also, it has been HEP-2 CELLS suggested that vector-borne viruses can display distinct Cardoso, R.S.; Jesus, B.L.S.; Carvalho, A.N.; Silva, M.L.; rates according to the type of cells they are growth. For Arruda, E. that reason we sought to determine the mutation rate of UNIVERSIDADE DE SÃO PAULO cell (HepG2), experimentally infected mosquitoes and HRSV is the most important respiratory pathogen in naturallyDengue Virus infected type humans 2 in insect (plasma). cell (C6/36), Cell cultures mammalian were the family Paramyxoviridae, causing disease in children infected consecutively and supernatants were collected worldwide. Despite its high public health impact, there is not a comprehensive understanding about HRSV were infected using a feeder (Glytube) with a mixture of assembly. In the present study, we sought to shed light after 7 days for C6/36 and 5 days for HepG2. Mosquitoes on the HRSV assembly processes during lytic infection of viral mutation rate in human plasma was obtained fromblood/viruses, previous andpublication. after 14 Complete days were polyprotein sacrificed. Datawas
4,of 8,HEP-2 12 and cells 24 using hours indirect post infection immunoflurorescence at MOI=1. After (IFI). that, Ion Torrent platform. Sequences were analyzed using cellsHEP-2 were cells permeabilizedwere fixed with with 4% paraformaldehyde0.01% Triton-X for at 10 0, CLCamplified Genomics with Workbench OneStep RT-PCR 7.5,. Only and Single sequenced Nucleotides in the minutes, incubated with 3% BSA blocking solution, and Variants (SNV) were considered in the analysis, indels then stained with primary monoclonal antibodies to the F were excluded. To determine the mutation rate, we and M virus structural proteins and to cellular organelles estimated the ratio of the number of SNV found within Golgi complex (TGN 46), endoplasmatic reticulum population by the number of nucleotides sequenced. The (Calnexin), late endosome (CD63) and early endosome (SNX2). We observed that, differently from what has 04; HepG2 =1,16E-04, Mosquitoes Host =1,18E-04 and been published for HRSV and other paramyxoviruses in Humanaverage Plasma of mutation average rates 5,22E-05. observed Overall, were: these C6/36= results 2E- different cell lines that the HRSV M protein co-localized are consistent with rates described for vector-borne with the F protein in the cytoplasm, near the nucleus, in RNA viruses. Most important however, we reported here a distribution that resembles the Golgi network, and not at the plasma membrane. Independent IFI experiments lower in human host than in mosquitoes or in cell cultures. done with a polyclonal anti-HRSV antibody showed that Althoughfor the first the time causes that remain DENV2 unclear, mutation it israte possible is almost that 1log the the virus was generally localized near the Golgi complex, human immune system leads to selection of particular and its replication appeared to induce rearrangement of viral genomes, ultimately observed trough sequencing. that cellular compartment. These observations suggest Financial Support: Fundação de Amparo a Pesquisa do that HRSV may have an alternative assembly process that does not take place at the plasma membrane. Perhaps HRSV assembly places may be variable among different EstadoBV363 de- THE São PauloSECONDARY - FAPESP STRUCTURE 2012/15381-7. ANALYSIS OF cell lines. Financial Support: FAPESP, CAPES and CNPq. SAPOVIRUS GENOMIC RNA Silva, J.M.F.; Nagata, T.; Blawid, R. BV349 - MUTATION RATE OF DENGUE VIRUS TYPE 2 IN CELL CULTURE, MOSQUITOES AND HUMAN HOST UNIVERSIDADE DE BRASÍLIA Salvador, F.S.; Urbano, P.R.; Romano, C.M. Sapovirus is a non-cultivable positive sense RNA virus that belongs to the Caliciviridae family, and is divided in INTITUTO DE MEDICINA TROPICAL 7 genogroups, of which GI, GII, GIV and GV are known as RNA viruses are known to present higher mutation rates human viruses, and GIII, GVI and GVII are animal viruses than DNA viruses. They also can present distinct mutation infecting pigs, minks and other animals. Calicivirus genomes exhibit the conserved structures at the 3’ and replication rate and the mode of transmission. Previous 5’ ends of both genomic and sub genomic RNA that rates among them due to the fidelity of RNA polymerase, October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
73 Basic Virology: BV play essential roles on virus replication, translation BV367 - CORONAVIRUS IN BATS FROM STATE OF and encapsidation. These structures have not yet been MINAS GERAIS, BRAZIL described in details for the sapovirus genera, with de Souza Luna, L.K.; Sabino-Santos Jr, G.; Gagliardi, exception of a putative sgRNA promoter at the anti- T.B.; Maia, F.G.M.; Vieira, T.M.; Melo, M.N.; Figueiredo, sense genomic RNA. We used extensive bioinformatics L.T.M.; Arruda, E. analysis to predict, in detail, the structures at the 5’ end 1. CELL BIOLOGY DEPARTMENT AND CENTER FOR of sapoviruses. The analysis was made using complete VIROLOGY RESEARCH, RIBEIRÃO PRETO MEDICAL genome sequences available on the NCBI database, with SCHOOL, UNIVERSITY OF SÃO PAULO total of 28 sequences containing GI (10 sequences), 2. DEPARTMENT OF PARASITOLOGY, INSTITUTE OF GII (5), GIII (6), GIV (5) and GV (2). No sequences from BIOLOGICAL SCIENCES, FEDERAL UNIVERSITY OF genogroups GVI and GVII were available, and we focused MINAS GERAIS on the analysis of genogroups GI, GII and GIV, which are Bats have been recognized as natural reservoirs of a human viruses. Alignments were performed using Codaln, broad diversity of coronaviruses (CoVs) worldwide, and and in order to identify suppression of synonymous some of them have on occasion crossed species barriers site variability (SSSV) in the sequences with SynPlot2, and became able to cause emerging human diseases, these alignments were edited with MEGA6. Three sets such as happened with the Severe Acute Respiratory of alignments were built for the SynPlot2 analysis and Syndrome coronavirus (SARS-CoV) in 2002 in China, then compared. The results led to the interpretation that and more recently with the Middle East Respiratory some secondary structures present in genogroup GI are Syndrome coronavirus (MERS-CoV) in the Arabian not conserved in genogroups GII and GIV. To get a better Peninsula. Surveillance of CoVs in bats is important to view of these structures, we performed RNA secondary recognize species that may potentially move from bats structure prediction with LocARNA, and individual RNA into humans. In the present study, 160 bats of 19 different secondary structure prediction with STAR for selected species were captured in mist nets during January- sequences. STAR prediction was carried only for the February and April-May 2014 in Montes Claros county, North region of Minas Gerais state, Southeast Brazil. Trap nucleotides of genogroup GII and GIV. We were able to sites were located at Sapucaia Ecological Park and Lapa first 300 nucleotides of genogroup GI and first 430 identify 4 conserved structures on the GI genogroup Grande Ecological Station. These areas are composed that were consistent with regions of SSSV, with minor predominantly by Cerrado vegetation and stretches of differences in the STAR prediction, suggesting that the transition to Caatinga, and have a high concentration of bulge formed on one of the stem loops in one genotype caves and shelters. Tested samples were composed of 20 has a different conformation in the other genotypes. blood and 136 feces specimens. CoVs were detected by a Interestingly, this bulge is located within a region of pan-corona nested RT-PCR targeting the conserved region SSSV, and may play a role on protein recognition. We of the RNA-dependent-RNA polymerase gene. CoVs RNA were detected in feces of four phyllostomid bats (2.5%) genogroups GII and GIV. For the GV genogroup, only from three different species: two frugivorous (Carollia also identified 3 conserved secondary structures in the STAR prediction was made, and genogroup GIII analysis perspicillata, n=2; and Artibeus obscurus, n=1) and one was made only with LocARNA. With exception of GIII, nectarivorous (Glossophaga soricina, n=1). CoVs in C. perspicillata and G. soricina had already been detected in 120 nucleotides with a highly conserved loop sequence other studies in Central and South America. However, in all genogroups presented a stem loop within the first UCAG. Financial Support: CNPq. A. obscurus report of CoV detection. Partial phylogenetic analysis of one C. perspicillata, to the best CoV, of based our knowledge,on 400 nucleotides this is the of firstPCR amplicon, revealed about 80% of homology with other Alphacoronavirus C. perspicillata captured in Trinidad and Tobago and Southern Bahia state in Brazil. Further studies based identified on sequencing in and phylogenetic
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
74 Basic Virology: BV analysis of PCR amplicons are underway to determine acid changes in this region. These results corroborate the genetic diversity of these CoVs. Financial Support: FAPESP, CNPq. from capsid. Co-crystallization of these proteins with HBGAwith the were affirmative made but that GII.19 P2 presentedis the most very variable compressed region BV368 - X-RAY CRYSTALLOGRAPHIC STRUCTURE crystal packings occluding the possible binding pocket ANALYSIS OF GII.19 AND GII.21 NOROVIRUS PROTRUDE (P) DOMAIN FROM VIRAL CAPSID region between aa 344 and 375. In both cases, further dos Anjos, K.; Singh, B.K.; Leuthold, M.; Nagata, T.; studiesand GII.21 concerning presented acarbohydrates possible flexible co-crystallization loop in the same Hansman, S.G. need to be done. Financial Support: CNPq SWE 1. UNIVERSIDADE DE BRASÍLIA 2. GERMAN NATIONAL CANCER RESEARCH CENTER 249420/2013-9.BV371 - DEVELOPMENT OF A NANOPARTICLE Noroviruses (NoV) are the most prevalent viruses DENGUE-4 CAPTURE ASSAY, DETECTION AND FULL cause of gastroenteritis worldwide. They belong to LENGTH GENOME SEQUENCING the Caliciviridae family and have a (+) ssRNA virus of Lima, C.P.S.; Vasconcelos, J.M.; Lemos, P.S.; Oliveira, approximately 8 kb, it is divided into three or four ORFs. R.S.; Vianez-Junior, J.Ls.G.; Nunes, M.R.T. Despite recent efforts to establish viral culturing in vitro it is still not known the role of infection. One parallel INSTITUTO EVANDRO CHAGAS approach is the study of the capsid protein structure Infections caused by Dengue virus (DENV) are considered and its interaction with cells.. Based on previous studies major concerns for public health in Southeast Asia, it is known that the most variable domain of the viral capsid is the protrude domain, but the mechanisms of that, in these regions, more than 390 million dengue cell recognition and entry remain unknown. Structural infectionsSouth America occurs and annually, western and Pacific. 96 million It is estimatedinfections studies such as crystallographic ones can help unveil interaction sites between the virus capsid and cells evidence of dengue in Brazil was registered in 1982, components such as carbohydrates present on the occasionare oligosymptomatic. when both DENVThe first serotypes clinical 1and and laboratory 4 were cell surface. In this work two rare genotypes of NoV associated with cases of dengue fever in Boa Vista (RR). characterized, eventhough attempts on demonstrating The DENV-2 was introduced in Brazil in 1990 in the state the interaction with histo-blood group antigens of Rio de Janeiro., and the DENV-3 was isolated, for the (HBGA) were unsuccessful. NoV GII.19 and GII.21 were expressed in E. coli positive-sense RNA of ~ 11 kb, with a long open reading columns and size exclusion chromatography. . The best first time, in São Paulo. The viral genome consists of a conditions for crystallization and were purified 0.1M sodium using Ni-NTAacetate coding regions (5 'and 3' NCRs). DENV genome produces aframe large of polyprotein about 10.000 cleaved nucleotides, into 10 flankedviral proteins: by two three non- acid, pH 5,0 for GII.21. The data were obtained through structural (C-prM-E) and seven nonstructural (NS1- X-raypH 4,5 diffraction for GII.19 collectedand, 20% at (w/v) the European PEG600 +Synchrotron 0.1M citric NS2a-NS2b-NS3-NS4a-NS4b, NS5). In order to eliminate Radiation Facility, France, at beamline BM30A and were contaminant genomes from cell culture, as well as processed with XDS. To solve the structure, molecular improve the genome recovering during Next Generation replacement in PHASER was used. Both structures Sequencing (NGS) methods, a protocol applying an iron formed crystals in space group P212121 were done using COOT and Phenix. The structures for DENV-4 was developed. A total of 17 positive cell GII.19 and GII.21 were obtained in a resolution. Refinements of 1.3Å culturesoxide nanoparticle infected with and DENV-4 monoclonal obtained antibody from the specific virus and 2.1Å, respectively. They are similar to other NoV collection of the Department of Arbovirology and GII P domains that are subdivided in P1 and P2. Their Hemorrhagic Fevers, Evandro Chagas Institute, were used in this study. The points discussed were: i) the form a barrel-like structure as previously observed, but afterP2 subdomains sequence alignment contain six they antiparallel had over β-strands50% of amino that efficiency of time ligation between the nanoparticles and October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology:the antibody BV (nanoimmune complex) ; ii) the efficiency XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
75 Basic Virology: BV of ligation between the nanoimmune complex with evaluated by viral plaque reduction assay. BHK-21 cells DENV-4 particles; iii) the stability of the nanoimmune were treated with different concentrations of samples complex; and iv) performance comparison of NGS at the same time of virus infection (simultaneous among DENV-4 obtained from samples sequenced after treatment). Results were expressed as 50 % cytotoxic viral particles recovered using the nanoimmunecomplex concentrations (CC50) and 50 % viral replication and not recoverd by nanoparticle immunecomplex. inhibitory concentrations (EC50), in order to calculate
The best binding time for nanopartícules to the DENV- the selectivity index (SI=CC50 50) of each tested
4 antibody was established in 10 minutes, and in 30 sample. The obtained EC50 for MI and MI-S were 40.84 min for the immunecomplex to viral particles. Using /EC Pearson correlation, a gradual decrease in the number value was 0.74 µM. The calculated SI values for MI, MI- of cDNA copies was observed, and represented by S,and and 0.44 Escin µg/mL, were respectively. 24, 95, and 23,The respectively. Escin obtained MI-S EC50 was the following formula y=34,3108-7,7287x+2,144x2- the most effective among the tested samples. Due to its 0,2651x3+0,0139x4-2.104x5 (R2=0,8716). Sequence chemical characteristics, this sulfated polysaccharide analysis of DENV-4, from the nanoparticulate capture probably acts as a dengue virus entry inhibitor, as already method, showed that the amount of ribosomal RNA of described for Herpes Simplex Virus types 1 and 2. We the host cell has been reduced in 80% when compared are now conducting further experiments to determine with samples direct sequenced from RNA extracted the mechanism of the detected antiviral activity for from infected cell cultures. Thus, the nanoparticle-viral MI, MI-S, and Escin. Keywords: in vitro anti-dengue capture assay showed to be simple, fast (, lasting about activity, natural compounds, Agaricus brasiliensis glucomannans, sulfated Agaricus brasiliensis glucomann and Escin. Financial Support: FAPESP (Project number: derivedtwo hours), from and host efficient cells. forKeywords: DENV-4 genomeFlavivirus, sequencing DENV-4, Nanoimmuneeliminating a complex, significant Next amount Generation contaminant Sequencing. RNA Financial Support: INSTITUTO EVANDRO CHAGAS. 2013/01690-0); CNPq (FTGSC Post doc Scholarship: 151180/2013-0); FAPESP (LVB Scientific Initiation BV380 - IN VITRO ANTI-DENGUE ACTIVITY OF Scholarship:BV393 - ORTHOBUNYAVIRUS 2014/17007-0). : ITAQUI GENOME NATURAL COMPOUNDS FROM PLANT AND FUNGUS SEQUENCE CHARACTERIZATION Bio, L.V.; Romano, C.M.; Sabino, E.C.; Cardozo, F.T.G.S. Moura, C.S.S.; Pinto, C.A.; Peregrino, P.C.P.; Magalhães, UNIVERSIDADE DE SÃO PAULO C.L.B.; Assis, M.T.A.; Bonjardim, C.A.; Kroon, E.G. Brazil has had the highest number of annual dengue 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. UNIVERSIDADE FEDERAL DE OURO PRETO virus (DENV) infections reported in the Americas, with over 7.35 million reported cases between 2000-2013. Itaqui virus (ITQV) BEAN12797 is a group C Arbovirus (genus orthobunyavirus, family bunyaviridae) with or vaccine to prevent or treat dengue infections. Given its genome constituted of three simple-stranded RNA theSo far, importance there is noof naturalcommercially resources available in the developmentspecific drug segments negatively polarized denominated S (~1000 of new antiviral drugs, this work aimed to evaluate pb), M (~4500 pb) and L (~7000 pb). The group C the anti-dengue activity of compounds derived from viruses show some potential to emerge as human natural products. The three compounds tested were: pathogens. However, the studies with those viruses are rare, and their molecular characteristics are still largely Agaricus brasiliensisMI, a mycelial (syn glucomannan A. subrufescens) [(1,3)-beta-D-gluco-(1,2)-; MI-S, the chemically The main goal is to partial sequence the M and L sulfatedbeta-D-mannan] derivative obtained of MI; and from Escin, the a fungusnatural mixture segmentsunknown, obtained which hinders from the the ITQV process sample of identification. BEAN12797. of triterpene saponins isolated from seeds of horse To complete the sequencing, the viral RNA was extracted chestnut (Aesculus hippocastanum L). The cytotoxicity of from the supernatant of infected vero cells and submitted these samples on BHK-21 cells was assessed by the MTT assay. The potential anti-DENV-2 (strain 46) activity was to reverse transcription using specific primers, and the October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology:cDNA BV obtained was amplified through PCR. The DNA XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
76 Basic Virology: BV
species that may potentially move from wild animals in E. coli DH5a, and the resulting clones were sequenced. into humans. In the present study, 115 bats and 154 Thewas resultsextracted show and a clonedsequence into placed a pGEM in the vector, 1470-2047pb amplified small terrestrial mammals (including 37 marsupials) region of the viral L segment, adding up to 579nt, and a sequence placed in the 2985 – 3661pb region of the viral ecologically distinct sites from the Northeast region of m segment, adding up to 677nt. The deduced aminoacid Sãowere Paulo captured with frommost Februaryof the original 2012 vegetation to July 2013, (Cerrado at five) sequence to the L segment corresponds to a fragment of the RNA-dependent RNA polymerase (RPRD); while grassland). Trap sites were located at Jatai Ecological the sequence for the m segment corresponds to a Stationconverted (Luis into Antonio mono-specific county), Cajuru cultivars and (sugar-cane Batatais county. and fragment of the glycoprotein GC. The nt sequence in the Overall tested samples were composed of 159 feces, 152 fragment from the L segment showed a highest identity saliva, and 139 blood specimens. CoVs were detected to Caraparu virus (CARV) of 94.8% than Apeu virus by a pan-corona nested RT-PCR aimed to a conserved (APEUV), which was only 74.6%; while the M segment region of the RNA-dependent-RNA polymerase gene. showed a lowest identity to CARV of 71.7% than APEUV, CoVs RNA were detected in ten Sigmodontinae rodents which was 71.4%. Deduces aminoacid sequence of the (3.7%) of three different species: Akodon montensis, n=7 ITQV showed to CARV and APEUV an identity with L (6 feces, 1 blood), Necromys lasiurus, n=2 (2 feces), and segment of 97.4% and 80.6%, respectively, and for the Calomys tener, n=1 (1 blood). Despite the great number M segment of 72.8% and 72.8%. We may conclude that of CoVs characterized in animals in the aftermath of the ITQV has its RNA-dependent RNA polymerase very similar to the one found in the CARV virus, but its GC described very recently in China. Thus, to the best of our are very distinct. However there are still much work to SARS, identification of novel CoVs in wild rodents was be done for we fully understand the complexity of the rodents in the Americas. Further studies on sequencing group C. Financial Support: CNPq, CAPES, FAPEMIG. andknowledge, phylogenetic this is theanalysis first report based of on CoV 400 detection nucleotides in wild of PCR amplicons are underway to determine the genetic BV400 - CORONAVIRUS AMONG WILD SMALL diversity of these CoVs. Financial Support: FAPESP, CNPq. MAMMALS FROM SÃO PAULO STATE, BRAZIL de Souza Luna, L.K.; Sabino-Santos Jr, G.; Gagliardi. BV403 - NATURAL PRODUCTS AS POTENTIAL T.B.; Maia, F.G.M.; Muylaert, R.L.; Figueiredo, L.T.M.; SOURCES OF ANTIVIRAL DRUGS AGAINST DENGUE Arruda, E. VIRUS 1. CELL BIOLOGY DEPARTMENT AND CENTER FOR Barbosa, E.C.; Francisco, F.L.M.; Bellardini, J.F.T.; Cota, VIROLOGY RESEARCH, RIBEIRãO PRETO MEDICAL B.B.; Alves, T.M.A.; Zani, C.L.; Rosa, L.H.; Calzavara- SCHOOL, UNIVERSITY OF SÃO PAULO Silva, C.E.; Kroon, E.G.; Oliveira, J.G. 2. DEPARTMENT OF ECOLOGY, SÃO PAULO STATE 1. CENTRO DE PESQUISAS RENE RACHOU UNIVERSITY 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS The Severe Acute Respiratory Syndrome (SARS) Natural products can be an alternative source for the development of antiviral agents for the dengue treatment. coronavirus (CoV). SARS-CoV was linked to a zoonotic pandemic of 2002-2003 was caused by a newly identified We performed an in vitro screening for activity against Dengue virus (DENV-2) of 3101 extracts from plants and andorigin, lead first to inthe palm discovery civets andof a thenbroad in varietyhorseshoe of animals bats in treatment in BHK-21 cells. The results were analyzed harboringChina. This novel findings CoVs, triggered and to the intense characterization research on of CoVs the byfungi observing at a concentration the degree of 25of inhibitionµg/mL using of athe simultaneous cytopathic new genus In 2012, the novel Middle Deltacoronavirus. effect (CPE) and by the MTT colorimetric assay. All East Respiratory Syndrome CoV (MERS-CoV) was the 117 extracts that showed antiviral activity against DENV-2 were selected for their respective determination dromedaries. This virus also has a presumptive zoonotic of the effective concentration 50 (EC ). Fifty-seven of originidentified from in bats. the Arabian For this Peninsula reason, surveillance infecting humans of CoVs and in 50 these extracts were obtained from plants belonging to wild animals, manly in bats, is important to recognize October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
77 Basic Virology: BV
21 different families: Amaryllidaceae (3), Annonaceae of Flavivirus associated with CNS infections circulating (1), Asteraceae (5), Begoniaceae (1), Clusiaceae (1), in the State of Piauí through molecular techniques. Five Combretaceae (1), Erythroxylaceae (2), Fabaceae (2), Leguminosae (2), Lythraceae (2), Malpighiaceae (8), suggestive of CNS infection, by LACEN-PI. The viral RNA Malvaceae (1), Melastomataceae (2), Melochia (1), wassamples extracted of cerebrospinal and RT-PCR reactions fluid were realized analyzed by random (CSF) Myrtaceae (3), Rubiaceae (8), Sapindaceae (9), Ochnaceae primers for conversion of viral RNA into cDNA and the (1), Primulaceae (2) Vitaceae (1), Vochysiaceae (1) and cultures of endophytic fungi, and also from fungi isolated ofprimers DENV. forThe amplification samples tested of CSF NS5 did flavivirus not amplify. gene Low and from60 extracts the Antarctic from fungi, continent not yet andidentified, the Atacama obtained Desert from detectionserotype-specific rates of primers the agents for amplificationcausing CNS infectionof the E gene has soil. To date, the most promising plant extracts obtained been observed around the world, thus the majority of from plants were from the Amaryllidaceae family these agents remain unknown. These may be associated (SI=32.15), and also from Leguminosae (SI=24.47) and with limitations of diagnostic methods used, factors such Fabaceae (SI=20.47) families. Twenty fungal extracts showed EC50 sensitivity of the tests. The majority of patients request medicalas the amount assistance of sampling if the symptoms and viral are load severe, influence to reach the mL. Our results values indicate ranging that from these 3.1 species to 12.5 of µg/mL, plants with and the hospital the virus can not be detected in the CNS, fungino apparent are a promising cytotoxicity source at the of concentrationsubstances with of antiviral100 µg/ contributing to low detection rates and false negative properties for further isolation and characterization. results. The molecular diagnostic RT-PCR allows for Financial Support: CPqRR - FIOCRUZ, CNPq, CAPES, clinical management of patients. The standardization early identification of viruses, contributing to the proper FAPEMIG,BV405 - APPLICATIONPROEP/P3D. OF MOLECULAR TECHNICAL FOR DETECTION OF FLAVIVIRUS IN CEREBROSPINAL Eof are new useful molecular for sensitiveassociation and between specific viral methods, genetics it is FLUID SAMPLES, IN THE PIAUÍ STATE andnecessary gravity to and increase the NS5 their gene efficiency. allow to Analyses investigate of gene the Garcês, T.C.C.S.; Neves, D.P.; Sousa, J.V.B.; Pereira, A.C.T.C.; Ferreira, G.P. Cerebrospinal Fluid (CSF), Flavivirus, Dengue. Financial inclusion of new flavivirus in the state. Keywords: UNIVERSIDADE FEDERAL DO PIAUÍ Support: UFPI, FAPEPI e CNPq. The arboviruses are transmitted by arthropod bites BV415 - EVALUATION OF AUTOCLAVING METHOD (mosquitoes, ticks...) infecting humans and animals FOR HUMAN ADENOVIRUS TYPE 5 SUSPENSION during the life cycle of the virus. These viruses are a DISINFECTION serious public health problem in Brazil and worldwide. Giehl, I.C.; Albino, S.M.; Rigotto, C.; Spilki, F.R. The Flavivirus disease includes a wide range of manifestations from mild to moderate or severe UNIVERSIDADE FEEVALE febrile disease unusual or atypical infections of the The processes most commonly used for the disinfection Central Nervous System (CNS) (myelitis, encephalitis, of biologically contaminated waste are chemical or meningitis and Guillain-Barré syndrome). Some of the thermal treatment. The ability of an agent or a process agents involved, highlight the Dengue virus (DENV) and in inactivating viruses depends on the characteristics West Nile virus (WNV). The neurological manifestations of both. It is usually accepted that enveloped viruses by DENV have been recorded in 0.5% to 20% of patients are inactivated more easily than non-enveloped, like admitted to hospital with dengue fever and 4% to 47% human adenovirus type 5 (HAdV-5). And the integrity of of patients admitted with encephalitis-like disease in the capsid and genome can be affected, reducing or not endemic areas. The state of Piaui is a hyperendemic their detection by PCR. Therefore, the aim of this study region for DENV, where the four serotypes circulate. Also decontamination of HAdV-5 suspensions. To this end, the in the country. This study aims to identify the presence viralwas to suspension evaluate the was efficiency produced of in autoclaving A549 cells method and 35mL for recently reported the first case of human WNV infection October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
78 Basic Virology: BV
2) in glass bottles for BV417 - A MOUSE CELL LINE EXPRESSING 1h30’, 2h or 2h30’. The negative control was represented INTERFERON TYPE I (IFN-I) SUPPORTS WILD TYPE bywere culture autoclaved medium (121°C, (MEM) 1.0 kgf/cm treated under the same PESTE DES PETITS RUMINANTS VIRUS INFECTION IN conditions. In order to evaluate the infectivity of thermal THE ABSENCE OF SLAM RECEPTOR treated HAdV-5, viral suspensions and the respective Comerlato, J.; Minet, C.; Puech, C.; Campos, F.S.; Roehe, controls were passaged in A549 cell culture for three P.M.; Franco, A.C.; Albina, E.; Almeida, R.S. times of six-day intervals. The initial autoclaved viral 1. CENTRE DE COOPÉRATION INTERNATIONALE suspensions, as well as the suspensions yielded from the EN RECHERCHE AGRONOMIQUE POUR LE three passages in cell, were treated with DNAse before DÉVELOPPEMENT DNA extraction was performed, in order to degrade free 2. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL viral genomes. qPCR was performed based on partial Peste des Petits Ruminant virus (PPRV), genus Morbillivirus, family Paramyxoviridae, causes an acute and in cells even after autoclaving. The characteristic highly contagious disease of goats and sheep: the Peste cytopathichexon gene effectamplification. (CPE) could The virusbe seen was in able 1h30’ to replicate and 2h treatments, at the end of the three passages. In the 2h30’ that aims the development of a suitable animal model for group, CPE was not visible, although the molecular PPRV,des petits this ruminants.study aimed As to the reproduce first step in of vitro an experimentthe desired analysis proved the viral replication. The hexon was, on average, 4 logs greater than values obtained after conditions for PPRV multiplication using the 10T1/2, an quantification by qPCR of initial autoclaved suspensions PPRVembryonic mouse fibroblastic and tested mouse in vitro cell isable the to goat express signaling IFN-I non-viable particles generated after heat treatment of (α/β). The gene to be introduced in the future transgenic their first passage in cells, indicating the prevalence of lymphocyte activation molecule (SLAM) gene, which codes the main cell receptor required for PPRV infection. thirdsuspensions. passages, On for the all other treatments, hand, hexon which quantification proves that combined to the expression of IFN-I, could create the virusby qPCR remained increased infectious by 5 logs betweenafter autoclaving, the first and being the scenarioThe 10T1/2 for PPRV cell transfected replication within vitro the, paving goat SLAM the way gene, for able to replicate exponentially in cells. In conclusion, the development of the PPRV transgenic mouse model. by autoclaving, according to the standards for testing significant reductions in HAdV-5 viability were obtained were infected with two different strains of PPRV: the wildThe 10T1/2 type and cells, the expressing attenuated or notvaccine the goat strains SLAM Nigeria gene, ofvirucidal adenovirus activity in suspensions, of chemical calling biocides attention (4 ≥ log to 10).the needHowever, to combine the results other don’t strategies reflect theto autoclaving,total inactivation such RT-qPCRs.75/1. The At synthesis different of periods the messenger post infection RNAs the (mRNA) virus as chemical treatment, for disinfection of biologically replicationof the goat SLAMwas measuredreceptor and by IFNviral α wasmRNA quantified detection, by contaminated waste. Keywords: Biosafety. qPCR. Viral observation of CPE and nucleoprotein expression. The inactivation. Viral viability. Financial Support: FEEVALE, vaccine strain was unable to complete the replication CAPES, FAPERGS, CNPq. cycle in the transfected and untransfected cells, as the nucleoprotein was poorly expressed and no CPE was observed. On the contrary, both cells were permissive to the wild PPRV, showing a complete replication cycle with typical PPRV CPE. To discard a possible effect of
blockage or induction of IFN-I previously to the infection withIFN-I both on virus viruses. replication, Interestingly, 10T1/2 the was results submitted of virus to a replication remained unaltered. These surprising results
wild PPRV and not to the vaccine strain, independently show that the 10T1/2 cells are only permissive to the October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
79 Basic Virology: BV of the goat SLAM expression or IFN response. This study obtained by other methods of inactivation highlights attempted to prove that the expression of goat SLAM the usefulness of HHP for viral inactivation. This receptor is enough to allow PPRV infection, however, strategy proved useful in understanding conformational our results indicate that other host cell factor(s) may be interfering in the virus-cell interactions. To date, there is replication as well as epitope shifts due to the treatment, no satisfactory causal explanation for such results. This andchanges may induced be paramount by HHP that for in vaccine turn may development influence viral if ongoing study will serve to guide and support future combined with in silico predictions as an intermediate animal model studies for PPRV experiments, and also to alternative for high resolution methods such as X-ray improve the understanding on the virus-cell interaction crystallography or nuclear magnetic resonance. Financial of morbilliviruses. Financial Support: CIRAD, AIRD, UFRGS. Support:BV428 FAPESP - GEOPROPOLIS / CNPq. PREVENTS THE BV422 - EFFECT OF HIGH HYDROSTATIC PRESSURE COXSACKIEVIRUS INFECTION IN VERO E6 CELLS ON THE REPLICATION KINETICS AND EPITOPE Veras, R.M.A.; Souza, S.J.M.; Melo, D.M.; Lima, A.R.V.; MAPPING OF THE AVIAN METAPNEUMOVIRUS Medeiros, L.M.L.; Goes, T.; Silva. J.; Leite, A.B.; Silva, Neto, D.F.L.; de Camargo, L.M.A.Q.; de Souza, A.R.; T.M.S.; Tâmara, S.A.; Souza, S.A.; Alexandre-Moreira, Martini, M.C.; Bonafé, C.F.S.; Arns, C.W. M.S.; Borges, A.A.; Muller, V.D.M. UNIVERSIDADE ESTADUAL DE CAMPINAS 1. UNIVERSIDADE FEDERAL DE ALAGOAS 2. UNIVERSIDADE DE SÃO PAULO High hydrostatic pressure (HHP) induces virus inactivation through structural changes in the virus. Although Coxsackievirus B5 (CVB5) and Dengue virus Since the virion is partially preserved its immunogenic (DENV) are RNA virus and can cause human disease properties can also be preserved, making HHP-mediated with a range of symptoms, they belong to different viral inactivation a potentially useful method for developing families: Picornaviridae and Flaviviridae respectively. new vaccines. In this work, we used in vitro and in vivo assays to examine the HHP-mediated inactivation of drug treatment or vaccine, making the search for new avian metapneumovirus (aMPV), a respiratory tract antiviralBoth viruses, agents CVB5 as andthose DENV, found do notin natural have specific compounds, antiviral a virus of turkeys and chickens. Exposure to HHP resulted promising source. A special type of propolis, geopropolis in time-dependent inactivation of aMPV, with exposure is an alternative mixture of wax, soil material and plant to 250 MPa for 60 min reducing the viral infectivity by 3-4 resines produced by stingless bees. The geopropolis orders of magnitude in a pressure- and time-dependent collected by Melipona subnitida Ducke, also known manner, as observed with the Beta propriolactone control. Epitope mapping of the aMPV fusion protein biologically evaluated showing activities as antioxidant, revealed subtle differences regarding antibody binding antibacterialfor “Jandaira” and bees antinociceptive. was chemically This characterized data suggests and to the overlapping synthetic peptides when HHP was the M. subnitida geopropolis is highly bioactive, but no compared to native controls. To better understand such studies were done against enveloped and no enveloped RNA viruses. So, this study investigates the in vitro in silico and the structure obtained was used for B cell antiviral activity of geopropolis against DENV 4 and discontinuousfinding the fusion and proteinlinear epitope was modeled prediction. by homologyEpitopes CVB5. Different concentrations of geopropolis, ranging found by spot synthesis were then mapped against the trimer structure for the HHP and control conditions cytotoxicity by MTT assay using VERO E6 cells. The effect tested and compared with the predictions. A correlation offrom geopropolis 12,5 to 200 against µg/mL, DENV were and primarily CVB5 was evaluated evaluated for between the viral replication kinetic, epitope mapping by replication inhibition, which was measured by MTT and in silico predictions was attempted. The results of the assay using three different methodological strategies: pre-treatment, virucidal and post-treatment. The results in vivo regarding antibody production and inactivation were expressed as 50% cytotoxicity (CC50) and 50% experiments in vitro were consistent with the findings effective (EC50) concentrations, in order to calculate measurements.October 2015 Volume Comparison 20 – Supplement of these 1 - Abstracts/Posters findings with -those Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
80 Basic Virology: BV
the selectivity indices (SI=CC50 50). The geopropolis with DENV infections, at 37 0C in 5% of CO2 atmosphere. showed a CC50 The viral load was measured in conditioned medium /EC against CVB5, geopropolis showed a EC50 by plaque assay and cell viability was assessed by MTT > 200 µg/mL. In the pre-treatment assay mL of geopropolis in post-treatment and= virucidal 189 µg/ effect was detected. In conditions where the cells were assaysmL and against the selectivity CVB5, the indices viral replication (SI) 1,11. Usinginhibition 200 wasµg/ infectedassay. In testedwith DENV dose ofand GU treated and PP, withno significant GU and PP cytotoxic it was 17,35% and 40%, respectively. Against DENV, the highest possible to observe a preservation of cell viability of 25 viabilities observed were 4,26% in pre-treatment, % and 33 %, respectively when compared to untreated ones. The same was observed in infections with MAYV. Moreover, treatment with GU and PP also promoted results,8,79% in geopropolis post-treatment has using shown 100 promisingµg/ml, and antiviral38,07% a reduction of 95% and 98% in infectious particles of activityusing 200 against µg/ml CVB5 in virucidal a non-enveloped assays. According virus. However, to these DENV in conditioned medium of infected HepG2. These more studies should be carried out to investigate their data suggest an antiviral activity of compounds present mechanism of action. Financial Support: CAPES, FAPEAL, in both plants species. Thus, the next steps consist of the fractionation of extracts and isolation of bioactive compounds. Financial Support: CNPq and FAPERJ. MCT,BV431 FINEP, - ANTIVIRAL CNPq INCT-INOFAR/CNPq. ACTIVITY OF GUAZUMA SP AND PIPER SP AGAINST ARBOVIRUS BV433 - VIRUCIDAL ACTIVITY OF SYNTHETIC Brasil-Neto, I.P.; Andrade, I.P.C.B.G.; Araujo, D.; COMPOUND III AGAINST DENV-4 Figueiredo, C.M.; Guerreiro, A.T.; Assunção-Miranda, Veras, R.M.A.; Melo, D.M.; Goes, T.; Rocha, M.A.L.; I. Alexandre-Moreira, M.S.; Borges, A.A. 1. UFRJ 1. UNIVERSIDADE FEDERAL DE ALAGOAS 2. FIOCRUZ 2. UNIVERSIDADE DE SÃO PAULO Arboviruses affect thousands of people worldwide and Dengue is an arboviral disease caused by the virus of are considered a global public health problem. Dengue the same name (DENV), transmitted by Aedes sp vectors. virus (DENV), from Flaviviridae family, is responsible for Infections in humans are mostly asymptomatic, but it one of the most relevant arboviruses, which infects about can lead to a wide range of clinical symptoms. There are 390 million people annually. Mayaro Virus (MAYV), from four DENV serotypes (DENV-1 to 4). DENV is a member Togaviridae family, is endemic in tropical forest regions of the Flavivirus genus, Flaviviridae family. DENV is an of South America. DENV and MAYV infections can enveloped and single-strand of positive-sense RNA virus. cause a febrile disease that can progress respectively The genome contains a single open reading frame which to hemorrhagic complications and persistent articular encodes a polyprotein, processed into three structural pain. Nevertheless, there are no vaccines or licensed and seven non-structural proteins. Currently, there is drugs to treat these infections. The aim of the present study was to evaluate the antiviral activity of compounds and the treatment is palliative. The development of present in medicinal plants of Brazilian Cerrado, antiviralno vaccine drugs neither against specific these antiviral viruses drugs is a againstpublic healthDENV Guazuma Sp (GU) and Piper Sp (PP), against DENV and priority. Thus, the main of this work was the evaluation MAYV infection. Plants were collected in areas of native of the activity of three synthetic compounds (I, II and vegetation of Mato Grosso do Sul and their parts were III) against DENV 4. These compounds were evaluated separated, dried and crushed. Crude extracts were then for cytotoxicity in Vero E6 monolayers by the MTT produced by percolation method with ethanol (cold assay and the concentration of each material required extraction). Human hepatocellular carcinoma lineage to reduce cell viability by 50% (CC50) was calculated by (HepG2) and BHK-21 were infected with DENV and comparison with the untreated cells. The evaluation of MAYV, respectively, at a multiplicity of infection of 1. antiviral activity was performed by three methodological After adsorption period, cells were treated with 50 µg of strategies: i) virucidal activity; ii) pre-treatment and iii) each extract and incubated for 24 h with MAYV and 48 h post-treatment assay. The concentration that inhibited
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
81 Basic Virology: BV
50% of viral replication (Effective Concentration 50%, In photo-activated conditions, phorphyrins treated
EC50) was calculated by comparison with the untreated virus were exposed for 10 minutes at 500 lux before cells. The antiviral activity was evaluated by MTT and incubation. The viral titer was determined by plaque plaque reduction assay. The values of CC50 and EC50 were assay on BHK cells. The results showed that heme, COPPIX used to calculate the selectivity index (SI= CC50 50). In and SNPPIX have activity against DENV, MAYV, SINV the pre and post-treatment, the compounds I, II and III and VSV, being capable to reduce the viral titer of those showed inhibition from 2 to 18% of viral infection,/EC and in viruses to undetectable levels at micromolar range, even the virucidal assay, the compounds I and II showed 2 and without photo-activation. The pre-treated viruses were 2,35% of viral inhibition, respectively. This inhibition incapable of inducing death or morphological changes was very slight in comparison with the inhibition in BHK cells. Electrophoresis of porphyrin-treated virus observed with the synthetic compound III, that showed demonstrated alterations on the VSV and MAYV envelope the most promising results in virucidal strategy with proteins. COPPIX activity against DENV, MAYV, SINV
CC50 = 100 µM, EC50 = 48,4 and IS > 2. This result was e VSV does not depend of photo-activation. However,
obtained a EC50 = 18,72 and IS = 5,34. This compound method. SNPPIX IC50 reduces over 10-15 times after wasconfirmed tested byagainst plaques coxsackie reduction B5 assay,too, a innon-enveloped which it was theSNPPIX photo-activation. activity was amplified To test if with the porphyrinthis photo-activation treatment virus, and it did not affect this virus replication. The can prevent the viral fusion, MAYV envelope was labeled results suggest that the compound III acts directly on the dengue virus envelope. However, more studies should be carried out to investigate their mechanism of photoswith DiD, were a self-quenchertaken under 660 fluorophore nm stimulation and fusion and DiD- was action. Keywords: Antiviral activity, dengue, synthetic monitored by confocal fluorescence microscopy. Cell compounds. Financial Support: CAPES, UFAL, CNPq. Photo-activated SNPPIX and COPPIX, 10 µM and 300 associated fluorescence was determined by ImageJ. BV435 - INACTIVATION OF ARBOVIRUSES BY HEME, to less than 5%. With these results, we concluded that COBALT AND TIN PROTOPORPHYRIN: AN EFFECT bothµM respectivelySNPPIX and reducedCOPPIX theinteract MAYV with fusion viral efficiencyenvelope BEYOND ITS PHOTOACTIVATION proteins, inhibiting viral fusion to cell membrane, and Neris, R.L.S.; Araujo, D.; Cruz-Oliveira, C.; Carvalho, that SNPPIX activity can be increased by light-exposure. C.A.M.; Gomes, A.M.; Assunção-Miranda, I. Financial Support: CNPq and FAPERJ. UFRJ V440 - EVALUATION OF A METAGENOMICS PROTOCOL Arbovirus transmitted diseases are considered a public FOR COMPLETE ARBOVIRAL GENOME SEQUENCING health problem of global order but their control and ON ION TORRENT PGM treatment are still a challenge. Broad spectrum antiviral de Souza, C.V.; Corado, A.L.G.; da Silva Monteiro, D.C.; agents, with activity against several viruses, appear as do Nascimento, V.A.; Naveca, F.G. alternatives. Porphyrins are amphipathic molecules with a tetrapirrolic ring that can carry a metal ion in its INSTITUTO LEÔNIDAS E MARIA DEANE center. Some porphyrins have the property of photo- The viral metagenome sequencing brings many activation, increasing their ability to generate reactive oxygen species and enhancing their capacity to interact and unknown viruses, overcoming previously technical with several biomolecules. The aim of the present study barrierspossibilities to generating of identification full-length and genomedeep characterization sequence. The was to investigate the potential use of phorphyrins and introduction of such techniques leads to a new era of their photo-activation against arboviruses. We pre- epidemiological research, which is of especial interest treated approximately 107 pfu of Dengue virus (DENV), for the health surveillance systems over the world. Mayaro virus (MAYV), Sindbis virus (SINV) and Vesicular For this reason, we decided to merge and evaluate Stomatitis Virus (VSV) with crescent concentrations previously published metagenomic procedures for full- of Heme, cobalt and tin protoporphytin (COPPIX and genome sequencing of known arboviral samples. The SNPPIX) and incubated for 1 hour at 37º C in the dark. Aedes
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology:supernatants BV from five previously inoculated XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
82 Basic Virology: BV albopictus endosomes in a pH dependent manner. We have used virus serotype (DENV-1 to DENV-4) and another one direct observation of the processes by immunoelectron with Chikungunya C6/36 cellsvirus flasks: (CHIKV) one were with eachanalyzed. Dengue All microscopy under a set of different temperatures and supernatants were submitted to low-speed centrifugation time progression. We found that upon attaching to the cell surface, intact RNA-containing viruses became treatedto remove with cell six debris, different followed nucleases: by filtration DNases on (TURBO 0.45 μMTM labeling. We found that the rate at which full particles DNase,membranes Benzonase to remove® Nuclease, large particles. Baseline-ZEROTM The filtrates DNase were wereempty converted shells that to couldempty only particles be identified increased by with antibody time and DNase I) and RNases (Rnase A and Rnase ONETM and temperature and it takes place at temperatures Ribonuclease) to destroy unprotected (without capsid) that inhibit both endosome formation and membrane nucleic acids. After digestion, viral RNAs were extracted fusion. The temperature data from 4oC to 37oC could with Trizol® reagent, followed by cDNA production with a 3' random (15N) primer. This oligo also contains a 5' force mechanism of RNA entry. We have tested the effectsbe fitted of toseveral an Arrhenius inhibitors plot of implyingcellular function, a non-physical some of which have been reported to inhibit virus RNA or (20 mers) specific sequence that is used as a target for protein synthesis, which was interpreted as resulting wassecond-strand submitted cDNAto agarose synthesis gel electrophoresis and PCR amplification. (e-gel), from a block in the entry process. Only ionophores were forThe ampliconresult of this size random selection amplification (150bp towas 300bp). a smear DNA that membrane potential is essential for entry. Additionally, with Agencourt AMPure XP; ligation of IonExpress wefound found to significantly that the rate inhibit of entry RNA was entry faster suggesting at 4oC when that barcodedfragments adapters were submitted and nick to repair. end repair; Amplicons purification were insect cells were employed, suggesting that increased
Ion Onetouch2. The NGS run was conducted in a 316v2 Similar results were obtained with other arboviruses chipfurther on thepurified Ion Torrent and pooled platform for template at the Instituto preparation Leônidas on suchfluidity as due West to theNile absence virus, whenof cholesterol obtained promotes directly entry.from e Maria Deane, Fiocruz unit in Amazonas State. More the mosquito vector as well as Dengue and Chikungunya than 2 million reads were initially analysed for quality viruses obtained from cell cultures. We conclude that with FASTQC plugin on Ion Torrent Suite, followed by entry of alphaviruses occurs by direct penetration of cell both "de novo" (MIRA 4.0 plugin) and "map to reference" plasma membranes through a pore structure. It appears assembly methods. The complete genome of all four that the energy driving the entry process is contained in DENV serotypes was accomplished, whereas near to the virion, acquired during the process of assembly and full CHIKV genome was obtained. Our results showed that there is only a membrane potential requirement that this protocol is useful for arboviral full-genome placed on the host cell. sequencing from cell supernatants. Further studies are been conducted to evaluate this protocol directly from clinical samples.
BV442 - ALPHAVIRUS UNCOATING AT THE PLASMA MEMBRANE IS DEPENDENT ON MEMBRANE POTENTIAL Vancini, R.; Hernandez, R.; Brown, D.T. DEPARTMENT OF MOLECULAR AND STRUCTURAL BIOCHEMISTRY, NORTH CAROLINA STATE UNIVERSITY The entry mechanisms of enveloped viruses are usually
Indirect observations led to a general belief that Alphavirusesclassified as infect being cells either by protein-assisted endocytotic or fusion fusogenic. with
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Basic Virology: BV ENVIRONMENTAL VIROLOGY - EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
84 Environmental Virology: EV
EV7 - IDENTIFICATION OF CANINE NOROVIRUS AND ASTROVIRUS IN SEWAGE FROM URUGUAY (CSIC I+D 2010) (UdelaR). (UdelaR). Comisión Sectorial de Investigación Científica Lizasoain, A.; Tort, L.F.L.; Garcia, M.; Gomez, M.M.; EV8 - MICROBIAL INDICATORS, PHYSICAL-AND- Leite, J.P.G.; Miagostovich, M.P.; Cristina, J.; Berois, M.; CHEMICAL PARAMETERS AND THE PRESENCE Victoria, M.; Colina, R. OF HEPATITES A VIRUS IN SAMPLES FROM 1. UNIVERSIDAD DE LA REPUBLICA (URUGUAY) REACREATIONAL WATERS OF THE ISLAND OF 2. FUNDAÇÃO OSWALDO CRUZ MOSQUEIRO, BELEM, PA, BRAZIL Norovirus (NoV) and Astrovirus (AstV) are important Santos, D.S.A.S.; Sousa, N.R.; Smith, V.C.; Deus, D.R.; enteric viruses causing diarrhea in mammals. These Silva, K.R.T.; Rocha, K.C.J.; Aranha, D.C.P.; Roldão, D.F.; naked viruses have an icosahedral capsid and a single Garza, D.R.; Vale, E.R.; Carneiro, B.S.; Gabbay, Y.B.; strand RNA genome. The aim of this study was to Morais, L.L.C.S. determine the presence and molecular characterization INSTITUTO EVANDRO CHAGAS of canine NoV and AstV circulating in sewage from Uruguay. An environmental surveillance of these viruses Hepatitis A is an acute infectious disease caused by was performed in sewage from Melo and Treinta y Tres the hepatitis A virus (HAV) and majorly transmitted cities (eastern region of Uruguay). Ten samples (42 ml) through contaminated water and food. The aim of this were collected bimonthly in each city from September study was to evaluate the relationship between HAV 2011 to April 2013. Viral concentration was carried out particles and water quality indicators in recreational by the ultracentrifugation method and the nucleic acid water. Microbial indicators and physical and chemical
© silica method. cDNA synthesis was carried out using with the Colilert 18 IDEXX kit; pH, total dissolved parameters were evaluated. Coliforms were quantified randomextraction hexamers was performed primers. For by canine using theNoV guanidinium/ and AstV two solids (TDS), and dissolved oxygen (DO) were assessed ® PCR were performed with primers towards the ORF1b with the HI9828 HANNA probe; turbidity, color, and ORF2, respectively. Amplicons were sequenced and and chemical oxygen demand (COD) were studied ® the phylogenetic analysis was carried out to determine with the DR2800 (HACH ) spectrophotometer. HAV the molecular characterization of these animal viruses. particles were concentrated with the adsorption-
AstV and one as canine NoV. The Uruguayan canine AstV was extracted with the QIAamp kit (QIAGEN). Viral elution method on filtering membranes and viral RNA® strainsFour out clustered of 20 analyzed with strains samples detected were identified in Italy and as canine Brazil in 2008 and 2012, respectively. The Uruguayan canine assay performed on the 7500 Real Time PCR system particles were detected and quantified with a TaqMan NoV strain clustered with a canine strain detected in (Applied Biosystems®) after reverse-transcription. Hong Kong which belongs to the GVII genogroup. The Statistical analyses were performed with the BioEstat (v.5.2.) software. 132 samples were collected in the possibility that these viruses were excreted by humans. period of January-2012 to July-2014 from four beaches: Theidentification presence ofof canine these animal NoV and viruses AstV in in sewage sewage highlights raises the Paraiso, Murubira, Farol, and Areiao. HAV particles were the importance of the environmental surveillance since that by using this approach we reported the presence of end Farol beaches exhibited the highest positivity rate, withdetected 5.30% in 17.42% of positive of the samples samples each, (23/132); while the only Paraiso 4.54 study warns about the presence of these animal viruses and 2.27% of the samples from Areiao and Murumbira inGVII sewage canine and NoV promotes for the first the time development in the Americas. of studies This tested positive, respectively. The average viral load 1 3 for the spread of these viruses in the environment as a ranged from 2.20 x 10 and 1.11 x 10 Indicators of thermotolerant coliforms and Escherichia genomic copies/L. human host that uses recreational waters contaminated coli were above the limit established by the CONAMA withfirst stepsewage. to determine Financial the Support: zoonotic Polos infection de Desarrollo risk for a Universitario (PDU), Universidad de la República school vacations and prolonged holidays. Nevertheless, HAVresolution particles 274/2000, were detected particularly in samples for that the were months within of
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
85 Environmental Virology: EV these limits. The correlation between coliforms and HAV PCR. The FC counting was determined monthly in each p = 0.4), nevertheless, a positive correlation was found between HAV and HAdV, with viral loads values ranging from 1.68E+03 to DOwas and not CODstatistically (p =0.04; significant r = 0.1. The( presence of HAV in point. All raw sewage samples (12/12) were positive for samples that were labeled as appropriated for bath and the lack of association between microbial indicators and samples,5.14E+05 with genome viral copiesloads values per milliliter ranging (GC/mL).from 3.27E+02 After the detection of this virus reinforces previous studies treatment, the HAdV was detected in 75% (9/12) of that show that microbial indicators do not assure the showed reduction 1-2 logs while others showed no virological quality of recreational water. Moreover, these changesto 5.03E+03 in viral GC/mL. load. However, Some samples the sewage of treated treatment effluent was able to reduce the FC counting into 2 logs in all samples of viral contamination. The positive correlation between analyzed. These results demonstrate that although the DOfinding and evidence CDO with the HAVneed suggestsof finding that accessory these indicatorsvariables secondary treatment was able to reduce the FC counting, could be used as indirect predictors of the presence of HAV in water samples. sewage. Thus, more studies on the impact of sewage treatmentit was not alwaysin viral efficient removal to should HAdV removalbe accomplished in domestic to EV21 - IMPACT OF SEWAGE TREATMENT WITH establish new and effective wastewater management ACTIVATED SLUDGE IN HUMAN ADENOVIRUS VIRAL policies. Financial Support: CAPES, FAPEMIG, UFJF. LOAD Assis, A.S.F.; Otenio, M.H.; Fumian, T.M.; Miagostovich, EV36 - ABSENCE OF HEPATITIS E GENOMES IN M.P.; Drumond, B.P.; Rosa e Silva, M.L. SURFACE WATER FROM FARMS IN RIO DOS SINOS WATERSHED, BRAZIL 1. UNIVERSIDADE FEDERAL DE JUIZ DE FORA 2. INSTITUTO OSWALDO CRUZ Heldt, F.H.; Gularte, J.S.; Staggemeier, R.; Henzel, A.; 3. EMBRAPA GADO DE LEITE Spilki, F.R. The fecal coliforms (FC) are widely used indicators UNIVERSIDADE FEEVALE Waters bodies and dams located in farms, are subject treatment plant (WWTP). It is known that the sewage to constant discharges of fecal material, due lack of treatmentto monitor mainly the quality aims the of theremoval effluent suspended in wastewater solids treatment of human and animal wastes. Although Hepatitis E virus (HEV) is a member of family Hepeviridae, the complete elimination of pathogenic microorganisms the viral particle is composed by non-enveloped capsid and organic matter, however it may be insufficient for containing single-stranded positive-sense RNA, the genome size 7.2 kb approximately. HEV is responsible consideringsuch as enteric the viruses. importance Thus, of the the return waterborne of the effluent diseases. to for acute infections, manly in tropical areas and endemic, Thethe nature human can provideadenoviruses significant (HAdV) harm toare public associated health, where health conditions do not existent or ineffective, with sporadic cases and outbreaks of gastroenteritis. affecting mainly people from 15 to 45 years. Due the These agents are present in various types of aquatic anthropozoonotic nature of the infection, HEV is more environments and also they have been described as the likely to be found in areas devoted to swine husbandry, most prevalent enteric viruses in sewage. In this scenario, the present study was conducted in surface waters the objective of this study was to evaluate the impact of collected in dairy farms located at Rio dos Sinos basin, sewage treatment with activated sludge in HAdV viral load southern Brazil. Forty-six samples were analyzed from and in FC counting. For this purpose, raw sewage (n=12) farms of Taquara, Rolante and Riozinho municipalities. bimonthly at WWTP from Juiz de Fora - MG, between were concentrated by adsorption-elution, to extraction Januaryand treated and June effluent 2014. samples The samples (n=12) were were concentrated collected For the identification of HEV, putative viral particles theyTM, Germany) protocols and cDNA synthesis was conducted Viral nucleic acids were extracted using a commercial kit using the kit of RTP DNA/RNA Virus Mini Kit (Invitek andusing the elution HAdV and viral skimmed-milk load was determined flocculation using procedure. real-time positive feces were used as positive controls. None of prior nested-PCR amplification of ORF1 gene. HEV October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
86 Environmental Virology: EV the samples showed positive, pointing to undetectable EV39 - STANDARDIZATION OF A PROTOCOL FOR levels of the virus in these farms, in contrast to previous DETECTION OF ADENOVIRUSES IN GASTROPODS works of the group conducted in other geographic areas TISSUES of Rio Grande do Sul State. A possibility of not HEV in the Gularte, J.S.; Staggemeier, R.; Heck, T.M.S.; Heldt, F.H.; samples is due to animals in the region not been infected Henzel, A.; Spilki, F.R. with the virus. Financial Support: FAPERGS, FEEVALE, CNPq, FINEP, CAPES. UNIVERSIDADE FEEVALE Human adenovirus (HAdV) is an important enteric EV37 - ABSENCE OF HEPATITIS E VIRUS IN WATER virus, often detected in water contaminated by human SAMPLES AND SEDIMENTS IN A URBAN AREA IN waste. HAdVs are non-enveloped DNA viruses belonging SOUTHERN BRAZIL to the Adenoviridae family. Even if the virus particles Heldt, F.H.; Gularte, J.S.; Staggemeier, R.; Henzel, A.; are released into the environment, its concentration in Spilki, F.R. hydrous bodies is low. It is therefore necessary a lot of UNIVERSIDADE FEEVALE water sample to perform the analysis. A resource to this
Hepatitis E virus (HEV), a RNA virus member of the surrounding water and end up concentrate on the highest Hepeviridae family, is one of the causative agents of levelsadversity tissue is virusthe use than of in aquatic water samples.organisms Molluscs that filter inhabit the acute viral hepatitis in human beings and is capable different environments and can be common and abundant of infect swine’s sub clinically. Especially in regions in fresh water, being gastropods of major importance in where sanitary conditions are poor due to enteric form these environments. Although several studies have been of contamination combined with the consumption of performed pointing to the presence of HAdV and other water and food contaminated by the virus. Elucidation of epidemiological routes of the infection in Brazil is water, research using gastropods as bioindicators of required, since a number of cases were reported and the fecalviruses contamination in shellfish in tissues freshwater collected environments in contaminated are not virus was detected in water in areas of swine husbandry. common. The aim of this study was to standardize a viral In this sense the present study aimed to detect HEV concentration technique from snails’ tissues, allowing genomes in water samples from urban streams crossing its use in virus detection and its use as a bioindication the main cities of Sinos River basin, southern Brazil. We tool. Groups of snails Pomacea canaliculata species were analyzed 318 samples of water and sediments of river kept in experimentally contaminated water with HAdV-
HEV, putative viral particles concentrated by adsorption- elutiontributaries protocols, by nested-RT-PCR. to extraction For using the identificationthe kit of RTP of 5 at different viral loads [4.04E+08 DNA/mL (1:100) TM , Germany) and cDNA theand snails 4.04E+07 were DNA/mLremoved from (1:1000)] the shell for and seven the days. body Twowas completelymethods of macerated.viral concentration One gram were of tissuetested. wasIn the diluted first, ofDNA/RNA ORF1 gene.Virus MiniAll Kitsamples (Invitek were negative, despite synthesis was conducted prior nested-PCR amplification in 1 mL Eagle’s minimal essential minimum (E-MEM) satisfactory analytical sensitivity of the protocols, homogenized for two minutes and centrifuged for 10 pointing that, differing from other areas of southern minutes at 14000rpm, and the supernatant was used at Brazil; these urban locations are not contaminated analysis. In the second protocol to the snail hemolymph was collected after the introduction of a needle in the excreta that presumably are present in these water by the virus, maybe reflecting the low levels of swine mantle region, where the hemolymph was drained. For bodies. Financial Support: FAPERGS, FEEVALE, CNPq, molecular detection was carried out polymerase chain FINEP, CAPES. reaction in real time (qPCR). The results indicated that gastropods had ability to accumulate the virus in their tissues. In samples with higher initial viral loads (1:100) occurred the highest detection values, viral detection
viral recovery from hemolymph was even greater October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmentalin snail Virology: tissue EV showed a value of 3.54E+07 DNA/mL, XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
87 Environmental Virology: EV
in eight water samples, with the highest value (1.93E+05 to that found in contaminated water (2.58E+08). These resultscorresponding are of great to 3.56E+08importance DNA/mL, for further a analysis, result similar since municipality of Rolante. Five hemolymph samples were under natural environment they are in direct contact positiveDNA/mL) and found the highest in the correspondingviral load found wetlands also occurred of the with the contaminated water and may serve as auxiliary bioindicators. Keywords: Enteric Viruses, Adenoviruses, were detected in two tissue samples, and the highest Gastropods, Bioindicators. Financial Support: Projeto valuein Rolante occurred (2.37E+05 in organisms DNA/mL). living Adenoviralin the corresponding genomes
results showed that four wetlands were positive for SinosEV40 D`Água - LOW (COMITESINOS/Petrobrás). RATES OF FECAL CONTAMINATION IN HAdVSão Leopoldo genomes. wetlandThe consensus of (2.72E+05 is that wetlands DNA/G). provide The WATER SAMPLES AND GASTROPODS IN WETLANDS important environmental services and specially water OF THE WATERSHED OF THE SINOS RIVER, RS Gularte, J.S.; Staggemeier, R.; Heck, T.M.S.; Heldt, F.H.; associated to contamination of these environments, but it Henzel, A.; Spilki, F.R. ispurification. remarkable We that noticed the occurrence that human of HAdV activities is much may lower be UNIVERSIDADE FEEVALE in these landsCAPES than found in other studies for the main course of the Sinos River. Keywords: Adenoviruses, Wetlands are ecosystems of great ecological Wetlands, Gastropods, Bioindicators. Financial Support: importance being currently considered threatened, due environmental degradation. The release of untreated wastewater into hydric bodies increases the ProjetoEV42 - Sinos MIMIVIRUS D`Água (COMITESINOS/Petrobrás). FIBRILS ARE IMPORTANT FOR contamination by pathogenic microorganisms, affecting VIRAL ATTACHMENT TO MICROBIAL WORLD BY A water quality and consequently human health. Viruses DIVERSE GLYCOSIDE INTERACTION REPERTOIRE are the main causes of water-related diseases, because Rodrigues, R.A.L.; Silva, L.K.S.; Dornas, F.P.; Oliveira, enteric viruses are spread through domestic sewage D.B.; Magalhães, T.F.F.; Santos, D.A.; Costa, A.O.; Farias, in large quantities into water bodies. Some human L.M.; Magalhães, P.P.; Bonjardim, C.A.; Kroon, E.G.; La adenoviruses (HAdV) are enteric viruses highly resistant Scola, B.; Cortines, J.R.; Abrahão, J.S. in the environment, being promising candidates as fecal pollution indicators. Molluscs are important members of 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS freshwater ecological nets, the use of these organisms as 2. AIX MARSEILLE UNIVERSITE 3. UNIVERSIDADE FEDERAL DO RIO DE bioindicators for virus detection may be an useful tool to JANEIRO complement analysis of water. The objective of this study was to detect the presence of HAdV in water samples Acanthamoeba polyphaga mimivirus (APMV) is a giant and Pomacea canaliculata molluscs in wetlands of the virus from the Mimiviridae family. It has many unusual Sinos River watershed, Brazil. Five water and gastropods features, such as a pseudo-icosahedral capsid that samplings were carried out and a total of 60 samples from natural wetlands were analyzed, including water, which the ~1.2 Mb dsDNA is released. It also has a dense presents a starfish shape in one of its vertices, through gastropods tissues and hemolymph. The waters were concentrated from the adsorption-elution method. The glycoprotein fibril layer covering the capsid that has not snails were removed from the shell and the body was that although these structures are not essential for viral yet been functionally characterized. Here, we verified completely macerated. One gram of tissue was diluted replication, they are truly necessary for viral adhesion to in 1 mL Eagle’s minimal essential minimum (E-MEM) homogenized and centrifuged, the supernatant was used Acanthamoeba amoebae, its natural host. In the absence of fibrils, APMV at analysis. The snail hemolymph was collected after the castellanii surface. This adhesion is mediated by glycans, had a significant lower attachment to the introduction of a needle in the mantle region, where the hemolymph was drained. For molecular detection was monomer of chitin and peptidoglycan), both of which are specifically mannose and N-acetylglucosamine (a carried out polymerase chain reaction in real time (qPCR) largely distributed in nature as structural components targeting HAdV hexon gene. Viral genomes were detected of several organisms. Indeed, APMV was able to attach
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
88 Environmental Virology: EV to different organisms, such as Gram-positive bacteria, are very dynamic environments, where HAdV may fungi, and arthropods, but not to Gram-negative undergo degradation by physical and chemical factors bacteria. This prompted us to predict that i) arthropods, thus decreasing its permanence in water. Furthermore, mainly insects, might act as mimivirus dispersors and since the viral genetic material may be present in the ii) by attaching to other microorganisms, APMV could environment and can be detected by PCR not necessarily be concurrently ingested by amoebae, leading to the representing viral infectious particles, there is the need successful production of viral progeny. To date, this to evaluate the viability of viral particles present in the mechanism has never been described in the virosphere. samples positive for HAdV genome. This ongoing study viral attachment, glycans. Financial Support: CNPq, human fecal contamination sources in Rio dos Sinos CAPES,Keywords: FAPEMIG, Acanthamoeba Pró-Reitoria polyphaga de Pesquisa mimivirus, da UFMG. fibrils, Watershed,will complement aiming theto assist screening in the management and identification of public of policies for sanitation. Financial Support: CNPq, CAPES, EV60 - HUMAN ADENOVIRUS IN STREAMS FROM RIO FEEVALE. DOS SINOS WATERSHED Albino, S.M.; Giehl, I.C.; Rigotto, C.; Spilki, F.R. EV64 - DETECTION AND MOLECULAR CHARACTERIZATION OF GASTROENTERIC VIRUSES UNIVERSIDADE FEEVALE IN COASTAL WATERS FROM NITERÓI, STATE OF RIO Infections of the gastrointestinal tract are commonly DE JANEIRO, BRAZIL caused by bacteria and more often by viruses. These Dias, J.B.L.; Corrêa, A.A. infections have faecal-oral contamination routes and their main spreading vehicle are contaminated water and UNIVERSIDADE FEDERAL FLUMINENSE food. Viruses are not effectively removed by conventional The waterborne diseases, especially acute diarrheal sewage and water treatment processes, having potential (AD), represent a serious public health problem, affecting for their use as fecal contamination markers of water mostly children in developing countries. Enteric viruses bodies. Similarly, viruses that cause respiratory are considered the main agents of these diseases and are infections are eliminated by the fecal-oral route, as some responsible for many cases of acute gastroenteritis (GA) human adenoviruses (HAdV). Adenoviruses belong to non-bacterial in the world. The main enteric viruses Adenoviridae family and Mastadenovirus genus, being associated with GA cases belong to genus Adenovírus, represented by 52 serotypes, that have variable prevalence Rotavirus and Norovírus. Contamination by these viruses according to geographic distribution. Like all viruses, can occur after contact with contaminated recreational waters, drinking water or food. The edge of the city of and containing a double stranded DNA genome, what Niterói, Rio de Janeiro, has 14 major beaches, which are enhanceHAdV are its species-specific,stability and resistance being alsoin the non environment, enveloped used by the population for recreational and economic allowing contamination source tracking. The aim of this activities and there is no data for viral contamination. study was to detect and quantify the presence of HAdV In this context, the main objective of this study was to genome in Rio dos Sinos Watershed surface waters. The evaluate the occurrence of Rotavirus (RV), Adenovirus study was conducted in four streams in urban and rural (HAdV) and Norovirus (NoV) in water samples collected areas of Novo Hamburgo, Campo Bom and Estância from four beaches in the city of Niterói (Itacoatiara, Velha cities. 22 water samples were collected in sterile Icaraí, São Francisco and Jurujuba), using PCR, qPCR and bottles (500 mL) during February and April 2015, being DNA sequencing. Were collected 24 samples of 10L each subjected to viral concentration techniques, nucleic acid during September 2014 to February 2015; the samples extraction and quantitative real-time polymerase chain reaction (PCR). Among the samples analyzed, three (3) using skimmed milk. The nucleic acids extraction was samples from Luis Rau stream were positive for HAdV were concentrated by organic acid flocculation®Kit (Invitrogen, method genome, having the following quantitation of genomic CA, USA); cDNA for RV and NoV was synthesized using copies per liter: 4.5x103 (Estância Velha), 2x104 (Campo randomperformed primers, by Pure and Link the Viral qualitative RNA/DNA PCR was performed Bom) e 9.8x105 (Estância Velha). The water bodies
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmentalusing Virology: specific EV primers for each viruses.Moreover, XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
89 Environmental Virology: EV the positive samples were quantifying by qPCR and sequenced (ABI Prism 3100 Genetic Analyzer and Big Dye Terminator Cycle Sequencing Kit v.3.1; Applied groups:cg/5uL) after(I) none 30 minutes previous the washingsuspension procedure; was removed (II) Biosystems, CA, USA). The molecular detection by PCR washingand tubes with were sodium separate hypochlorite into five following2% and extran treatment and; showed the presence of HAdV, RV and NoV in 67%, 2) for (III) 20, (IV) 67% and 58% of the samples, respectively. The viral 40 and (V) 60 minutes. After each step of the treatment, sterileand autoclaving swabs were (121ºC, passed 1.0 in kgf/cm the inner surface of the tubes to collect putative remaining viral particles or 1,5quantification x 102 to 5,2 ofx 10 positive2 (HAdV), samples from 4,9 indicated x 103 to 2,0 a x viral 104 genomic material and were immediately eluted in cell (NoV)concentration and from (in 5,9 genomicx 104 to 1,2 copies/mL) x 105 (RV). ranging The beaches from culture medium (MEM) by 2 hours and 30 minutes at of Icaraí, São Francisco and Jurujuba were positive for 4°C. The nucleic acids extraction was carried out using all viruses analyzed; Itacoatiara was negative only for BioPur silica kit following the manufacturer instructions and ICC-qPCR and qPCR were performed based on origin of environmental contamination, showing the prevalenceNoV. The phylogenetic of enteric HAdV analyses serotype confirmed 41, of human the human NoV only to the washing procedure reduced about 3 logs in viruspartial detection hexon geneand after amplification. 20, 40 and Samples 60 min submittedthe decay rate was 4 logs for all autoclaving times. The analyses theGenogroup presence II (GII)of enteric and human viruses RV G1P[8]in the andseashore G12P[8]. of by ICC-qPCR showed the absence of viral viability after Niteroi,To our justifying knowledge, future this studies is the firstof environmental study describing and all treatments, even in samples with detectable HAdV- epidemiological monitoring in this region. Keywords: 5genomic copies. In conclusion, it was possible to see the enteric viruses, Gastroenteritis, PCR, sequencing, decay rate of HAdV-5 genomes in samples that passed through the sterilization process used in the laboratory routine, showing the relevance of the washing steps. Recreation Water. Financial Support: FAPERJ/projeto Financial Support: CNPq, CAPES, FEEVALE. 112.036EV68 - EVALUATION 2013; FOPESQ/UFF OF ADENOVIRUS 2014. INACTIVATION BY ROUTINE STERILIZATION PROTOCOLS EV88 - HANTAVIRUS CIRCULATION AMONG SMALL Pressi, G.; Rigotto, C.; Giehl, I.C.; Albino, S.M.; Fleck, MAMMALS AND HUMANS FROM ATLANTIC FOREST J.D.; Spilki, F.R. AND CERRADO IN NORTH MINAS GERAIS, BRAZIL Amaral, C.D.; Costa, G.B.; Borges, I.A.; Miranda, UNIVERSIDADE FEEVALE J.B.; Vieira, F.; Tolardo, A.L.; Farignoli, M.; Souza, Human adenoviruses (HAdV) are formed by non- W.M.; Kroon, E.G.; Figueiredo, L.T.M.; Abrahão, J.S.; enveloped particles containing genomic DNA and belong Drumond, B.P.; Paglia. A.P.; Trindade. G.S. to the Adenoviridae family. HAdV are responsible by gastroenteritis, respiratory and conjunctivitis infections. 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS They remain viable for long periods outside the host, and 2. UNIVERSIDADE DE SÃO PAULO 3. UNIVERSIDADE FEDERAL DE JUIZ DE FORA are widely known for their high stability and resistance to degradation by physical and chemical factors in the Hantavirus Cardiopulmonary Syndrome (HPS), spread environment. Considering the HAdVs resistance, the goal into all Americas, is considered one of most important of this study was to assess the effectiveness of disinfection emerging diseases, with high mortality rate (~40%) in and sterilization processes of plastic materials used in humans. Transmission occurs through human inhalation the laboratory routine. In this study, we analyzed the of aerosolized virus from rodents excreta or direct contact presence of viable viral particles and HAdV-5 genome with bites. The present work reports the detection of by integrated cell culture quantitative PCR (ICC-qPCR) Hantavirus in small mammals and humans from two or directed qPCR after exposure to different routinely biomes in Minas Gerais, Brazil. Animals were trapped used sterilization procedures. Three independent on rural areas of Serro city, which is a biome with a experiments were performed, in which plastic tubes of transition between Cerrado and Atlantic Forest. An effort 50 mL received a viral suspension of HAdV-5 (8.98x107 of 4800 traps was carried out during 2012-2013, and
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
90 Environmental Virology: EV
56 animals were captured in forest (52%), domiciliary Pirajubaé), a marine extractivist reserve in Florianópolis areas (32%) and pasture (16%), which demonstrates a city, Anomalacardia brasiliana, a bivalve mollusk similar to high incidence of these rodents in anthropic areas. At the Clams, is extracted and commercialized. Its consumption same time, it was retrospectively analyzed 240 human began to become frequent as an ingredient used to serum samples collected in this region. All serum samples replace the European mollusks in Azorean and Italian dishes, by European immigrants. Since A.brasiliana is a protein of Araraquara virus as antigen. It was found twowere IgG tested positive by IgG/IgM rodents ELISA (3.5%), using 17 IgGthe positiveN recombinant (7.1%) such as bacteria and viruses present in the seawater. So and 4 IgM (1.7%) positive humans. In order to detect far,filter-feeder few researches it can have also addressed accumulate the human potential pathogens of these which Hantavirus is circulating in this region, RNA was extracted from RNA Latter (Life Technologies) A.brasiliana there are no publications yet. Our aim was to preserved lungs of rodents and from serum samples studyshellfishes the bioaccumulation as a human pathogen behavior vehicle, of A.brasiliana and regarding using of humans. A sensitive qPCR assay was performed to Human Adenovirus (HAdV) and Human Rotavirus-A amplify the Hantavirus S segment conserved gene. It (RVA) as enteric viruses’ models. The mollusks were was found one Olygorizomys sp and two IgM positive individuals. The qPCR product of positive samples was seawater during 3, 8 and 12 hours. One aquarium was sequenced in both orientations (Mega BACE sequencer). inoculatedmaintained with in three HAdV aquaria (avg.1.9e+11 filled with GC), 10L the of filtered other A phylogenetic tree was constructed using the neighbor- with RVA (avg. 6e+09 GC) and the third without adding joining method and the sequences were grouped with viruses (negative control). At each time listed above, 20 Juquitiba animals where opened, dissected and their digestive Hantavirus circulation in North region of Minas Gerais tissues (DT) were used to investigate the amount of State. Olygorizomysvirus (JUQV) sp wasgroup. trapped This is in the domiciliary first report area of viral concentration, by RT-qPCR method. At the end of indicating a close contact among wild and domestic life. the bioaccumulation experiments, 40mL of the seawater Nonetheless, no clinical symptoms were reported by from each aquarium were also collected and processed individuals enrolled, but, the presence of IgM antibodies by polyethylene glycol precipitation method (PEG).The reinforce the occurrence of Hantaviruses in described results from the duplicates of HAdV and the triplicates region. While serology assesses antibodies and it is of RVA biaccumulations showed that the A.brasilliana connected to host immune factors, molecular methods was able to bioaccumulate both viruses with different detect viral RNA, demonstrating more precisely the circulating viruses. Therefore, this study reported the 12.5%efficiencies. of the The HAdV highest added values in the found aquarium. for HAdV RVA presence was less the North Minas Gerais. Human infections continue to bioaccumulatedin DT were after and 12h the higher (1.2e+06 concentration GC/g), representing was after befirst reported detection in ofseveral JUQV-like areas in of rodents Brazil and and are humans directly in related to changes in the natural environment, which RVA added to the aquarium. The analysis of the seawater may alter the population of rodents and increase the showed8h (1.6e+04 that, after GC/g), 12h, representing 10% of the seeded around HAdV 0.5% remained of the rate of viral dissemination. Keywords: Hantaviruses, in the water and more than 40% of the RVA was still in wild rodents, humans, epidemiology, Juquitiba virus. the water. This study proved that there is a difference in Financial Support: CNPq, FAPEMIG, CAPES. the uptake of these two viruses by the A.brasiliana and that this can be due to the differential virus interactions EV96 - ENTERIC VIRUSES BIOACCUMULATION BY with the digestive tissues of the mollusk. This study will BRAZILIAN CLAMS ANOMALOCARDIA BRASILIANA be useful for the future depuration experiments that will Souza, D.M.S.; Dominot, A.F.A.; Barardi, C.R.M. be performed in A.brasiliana. Financial Support: Project UNIVERSIDADE FEDERAL DE SANTA CATARINA Santa Catarina is one of the main Brazilian States in UNIVERSAL/CNPq/14 472804/2013-8 and CNPq PDJ/ exploiting and exporting marine organisms such as 158865/2014-6. Reserva Extrativista Marinha do shellfishes.October 2015 AtVolume REMAPI 20 – Supplement ( 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
91 Environmental Virology: EV
EV97 - DETECTION AND GENOTYPING OF HUMAN until then was unknown in this region used for leisure. ADENOVIRUS IN RECREATIONAL WATERS FROM So, this data reinforce the importance of virological MOSQUEIRO ISLAND, METROPOLITAN REGION OF analysis together with the bacterial indicators, currently BELÉM, PARÁ, BRAZIL used. Financial Support: Evandro Chagas Institute-IEC Smith, V.C.; Teixeira, D.M.; Santos, D.S.A.S.; Deus, D.R. (Secretary of Surveillance in Health, Brazilian Ministry de; Alves, J.C. dos S.; Junior, E.S.C.; Bandeira, R. da S.; of Health); Program of Post Graduation in Virology Sousa, N.R.; Silva, K.R.T. da; Vale, E.R.; Morais, L.L.C. (PPGV,IEC); Amazon Pará Foundation for Supporting de S.; Gabbay, Y.B. Research (FAPESPA). 1. INSTITUTO EVANDRO CHAGAS EV101 - METAGENOMIC ANALYSIS OF FECAL VIROME 2. UNIVERSIDADE DO ESTADO DO PARÁ OF FUR SEALS FOUND ON THE COAST OF RIO GRANDE Raw sewage discharge in aquatic environments favors DO SUL, BRAZIL the occurrence of accidental infection by possible Kluge, M.; Campos, F.S.; Tavares, M.; Derek, A.; Valdez, virus particles, mainly in recreational waters. Enteric F.P.; Giongo, A.; Roehe, P.M.; Franco, A.C. viruses are important agents related with waterborne 1. UNIVERSIDADE FEDERAL DO RIO GRANDE diseases, highlighting the human adenovírus (HAdV) DO SUL known for its high resistance and persistence for long 2. CENTRO DE ESTUDOS COSTEIROS, periods in aquatic environments. The Mosqueiro Island LIMNOLÓGICOS E MARINHOS is the main recreational tourist place of Belém city and 3. PONTIFÍCIA UNIVERSIDADE CATÓLICA although receives a large populations over the year, The Rio Grande do Sul coast, the southernmost state it has no sewage and stormwater treatment plants. in Brazil, seasonally hosts numerous marine species, This study aimed to investigate the HAdV presence in including birds, turtles and mammals. Among the surface water from four beaches (Paraíso, Murubira, marine mammals, the Subantarctic and South American Farol and Areião) of Mosqueiro Island, collected from fur seals are observed near and on-shore frequently, january 2012 to december 2014. Each water sample was particularly during winter months. Although some reach the coast to rest, several are found dead or membrane and the dna was extracted by silica method debilitated along the shore. Establishing microbial andconcentrated then submitted by adsorption-elution to nested PCR. The method positive in products filtering etiological agents of diseases that infect these fur seal populations remains limited by available data, especially using the bigdye® terminator v3.1 cycle sequencing kit concerning viruses. The aim of this study was to apply a andwere the purified 3130xl using genetic a commercialanalyzer. The kit tide and and sequenced rainfall metagenomic approach to characterize the fecal virome data were obtained by hydrographic center site of the of fur seals found dead along the Rio Grande do Sul brazilian navy and the national institute of meteorology, coast. Two species were analyzed: the South American respectively. Of the 156 samples tested 34 (21.8%) were fur seal (Arctocephalus australis) and the Subantarctic positive for HAdV. Of these, 23 (67.6%) were sequenced, fur seal (Arctocephalus tropicalis). Fecal samples from 20 (87%) characterized as specie f, two (8.7%) as specie 10 specimens (A. australis n=5, A. tropicalis n=5) c and one (4.3%) as specie a. Rainfall apparently did were collected directly from the intestines of dead not occur in relation to tidal action, considering that ultracentrifugation on a 25% sucrose cushion, and were mostnot influence HAdV detection the detection occurred of HAdV,in high however, tide. It wasthis not did followedfur seals. by Viral RNase particles and DNase were treatment. purified and Viral pelleted genomes by observed relationship among the presence of coliform were extracted via commercial kits (PureLink® Viral bacteria ( ) and HAdV, considering that the Escherichia coli ® Mini Kit, Qiagen) and concentration of bacteria was in accordance with the wereRNA/DNA, sequenced Invitrogen through and IonRNeasy Torrent and Illumina NGS currentHAdV was standards present (<2000). in 21.1% This (31/147) study demonstratedof samples whose the platformsa random andPCR readswas performed. were assembled The amplified using MetaVelvet products presence of HAdV in the recreational waters of the four and SPAdes before subjecting to BLASTx searches. Both beaches and revealed the HAdV circulation pattern that October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
92 Environmental Virology: EV viromes were dominated by bacteriophages, however, were positive for AdV by nested-PCR (P1-May; P3-May enteric and potentially novel eukaryotic viruses were and June) and three (37.5%) were positive for HAdV by also found. Sequences of anellovirus, parvovirus and of the three positive samples by qPCR ranged from Sequences of picobirnavirus and a hepevirus-like were 4.23x10qPCR (P1-June;3 to 4.74x10 P4-May4 and June). The quantification picornavirus A. were australis identified; while in sapovirus, both fur rotavirus seal species. and sakubovirus were found in A. tropicalis for AdV by nested-PCR genomic (P1-March copies and (gc)/L.May; P3-April, In the contributeidentified in to a better understanding of the viruses that unconcentrated samples, 38.4% (5/13) were5 positive circulate within fur seal populations. Financial. These Support:findings HAdV by qPCR (P1-April). In this preliminary study it CNPq, CAPES, FINEP. wasMay possible and June) to observe and 7.69% that (1/13;applying 1,82x10 the concentration gc/L) for method we were able to detect and quantify AdV EV128 - ADENOVIRUS IN CONCENTRATED AND genome by nested-PCR and qPCR. However, the analysis UNCONCENTRATED SAMPLES FROM SURFACE of unconcentrated samples by qPCR was compromised WATER IN CAXIAS DO SUL/RS probably due to the interference of inhibitors or the Girardi, V.; Goulart, N.; Hahn, R.C.; Cornelli, R.; conventional nested-PCR method was more sensitive to Staggmeier, R.; Rigotto, C.; Schneider, V.E.; Paesi, S.O.; assure the AdV presence in this particular samples. This Spilki, F.R. ongoing study will complement the viral assessment 1. UNIVERSIDADE FEEVALE 2. UNIVERSIDADE DE CAXIAS DO SUL Caí River Watershed in Caxias do Sul region. Keywords: Adenovirus,and identification Arroio of Belo,fecal contaminationNested-PCR, qPCR. sources Financial in the Arroio Belo belongs to Caí River Watershed, Caxias do Support: CAPES, FEEVALE, ISAM, UCS. Sul municipality (Brazil) and is often used for recreation by local population, although receives discharge of EV131 - LEVELS ADENOVIRUS LOADS AFTER WATER TREATMENT STEPS IN TWO CONVENTIONAL WATER are common pathogens often associated with respiratory TREATMENT PLANTS domestic and industrial effluents. Adenoviruses (AdV) Jesus, L.F.; Girardi, V.; Ruskowski, L.; Heck, T.M.S.; young people, becoming a public health concern due Staggemeier, R.; Soliman, M.C.; Rigotto, C.; Henzel, A.; and gastrointestinal illness and/or conjunctivitis in to their occurrence in aquatic environments. Their Nascimento, C.A.; Spilki, F.R. presence in water may indicate contamination from human or different animal sources. The main goal of this UNIVERSIDADE FEEVALE study was to evaluate AdV presence in surface water Contamination of water resources by enteric pathogens in concentrated and unconcentrated samples by real is a concern because it can lead to impacts both health time PCR (qPCR) and conventional nested PCR (nested- and the environment. It has been questioned whether PCR). Collection was performed from March to June of conventional water treatment processes are capable 2015 in Arroio Belo in four sites located in urban region of removing microbial contaminants properly. Among (P1 and P2), countryside (P3), and in a recreational the enteric viruses, human adenoviruses (HAdV) have zone (P4). Concentrated samples (using adsorption- been the focus of many studies due their persistence in elution method) and unconcentrated samples were the environment. However, viral removal mechanism is subsequently submitted to nucleic acid extraction with a still unclear. The aim of this study was to evaluate the commercial kit (Stratec Kit). For screening the presence presence of HAdV during the water treatment stages in of AdVs, a partial sequence of the DNA polymerase (pol) the water treatment plants of Santo Antônio da Patrulha and Parobé, in Rio dos Sinos watershed, during May 2011 of several AdV types from the genera Mastadenovirus to May 2012. Samples from raw water, decanted water, andgene wasAtadenovirus. amplified byIn nestedaddition, PCR aimingwe performed the detection the qPCR that targets the partial sequence of hexon gene during one year, with a total of 103 samples. Adsorption– conserved among human adenovirus (HAdV) species C. elutionfiltered concentrationwater, and treated method water using were a negatively collected monthlycharged In a total of eight concentrated samples, three (37.5%) membrane was performed. Viral nucleic acids were
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
93 Environmental Virology: EV extracted with a commercial kit (Stratec Kit) and the real milliq water. Lower recovery rates were observed in time polymerase chain reaction (qPCR) was performed untreated surface water, due to the presence of inhibitors. using primers designed to amplify the hexon protein In miliq water the recovery rates were 150 times higher gene of HAdV. Comparing different treatment steps 96% than in untreated surface water. There was also 1 log of of raw water were positive for AdV, 12% of decanted analyzed by ICC-qPCR in comparison with direct q-PCR. water were positive for AdV and 62% of treated water Inincreasing environmental in the detectionsamples we of observedartificially a spikedlow prevalence samples werewater positive were positive for AdV. for In AdV, both and water after treatment 50% of filtered plants of hav, viral genome was detected only in 1 out of 84 it was observed a curling in the values with a decrease samples and viral particles were not considered viable by ICC-qPCR. Even at low concentrations, HAV may from 1,46E+06 maximum to 3,68E+02, minimum.. The also cause infections. With the decrease of infections systemsin the settling have a stagereduction and anlower increase to 4 logs in filtered according water, to and increase of susceptible individuals, environmental international standard and it is noteworthy that decanted monitoring and studies that will complement public water presents lower adenoviral loads. Management health actions become relevant. practices and engineering related to the pass of decanted EV141 - EVALUATION OF THE NEGATIVELY CHARGED viral particles and increase in viral positivity in further MEMBRANE METHODOLOGY FOR INFECTIVE steps.water toKeywords: filtration mayAdenovirus, be involved qPCR, in aWater resuspension treatment of BACTERIOPHAGE PARTICLES RECOVERY FROM plant. Financial Support: CNPq, FAPERGS, CAPES. SEAWATER Meira, G.L.S.; de Albuquerque, J.P.; Cabral, M.C.; EV138 - LOW PREVALENCE OF HEPATITIS A IN Fracalanzza, S.E.L.; Campos, R.M.; Vermelho, A.B.; ENVIRONMENTAL SAMPLES IN RIO GRANDE DO SUL Ferreira, D.F. STATE, BRAZIL UNIVERSIDADE FEDERAL DO RIO DE JANEIRO Souza, F.G.; Staggemeier, R.; Rigotto, C.; Spilki, F.R. Bacteriophages (phages) have an important role in UNIVERSIDADE FEEVALE marine micro ecology, mainly by recycling the carbon Enteric viruses may be present naturally in aquatic available in the ocean. Phage therapy has gained environments and over 100 types of pathogenic increasing attention as an alternative approach due viruses are excreted in human and animal wastes. The to bacteria antibiotic resistance. The large number of hepatitis a virus (HAV) is the major cause of acute viral phages observed in the ocean makes it an important hepatitis worldwide, endemic mainly in developing source for obtaining new phages with potential countries. In endemic areas there is high prevalence application in health care. The majority of researchers in of immune adults, due to infection with hav occur mostly in children, since the exposure of the pathogen instead of focusing on the recovery of infective phage is not delayed. HAV infections are often associated with particlesthe field focusthat wouldin obtaining be used large for amounts bacteria of lysis phage assays. DNA socioeconomic factors and environmental quality. In The methodologies for obtainning infective phages Brazil, the northern region has the highest prevalence from sea water is very poor documented. In this work, of immunized individuals. The rio dos sinos watershed we used the Klebsiella pneumoniae phage as a model is located in the northeastern of rio grande sul, the major source of public water supply for a population of one of the main methodologies used for the recovery approximately 1.5 million people. The main goal of this ofto viruses evaluate (enteroviruses) the efficiency offrom phage environmental concentration water. by study was to evaluate the presence and viability of hav Our data shows that less than 1% of the Klebsiella from 84 untreated surface water samples collected from pneumoniae phage is recovered from seawater using this methodology and therefore we suggest that negative by q-PCR with primers for the 5’utr and taqman probe. charged membrane method is not indicated for the sinos river affluents. Genome detection was performed recovery infective phage particles. We are now testing concentration of hav in untreated surface water and Recovery efficiency was also evaluated spiking known October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
94 Environmental Virology: EV new improvements in the available methods and novel approaches as well. Financial Support: CNPq, FAPERJ. as a marker of faecal contamination of fresh produce sinceMoreover, the used we suggestmethodology that HAdV provides can begood efficiently recoveries used of EV150 - EVALUATION OF ADENOVIRUS INFECTIVITY infectious particles which cannot be achieved studying IN FRESH PRODUCE other enteric viruses. Financial Support: This study was Marti, E.; Barardi, C.R.M. UNIVERSIDADE FEDERAL DE SANTA CATARINA supported by the program “Ciência sem fronteiras, Bolsa Foodborne viruses are increasingly recognised atraçãoEV154 de - Jovens ENVIRONMENTAL Talentos- BJT 2014.” SURVEILLANCE OF worldwide as the most important cause of outbreaks HEPATITIS A VIRUS (HAV) IN SAMPLES OF WATER associated with food contamination. Enteric viruses are DESTINED TO HUMAN CONSUM a major concern due to the low infectious dose and the Pinto, W.V.M.; Santos, D.S.A.S.; Silva, L.V.; Sousa, N.R.; high persistence in the environment. Although norovirus Valle, E.R.; Aranha, D.C.P.; Morais, L.L.C.S. (NoV) and hepatitis A virus (HAV) are most frequently involved in foodborne infections, adenoviruses (HAdV) INSTITUTO EVANDRO CHAGAS/SVS/MS has become of growing interest because they present Among hepatitis, the most prevalent in the world is some characteristics that make them an ideal indicator caused by hepatitis A virus (HAV). HAV belongs to the for faecal pollution. Virus presence in food matrices family Picornaviridae, genus Hepatovirus, it’s a rounded, can be evaluated by cell culture methods, determining non-enveloped virus possessing a single-stranded RNA the virus infectivity and by molecular techniques such surrounded by a capsid of 27-30nm in diameter and the as qPCR, quantifying viral genomes. Even though qPCR transmission involves mainly fecal-oral route, through is considered the gold standard for virus detection, water and polluted foods, being rare the person-to- this method lacks to provide information about virus person’s transmission cases. Previous studies have infectivity. Hence, the plaque assay method was demonstrated a total of 1,5 million cases of hepatitis would be associated to socioeconomic factors: access and naturally contaminated fresh produce. Lettuce, to drinking water, absence of appropriate manure strawberriesemployed to determineand green infectious onions were HAdV included from artificially in this treatment, basic sanitation and sanitary education study as they are food items usually associated with foodborne outbreaks. A quantity of approximately 108 Laboratory of Environmental Microbiology received plate forming units (PFU) of HAdV were seeded and 129among samples others. of consumption During May/2012 water from to July/2015 Acre, Amapá, the eluted from food surfaces using the procedure described Pará, Federal district, Minas Gerais and Tocantins states previously based on elution with Tris-glycine (pH 9.5) with the objective of researching of HAV, contributing in buffer containing 1% beef extract and concentration the elucidation of the origin of outbreaks of the disease. The samples were originated from different LACENs: were tenfold serially diluted and inoculated in duplicate PA (n=76), AC (n=9), TO (n=4), DF (n=8), AP (n=6) intowith six-well polyethylene plates glycol/NaClwith A549 cell solution. monolayers. Then, The samples cells and MG (n=26). We used the adsorption and elution were incubated at 37°C with 5% CO2 during 7 days and PFU were then detected by staining cell monolayer with extraction using QIAamp® mini kit. For oblation of the crystal violet. HAdV recoveries in spiked fresh produce cADNmethodology we used in randomfiltrate membrane prime and followed SuperScript by viral III RNAand were about 7% for lettuce, 25% for green onions and the detection of viral RNA fragments were performed by Nested PCR. In 19,2% (n = 24) of the samples it was samples, values in the range of 10-1 were3% for detected strawberries. in 3 from In 5 green non-artificially onion samples, contaminated in 3 from the epidemic link among the consumption of polluted 5 strawberry samples and in any of-10 5 lettucePFU of samplesHAdV/g waterpossible with to confirmHAV and the a possible presence outbreak of HAV and of theto establish disease. analysed. These results highlight that fresh produce may represent a potential vector of transmission of HAdV as these viruses may remain infectious in food surfaces. Most of the cases (17/24) occurred in Pará, followed by the states of Minas Gerais (4/24), Acre (1/24), Amapá October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental(1/24) Virology: and EV Tocantins (1/24). In Distrito Federal there XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
95 Environmental Virology: EV were not positive samples. The municipal districts of sizes considered positive were 171 bp (HAdV), 380 stood out in number of positive samples. In those places bpin the (NoV first GI) and and second 390 bp step, (NoV respectively. GII). Of the The 111samples amplicons theCuruçá geographical (4/24) and and Cachoeira socioenvironmental do Arari (3/24), conditions in Pará, tested (exception of the ones of September 2013), the might have favored the propagation of the agent by hydric route, given the high number of springs in those areas and absence of sanitation. The results corroborate toNoV NoV were GII detected from Água in 4.5%Preta (5/111) lake (n=2) of them, and WTP 20% (n=2). (1/5) the transmission of HAV by hydric route, failure in the belonged to NoV GI, from Bolonha lake and 80% (4/5) treatment of water for consumption, and demonstrate the importance necessity of the environmental surveillance HAdV were observed in 27.9% (31/111) of the samples for HAV, which constitutes an important public health fromanalyzed, WTP. of The these Bolonha 41.9% lake (13/31) was the came point from that Bolonhashowed problem in the country. Keywords: hepatitis A virus; mostlake, 32.3%contaminated (10/31) with from both Água viruses, Preta and 25.8%the HAdV (8/31) was environmental surveillance; potable water. Financial predominant in all places during the study period. The data obtained showed the presence of at least one of the viruses investigated in water sources used for public Support:EV168 Instituto - DETECTION Evandro Chagas/SVS/MS. OF NOROVIRUS AND supply, reinforcing the need to a continuous monitoring ADENOVIRUS IN SOURCE WATERS USED FOR THE of viruses in these places. Keywords: norovirus, human SUPPLY OF BELÉM CITY, PARÁ STATE, BRAZIL adenovirus, gastroenteritis, aquatic environments. Corrêa, M.O.; Teixeira, D.M., Smith, V.C.; Aranha, D.C.P.; Virgolino, L.M.S., Morais, L.L.C.S., Gabbay, Y.B. Fapespa. Financial Support: Instituto Evandro Chagas-IEC, PIBIC/ INSTITUTO EVANDRO CHAGAS EV190 - POTENTIAL VIRAL INDICATORS USED TO The detection of enteric viruses in aquatic environments EVALUATE THE CONTAMINATION OF RECLAIMED has become frequent. Norovirus (NoV) are responsible WATER FROM SÃO PAULO, BRAZIL for major viral gastroenteritis outbreaks normally Prado, T.; Barbosa, M.R.F.; Garcia, S.C.; Bonanno, V.M.; associated with the consumption of contaminated food Hachich, E.M.; Sato, M.I.Z. and water. Human adenoviruses (HAdV) are also related to gastroenteritis cases in childhood. This study was COMPANHIA AMBIENTAL DO ESTADO DE SÃO conducted in the metropolitan area of Belém, Pará, where PAULO is located the Utinga Environmental Park, consisting Water reclamation and reuse have almost become of two water fountains and a water treatment plant necessary for conserving and extending available (WTP) – ETA Bolonha. The water sources denominated water supplies in many communities. São Paulo State Bolonha and Água Preta lakes maintain their levels due to uptake by four bombs planted by the Pará Sanitation Company (COSANPA) in the shores of the Guama River. Duehas severalto increased projects production to reuse effluentsof reuse water,as alternative reclaimed to This treatment Park is responsible for 65% of the watermitigate quality effects criteria of hidric should stress be verified established. in the Adenovirus last years. water consumed in Belém. Two liters of water samples (HAdV) and Polyomavirus (JCPyV) are considered good were collected once a month from November 2010 to viral indicators to evaluate contamination in several December 2013 from each of these three points and environmental matrices. However, bacteriophages concentrated by adsorption-elution method using a that infect Bacteroides, as GB-124 phages, have been promising in Microbial Source Tracking (MST) studies The RNA extracted by silica method was submitted to reversefiltering transcription membrane, resulting to obtain ain cDNA. a final For volume NoV detection, of 2 mL. have large distribution in municipal wastewaters and a nested and semi nested PCR were carried out for GI theirsince analysis they are are specific simple indicators and of low of humancosts. Therefore, pollution, the aim of this study is evaluate viral contamination respectively. The HAdV was detected by nested PCR, using in reclaimed water from São Paulo city using potential (COG1F/G1SKR) and GII (COG2F/G2SKR) genogroups, viral indicators: HAdV, JCPyV and GB-124 phages. Four theOctober primers 2015 Volume Hex1Deg/Hex2Deg 20 – Supplement and1 - Abstracts/Posters Hex3Deg/Hex4Deg - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
96 Environmental Virology: EV municipal WWTPs of São Paulo employing active sludge good indicators of environmental contamination due as secondary treatment and different tertiary treatments to its resistance both on the environment and in the gastrointestinal tract. Transmitted in fecal-oral form, are and disinfection) were chosen for this study. Forty liters excreted in large amounts in the humans feces, can deposit (40L)(sand-anthracite of water were and membranecollected monthly filters, reversein each osmosis WWTP, in the environment affecting the quality of the water and system and reconcentrated using Celite®. Viral detection risk to human health. Causers of gastroenteritis affecting wasconcentrated performed through by Real-Time of hollow-fiber PCR assay ultrafiltration (qPCR) and mainlythe soil/sediment children becoming through a untreatedpublic health sewage problem. bringing Rio double agar layer technique for GB-124 phages. dos Sinos watershed includes 32 municipalities and According to preliminar results (April, May, June 2015), corresponds to 1.5% of the territory of the State of Rio Grande do Sul, greater population density in urban areas mainly in its lower region, where is the 4 streams HigherHAdV and contamination JCPyV were detected levels havein 75% been (6/8) observed of the total in tributaries in the dissemination of microorganisms in Rio samples from analyzed WWTP and that GB-124 employs phages only sand-anthracite in 25% (2/8). 6 and 2 x 106 genome viral particles present in the environment or in the water bodydos Sinos. by sewage The soil/sediment disposal loaded has throughcapacity theaccommodate streams of filter and chlorination (1,4 x 10 study and through the phenomenon of a adsorption- copies - GC/L for HAdV and JCPyV, respectively, and 5,0 desorption, the viral particles can percolate and reach withUFP/100 membrane mL for bioreactors GB-124 phages). (MBR) and Lower reverse frequency osmosis. of groundwater. In turn, the hydric transmission contributes Resultsdetection suggesting has been that verified virus removal in WWTP is a which concern operates due to their small size and resistance to disinfection processes. drinking water, being the Rio dos Sinos responsible for Other disinfection processes are recommended if the thesignificantly water supply to the of spread the population. of viral particles In this work,reaching aimed the reuse is more restrict, as potable reuse or irrigated crops. at molecular detection of RV in the environment, were HAdV and JCPyV were detected in higher rates when analyzed 102 water samples and 102 sediment samples compared with GB-124 phages, but further analysis Velha and Portão municipalities), Schmidt (Campo genomes detected. It’s expected that this study will be Bom),from 4 Pampa urban andstreams, Luiz Rau Estância (Novo Velha/Portão Hamburgo), belonging(Estância usefulwill be to performed support future to confirm guidance the on infectivity water regulations of viral to the Rio dos Sinos watershed, performed six bimonthly in the country. Financial Support: Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) – Processo 17 different points between the streams mentioned above.collections For viral (September/13 analysis was to performed July/14) distributedthe extraction in São Paulo (CETESB). of RNA from samples, followed by the cDNA synthesis No 2013/26586-1 e Companhia Ambiental do Estado de by reverse transcription. Viral detection was performed EV194 - MOLECULAR COMPARISON OF ROTAVIRUS IN by quantitative polymerase chain reaction (qPCR). Was SEDIMENT AND WATER SAMPLES IN URBAN STREAMS detected RV in both matrices, 11.7% in water and 24.5% AND THEIR ASSOCIATION WITH ENVIRONMENTAL in sediments. The results prove the ability of these QUALITY FROM RIO DOS SINOS WATERSHED, RS microorganisms remain in the sediment for adsorption- Heck, T.M.S.; Staggemeier, R.; Ritzel, R.G.F.; desorption phenomena, affecting water quality and Andriguetti, N.B.; Oliveira, F.C.; Jesus, L.F.; Luz, R.B.; suggest a fecal contamination of human origin in the Fabres, R.B.; Demoliner, M.; Soliman, M.C.; Gularte, streams, making the man susceptible to acute diarrheal J.S.; Heldt, F.H.; Girardi,V.; Manfro, I.D.; Spilki, F.R.; diseases or other further fecal-oral transmission, which Almeida, S.E.M. shows the importance of effective monitoring of the UNIVERSIDADE FEEVALE environmental quality. Financial Support: CAPES, CNPq, FAPERGS, FEEVALE. Rotaviruses (RV) are enteric viruses belong to the family Reoviridae have RNA genome (double strand), non-enveloped, present in humans and are considered
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
97 Environmental Virology: EV
EV198 - NEW BRAZILIAN GIANT VIRUSES ISOLATION EV215 - DETECTION AND GENOTYPING OF FROM ENVIRONMENTAL SAMPLES USING A PANEL NOROVIRUS IN RECREATIONAL WATER FROM OF PROTOZOA MOSQUEIRO ISLAND, BELÉM, PARÁ STATE, BRAZIL Dornas, F.P.; Khalil, J.B.; Pagnier, I.; Raoult, D.; Deus, D.R.; Teixeira, D.M.; Smith, V.C.; Santos, D.S.A.; Abrahao, J.; La Scola, B. Alves, J.C.S.; Morais, L.L.C.S.; Gabbay, Y.B. 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 1. UNIVERSIDADE DO ESTADO DO PARÁ 2. AIX MARSEILLE UNIVERSITE 2. INSTITUTO EVANDRO CHAGAS The viruses from the proposed order Megavirales have Recreational water must accompany important quality been described infecting eukaryotes hosts from different requirements (monitoring and management), because taxa. For most of them, the natural host is unknown. of possible implications to user’s health. In Brazil, Several methods have been used to detect these viruses, current legislation uses bacteria such as Escherichia with large discrepancies between molecular methods coli, enterococci and fecal coliform as quality indicator. and co-cultures. To isolate giant viruses, we propose the However, the importance of water as a transmission route use of different amoeba species as a cellular support. for viral pathogens, including the noroviruses (NoV), The aim of this work was to isolate new Brazilian giant has been demonstrated in recreational environments viruses by comparing the protozoans Acanthamoeba such as swimming pools, lakes, rivers or oceans where castellanii, A. polyphaga, A. griffini and Vermamoeba activities are developed allowing accidental ingestion of vermiformis as a platform for cellular isolation using contaminated water. There are few studies involving NoV environmental samples. A hundred samples, including in Brazil’s beaches. This research aimed to investigate the sewage, sludge, water, wet soil and lake sediment were circulation of genogroups (G) I and II of NoV in bathing collected at 3 different areas in September 2014 from water samples, collected from four estuarine beaches Pampulha’s lagoon in Belo Horizonte city, Minas Gerais, (Farol, Murubira, Areião e Paraíso) located at Mosqueiro Brazil. Real time systems and PCRs were used to identify island in the Metropolitan Region of Belém, Pará, during the isolated viruses as well hemacolor staining, labelling the period of January 2012 to December 2014. The water samples (two liters) were concentrated by adsorption- viruses were isolated, belonging to lineage A, B and C withfluorescence ratios of and79.73%, electron 1.45% microscopy. and 4.35% A respectively. total of 69 extracted by the silica method and subjected to semi- One Marseillevirus and one Pandoravirus were also elution technique on filtering membrane. Viral RNA was isolated. Among correlations between the three collected point, area 1 had a low positivity of 8.7%, followed nested RT-PCR, with the first step using the primers pair by 44.93% from area 2 and 46.38% from area 3. The GII,JV13I/JV12Y respectively. and Ofin thethe second156 samples stage thecollected, pair JV13I/GI 31.4% highest ratio of isolation was found in Acanthamoeba and JV12Y/NoroII-R for the specific detection of GI and polyphaga (46.38%) and the lowest in Vermamoeba vermiformis (0%). Mimiviruses were the most frequently (49/156) were positive for NoV, which 61.2% (30/49) isolated. With Brazilian environmental samples, we were classified as GI, 34.7% (17/49) as GII and 4.1% demonstrated the high rate of lineage A Mimiviruses (2/49) as GI+GII. GI NoV was detected more frequently previously suggested as well new giant viruses species (65.3% - 32/49) than GII (38.8% - 19/49). These never isolated in Brazilian samples. This work supports observedpathogens on have the beenParaíso identified beach. Thisin all virus analyzed was detectedbeaches, how these viruses survive and circulate in nature as inwith almost the highest all the percentage months, whereasof positivity in (38.5%April 2012 - 15/39) and well the differences between protozoans as a platform 2013 and in May 2013 there was presence in all studied for cellular isolation. Financial Support: CAPES, CNPq,
lowbeaches. tide, Inhowever relation no to thestatistical level of relationship the tide 34.8% was (32/92) found FAPEMIG and URMITE/CNRS. betweenwere positive the NoV-positivity for NoV in high and andlevels 26.6% of tide (17/64) (p = 0.7). in These results highlight the importance of including virologic parameters concurrently to bacteriological October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
98 Environmental Virology: EV analyzes to improve the assessment of water quality. Financial Support: CNPq, FAPERGS, UNIVERSIDADE Keywords: Beach, Norovirus, RT-PCR, Semi-nested, FEEVALE, CAPES.
EV236 - ADENOVIRUS ASSESSMENT IN THE WATERS Water.EV235 Financial - DETECTION Support: OF CAPES/UEPA; ENTEROVIRUS IEC. IN WATER FROM RIO TRAMANDAÍ WATERSHED, RS FROMSTREAMS IN URBAN AREAS FROM RIO DOS Ritzel, R.G.F.; Staggemeier, R.; Heck, T.M.S.; SINOS WATERSHED Andriguetti, N.B.; Oliveira, F.C.; Manfro I.D.; Luz, R.B.; Ritzel, R.G.F.; Staggemeier, R.; Heck, T.M.S.; Bianchi E.; Spilki, F.R.; Almeida, S.E.M. Andriguetti, N.B.; Oliveira, F.C.; Manfro I.D.; Gularte UNIVERSIDADE FEEVALE J.S.; Luz, R.B.; Ruskowski L.; Girardi, V.; Heldt, F.H.; Jesus L.F.; Demoliner M.; Soliman M.C.; Spilki, F.R.; Enteric viruses are important causes of disease Almeida, S.E.M. in humans; they are characterized by being in the human gastrointestinal tract, where viral replication UNIVERSIDADE FEEVALE occurs. The contamination route is fecal-oral and Enteric viruses are usually found in water contaminated by affects immunocompromised individuals. Among the the disposal of untreated sewage. They are characterized enteric viruses, adenoviruses have the genome DNA, by being present in the human gastrointestinal tract, non-enveloped, are extremely resilient in the current where viral replication occurs. The contamination is environment and are resistant to the usual water fecal -oral route and occurs in immunocompromised treatments. These microorganisms are considered good biological indicators of environmental quality. viruses; their physicochemical properties allow water to The present study is to evaluate the environmental remainindividual. viable Enteroviruses in the environment are classified for extended as periods enteric contamination of fecal origin for human Adenovirus of time, presenting resistance to the usual methods of (HAdV) in water samples from the Rio Tramandaí water treatment. These microorganisms are considered Watershed in state of the Rio Grande do Sul, Brazil. good biological indicators of environmental quality. This Twenty samples were collected in the period of two study aims to evaluate the environmental contamination of fecal origin by detection of EV in water samples from ponds in 10 different points, located in the municipalities urban streams from Rio dos Sinos Watershed. One of:months Três (December/2013Cachoeiras (Lagoa and de January/2014) Itapeva), Capão from 10da hundred and two water samples from four streams were Canoa (Lagoa dos Quadros), Osório (Lagoa do Passo), collected at 17 different points in the municipalities of Tramandaí (Lagoa do Tramandaí), Tramandaí (Lagoa do Campo Bom (Stream Schmidt), Novo Hamburgo (Stream Gentil), Cidreira (Lagoa da Fortaleza), Cidreira (Lagoa da Luis Rau and Stream Pampa), Estancia Velha and Portão Cidreira), divisa de Cidreira e Balneário Pinhal (Lagoa Rondinha), Mostarda (Lagoa do Bacupari) e Maquiné (Balneário Maquiné). The method used for concentration For(Stream the analysis, Estancia the Velha concentration / Portão). method The samplesby adsorption were collected bimonthly (September / 2013 to July / 2014). membrane, after was performed the extraction of viral subsequent Viral DNA was extracted by kit commercial, DNAof water by a wascommercial by adsorption kit, viral / detection elution withwas obtained negative followed/ elution for was cDNA performed using the with kit negativeHigh Capacity membrane, cDNA by quantitative polymerase chain reaction (qPCR). Of the reverse Transcription and viral detection is obtained 20 water samples, 60 % were positive (HAdV) for each by quantitative polymerase chain reaction (qPCR). The streams that had a greater number of samples with positive results were, respectively, stream Schmidt 42% sampling month, equivalent to 60 % of the final results onevaluated. the Rio Thus, Tramandaí there was watershed. significant Financial contamination Support: in CNPq,the lakes FAPERGS, analyzed UNIVERSIDADE presenting a significant FEEVALE, human CAPES. impact (10/24) and stream Luis Rau 38% (9/24) followed contaminationthe stream Estancia in streams Velha / Portãoanalyzed 26% presenting (8/30) and a Pampa stream 17% (4/24). Thus, there was significant significantOctober 2015 anthropic Volume 20 –impact Supplement on Rio 1 - Abstracts/Postersdos Sinos watershed. - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
99 Environmental Virology: EV
EV269 - PRESENCE OF HUMAN ADENOVIRUSES AND SOMATIC COLIPHAGE IN WATER AND SEDIMENTS IN PERI LAGOON, SANTA CATARINA, BRAZIL found between HAdV quantified by real-time PCR and culturable coliphages. Financial Support: CNPq/TWAS Elmahdy, M.E.I.; Fongaro, G.; Magri, M.E.; Petruccio, andEV302 CNPq - Universal DETECTION 470808/2009-8. OF ENTEROVIRUS AND M.M.; Barardi, C.R.M. ROTAVIRUS IN RECREATIONAL WATER SAMPLES UNIVERSIDADE FEDERAL DA SANTA CATARINA IN MOSQUEIRO ISLAND, METROPLITAN REGION OF Due to increasing numbers and diversity of water BELEM, PARÁ, BRAZIL Alves, J.C.S.; Teixeira, D.M.; Wanzeller, A.L.M.; Santos, and quantify all the potential microbial agents A.S.; Oliveira, D.S.; Deus, D.R.; Morais, L.L.C.S.; Smith, incontamination contaminated sources, water. it Detection is difficult of to microbial identify V.C.; Santos, D.S.A.S.; Monteiro, J.C.; Soares, L.S.; indicators serves as a simple diagnostic tool to predict Mascarenhas, J.D.P.; Tavares, F.N.; Gabbay, Y.B. microbiological water quality with respect to pathogen EVANDRO CHAGAS INSTITUTE presence and densities and human health risks. Currently, total coliforms, fecal coliforms, enterococcus Human enteric viruses are major causes of waterborne diseases. These agents are present in large amounts in spp., and E. coli are used as microbial indicators for predicting water pollution. Compared to bacterial the stools of infected individuals. They remain viable indicators, enteric viruses have shown higher survival and infective for months in the environment and may rates during wastewater and drinking water treatment contaminate the water used for consumption and and greater persistence in environmental waters. human recreation. The monitoring is required, since Several studies indicate that bacteriophages could serve water quality do not have any correlation with viral as viral indicator for estimating human enteric viruses bacteriological indicators/standards used to verify the in water. This study aimed to quantify HAdV and somatic contamination. In addition, some pathogens transmitted coliphage either in waters or sediment samples at Peri by water are fastidious, such as Enterovirus (EV) and Lagoon, Florianopolis city. With the aim to predict the Rotavirus (RV). The purpose of this study was to detect EV seasonal occurrence of these viruses, 84 water samples and RV in surface water samples from four recreational (2L) and 48 sediment samples (20g) were collected beaches (Paraiso, Murubira, Farol and Areião) located monthly at Peri Lagoon, during one whole year (2014), in Mosqueiro Island, Belém, Brazil. Water samples with a sum of 132 samples. The analysis of coliphages in were collected monthly in the period of January 2012 water and sediment samples was performed according to December 2013, with exception of July, due to school to ISO 10705-2. For HAdV detection, water samples vacation. Collections were made fortnightly. Two liters were concentrated by negatively charged membranes of water were obtained from each site and concentrated using glycine buffer followed by polyethylene glycol and sediment samples were concentrated and clarified ofby 2adsorption-elution mL. RNA was obtained method using using the filtering silica membrane,extraction. (PEG) precipitation. HAdV genome copies (gc) were followed by centrifugation to obtain a final volume assayed by direct qPCR. Infectious somatic coliphages The semi-nested PCR with primers P2, P3 and P10 in collected water samples and sediment respectively. were detected in 42.8% (36/84) and 18.75% (9/48) for EV, and Nested PCR using oligonucleotides VP6F/ VP6R and VP6NF/VP6NR for RV were employed. Of the water samples ranging from 2.87 × 107 to 1.69 × 106 gc Regarding HAdV gc, 64.3% (54/84) were positive in the predominance102 samples analyzed of EV and 16.7% RV positivity (17/102) in July were in positivethe two for EV and 31.4% (32/102) for RV. It was observed a positive ranging from 1× 108 to 6.14 × 106 gc per liter. years of study, coinciding with the school holidays. These Inper our liter. study, For somatic sediment coliphage samples, proved 47.9% to (23/48) be prevalent were beaches are contaminated through sewage galleries that during the winter and spring seasons along one year with its contamination, and, consequently, exposing of collection and it was completely absent during the flow directly in these recreational waters, contributing summer season while HAdV was detected along one year people who use these places, mainly susceptible children. Methods with high sensitivity for detection of
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV of collection. However, no significant correlations were XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
100 Environmental Virology: EV enteric viruses in the aquatic environment is of great four genes based on APMV genome: methionyl, tyrosyl, cysteinyl and arginyl tRNA synthetases to evaluate the recovery in environmental samples. These viruses are of relevanceimportance, in particularlyterms of public to increase and environmental the efficiency ofhealth, viral Genomic data showed that Niemeyer harbors duplicated as they have an enormous potential for its prolonged copiesprofile of expression3 of its 4 aaRS of NYMV genes in (cysteinyl, comparison methionyl with APMV. and maintaining into the environment. tyrosyl RS). Gene expression analysis showed that such
EV319 - NIEMEYER VIRUS: A NEW GIANT VIRUS of methionyl and tyrosyl aaRS mRNA by Niemeyer in HARBORING A SET OF DUPLICATED AMINOACYL- comparisonduplications allowedto APMV. a significantRemarkably, increased phylogenetic expression data TRNA SYNTHETASES revealed that Niemeyer duplicated genes are different Arantes, T.S.; Boratto, P.V.M.; Silva, L.C.F.; Assis, F.L.; between them, clustering each one with a different Colson, P.; La Scola, B.; Kroon, E.G.; Abrahão, J.S. group of mimivirus strains. Taken together, our results 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS raise new questions about the origins and selective 2. AIX MARSEILLE UNIVERSITE pressures involving events of aaRS gain and loss among mimiviruses. Keywords: Enterovirus, Rotavirus, surface water, beaches, PCR. Financial Support: Evandro Chagas Mimiviridae, Acanthamoeba polyphaga mimivirus Institute-IEC (Secretary of Surveillance in Health, (APMV),Since the in discovery 2003, several of the firstmimivirus-like member of viruses family Brazilian Ministry of Health); Program of Post Graduation have been isolated from phagotrophic protists. in Virology (PPGV,IEC); CAPES. APMV presenting about 1.2 megabases (Mb), and approximately 1000 hypothetical proteins, many of them EV324 - DETECTION OF ANIMAL ADENOVIRUS IN WATER AND SEDIMENT FROM STREAMS FROM RIO seen before in other viruses. Among the most predicted DOS SINOS WATERSHED IN SOUTHERN BRAZIL still uncharacterized or having functions never/rarely proteins the genome of mimiviruses, it is worth highlight Oliveira, F.C.; Staggemeier, R.; Heck, T.M.S.; those related to DNA repair, translation machinery, Andriguetti, N.B.; Ritzel, R.G.F.; Jesus, L.F.; Gularte, besides chaperones related to DNA processing, genes that J.S.; Heldt, F.H.; Luz, R.B.; Fabres, R.B.; Soliman, M.C.; encode to translation-related proteins, such as aminoacyl Spilki, F.R.; Almeida, S.E.M. tRNA sinthetases (aaRS) and translation factors. Gene UNIVERSIDADE FEEVALE evolution, being directly related to the emergence of new The precariousness of sewage systems, industrial geneticduplication/acquisition variants. In this work is a keywe describe factor for the molecular isolation and characterization of Niemeyer virus (NYMV), a new soil and water. With the expanded population areas mimivirus isolate obtained from water samples of an theseeffluents problems and domestic tend to increase. compromises Enteric the viruses quality are ofa urban lake in Brazil. After the isolation, the genome of heterogeneous group of viral agents associated with NYMV sequenced by the Illumina MiSeq instrument subclinical infections and diseases in animals, such as (Illumina Inc., San Diego, Calif., USA) with the paired- Bovine adenovirus (BAV), Canine Adenovirus (CAV), end application. The sequenced reads were imported to Avian Adenovirus (AvAdV) and Porcine Adenovirus CLC_Bio software and assembled into contigs by de novo (PoAdV). The above agents are characterized by method. The prediction of open reading frame (ORF) their stability, both in the gastrointestinal tract as in sequences was carried out using the FgenesV tool. The the environment, are excreted through the feces of paralog groups of genes were predicted by OrthoMCL animals can resist contaminants such as soil and water program. The ORFs were functionally annotated by for long periods of time, furthermore, it is suggested using similarity analyzes against sequences at NCBI that such viruses are important indicators of fecal database using BLAST tools. In addition, the presence of landmark genes of family Mimiviridae was evaluated, of these animals on the quality of water and soil from and some of them were analyzed in deep. Aiming to contamination. This study investigated the influence check the expression of aaRS by NYMV, we selected Portão cities), Schmidt (Campo Bom city), Pampa and the streams EstânciaVelha/Portão (EstânciaVelha and October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
101 Environmental Virology: EV
Luiz Rau (Novo Hamburgo city), municipalities of Rio are recipients of large amounts of urban sewage (mostly dos Sinos Watershed, State of Rio Grande do Sul. The without any treatments). Among the enteric viruses, study aims to detect CAV, AvAdV, PoAdV and BAV. A total human adenoviruses (HAdV) have been the focus of 102 water samples and 102 sediment samples were of many studies, because of their persistence in the collected bimonthly from September 2013 to July 2014 environment and their great impact on public health. in 17 points of the streams mentioned above. Water HAdV are excreted in high densities in human feces and samples were concentrated to isolate the viral genome has been found in various environmental matrices. The integrated cell culture-quantitative PCR (ICC-qPCR) assay has been developed for the detection of virus E-MEMwith a (pH membrane 11,5). Viral filtration extraction system was performed with negatively using acharged. commercial Sediment kit following samples manufacturer’s were eluted 10%instructions v./v. in approach in detecting infective viruses by combining cell cultureavailability. and ICC-qPCRmolecular provides techniques. an efficient The main and goal sensitive of this reaction in real time). The results show that 38.24% study was to assess the viral viability of HAdV by ICC- and amplification of DNA by qPCR (polymerase chain Portão (EstânciaVelha and Portão cities), Schmidt in(39/102) soil. Regarding of all samples the streams showed individually, contamination the following with at (CampoqPCR in Bomwater city), samples Pampa from and the Luiz streams Rau (Novo EstânciaVelha/ Hamburgo resultsleast one were type offound virus (%in waterfor waterand 44.12% and (45/102)sediment city). In total, 102 water samples (500 ml each) from 17 different sampling points, at were collected bimonthly (10% and 20%), CAV (26.67% and 10%), AvAdV (6, 67% andrespectively): the absence Estância of sediment) Velha/Portão and PoAdV were detected (6.67% BAVand concentrated by the negatively charged membrane 20%). In Luis Rau was detected BAV (4.17% in water method,from September/2013 this concentrated to July/14. was Waterdiluted samples 1:2 (non-were and soil), CAV (29.17% and 45.83%), AvAdV (8.33% citotoxic concentration) and inoculated in A549 cells and no sediment), PoAdV (4.17% and 8.33%). In Pampa for the ICC-qPCR assay. After 1 h of incubation at 37°C was detected BAV (8.33% and 25%), CAV (29.17% with rotation every 15 min, the inoculum was removed and 12.5%), AvAdV (8.33% and 4.17%), PoAdV (16,67 and the cell layers were overlaid with high-glucose and 12% , 5%). In Schmidt detected BAV (8.33% and 12.5%), CAV (20.83% and 29.17%), AvAdV (8.33% and incubated at 37ºC for 5 days. Samples were passaged in no sediment), PoAdV (absence of water and 12,5%). The A549Dulbecco’s cells 3Modified times, 5 Eagle’s days each, Medium(DMEM) and the cell monolayers after being results demonstrate fecal contamination from animals were after tested for the presence of adenoviral DNA. in the water and sediments of these streams. Financial Viral extraction was performed using a commercial kit Support: CAPES, FAPERGS, CNPq, PROJETO MAIS ÁGUA, following manufacturer’s instructions. Virus detection UNIVERSIDADE FEEVALE. was performed by qPCR using primers that targeted a conserved region (hexon) of the virus genome. In total, EV236 - DETECTION OF INFECTIOUS ADENOVIRUSES IN WATERS OF STREAMS FROM URBAN AREAS IN positive samples were found in the stream Schmidt, 6 THE RIO DOS SINOS WATERSHED 19.6% (20/102) of the samples had infectious HAdV: 8 Staggemeier, R.; Heck, T.M.S.; Andriguetti, N.B.; Ritzel, The presence of infectious virus shows risk to public R.G.F.; Oliveira, F.C.; Jesus, L.F.; Gularte, J.S.; Heldt, healthin Estância since Velha/Portão, these streams 5 hasin Luiz its mouth Rau and in 1the in RioPampa. dos F.H.; Luz, R.B.; Fabres, R.B.; Soliman, M.C.; Manfro, Sinos that is used as a source of urban water supply in I.D.; Henzel, A.; Spilki, F.R.; Almeida, S.E.M. the region. Furthermore, the presence of such enteric UNIVERSIDADE FEEVALE viruses suggests fecal contamination in water bodies in The increased population density in urban areas is often
The 4 streams targets of this work are situated in this highlyreflected urbanized in a higher and contaminationindustrialized region,of water from resources. the Rio dos Sinos watershed, southern Brazil. These streams
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
102 Environmental Virology: EV the region. Financial Support: CAPES, FAPERGS, CNPq, The logistic regression analysis showed no association PROJETO MAIS ÁGUA, UNIVERSIDADE FEEVALE. between the presence of HAV and physical-chemical and bacteriological parameters of environmental samples. EV347 - GENOTYPES OF THE HEPATOVIRUS A IN The mean values of OD were below the minimum DIFFERENT AQUATIC ECOSYSTEMS FROM BELÉM, PARÁ, BRAZIL demonstrated the co-circulation of subgenotypes IA and Gurjão, T.C.M.; Santos, D.S.A.S.; Garza, D.R.; Teixeira, IBlimit in this of 4 region, mg / L-1providing O2 established additional by information law. The results on the D.M.; Sousa, N.R.; Smith, V.C.; Vale, E.R.; Mascarenhas, molecular epidemiology of HAV in Brazil, as well as, the J.D.P.; Gabbay, Y.B.; De Paula, V.S.; Loureiro, E.C.B.; high degree of microbiological contamination of aquatic Morais, L.L.C.S. ecosystems of the city of Belém, PA, Brazil. Financial 1. UNIVERSIDADE FEDERAL DO PARÁ 2. INSTITUTO EVANDRO CHAGAS Support:EV354 - THECNPq, RELATIONSHIP IEC/SVS/MS. BETWEEN HEPATITIS A Hepatovirus A (formerly named Hepatitis A virus) (HAV) VIRUS (HAV) AND WATER QUALITY INDICATORS IN is a major cause of acute viral hepatitis worldwide. THE PUBLIC WATER SUPPLY OF THE CITY OF BELEM, There is little data on circulating HAV genotypes in the PARA, BRAZIL Amazon region and in the state of Pará a limited number Aranha, D.C.P.; Santos, D.S.A.S.; Sousa, N.R.; Valle, E.R.; of strains were characterized the genomic level. This Corrêa, M.O.; Carneiro, B.S.; Garza, D.R.; Gabbay, Y.B.; study aimed to determine HAV genotypes circulating Marais, L.L.C.S. in aquatic environments of the city of Bethlehem and its relationship to the bacteriological and physical 1. INSTITUTO EVANDRO CHAGAS/ SEÇÃO DE parameters of water. Between 2009 and 2010, 2L water MEIO AMBIENTE and sewage were collected monthly in the Bay of Guajará, 2. INSTITUTO EVANDRO CHAGAS/ SEÇÃO DE VIROLOGIA river Guama, Tucunduba stream and EEA-UNA. The concentration of virus was performed by the method HAV infection is the most common worldwide cause of adsorption-elution electronegative membranes, of acute viral hepatitis and is closely related to underdeveloped economies, lack of clean water, and poor Ultra-15. Viral RNA was detected by PCR preceded by sanitation. Brazil, especially the North and Northeastern reversefollowed transcription by reconcentration and the by ultrafiltrationpositive products in Amicon were regions, is endemic for hepatitis A. The aim of this study was to evaluate water quality and the occurrence of HAV of fecal coliforms and E. coli, as well as the pH, water temperature,subjected to nucleotideturbidity, electrical sequencing. conductivity, The quantification dissolved human consumption in Belem, capital of Para, including oxygen (DO), total dissolved solids, salinity, total thein the output major of sourcesthe Water of Treatment superficial Plant water (WTP). supplied From for suspended solids were also determined. The HAV RNA January 2012 to December 2014, a total of 108 water was detected in 44% of samples and genotyping showed samples from Lake Bologna (n = 36); Agua Preta that all belonged to genotype I, with co-movement of lake (n = 36); and the WTP output, ETA (n = 36) were subgenotypes IA and IB, 37 (95%) of them belonging to IA and 2 subgenotypes (5%) by subgenotypes IB, following bacteriological indicators was performed using the IDEXX the pattern of HAV distribution in the country. Strains kitmonthly Colilert collected ©. The concentration and analyzed. of Thewater quantification samples for the of of subgenotype IA had higher diversity compared to IB. detection of HAV was based on the method of adsorption The high similarity with Brazilian sequences highlights the endemic circulation of HAV strains in Brazil. The kit QIAamp Viral RNA Kit (QIAGEN) was used to extract sequences obtained showed, in general, a high level of viraland elution RNA, followed with a filtering by reverse membrane. transcription The commercial and nested conservation. Concentrations of fecal coliforms and E. PCR. E.coli density, among the lakes of bologna and Agua coli ranged from 4.10 x 103 to 6.49 x 106 and 2.00 x 103 the most contaminated (p = 0.0001). HAV was detected Preta was significantly different, with the Bologna being to 5.79 x 106 MPN / 100 mL, respectively, surpassing everyOctober month 2015 Volume the limits 20 – Supplement set by CONAMA 1 - Abstracts/Posters 357/05, Class - Environmental 2. in 43% Virology: (40/93) EV of the opportunities. Lake Agua Preta XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
103 Environmental Virology: EV
São Caetano de Odivelas and Tracuateua) totaling 19 pools compounds of 20 samples every. The sample exhibited more positive samples (40%, 16/40), followed were suspended in buffer Tris-Ca++ 0,01M pH 7.2, then Theby the bacteriological Bologna (27%, examination 11/40), and of the ETA ETA (33%, output 13/40), was the extraction of viral nucleic acid and subjected to systematicallyhowever, this difference negative, washowever, not significant HAV was (p detected = 0.4345). in qPCR in order to detect RV groups A-H. Results: Of the viral particles remained in the water that would be distributed41.93% (13/31) to the population of the opportunities, after treatment. suggesting The results that for19 the pools other analyzed, groups 26.31%investigated. (5/19) The were positive positive samples for point to environmental degradation of surface water wererotavirus collected group from A, notthree being of the observed six collection amplifications points in sources, which supply water to 65% of the population of Belem and corroborate previous results that show the were originally imported from the municipalities of lack of correlation between bacteriological indicators Augustoa total of Corrêa,50% (3/6). São RegardingCaetano de origin, Odivelas, positive Marapanim, samples and the presence of viruses in drinking water. These results draw attention to the need of reviewing existing localities presenting contamination by rotavirus group legislation, as well as indicating the risks to public health Bragança and Maracanã, with 55.5% (5/9) of producing of the spread and endemicity of hepatitis A in the region. in the detection of rotavirus group A. The observed Keywords: Hepatitis A Virus; Water Quality; Public Water prevalenceA. Conclusion: of rotavirus The qPCR was technique high in used the wasinvestigated efficient
Supply.EV357 Financial - IDENTIFICATION Support: FAPESPA-PPGV, AND MOLECULARIEC/SVS/MS. samples (26.31% - 5/19), has a direct impact on local CHARACTERIZATION OF ROTAVIRUS IN BIVALVE bivalveproducers mollusks (55.5% marketed - 5/9) andin the collection metropolitan points region (50% MOLLUSKS SOLD IN THE METROPOLITAN REGION OF of- 3/6),Belém, demonstrating Pará, Brazil. the Keywords: need for greaterBivalve controlmollusks; of BELÉM, PARA, BRAZIL Rotavirus; qPCR. Financial Support: Conselho Nacional Alves, C.M.; Barros, B.C.V.; Rocha, D.C.C.; Kanai, Y.K.; Bonfim, M.C.M.S.; Mascarenhas, J.D.P.; Marinho A.N.R. Coordenação de Aperfeiçoamento de Pessoal de Nível de Desenvolvimento Científico e Tecnológico (CNPq), INSTITUTO EVANDRO CHAGAS Superior (CAPES), Fundação de Amparo à Pesquisa do Estado do Pará (FAPESPA), Instituto Evandro Chagas (IEC). the ability to absorb toxins, chemical and biological pollutants.The bivalve Several mollusks outbreaks are filter have organisms been associated that have EV390 - MOLECULAR DETECTION AND VIABILITY with consumption of bivalve mollusks and reported OF THE HUMAN ADENOVIRUS IN THE SOIL SAMPLES worldwide, especially related to the ingestion of raw FROM FOUR STREAMS OF THE RIO DOS SINOS foods such as oysters, with evidence suggesting that WATERSHED, SOUTHERN BRAZIL human enteric viruses such as rotaviruses, present Andriguetti, N.B.; Staggemeier, R.; Heck, T.M.S.; as pathogens most commonly transmitted by these Ritzel, R.G.F.; Gularte, J.S.; Oliveira, F.C.; Heldt, F.H.; mollusks. Rotavirus belongs to the Reoviridae family, Spilki, F.R.; Almeida, S.E.M. genus Rotavirus; and has a segmented nature with a genome that contains 11 segments of double-stranded UNIVERSIDADE FEEVALE RNA (dsRNA). Objective (s): Identify the presence of Pollution of water bodies by animal and human waste rotavirus groups A-H by Quantitative Real Time PCR poses a risk to human health due to the presence of (qPCR) in samples of bivalve mollusks originating viruses and pathogenic bacteria. The ability to detect from breeding the state of Pará and marketed in the infectious viral particles in soil and other environmental metropolitan area of Belém. Material and Methods: In samples is of great importance in predicting public our study the samples were collected at six fairs in the health risks. Soils and sediments under water bodies may metropolitan area of Belém, originally imported nine contain viruses and bacteria on higher loads than those producers municipalities (Augusto Corrêa, Bragança, Curuçá, Maracanã, Marapanim, Primavera, Salinópolis, fecal oral transmission acquired by the consumption of identified in contaminated waters. Among the virus October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
104 Environmental Virology: EV these waters, human adenovirus (HAdV) stand out for viral suspensions or in AdV-positive environmental water being etiological agents of gastroenteritis and possess samples. In order to establish a dose-response curve, greater resistance to the environment because it is a HAdV-5 was inoculated onto A549 cell line, at 10-5, 10-4, non- enveloped viruses. The aim of this study was to 10-3, 10-2, 10-1, 1 and 2 m.o.i. (multiplicity of infection). evaluate the presence of infectious virus in samples of In other assay, cells were exposed to environmental sediment in seventeen collection points distributed samples positive for AdV genomes at concentrations in four streams of Rio dos Sinos watershed. Samples ranging from 4.5×103 to 9.8×105 were collected bimonthly during the period September In both experiments mock inoculated cells were the 2013 to July 2014. The streams analyzed are located negative control. At 6 and 30 hours post genomic infection copies/L. (h.p.i.), in the cities of Campo Bom (Stream Schmidt), Novo total RNA was extracted, followed by DNAse treatment Hamburgo (Stream Luis Rau and Pampa), Estância Velha and cDNA synthesis. Quantitative real time PCR (qPCR) was performed using primers targeting CCNDBP1 and do Rio dos Sinos, Rio Grande do Sul, Brazil. This study DHFR genes. The 18S gene was used as endogenous usedand Portão quantitative (Stream polymerase Estância Velha/Portão),chain reaction in(qPCR) the Vale for control. Comparative threshold cycle method was used the detection of HAdV and the Integrated Cell Culture- to quantify changes in gene expression in exposed qPCR (ICC-qPCR) for demonstration of the occurrence of groups compared to negative control, expressed as fold infectious HAdV in soil samples. From a total of 102 soil differences (FD). In order to quantify HAdV-5 present in samples were obtained by month: September 2013 82% exposed group, qPCR was performed using primers that amplify AdV hexon protein gene. Increased expression was noticed for CCNDBP1 gene at 6 h.p.i. in 10-1 m.o.i. (14/17), November 2013 71% (12/17), January 2014 dilution (2.14 FD) and for DHFR gene at 30 h.p.i. in 82% (14/17), March 2014 82% (14/17), May 2014 29% 10-1, 1 and 2 m.o.i. dilutions (2.96, 3.39 and 3.15 FD, In(5/17) the viability and July 2014study 24% by integrated (4/17) totaling cell culture at the end PCR, of the respectively). Hexon gene transcription was detected in six months 62% (63/102) of samples positive for HAdV. infected group at 6 h.p.i. from 10-2 m.o.i. up to 2 m.o.i. samples positive for HAdV. In conclusion, the presence dilutions (3.17×102 – 2.05×105 ofresults viable confirmed virus in viablesediment HAdV samples in 16 samplesdemonstrates of the the63 at 30 h.p.i. in all dilutions (2.01×102 – 3.09×108 genome importance of analyzing this matrix for environmental genome copies/5µL) and monitoring, besides the public health risk. Financial analyzed were found in cells exposed to environmental Support: CAPES,CNPq, FAPERGS, FEEVALE. watercopies/5µL). samples, No as significantthe presence FD of results AdV wasn’t for the detected genes in these groups, in the periods studied. The results prove EV410 - HUMAN ADENOVIRUS TYPE 5 ALTERS HOST that (1) during an infection, cell gene expression levels GENE EXPRESSION IN A DOSIS-DEPENDENT MANNER depend on the existing HAdV-5 concentration; and that Giehl, I.C.; Albino, S.M.; Rigotto, C.; Paim, I.F.; Spilki, (2) samples positive for AdV genome in concentrations F.R. up to 9.8×105 UNIVERSIDADE FEEVALE expression of the genes analyzed in cells exposed to them. Keywords: genomic HAdV-5 copies/L infection. don’t Environmental impact on Human adenoviruses, such as serotype 5 (HAdV-5), water. Human cell line. Transcription. Financial Support: encode proteins that may disturb cellular mechanisms FEEVALE, CAPES, FAPERGS, CNPq. during infection cycle. A small number of viral gene products can induce substantial reprogramming of EV413 - MUSSELS AS HOT SPOTS TO ISOLATE cell gene expression. Studies evaluating the effect of MARSEILLEVIRUS infectious adenoviral particles on expression of cellular Santos, R.N.; Albuquerque, N.R.M.; Campos, F.S.; Ortiz, genes are frequent. However, none support existence of a L.C.; Roehe,P.M.; Franco, A.C. dose-dependent effect. Therefore, we aimed to evaluate the expression of two cellular genes involved in cell UNIVERSIDADE FEDERAL DO RIO GRANDE DO cycle progression and proliferation, in cells exposed to SUL different concentrations of HAdV-5 present in standard
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
105 Environmental Virology: EV
Giant viruses, like mimiviruses and other large DNA UNIVERSIDADE FEDERAL DO RIO GRANDE DO viruses, have been isolated since 2004 from different SUL environmental sources containing usually (or necessarily) amoebas. Thenceforward, different virus single strand DNA and RNA and can be used to estimate families have been reported, as the Marseilleviridae theA fluorescent abundance dye, of SYBRviruses Gold, in samples interacts without with double the need and family. Until now, researchers have used samples from cooling towers, fresh water samples, soil, larvaes, metagenomics has been used to evaluate the composition contact lens, seawater, human stool, and others as offor virusviral isolation.communities As a morein environmental specific approach, samples. virus Both methods, used in association, can be helpful in oysters were also described as hot spots for the determining the virus content present in a sample sources for the identification of giant viruses. Recently, leaving out the virus isolation step. To determine the these organisms accumulate microorganisms in their viral diversity present in mussels (Limnoperna fortunei identification of such viruses, as during water filtration and Perna perna), we collected these organisms from the and process samples of mussels (Limnoperna fortunei Guaíba Lake in Rio Grande do Sul and marine water from andbody Perna and/or perna) shell. Theobtained objective from of waterthis work collections was to use in Rio Grande do Sul and Santa Catarina, south coast of internal water from these mussels were collected; from Brazil, to recognize mussels as hot spots for the isolation theseSanta 40 Catarina originated coast. from Sixty-five the Guaíba samples Lake consistingand 25 from of of giant viruses. Samples were collected between May the Santa Catarina coast. The samples were processed in pools specimens (separated in water and body), totalizing 65 and November 2014 and prepared in pools of five mussels. Next, these samples were homogenized with paraformaldehyde, of five samples homogenized and purified with by ultracentrifugation SYBR Gold 2x and pbs and centrifuged. supernatants were inoculated onto through a 25% sucrose cushion. Samples were fixed in 1% a monolayer of Acanthamoeba polyphaga cultivated in ultracentrifuged samples were submitted to DNA 24-well microplates with PYG medium supplemented extractionvisualized byusing fluorescent phenol-chloroform microscopy. Simultaneously,method. Viral with antibiotics. Cytopathic effect was observed up to 72 DNA enrichment was performed by random PCR with hours after inoculation. A polymerase chain reaction to a reaction mixture containing Taq polymerase and amplify the DNA polymerase gene in search for probable K-random-s. The second strand DNA was synthesized virus isolates of Marseilleviridae was performed using by Klenow polymerization and submitted to a second the viral DNA extracted from cell supernatants. Seven out of the twenty pools analyzed induced cytopathic were subsequently analyzed on a 1.5% agarose gel. effect on the cell monolayers. From these, six samples Virusround DNAof amplification samples have with been K-s submittedprimers. PCR to theproducts next- were positive at PCR. These products were submitted to generation sequencing in Illumina MiSeq sequencer. The sequencing and one of them showed high homology with sequences will be analyzed in Blast2Go to assess the viral members of the Marseilleviridae. Partial sequencing of diversity. The analysis of SYBR Gold stained samples the viral genome, in addition to the comparative analysis with other genomes of giant viruses, indicate that is indicating the presence of viruses in these samples. probably a new marseillevirus. Next, all isolates will be allowed the visualization of many fluorescent particles, submitted to the complete sequencing of the genome. gels from each sample contained different patterns of a numberThe molecular of DNA fingerprintsfragments, indicating visualized a high on thediversity agarose of be hot spots for the isolation of giant viruses. Financial the viral components in different samples. These results This report shows for the first time that mussels can Support: CNPq, CAPES, FINEP, FAPERGS. indicate that the SYBR Gold staining associated with the EV414 - VIRAL SCREENING BY SYBR GOLD STAINING next-generation sequencing of viral DNA can provide AND METAGENOMIC ANALYSES IN MUSSELS COLLECTED IN THE SOUTH OF BRAZIL from environmental samples. Financial Support: CNPq, CAPES,an efficient FAPERGS, approach FINEP. to identify the virus community Santos, R.N.; Albuquerque, N.R.M.; Campos, F.S.; Finoketti, F.; Ortiz, L.C.; Roehe, P.M.; Franco, A.C. October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Environmental Virology: EV HUMAN VIROLOGY - HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
107 Human Virology: HV
HV9 - DEMETHYLATION PROFILE IN TNF-ALPHA HV13 - PROSPECTIVE STUDY OF CORONAVIRUSES IN PROMOTER GENE ASSOCIATED WITH DENGUE VIRUS SMMAL WILD MAMMALS, IN THE STATE OF MINAS INFECTION GERAIS, BRAZIL Coelho, L.F.L.; Gomes, A.V.B.T.; Morais, S.M.S.; Sacchetto, L.; Mendonça, L.A. de; Miranda, J.B.; Menezes-Filho, S.M.; Ferreira, J.M.S.; Santos, L.L.; Amaral, C.D.; Borges, I.A.; Vieira, F.N.; Ambrósio, Malaquias, L.C.C.; Coelho, L.F.L. L.L.D.; Alves, P.A.; Paglia, A.P.; Trindade, G. de S.; Drumond, B.P. 1. UNIVERSIDADE FEDERAL DE ALFENAS 2. UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL 1. UNIVERSIDADE FEDERAL DE JUIZ DE FORA REI 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS Dengue is the most prevalent arthropod-borne viral illness The emergence of viruses is an important public health in humans and an overexpression of cytokines by Dengue problem worldwide. Some animals including wild virus infected cells is associated with the severe forms mammals, play an important role in the maintenance and of the disease. DNA methylation is characterized by the in the transmission of viruses and can act as hosts and addition of a methyl group in a cytosine within cytosine- natural reservoirs. Coronaviruses belong to the family phosphate-guanine (CpG) islands. Unmethylated islands Coronaviridae. Several viruses belonging to this family are related to transcriptionally active structure, whereas have been described from wild animals. Coronaviruses methylated DNA recruits methyl-binding proteins are viruses that cause respiratory, enteric, hepatic and that promotes chromatin compaction and inhibits the neurological disorders and are widely spread among gene expression. Several studies have been described humans and other mammals. In this context, the aim the importance of epigenetic events in the expression of this work was to perform a prospective study of regulation of many cytokines. The purpose of the coronaviruses in small wild mammals. The capture of present study was to evaluate the methylation status the small mammals was performed on a rural property located in the state of Minas Gerais, from October 2012 to whole blood of dengue infected patients. Methylation- August 2013. The viscera and serum were obtained from of IFN-ϒ and TNF-α promoters in DNA extracted from specimens collected and composed a collection called Col-ECOVIR. For this work, samples of liver, lung and inspecific 40 human polymerase DNAs chain obtained reaction from was useddengue to verify infected the serum of animals were submitted to total RNA extraction patientsDNA methylation and 14 non-infected profile of IFN-ϒ controls. and TNF-α It was promoters observed using RNeasy® Minikit (QIAGEN), followed by cDNA synthesis for detecting the virus of interest. A total of 175 DENV infected patients when compared to non-infected wild mammals were captured. So far, we performed the controls.a high frequency No difference of demethylation was found in inTNF-α the methylationpromoter of real-time PCR (qPCR) in 59 lung samples for coronavirus frequency between the two analyzed groups regarding genome sequences of human coronavirus HCoV-HKU1 andresearch, HCoV-OC43. using primers Of these (HCoV 59 Fsamples, / R HCoV) two that samples targets infectedthe IFN-ϒ individuals. promoter. The Financial present Support: study provides CNPq, the CAPES first originated from rodents, were considered suspects after andassociation UNIFAL-MG. of TNF-α promoter demethylation in DENV the assay. These amplicons will be sequenced in order
of human coronavirus circulation in wild rodents, such animalsto confirm may the be results. developing This ademonstrates role in the maintenance the possibility and emergence of such viruses. In addition, it emphasizes the importance of animal surveillance studies, such as rodents, to understand the movement, maintenance and transmission of these viruses, as well as its emerging potential. Financial Support: FAPEMIG, CNPq, CAPES,
UFJF, PROPESQ/UFJF. October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
108 Human Virology: HV
HV15 - INVESTIGATION OF THREE DENGUE HV16 - INVESTIGATION OF HUMAN SNPS RELATED ASSOCIATED RISK/PROTECTIVE SNPS IN A TO THE PREDISPOSITION FOR SEVERE FORMS OF POPULATION OF MINAS GERAIS, SOUTHEASTERN DENGUE IN PATIENTS FROM JUIZ DE FORA, MG BRAZIL Penido, B.; Siqueira, T.R.; Mendonça, L.A.; Penido, B.; Prado, A.A.O.; Rodrigues, N.F.; Gomes, A.V.B.T.; Fernandes, G.C.; Coelho. L.F.L.; Drumond, B.P. Morais, S.M.S.; Aleixo, A.A.; Moraes, T.F.S.; Magalhães, 1. UNIVERSIDADE FEDERAL DE JUIZ DE FORA J.C.; Magalhães, C.L.B.; Drumond, B.P.; Ferreira, J.M.S.; 2. UNIVERSIDADE FEDERAL DE ALFENAS Malaquias, L.C.C.; Silva, B.M.; Coelho, L.F.L. Dengue virus (DENV) is considered the most important 1. UNIVERSIDADE FEDERAL DE ALFENAS arbovirus in the world. Four different serotypes of DENV 2. UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL (DENV-1 to DENV-4) have been described and they can REY cause infection in humans. Any of the four DENV can cause 3. UNIVERSIDADE FEDERAL DE OURO PRETO asymptomatic infection or a wide variety of disorders, Dengue virus (DV) is an enveloped virus, positive single- as dengue fever, dengue hemorrhagic fever (DHF) and stranded RNA, transmitted to humans through the bite dengue shock syndrome (SCD). The pathogenesis of of infected female Aedes aegypti mosquito. There are two main clinical manifestations caused by DV infection been demonstrating that different factors are involved named Dengue Fever (DF) and Dengue Hemorrhagic Fever withDHF the / DSS pathogenesis is multifactorial of severe and dengue several cases; studies (i) haveviral (DHF). A variety of genetic polymorphisms, particularly factors (ii) secondary infection caused DENV and (iii) in immune response related genes, have been described host genetic factors that could be related to exaggerate to be associated with susceptibility and resistance to immune response. Previous data have shown that host dengue. In order to study the frequency of important genetics play a role in disease susceptibility and severity. polymorphisms that might be associated with dengue Studies trying to understand why dengue patients have clinical outcomes in a Minas Gerais population (Southeast different prognoses are of great importance for public Brazil), three human single nucleotide polymorphisms health. Although dengue is considered one major public health problem, antiviral drugs and vaccines are rs1801274) were analyzed using a Real Time PCR assay. still not available to treat or prevent the infection. The (DC-SIGN/rs4804803, JAK-1/rs11208534 and FcRIIa/ vector control has been the only control strategy but it Minas Gerais (Alfenas, Divinopolis, Juiz de Fora, Ouro PretoA total and of 1477Ouro individualsBranco) were from studied. five different Among citiesthe DC- in occurrence of new outbreaks. The city of Juiz de Fora, Minashas been Gerais demonstrated has experienced to be several inefficient, dengue allowing epidemics the prevalent in all cities analyzed (59,69% ±4,77) and this in recent years, with reports of severe cases and deaths. genotypeSIGN/rs4804803 was associated SNP, the genotypeto protection A/A wasagainst the mostFHD Given this context, this study aimed to investigate the serological status and genetic factors (SNPs) that may be with FHD predisposition, had a minor frequency in all related to the predisposition to severe forms of dengue development. The genotype G/G, that was associated in Juiz de Fora. From September to October (2013) and rs11208534 SNP in this population showed a high from February to May (2014), 342 samples of whole cities studied (5,97% ±1,92). The analysis of JAK-1/ blood were randomly collected from inhabitants of Juiz cities studied and this SNP is associated with FHD risk. de Fora. Samples were used to investigate the immune frequency of the A/A genotype (69,21% ±3,28) in all response do dengue, SNPs and DENV. In the study group, has a frequency of 32,39% ±3,28 and the genotype a seroprevalence of 16.1% was observed. Predisponent Among the FcRIIa/rs1801274, the protective genotype and protector SNPs were detected in genes FCyRIIa, 19,27±1,27. Future studies should be done verify the JAK-1 and DCSIGN and those were randomly distributed associated with FHD risk (A/A) has a frequency of without correlation with the gender distribution, cases in the Minas Gerais State. Financial Support: CNPq, different Juiz de Fora regions where the participants lived CAPES,influence FAPEMIG. of this genotypes frequencies in the DF/FDH and report of dengue symptoms by patients. Moreover, three patients were detected with DENV infection, by the October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
109 Human Virology: HV time of sample collection. The knowledge of areas and expression in the presence of agents without antiviral persons who are more prone to have FHD is valuable information from the epidemiological point of view and with antivirals. The system F2R ZsGreen1-1 revealed for the structuring of public policies aiming the control aproperty functional and system expressed opening no fluorescence ways for applications when treated in of dengue. Financial Support: FAPEMIG, CNPq, CAPES, clinical diagnosis, resistance tests to the antiviral and for new drugs research. Financial Support: CNPq and CAPES. UFJF,HV22 PROPESQ/UFJF. - DEVELOPMENT OF A REPORTER CELL LINEAGE TO DETECT ACTIVE HERPES SIMPLEX HV27 - ANTIHERPES ACTIVITY OF SOY VIRUS (HSV) INFECTIONS ISOFLAVONOIDS: STUDY OF MECHANISM OF ACTION Feltrin, C.; Simões, C.M.O.; Sincero, T.C.M. AND INCORPORATION INTO NANOEMULSIONS Argenta, D.F.; Silva, I.T.; Misturini, F.D.; Koester, L.S.; UNIVERSIDADE FEDERAL DE SANTA CATARINA Bassani, V.L.; Teixeira, H.F.; Simões, C.M.O. Immunosuppressed patients can develop infections by Herpes Simplex Virus (HSV-1 and HSV-2) with fast 1. UNIVERSIDADE FEDERAL DE SANTA evolution, severe atypical symptomatology and often- CATARINA 2. UNIVERSIDADE FEDERAL DO RIO GRANDE fatal outcome, being essential the early diagnosis to DO SUL obtain effective treatment. Due to viral latency, methods
Studies have shown the benefits of topical application infectivity.based on amplification Therefore, the of aim HSV of thisDNA work provide was sensitivityto develop of soy isoflavones due to their antioxidant, estrogenic, aand reporter specificity, cellular however system none to earlier information diagnosis about of active viral genistein to inhibit Herpes Simplex Virus types 1 and 2 replicationand antiherpes has been activities. reported The and ability seems of the to be isoflavone related protein (GFP), the reporter system was constructed to its inhibitory effect on tyrosine kinase. Following byinfections transfecting caused Vero by HSV.cells Usingwith thethe greenICP10 fluorescent promoter (F1R and F2R) from the HSV-2 fused to the vector these findings, we investigated the antiherpes effects of pZsGreen1-1. The regulation of GFP expression via and coumestrol). The antiviral activity was tested against soybean’s isoflavonoids (genistein, daidzein, glycitein ICP10 is dependent of viral infection and occurs through HSV-1 (KOS strain) by viral plaque number reduction the viral transactivating protein VP16 and cellular assay (IC50) and the cytotoxicity (Vero cells) was factors Oct-1 and HCF-1. The system effectiveness evaluated by using sulforhodamine B assay (CC50). The was evaluated by viral infection followed by antiviral treatments (Acyclovir, Gallic Acid, Convalotoxin and effects. However, genistein and coumestrol presented isoflavones daidzein and glycitein showed no antiviral Uncaria sp. extract) and by inactive antiviral candidates HSV-1 inhibitory activity with IC50 values of 14.02 ± 0.97 (Passiflora edulis extract and cardenolides derivatives). µM and 11.50 ± 1.68 µM, respectively. The mechanism The reporter system F2R ZsGreen1-1 expressed GFP of action was elucidated by different methodological as a function of HSV-1 and HSV-2 infection, which was strategies. Genistein presented neither virucidal activity nor affected the early events of HSV-1 replication, but it reduced the expression of HSV-1 ICP27, gD and reporterdetected system by fluorescence was directly correlated microscopy with and/or virus titers flow (MOIcytometry. 4.0 x By10 -3 flow to 3.3 cytometry x 10-4, that the is, fluorescence 1 viral particle of the to effects and was able to interfere with HSV-1 attachment gB proteins. Coumestrol had no significant virucidal each 250 to 3000 cells). Infection with HSV-2 MOI 1.3 and penetration steps with IC50 values of 33.24 ± 2.88 x 10-3 µM and 64.66 ± 3.34 µM, respectively. In addition, the to the control in approximately 30% and 60% at MOI reduction of gB protein expression, which is produced 4.0 x 10 increased-3 48 h post mean infection. fluorescence HSV-1infection intensity comparedMOI 6.7 x in the late stage of virus replication, suggests that 10-4 coumestrol affects different steps of viral replication. the control in approximately 20% and 35% at MOI 4.0 x The active compounds (genistein and coumestrol) were 10-3 increased48h after infection.mean fluorescence The system intensity maintained in relation the GFP to incorporated into cationic nanoemulsions composed
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
110 Human Virology: HV by isopropyl myristate, dioleoylphosphatidylcholine, this infection. Viral RNA was detected in fourteen of oleylamine and polysorbate 80, and they reduced the the twenty-two anti-HCV positive samples, and the viral plaque number formation with IC50 values of 8.14 ± genotypes 1 and 3, subtypes 1a (n = 7), 1b (n = 3) and 1.06 µM and 7.63 ± 0.13 µM, respectively. Taken together, our results showed that genistein and coumestrol as HCV infection prevalence found among users of crack well as the nanoemulsions loaded with these bioactive institutionalized3a (n = 2) were identifiedin Goiania in isthe about study three population. times thatThe compounds could be considered as promising anti- observed in local blood donors; this population is in risk herpes agents and deserve to be deeply investigated. for HCV by sexual and parenteral transmission. Financial Financial Support: CAPES and CNPq (Brazil). Support: FAPEG.
HV31 - HEPATITIS C: PREVALENCE AND RISK FACTORS HV49 - OPTIMIZATION AND USE OF REAL TIME PCR AMONG CRACK USERS INSTITUTIONALIZED IN (QPCR) IN THE DETECTION AND QUANTIFICATION OF GOIÂNIA, CENTRAL BRAZIL ACTIVE INFECTIONS CAUSED BY BETAHERPESVIRUS Carneiro, M.A.S.; Del-Rios, N.H.A.; Araújo, L.A.; IN PLASMA SAMPLES FROM HEMATOPOIETIC STEM Martins, R.M.B.; Matos, M.A.D.; Caetano, K.A.A.; CELLS TRANSPLANT PATIENTS Pinheiro, R.S.; Santos, N. C.; Guimarães, R.A.; Da Silva De Oliveira, R.S.; Dellariva, T.C.; Leon, L.L.; Vigorito, França, D.D.; Da Silva, L.N.; Teles, S.A. A.C.; Aranha,J.P.; Costa, S.C.B.; Bonon, S.H.A. 1. PONTIFÍCIA UNIVERSIDADE CATÓLICA DE UNIVERSIDADE ESTADUAL DE CAMPINAS GOIÁS Human herpesviruses (HHV) are a major cause of 2. SECRETÁRIA MUNICIPAL DE SAÚDE DE infection in transplant patients. High levels of HHV-6 GOIÂNIA are associated with the mortality increase, GVHD, HCMV 3. UNIVERSIDADE FEDERAL DE GOIÁS disease and encephalitis in hematopoietic stem cell Crack is considered a public health problem in Brazil and transplant (HSCT) patients. HHV-7 can cause fever, rash in the world because of its impact on social relationships, and it is a possible cofactor for HCMV disease. Real Time physical and mental integrity of the user, and the risk Polymerase Chain Reaction (qPCR) in plasma is one of associated with infections, such as those caused by the the most modern options used in the monitorization of hepatitis C virus (HCV). This study investigated the transplant patients in relation to viral infections. The prevalence of hepatitis C and risk factors associated aim of this study was to optimize a qPCR technique among users of crack institutionalized in Goiania, Brazil. Between, August 2012 to April 2013, a total of betaherpesvirus DNA from HSCT patients. Primers 600 individuals were interviewed and blood samples “in house” for the detection and quantification of collected for the detection of serological markers of HCV regions for betaherpesvirus. It was also performed a (anti-HCV) by enzyme-linked immunosorbent assay Nesteddesigns PCR were for performed comparison of between conserved qPCR and technique. specific (ELISA). Positive samples for this marker were submitted Plasma samples from 60 HSCT patients were collected for to HCV RNA detection by polymerase chain reaction prospectively, from the day of the transplant until day (PCR) with primers complementary to the conserved +100 post-transplant. Active HCMV, HHV-6 and HHV- area of the 5’ non-coding (NC) region of HCV. Positive 7 infections were detected by Nested PCR in plasma in HCV RNA samples were genotyped by direct sequencing 61.7%, 23.3% and 51.7%, with a median of 34, 24 and 15 analysis of the NS5B region of viral genome, followed days, respectively. HCMV antigenemia test was positive by phylogenetic analysis. The average age of the studied in 48.3%, in a median of 40 days after the transplant. population was 30.47 years, masculine predominance The qPCR optimized for HCMV, HHV-6 and HHV-7 were and 62,6% had a low level of education (<9 years). The positive, respectively, in 70%, 16.7% and 41.7%, with HCV infection prevalence was 3.7% (95% CI: 2.4%- a median of 26, 20.5 and 20 days after transplant. Five 5.6%) in users of crack institutionalized in Goiania-Go. out of 37 (13.5%) patients with active HCMV infection In a multivariate analysis, age > 40 years and history of injecting drug were independently associated with main cause of death was HCMV disease. Five patients died in a median of 50 days and in 2/5 (40%). The October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
111 Human Virology: HV had disease by HCMV in the gastrointestinal tract (GT), proven by biopsy. Active HHV-6 infection in plasma was for HAdV by nested-PCR, and these from eight different patients.the total samplesStool samples (105), 15.24%were screened (16/105) by were nested positive PCR. days after transplantation. One patient with positive HHV-6detected died in 14/60in less patients than 100 (23.3%), days after in a the median transplant of 24 of patients, demonstrating a high occurrence of these and had coinfection by HCMV, and he died by this agent. agentsPositive in samples patients forundergoing HAdV were HSCT. found The in most 42% frequent (8/19) Four patients with HHV-6 (33.3%) had acute GVHD and symptoms observed in patients positive for HAdV were gastrointestinal ones, such as vomiting, abdominal of 15 days after transplantation. Three patients with pain, diarrhea, constipation; and diarrhea was the most activeoverlap. HHV-7 HHV-7 (9.7%) occurred died, in and 31/60 their (51.7%) main cause in a of median death frequent symptom. Only one patient excreted HAdV was acute GVHD and bacterial infection. Eight patients without diarrhea. Graft-versus-host disease (GVHD) with active HHV-7 infection (25.8%) had acute GVHD was the most common complication. Ten patients and overlap. The qPCR was effective in the detection and (52.6%) died during the study, six of them (60%) were positive for HAdV. We hope that this information can relation to positivity and early detection, and can safely help to understand the patterns of HAdVs infection in replacequantification the method of human of Nested betaherpesvirus, PCR and antigenemia including for in patients undergoing HSCT, and contribute to establish HCMV especially considering the patients who are the adenovirus testing in the routine screening of these focus of our study. Financial Support: FAPESP. patients. Financial Support: Conselho Nacional de
HV51 - SCREENING FECAL SAMPLES FROM Universidade Federal de Goiás (UFG). PATIENTS UNDERGOING TRANSPLANTATION OF Desenvolvimento Científico e Tecnológico (CNPq); HEMATOPOIETIC STEM CELLS FOR ADENOVIRUS HV52 - PHYLOGENETIC ANALYSIS OF GROUP A Abreu, M.N.; Santos, H.C.P.; Borges, F.P.S.; Arantes, ROTAVIRUS CIRCULATING IN BRAZIL: EVOLUTIONARY A.M.; Fiaccadori, F.S.; Cardoso, D.D.P.; Souza, M.B.L.D. PATTERNS OF GENOME CONSTELLATION Barreto, D.M.; Batista, M.V.A. 1. UNIVERSIDADE FEDERAL DE GOIÁS 2. HOSPITAL ARAÚJO JORGE UNIVERSIDADE FEDERAL DE SERGIPE 3. ASSOCIAÇÃO DE COMBATE AO CÂNCER EM Diarrheal disease is a major cause of mortality in GOIÁS children around the world. Many of these infections Viral infections are an important cause of morbidity are caused by group A rotaviruses (RVA), which are and mortality in patients who receive hematopoietic responsible for approximately 196.000 cases of diarrhea stem cell transplantation (HSCT). Adenovirus (HAdV) and deaths in developing countries. Rotaviruses are frequently infects humans and can be associated with members of the Reoviridae family and the genome of that pathogen consists of double-stranded RNA intrinsic characteristics of the infected individuals. with 11 segments located within the nucleocapsid. different clinical profiles according to the serotype and However, the infection is usually well controlled by Twelve viral proteins are divided into two groups, six the immune system of immunocompetent individuals. structural (VP1-VP4, VP6-VP7) and six non-structural Thus, the objective was to verify the occurrence and HAdVs excretion in patients who underwent HSCT in system has been established for RVA based on eleven one of the reference centers for marrow transplant in proteins (NSP1-NSP6). Recently, a novel classification Brazil (Hospital Araújo Jorge, located in Goiânia, Goiás), RVA detected worldwide possess one of the following correlating viral positivity to the clinical state of the genes. According to classification, most of the human patient. 19 patients who were followed underwent HSCT from bone marrow or peripheral blood, allogeneic type genome constellations: Wa-like (Gx-P[x]-I1-R1-C1- M3-A3-N3-T3-E3-H3),M1-A1-N1-T1-E1-H1), also DS-1-like called genotype (Gx-P[x]-I2-R2-C2- 1, 2 and 3, respectively.M2-A2-N2-T2-E2-H2) Therefore, or this AU-1-like study aimed (Gx-P[x]-I3-R3-C3- at analyzing the patient,(47.4% (9/19)ranging male,from one ages to 4-61 18 samples years). Aper total patient. of 105 Of fecal samples were collected, averaging five samples per October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology:genomic HV constellation classification and phylogenetic XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
112 Human Virology: HV relationships of RVA circulation in Brazil according to data regarding the mechanisms of pathogenesis and geographical distribution and year, in order to obtain transmission as well as viral diversity are still unknown. a comprehensive evolutionary scenario to assess the genotype dynamics since the vaccine introduction. In from an immunosuppressed patient using metagenomic order to do this, nucleotide sequences of 860 Brazilian approaches.Recently, we Here, identified we TSPyVdeveloped on a a skin qPCR cancer for biopsyTSPyV isolates of Rotavirus A from 1986 to 2011 were obtained detection directed to AgT gene using the Taqman from the Virus Sequence Database. Then, BLAST tool were used to compare sequence identity of the isolates. any other polyomaviruses but tsv. The limit of detection Genomic constellation genotyping was performed method. Our method was specific, since did not detect according to sequence identity. Phylogenetic analyses test (using a commercially constructed plasmid). Intra- were carried out under the GTR + I and HKY models laboratorywas 100 cp/uL repeatability in water andand 500 reproducibility cp/uL in urine-spiked was also of nucleotide substitution, selected using jModelTest. conducted. Using this assay, we searched for the presence Maximum likelihood (ML) phylogenetic trees were of the virus in tissue (spicules) and 12 urine samples inferred for each one of the 11 gene sequences using obtained monthly from a kidney transplantation patient six months before and after trichodysplasia spinulosa The results of the phylogenetic tree showed that diagnostic. We also tried to detect TSPyV in blood of two allPhyML genes program were withgrouped the modeltogether that according best fit the to data.the additional cohorts of 71 individuals each: (i) healthy distribution of genotypes. NSP2 and NSP3 genes have individuals and (ii) kidney transplantation recipients showed a temporal pattern of grouping. In addition, (without TS disease). According to our test, TSPyV VP1, VP2 and VP3 genes presented evolutionary can be detected in the spicules and biopsy skin from a relationships according to geographical distribution. kidney transplant patient who developed TS and blood Therefore, many genotypes are emerging in Brazil and and urine samples from non-TS individuals. The samples are being distributed according to the location and the of the TS patient presented a viral load from 10e3 to year of infection. It was possible to observe a change in the frequency of genotypes after the implementation the sampling time. Among kidney recipients, we found of Rotarix vaccine. Therefore, there is a necessity of a more than 10e8 copies/ml, which ranged according to continuous surveillance program in order to assess the impact of the vaccine. Financial Support: CNPq, CAPES individuals26,8% (19/71) had detectableof positivity TSPyV in blood in blood. and Inthe conclusion, viral load weranged presented from 500a new to and 10e4 sensitive copies/ml. Taqman none real of healthytime to detect TSPyV in different biological samples. we also andHV54 FAPITEC/SE. - NEW TAQMAN REAL TIME PCR ASSAY FOR RAPID DETECTION OF TRICHODYSPLASIA blood at least 6 months before the onset of disease and SPINULOSA-ASSOCIATED POLYOMAVIRUS IN remainsshow for detectable the first time even that after the a virussuccessful can be treatment found in BIOLOGICAL SAMPLES for ts. Not less important, we also demonstrated the Urbano, P.R.; Nali, L.H.; Pannuti, C.S.; Pierrotti, L.C.; presence of TSPyV in blood of kidney recipients that did David-Neto, E.; Romano, C.M. not develop the disease. We suggest that early detection 1. INSTITUTO DE MEDICINA TROPICAL - USP of TSPyV in blood and urine can be used to monitor 2. UNIVERSIDADE DE SÃO PAULO immunocompromised patients that are at risk to develop the disease. Financial Support: FAPESP, project A new polyomavirus ts, was described in a solid organ transplant recipient with rare skin disease. Urbano holds a CAPES scholarship. trichodysplasia spinulosa (TS) is characterized by the #2012/15381-7 and CNPq #446851/2014-0. Paulo development of follicular papules and keratin spines known as spicules, which usually manifests on the face of the patient, demonstrating hair follicle dilatation and keratotic plugging of the infundibulum. Although there is a strong association between TS disease and the virus,
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
113 Human Virology: HV
HV55 - ISOLATION OF TSPYV POLYOMAVIRUS IN DIFFERENT CELL LINES an easy task, and the successful isolation of the TSPyV for the first time. Polyomavirus isolation is not always Urbano, P.R.; Boas, L.S.V.; Cardozo, F.T.G.S.; Romano, will certainly contribute to future studies directed to C.M. diagnostic and the understanding of its pathogenesis INSTITUTO DE MEDICINA TROPICAL - USP TSPyV is a polyomavirus was recently discovered in a scholarship.Financial Support: FAPESP, project #2012/15381-7 and solid organ transplant recipient with a rare skin disease, CNPq #446851/2014-0. Paulo Urbano holds a CAPES Trichodysplasia spinulosa (TS). TS is characterized HV56 - ADENOVIRUS, POLYOMAVIRUS, EPSTEIN- by the development of follicular papules and keratin BARR, CYTOMEGALOVIRUS, HERPESVIRUS 6 spines and usually affects face, presenting, hair follicle AND 7 IN CHILDREN AND ADOLECENTS WITH dilatation, and less frequently, the lack of hair. Although GLOMERULOPATHIES there is a strong association between TS disease and the Menoni, S.M.F.; Bonon, S.H.A.; Costa, S.C.B.; Lutaif, virus, data regarding the mechanisms of pathogenesis, A.C.C.B.; Ferrari, C.; Belagero, V.M.S. virus transmission and further consequences are still UNIVERSIDADE ESTADUAL DE CAMPINAS unknown. There is no molecular or serology tests available, as well no virus isolation was performed. This Viral infections have been associated with the onset study aimed to isolate TSPyV using different cells lines of many glomerular diseases, particularly in children. in order to set the best model for future invitro studies. In some glomerulonephritis cases, when infection is Vero cells (epithelial cells from African green monkey clinically silent, viral syndromes can act as a trigger kidney), LLC - MK2 cell, from kidney of rhesus monkeys for the case aggravation. However, strong evidence for were initially used. Among the human cell lines, the viral causality in most glomerular disease is still lacking. HEK-293, derived from human embryonic kidney and a While numerous medical records of children shows the
seroconversion to a wide range of viruses, relatively few used to preform virus isolation. Cells were cultured in occurrence of specific forms of glomerular disease after monolayersprimary fibroblast using strainRPMI-1640 derived medium, from lung supplemented (HF-4) were reports provide pathological evidence of viral infection with 10% fetal bovine serum (FBS). Cells were kept at associated with glomerular lesions on kidney biopsy. Else, status urine sample was used for inoculation into 75% a viral infection in a child with glomerulopathy could 37°C for infection, 100uL of previously confirmed positive changethere is theno evidence management suggesting of either that thethe infectionidentification or the of After inoculation, cells were incubated for 1 hour at 37°c glomerulonephritis. Therefore, additional research forconfluence adsorption, HEK-293 and 5 ml cells of inmedium a MOI=5 with approximately. 2% FBS were into this topic is very important and needed. The aims added, and cells were incubated in 370C in incubators. of this study were to verify the virus replication in children and adolescents with glomerulopathies and to cytopathic effect (CPE) was observed, compatible to determine a possible association between viremia and syncytiaAfter five effect. to seven These days cells post were inoculation, recovered theand onsetused to of episodes of decompensation. Patients and methods: co-cultive together to the other cells lines in order to eighty six children and adolescents between 2-18 get them infected. Using this method, the virus infected years old (median of 10 yars) with diagnosis of chronic successfully all tested cell lines, but the CPE was more glomerulopathies using at least two immunosuppressive evident in the HF-4 cell and again, as a fusogenic CPE. drugs had urine and plasma analyzed prospectively in It is important to note that syncytium is characteristic relation to active infections caused by adenovirus (ADV), of enveloped viruses (which is not the case for TSPyV), polyomavirus (BK), epstein-barr virus (EBV), human and only few non-enveloped viruses were reported to cytomegalovirus (HCMV) and herpesvirus 6 and 7 (HHV- cause such effect (i.e Orthoreovirus). Therefore, further 6 and 7) by nested pcr and antigenemia test for hcmv. studies are needed to better evaluate this observation. In conclusion, we were able to isolate TSPyV in had30/86 as (34.9%)base disease patients an idiopathicwere positive nephrotic for these syndrome viruses, different human and non-human primate cell lines and 17/30 (56.7%) were uncompensated; 21/30 (70%) October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
114 Human Virology: HV
caused by adenovirus (ADV), polyomavirus (BK), Epstein- Barr virus (EBV), human cytomegalovirus (HCMV), (INS); 5/30 (16.7%) had systemic lupus erythematosus herpesvirus 6 and 7 (HHV-6 and 7) by nested PCR and (SLE) and other 3/30 (10%) other causes. Adv occurred in 4/30 (13.3%) patients, 3 with ins and one with (30%)sle; bk patients occurred with in 1/30ins and (3.3%) 2 patients with focalwith segmentalsle; hhv-6 HCMV antigenemia test. 14/18 (77.8%) patients were glomerulosclerosis (FSGS); hhv-7 occurred in 9/30 positive for these viruses, and 4/14 (28.6%) had renal nephropathy, 1 with hemolytic uremic syndrome (HUS) failure; EBV occurred in 3/14 patients (16.6%) and one occurred in 11/30 (36.6%), 7 with sni, 1 sle, 1 with iga (28.6%)had renal and failure; 1 patient HCMV had positivity renal failure; was 9/14 BK occurred (64.3%) and 2 patients had renal failure; HHV-6 occurred in 4/14 sle.and Co-infection1 with fsgs; cmv occurred occurred in 2 in patients: 1/30 (3.3%) ebv+hhv-6 in patients with not observed positivity for HHV-7 and Adv.. Coinfection slewith and sni; hhv-6+bk 2/30 (6.7%) in fsgs.. patients With had the ebv diagnosis positive ofand these had occurredin 6/14 (42.8%) in 6 patients: and 1 EBV+BK+HCMV patient had renal in a failure. patients It withwas viruses, our study could evaluate the viral pathogenesis meningitis sequelae; HCMV+BK occurred in 2 patients, in relation to pediatric patients with decompensation one with Frasier syndrome and one with Bad Urinary and improve the treatment in cases of these infections. Tract Training (MFTU); HCMV+HHV-6 in a patient with Glomerulonephritis (GNC) and the last patient with renal HV59 - ADENOVIRUS, POLYOMAVIRUS, EPSTEIN- failure had shown EBV+HCMV. With early diagnosis BARR, CYTOMEGALOVIRUS, HERPESVIRUS 6 AND through early and sensitive techniques, we can evaluate 7 INFECTIONS IN PEDIATRIC RENAL TRANSPLANT the viral pathogenesis in relation to pediatric patients PATIENTS with episodes of rejection and optimize treatment in Menoni, S.M.F.; Bonon, S.H.A.; Costa, S.C.B.; Prates, cases of these infections. L.C.; Palma, L.P.; Belagero, V.M.S.; Leon, L.L. HV62 - CHIMERIC PROTEIN EXPRESSION UNIVERSIDADE ESTADUAL DE CAMPINAS CONTAINING EPITOPES NS1 OF DENGUE VIRUS FOR DEVELOPMENT OF DIAGNOSTIC KITS AND VACCINES and mortality following renal transplantation. The Purificação Junior, A.F.; Coêlho, D.F.; Caiado, B.V.R.; Viral infections remain a significant cause of morbidity pediatric cohort is at high risk of developing virus- Lins, R.D.; Dhalia, R. related complications due to immunological naiveté and the increased alloreactivity risk that requires 1. UNIVERSIDADE FEDERAL DE PERNAMBUCO maintaining a heavily immunosuppressive environment. 2. CENTRO DE PESQUISAS AGGEU MAGALHÃES, FIOCRUZ Although cytomegalovirus is the most common opportunistic pathogen seen in transplant recipients, Dengue fever, caused by dengue (DENV) virus, is an numerous other viruses may affect clinical outcome. emerging disease, placed as a challenging to global Recent technological advances and novel antiviral public health. There are about 400 million cases therapy have allowed implementation of viral and worldwide annually and 40% of the world population immunological monitoring protocols and adoption of lives in risk transmission areas. The clinical status of prophylactic or preemptive treatment approaches in dengue is very broad, ranging from asymptomatic cases high-risk groups. These strategies have led to improved to more serious hemorrhagic form. The most effective viral infection management in the immunocompromised way to control these viruses would be a development of a vaccine against the DENV. However, there is still positivity in pediatric kidney transplantation and to no vaccine available for Dengue fever disease. Also, determinehost, with significanta possible impact association on outcome. between To viremia verify virus and main diagnostic systems present several limitations rejection episodes. Eighteen children and adolescents with a median age of 14 years (range 9-18 years) with systems, long processing time and elevated cost. Among diagnosis of chronic kidney diseases and use of at least thesuch viral as difficulties proteins, NS1in protein is placed expression as a great on prokaryoticcontributor two immunosuppressants drugs had urine and plasma to the immune response triggered by DENV virus. This analyzed prospectively in relation to active infections protein is found in both ways: connected to cell and
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
115 Human Virology: HV secreted at higher levels, as a hexamer, in the beginning host interaction, it is likely that different genotypes are of infection. This may explain the antibody production associated with virulence and different clinical outcomes. against the NS1 protein, which makes it an important In fact, it has been suggested that these genotypes may target for acute phase, through infection. This study aims be associated with the risk of developing the disease to produce new chimeric proteins (containing epitopes of NS1) as potential candidates for diagnostic antigens facilitate viral replication. This is a prospective study, whichdue to ahas specific been tissue performed tropism a orneonatal some mechanism screening thatfor dynamics simulation and de novo design, were used to detection of symptomatic congenital CMV infection. It elaborateand/or vaccine. a global Computational protocol of protein approaches, design that molecular select has been included all newborns under three week who short sequences of the NS1 protein. These possible are admitted to the Intensive Care Unit of the Hospital antigenic sequences were inserted into the Top7 protein, Manoel Novaes, in Itabuna, Bahia. Urine samples have known for its outstanding thermal and environmental been collected in sterile collectors bags and saliva stability. The results revealed that chimeras, containing samples have been collected with sterile swabs. Samples antigenic sequences of interest, were structurally stable. of saliva and urine are subjected to PCR without prior The genes originated from these proteins were optimized DNA extraction. By the time, it was collected samples and commercially synthesized, then cloned into pRSETA was asymptomatic until this moment. Children with had their DNA extracted in large scale and, have produced congenitalof 40 children infection and 1/40 will (2,5%) be assessed was infected. and monitored This child recombinantexpression vector. proteins The of confirmed interest in recombinant cells of Escherichia clones by a medical team until the second year of life and the coli BL21 strain. The obtained proteins (13 kDa) were genotypes of CMV glycoprotein B will be determined by RFLP and the viral load will be carried out by real-time were observed by immunoblot assays (an antibody was PCR. Financial Support: UESC, FAPESB. usedpurified against by affinity their histidinechromatography tails). These on nickel proteins resin have and been evaluated by enzyme immunoassays (ELISA) using HV66 - EFFECTS OF GENISTEIN AND COUMESTROL panels of reference sera to determine its immunogenicity, AGAINST AN ACYCLOVIR-RESISTANT STRAIN OF HSV Argenta, D.F.; Silva, I.T.; Koester, L.S.; Bassani, V.L.; study may contribute to the development of alternative Teixeira, H.F.; Simões, C.M.O. sensitivity and specificity. The results described in this 1. UNIVERSIDADE FEDERAL DE SANTA CATARINA intargets comparison in Dengue with fever currently diagnosis methods and/or used vaccine, by SUS. at 2. UNIVERSIDADE FEDERAL DO RIO GRANDE Keywords:a lower cost Dengue; and withChimeric greater protein; production Diagnosis, efficiency, vaccine. DO SUL Financial Support: CNPq, PPSUS.
HV65 - CONGENITAL CMV INFECTION IN CHILDREN investigated widely. It has been reported that genistein Antiviral effects of flavonoids compounds have been ASSISTED IN AN INTENSIVE CARE UNIT Glycine max, are able to inhibit herpes simplex virus (HSV) replication, which Marin, L.J.; Lopes, B.L.; Gadelha, S.R.; Carvalho, L.D.; isand associated coumestrol, with flavonoids skin and foundepithelial in mucosa infections. Silva, L.A.; Santos, M.C.M. Acyclovir is the drug of choice in the treatment of these UNIVERSIDADE ESTADUAL DE SANTA CRUZ infections. However, the administration of antiherpes The CMV is the most common agent of congenital drugs has resulted in the emergence of resistant viral infection in the world. It is not clear why some newborns strains. Based on this evidence, the aim of this study with congenital CMV infection are asymptomatic and was to investigate the anti-HSV effects of genistein other symptomatic. One of the most common and and coumestrol against an acyclovir-resistant strain of important virus glycoprotein is the gB. This protein is HSV-1 (29R strain) and against an acyclovir-sensitive polymorphic and highly immunogenic. Most of the wild strain of HSV-2 (333 strain) during replication. The viral strains are grouped in four major gB genotypes. antiviral activity was tested against HSV by viral plaque
Recognizing the vital role of this glycoprotein in virus- number reduction assay (IC50) and the cytotoxicity was
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
116 Human Virology: HV
evaluated by sulforhodamine B assay (CC50), using Vero of HCV among indigenous populations, especially in and GMK AH1 cells, which are permissive to HSV-1 and Tocantins. This study aimed to evaluate the prevalence HSV-2, respectively. Coumestrol and genistein were of antibodies to HCV (anti-HCV) in individuals of able to inhibit the replication of both viruses. These the indigenous population and compare with non- compounds showed stronger inhibitory effects against indigenous population from Tocantins state (North acyclovir-resistant strain of HSV-1 replication, with Brazil). A cross-sectional study was conducted. This
IC50 values around 3.3 µM and 7.8 µM for coumestrol project was approved by the Ethics Committee of the and genistein, respectively, compared to effects against National Research Council, Special Indigenous Health acyclovir-sensitive strain of HSV-2, IC50 values around District, local leaders of the tribes and the community. 35.53 µM and 14.12 µM for coumestrol and genistein, This study recruited 387 non-indigenous individuals respectively. The mechanism of action was elucidated from six districts and 575 indigenous people from six by different methodological strategies. The compounds villages located in the municipality of Tocantinópolis did not present virucidal activity. Concerning the effects (Tocantins). The recruitment was carried out in non- in early events, coumestrol was able to interfere with probabilistic way. Blood samples were collected from each viral attachment and penetration steps with IC50 values subject by venipuncture to obtain serum after signing around 23 µM and 100 µM on acyclovir-resistant strain an informed consent form. Samples were subjected and acyclovir-sensitive strain, respectively. In the plaque to anti-HCV detection using a commercial enzyme area reduction assay, no reduction was observed with immunoassay (Murex HCVab, Diasorin) and those samples with anti-HCV positive result were subjected to resulted in smaller plaques when compared to untreated detection of HCV RNA by real time PCR (Cobas taqman controlsHSV-1, however, (p the treatment with both flavonoids HCV, Roche). Among indigenous individuals (n = 575), reduced the plaque areas at concentrations of 20 µM most were female (50.7%) and mean age was equal and 40 µM,<0.05) whereas with coumestrol HSV-2. Genistein reduced significantlythe plaque to 23.9 ± 19.4 years. In the group of non-indigenous areas only at a concentration of 40 µM (p<0.05). Thus, individuals (n = 387), most were female (56.7%) and although only coumestrol affects the early stages of viral mean age was equal to 32.3 ± 21.3 years. Anti-HCV was infection, both compounds were able to reduce HSV-2 detected in eight subjects, seven were indians from four villages and one was not indian. Thus, the prevalence of coumestrol and genistein have inhibitory effects over anti-HCV was 1.2% among indigenous group and 0.2% ancell-to-cell acyclovir-resistant spread. In summary, strain of our HSV-1, findings interfering suggest with that in the non-indigenous group. Among anti-HCV reactive different steps of the HSV replication cycle. Financial samples (n=8), one was HCV RNA reactive (viral load Support: CAPES and CNPq (Brazil) prevalence of anti-HCV was six times higher among HV69 - HEPATITIS C VIRUS INFECTION AMONG indigenous= 3log IU/mL) compared and belongs to the togroup indigenous of non-indigenous group. The INDIGENOUS AND NON INDIGENOUS INDIVIDUALS individuals. Due to increased vulnerability of indigenous FROM TOCANTIS STATE (NORTH BRAZIL) people related to cultural customs, the data reported Villar, L.M.; Milagres, F.A.P.; Scalioni, L.P.; Cruz, H.M.; in this study emphasize the importance of establishing Miguel, J.C.; Lampe, E.; De Paula, V.S. measures to prevent and control hepatitis C in this 1. FUNDAÇÃO OSWALDO CRUZ population. Financial Support: CNPq, FIOCRUZ. 2. UNIVERSIDADE FEDERAL DE TOCANTIS Infection by hepatitis C virus (HCV) is an important cause of morbidity and mortality worldwide. The prevalence of HCV infection varies according to geographic region and population characteristic. Indigenous population is considered vulnerable for acquiring infectious diseases due to their cultural habits and sanitary and hygienic conditions. In Brazil there are few data on the prevalence
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
117 Human Virology: HV
HV74 - ANALYSIS OF HUMAN PAPILLOMAVIRUS using CLUSTAL W program. The results showed that two 11 LCR REGION IN RECURRENT RESPIRATORY patients had mutations in the LCR region, while the others PAPILLOMATOSIS SAMPLES (three patients) showed no changes in the same region. Dias, M.C.; Bonfim, C.M.; Nogueira, R.L.; Kupper, D.S.; Valera, F.C.P.; Nogueira, M.L.; Rahal, P.; Calmon, M.F. transcriptional activity of the virus. Because the changes Later, it will be tested if these changes influence the 1. INSTITUTO DE BIOCIÊNCIAS, LETRAS factors, it is believed that there are differences in the E CIÊNCIAS EXATAS - UNIVERSIDADE aggressivenessin LCR influence of onpapillomatosis the binding ofwithin virus the transcription sequences ESTADUAL PAULISTA “JÚLIO DE MESQUITA of HPV11 mutations and, therefore, it is important to FILHO” detect these changes and the correlation with clinical 2. FACULDADE DE MEDICINA DE RIBEIRÃO PRETO and pathological data of patients in order to understand 3. FACULDADE DE MEDICINA DE SÃO JOSÉ DO the course of the disease and to optimize the treatment RIO PRETO of RRP. Keywords: HPV11; LCR; Recurrent Respiratory Papillomatosis. Financial Support: FAPESP, CAPES. The recurrent respiratory papillomatosis (RRP) is characterized by the formation of papillomas in the HV80 - STUDY ON SEROEPIDEMIOLOGICAL respiratory tract of children and adults. Papillomas ARBOVIRUS IN NATIONAL FOREST CAXIUANÃ found in the larynx are benign, and can spread MELGAÇO-IN PARA MUNICIPALITY throughout the respiratory tract and obstruct the Ferreira, M.S.; Arrúda, F.S.; Chagas, L.L.; Martins, L.C.; airway, causing death. This disease is the result of Chiang, J.O.; Pinheiro, G.S.; Fernandes, D.D.C.; Freitas, infection with human papillomavirus (HPV), which M.N.O.; Araújo, P.A.S.; Vasconcelos, P.F.C. have the ability to infect skin, oral and genital mucosa. HPV can be divided into two groups according to their 1. UNIVERSIDADE FEDERAL DO PARÁ oncogenic potential, high-risk or low-risk, being the 2. INSTITUTO EVANDRO CHAGAS 3. FACULDADE INTEGRADA BRASIL latter responsible for the RRP and mainly represented AMAZÔNIA by genotypes 6 and 11. HPV replication is controlled by the long control region (LCR), which regulates viral Arboviruses are endemic in the Brazilian Amazon replication and transcription of early genes like E6 and populations living in different Amazonian ecosystems. and inflection by them can be endemic on epidemic the binding of virus transcription factors, the detection The study aimed a serologic survey conducted in ofE7 mutations oncogenes. observed Because throughthe changes this inregion LCR isinfluence important on human residents in Caxiuanã National Forest in the to identify and correlate differences in clinicopathologic municipality of Melgaço -Para, November - December features that can be linked to nucleotide variations. 2014. The serum samples collected were tested for 18 In this way, the aim of this study was to detect HPV11 different types of arboviruses of the following genera: mutations present in the samples of RRP. For this, the Alphavirus (East Equine Encephalitis Virus - EEEV; West Equine Encephalitis Virus -WEEV; Mayaro Virus - MAYV; Chikungunya Virus - CHIKV; Mucambo Virus includedLCR of RRP negative samples (no was DNA) amplified and positive by Polymerase controls Chain and - MUCV); Flavivirus (West Nile Virus - WNV; yellow productsReaction (PCR)were submittedusing specific to electrophoresis primers. All PCR on reactions agarose fever Virus (wild and vaccine strains) - YFV; Ilheus Virus - ILHV, dengue Virus DENV-1, 2, 3, 4; Saint Louis Encephalitis Virus-SLEV; Cacipacore Virus - CPCV; Rocio usinggel 1%. the When BigDye® positive, Terminator the products v3.1 wereCycle purified Sequencing and Virus- ROCV); Orthobunyavirus: Tacaiuma Virus - TACV; Kit.sequenced The quality by the ofdideoxy the sequences fluorescent-terminal was analyzed method on Caraparu Virus - CARV; Oropouche Virus – OROV and Eletropherogram Quality Analysis program available Catu Virus - CATV). Blood samples of 263 individuals online, and the analysis was then performed comparing were collected. Of these, 141 (54%) were female and the nucleotides in relation to the sequences of prototype belonged to the age group of 5-9 years 47 (17,9%) and HPV11, by aligning the sequences in both orientations 10-14 (16,3%). The level of education indicated that
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
118 Human Virology: HV
172 (65,4%) had not completed high school, 28 (10,6%) pane for 18 different types of arbovirus, belonging to were illiterate; 100% lived in rural areas; 210 (79,8%) the genus: Flavivirus – Dengue 1, 2, 3 and 4 (DENV), were vaccinated against yellow fever and 243 (92,4%) Saint Louis Encephalitis (SLEV), Rocio (ROCV), Ilheus traveled to the urban area of the municipality. The HI (ILHV), West Nile (WNV), Yellow Fever (YFV) and yellow tests detected 132 (50,2%) positive reactions. 122 fever vaccine. Alphavirus – Eastern Equine Encephalitis (92,9%) to Flaviviruses, 36 (27,3%) Alphaviruses and (EEEV), Western Equine Encephalitis (WEEV), Mayaro 40 (30,3%) Orthobunyaviruses. Simultaneous infections (MAYV), Mucambo (MUCV) and Chikungunya (CHIKV). were found in 55 (41,7%) samples and antibodies to Orthobunyavirus – Caraparu (CARV), Oropouche (OROV), YFV (vacine- 17D) in 117 (8,6%). The results suggest Catu (CATUV) and Tacaiuma (TCMV). From 282 tested an intense arbovirus circulation in Caxiuanã, indicating samples, 69,8% had antibodies to arbovirus of genus the need for monitoring arboviruses in the area. Positive Flavivirus (64,1% to DENV1, 60,2% to DENV2, 62,0% to samples were more frequent to MUCV and MAYV DENV3, 62,4% to DENV4, 62,0% to SLEV, 50,7% to ROCV, (alphaviruses); YFV and DENV (Flaviviruses); and OROV 64,8% to ILHV, 61,7% to WNV, 65,6% to YFV and 67,7% to yellow fever vaccine) and 0,3% to arbovirus of genus SVS. Alphavirus (0,3% to EEV), 1% to arbovirus of genus (Orthobunyaviroses). Financial Support: CNPq e IEC/ Orthobunyavirus (0,7% to CARV, 1,0% to OROV and HV81 - SEROEPIDEMIOLOGICAL SURVEY FOR 0,3% to CATUV). 29,7% had no antibodies to the tested ARBOVIRUS IN THE RESIDENT POPULATION OF ILHEUS, BAHIA Fernandes, D.D.C.; Arrúda, F.S.; Chagas, L.L.; Catenacci, differenceinarbovirus. Profile relation of to residentes sex. The age who group had between antibodies 40 L.S.; Ferreira, M.S.; Sousa, A.C.M.;Chiang, J.O.; Freitas, andto the 50 years tested old arbovirus was the most demonstrated affected, as nowell significant as people M.N.O.; Araújo, P.A.S.; Vasconcelos, P.F.C.; Martins, L.C. with low education, rural workers and people with poor 1. INSTITUTO EVANDRO CHAGAS sanitation conditions. Among the members of genus 2. UNIVERSIDADE FEDERAL DO PARÁ Orthobunyavirus, serological crossing was very subtle. 3. FACULDADE METROPOLITANA DA The genus Flavivirus was the most prevalent, however AMAZÔNICA it was observed serological crossing among the genus 4. FACULDADE INTEGRADA BRASIL AMAZÔNIA of public health importance in Brazil. Financial Support: members, probably due to circulation of many flavivirus Arbovirus are virus transmitted through the bite of haematophagous arthropods to living hosts, causing CNPqHV84 and - EVALUATIONIEC/SVS. OF PERSISTENT INFECTION diseases known as arboviruses, mostly zoonotics, and WITH HPV-16 VARIANTS IN REPRODUCTIVE AGED may present serius cases. They occur mainly in countries WOMEN ATTENDED AT HEALTH CARE UNITS IN with tropical climate, where the diversity of vectors BOTUCATU, SP, BRAZIL Candeias, J.M.G.; Silveira, A.C.; Kurissio, J.K.; Ferreira, S.; Pinto G.V.S.; Bolpetti, A.; Sichero, L.; Villa, L.L.; theand realization wild vertebrates of this issoroepidemiological large. Due to in city survey of Ilhéus/ aims Silva, M.G. toBA verify was isolated the prevalence an important of arbovirus flavivirus antibodies (Ilheus virus),in the resident population of city. The study evaluated 282 1. INSTITUTE OF BIOSCIENCES OF BOTUCATU, residents who accepted to be part of the survey and were SÃO PAULO STATE UNIVERSITY submitted to data questionnaires with informations as 2. CANCER INSTITUTE OF SÃO PAULO STATE age, sex, previous residences, current adress, occupation, 3. MEDICAL SCHOOL - UNIVERSITY OF SÃO education and vaccination historic. Then were collected PAULO blood samples and obtained the serums for serological 4. BOTUCATU MEDICAL SCHOOL, SÃO PAULO tests in Instituto Evandro Chagas. For detection of total STATE UNIVERSITY antibodies was used the Haemagglutination Inhibition Human Papillomavirus (HPV), among those, HPV-16 (HI) test, described by Shope (1963), using a antigen molecular variants have been shown to be differentially
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
119 Human Virology: HV involved in viral persistence and development of (B19V). The assembly of the reads allowed us to recover cervical lesions. Objective: To determine the persistence of HPV type and HPV-16 molecular variants involved in a twelve-month interval. Patients and Methods: It the complete genome of a B19V from the pool. Specific was a molecular study consisting of 1601 women aged ofPCR anti-B19V and Sanger IgM sequencingand IgG antibodies confirmed were the presencenegative, 18-50 years attended at Health Care Units in Botucatu, probablyof B19V because in 1/5 samplesthe individual in the was pool. in the The acute presence stage Brazil. HPV was detected by PCR and genotyping was of infection. This B19V infection was associated with a conducted by Linear Array HPV Genotyping Test (Roche fatal case of a 12-year-old boy who presented symptoms Molecular Systems Inc.). Sequencing of viral LCR was such as thrombocytopenia, hemorrhagic fever and done to evaluate HPV-16 intratypic variation. Results: shock; symptoms also associated with dengue virus Overall frequency of HPV detection was 33.0% and HPV- infection. Phylogenetic analysis using B19V complete 16 (17.0%) was the most frequent genotype. Among samples for which it was feasible to analyze intratype to genotype 1, the most prevalent genotype worldwide. genomes showed that the B19V/RJ2929 strain belongs variants belonging to four branches of geographical 1 from Brazil where this genotype is the prevalent and variability, we identified four different molecular widespread.This is the first Financial complete Support: genome CNPq of and a B19V FAPERJ genotype grants. prevalentand phylogenetic and diverse relatedness. group, Infollowed a first by evaluation the Asian- we HV86 - NOROVIRUS INVESTIGATION IN Americanverified that (6.4%), European African variants (4.8%) (87.0%) and North-American were the most GASTROENTERITIS CASES IN THE NORTHERN (1.6%). Within the European branch, 75.0% of the BRAZIL samples were prototype and the remaining 25.0% were Silva, L.D.; Hernandez, J.M.; Lucena, M.S.S.; Rodrigues, B-12. After a twelve-month interval, the persistence rate E.A.M.; Soares, L.S.; Mascarenhas, J.D.P.; Gabbay, Y.B. of HPV was 56.5% and 19.2% of them were HPV-16, INSTITUTO EVANDRO CHAGAS where 95.0% presented the same variant. Conclusion: Norovirus (NoV) infection is the most common cause of nonbacterial acute gastroenteritis, which affects mainly persistence is higher than the worldwide rate. Financial The findings of this study reinforce that the observed children. These viruses are predominant etiologic agents of foodborne and waterborne gastroenteritis in Support: FAPESP 2012/01278-0 FAPESP 2008/57889-1 the worldwide. However, the epidemiological impact of andHV85 CNPq - COMPLETE 573799/2008-3 GENOME from OF LLV. PARVOVIRUS B19 1 NoV infections in the northern region of the Brazil, still RECOVERED BY METAGENOMIC APPROACH need to be elucidated. In this study, we investigated the Conteville, L.C.; Zanella, L.; Marín, M.A.; de Filippis, occurrence of NoV in cases of gastroenteritis, that coming A.M.; Nogueira, R.M.; Vicente, A.C.; Mendonça, M.C.L. from the National Surveillance Program of Rotavirus Gastroenteritis-Northern region, coordinated by the INSTITUTO OSWALDO CRUZ/ FIOCRUZ Brazilian Ministry of Health. The detection of NoV was performed using a commercial enzyme immunoassay pathogens in different kinds of clinical samples. In (EIA) (Ridascreen® Norovirus, R-Biopharm) following thisMetagenomic study we analysisimplemented allows this theapproach identification to identify of the manufacturer’s instructions. The positive samples infectious agents present in serum samples from were tested by reverse transcription-polymerase chain patients with suspected dengue fever, but with negative reaction (RT-PCR) using primers for the polymerase gene. Sequencing was performed in ABI Prism 3130XL DNA Sequencer (Applied Biosystems, USA) and randomlaboratory primers, diagnosis. and The combined nucleic acidsinto one from pool five samplesfor high genotyping was accomplished with NoV genotyping performanceof different patientssequencing were on extracted, the Illumina amplified HiSeq using2500 tool 1.0. A total of 944 stool samples collected in the compare the reads to microbial genome databases. It was obtainedplatform. hits Taxonomic with similarity profiling to programsHuman Parvovirus were used B19 to Thestates frequency of Amazonas, observed Para and for Acre,this duringvirus in January/2012 these three to December/2014 were tested for NoV detection. October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
120 Human Virology: HV
inlocations 2014. Thewas 30.7%temporal (290/944), distribution being demonstrated 33.6% (139/414) that methods.purified bacteriocins All experiments were subjectedwere performed to quantification in Vero cell of thein 2012, NoV 26.6%circulated (59/222) all over in 2013the yearand 29.9%considering (92/308) the culturesproteins byand spectrophotometric the cytopathic effects and fluorometric were observed (Qubit) by results obtained for each state. The Amazonas state optical microscopy. The cytotoxic effect of the semi- demonstrated more regularity in the number of cases collected and detected. The frequencies of NoV in this the antiviral activity was determined by the reduction of viralpurified titer bacteriocins using the statistical was tested method by of MTT Reed method & Muench, and expressed in Viral Inhibition Index (IIV) and percentage state was 35.5% (104/293), 33.5% (54/161) and 35.1% inhibition (PI). The index of selectivity (IS) was calculated (66/188) in the three years studied respectively. Also as the ratio of CC50 and ED50. RESULTS: The antiviral peaks of positivity for NoV were observed in May/ samplesNovember from 2012, Amazonas March/November were sequenced 2013 and and most June/ of bacteriocins (40% iso-propanol fraction of bacteriocin themSeptember/December were characterized 2014. as genotype Some of GII.Pe, the a positive strain producedassays showed by L. thatplantarum one of ST8Sh) the analyzed were active semi-purified against that is related with the variant GII.4 Sydney 2012, which emerged in Manaus in June 2012, and became the most presented 95.6% inhibition of herpes virus and IS greater prevalent strain in 2013 and 2014, replaced the other thanHSV-1 13.6. and Moreover Aichivirus. it was This also semi-purified active toward bacteriocinAichivirus, variants of GII.4 circulating in this region. The positivity it presented 74.9% inhibition of the replication with IS obtained in this study demonstrates the importance of exceeding 10.2. The remaining bacteriocins showed no the NoV as causative agent of gastroenteritis. Continued antiviral effect. CONCLUSIONS: The study showed that surveillance and molecular characterization is necessary to provide information on epidemiological and effect with potential application. On our knowledge, this molecular trends of NoV strains. Keywords: norovirus, one of the semi-purified bacteriocins presented antiviral gastroenteritis, surveillance. Financial Support: Evandro against aichivirus. Keywords: herpes simples, aichivirus, Chagas Institute, FAPESPA. bacteriocin,is the first study antiviral. showing Financial antiviral Support: effect CNPq.of a bacteriocin
HV95 - EVALUATION OF THE ANVITIRAL ACTIVITY HV98 - EVALUATION OF GENETIC VARIABILITY OF OF BACTERIA FRACTIONS AGAINST HUMAN HERPES HEPATITIS C VIRUS (HCV) CORE AND NS3 REGIONS VIRUS 1 AND AICHIVIRUS IN RELATION TO INSULIN RESISTANCE Jesus, M.G.; Mendes, G.S.; Vilas Boas, L.C.P.; Lima, Scalioni, L.P.; Almeida, A.J.; Silva, A.P.; Miguel, J.C.; L.M.P.; Franco, O.L.; Todorov, S.D.; Silva, P.A. Espírito-Santo, M.P.; Marques, V.A.; Villela-Nogueira, C.A.; Lewis-Ximenez, L.L.; Lampe, E.; Villar, L.M. 1. UNIVERSIDADE CATÓLICA DE BRASÍLIA 2. UNIVERSIDADE FEDERAL DE VIÇOSA 1. FIOCRUZ Viruses are presents in a wide range of organisms and 2. UNIRIO some of them are a public health problem. Considering that 3. UFRJ few drugs are available for treatment of viral infections, The pathogenetic role of hepatitis C virus (HCV) in the controls and vaccination programs have been the development of insulin resistance (IR) is not fully reinforced to prevent human viral infections. Antiviral understood. The aim of this study was to determine activities have been tested in some molecules, including the genetic variability of core and NS3 regions of HCV bacteriocins that showed antiviral activities making genome among HCV patients with and without IR in them candidates for antiviral drugs. This study aimed to order to identify possible mutations associated with IR. evaluate the antiviral activity of bacterial extracts against A total of forty-eight treatment-naive patients infected human herpes virus 1 and aichivirus. MATERIALS AND with HCV underwent peripheral blood collection to lactic acid bacteria were tested against Herpes Simplex phosphatase, insulin, glucose, triglycerides, HDL and VirusMETHODS: 1 (HSV-1) Ten semi-purified and against thebacteriocins Aichivirus. produced The semi- by LDL)determine and complete laboratory blood markers cell count. (ALT, IRAST, was ɣ-GGT, calculated alkaline by
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
121 Human Virology: HV using the Homeostasis Model Assessment (HOMA) index HV100 - IMPROVEMENT AND APPLICATION OF NESTED-PCR TO DETECT HUMAN HERPESVIRUS IN load and genotype were determined by Abbott Real time SERUM AND CEREBROSPINAL FLUID WITH USE OF HCVwhere (Abbott, IR was USA).defined HCV as RNAHOMA was higher extracted than 2.with HCV Qiamp RNA CONSENSUS-DEGENERATE PRIMERS Viral RNA minikit (QIAGEN, Germany) and reverse Bonon, S.H.A.; Dellariva, T.C.; Rimério C.A.T.; De transcription was done using Superscript III reverse Oliveira, R.S.; Leon, L.L.; Costa, S.C.B. enzyme transcriptase (Invitrogen, USA) with random UNIVERSIDADE ESTADUAL DE CAMPINAS (3289 – 4054 nt) and core (448 – 732 nt) fragments. Human herpesviruses are a major cause of infections in Directprimers. nucleotide A nested sequencingPCR was used was for done amplification using ABI of Prism NS3 humans and they are able to establish latency in infected 3730XL Genetic Analyzer (Applied Biosystems, USA) and individuals and reactivated when exposed to biological, sequences were analyzed in MEGA v.6.0. Chi -square test psychological or chemicals stimulus. This viral group was used to compare mutations prevalence. Among 48 consists in three subfamilies: Alpha-herpesvirinae, HCV-positive patients, mean age was 54.7 years (±11.2) Beta–herpesvirinae and Gamma–herpesvirinae which and females were predominant (60.4%). Mean HCV include, respectively, Herpes Simplex type 1 and 2 (HSV- viral load was 1.9 x 106 (±3.5 x 106 1 and HSV-2) and Varicella Zoster virus (VZV or HHV- infected by HCV genotype 1b, and 29.2% presented IR. 3); Human Cytomegalovirus (HCMV or HHV-5), Human In bivariate analyses, serum total )cholesterol IU/mL, 62.5% (p=0.03) were Herpesvirus type 6 and 7 (HHV-6 and HHV-7); Epstein- and insulin (p <0.001) were statistically related to Barr virus (EBV or HHV-4) and Human Herpesvirus type IR. As to core region, 17 individuals (35%) presented 8 (HHV-8). Currently, the diagnosis of infectious diseases had a considerable advance after implantation of and 23 patients (47.9%) presented substitutions at molecular techniques, especially the Polymerase Chain substitutions at amino acid 70 (arginine) (R70E/H/P) Reaction (PCR), once it presents high sensitivity and
C1042T,amino acid I1061V, 91 (methionine) T1068S, (M91L/C).T1087S, R1088K, In the NS3 I1090L, region, of consensus-degenerate primers in PCR has become an the following substitutions were found: A1033S/T, specificity from low quantities of nucleic acids. The use of member of Herpesviridae family present in patients’ andS1092G, L1201M. I1098T/V/L/S, The number T1100M, of mutations Q1115P/A, in core S1117A, or NS3 samples.efficient alternativeMaterials forand the Methods. detection It andwas identificationtested eight genesI1158V/L, was T1173S/A/M,not related to theL1179I, presence I1196V, or absenceN1200S/T/A, of IR. herpesvirus positive controls and twelve serum and Mutations at position 91 of the core region were more common than in the position 70, but these mutations clinical manifestations of herpesvirus infections in the were not associated with the presence of IR. In addition, nervouscerebrospinal system. fluid PCRs (CSF) were samples performed from in patients, nested form with several amino acid substitutions in the NS3 region were also observed, but none of them was associated with which was designed from highly conserved amino acidusing sequences degenerate of primers herpesviral on first DNA and polymerase second reactions, gene. in the core and NS3 genes does not play a role in the developmentIR. These findings of IR. Financial appear toSupport: suggest FAPERJ, that variability FIOCRUZ, control positive samples, it was possible to detect the CAPES. threeResults. herpesvirus After successful subfamilies of Nested in PCRbiological amplification samples, in
HHV-6 and HHV-8. In relation to these twelve patients’ samplesalso, more tested, specifically four of HSV-1them were and HSV-2,positive EBV, for Alpha- HCMV, herpesvirinae and Gamma-herpesvirinae subfamilies (three serum samples and one CSF), while a single CSF sample was positive for Beta-herpesvirinae subfamily. Conclusion. The development of molecular methods have been of fundamental importance in helping the clinical
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV diagnosis, therapy, classification and epidemiological XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
122 Human Virology: HV studies of diseases and the application of degenerate that showed cytopathic effect, the supernatant was collected and extracted using the QIAamp viral RNA kit, the positive samples and then carrying out further primers allows identification and prior screening of Conclusion: From a total of 80 samples inoculated in the of herpesvirus species and the initial characterization of aboveusing -ifmentioned such conventional 05 (6%) wereRT-PCR positive techniques. in cell Results/ culture, newspecific herpesviral experiments genomes. in order Financial to effective Support: confirmation FAPESP. with ECP starting the second passage. When subjected to genomic sequencing, we obtained the following HV104 - ISOLATION AND MOLECULAR results: adenovirus type C; poliovirus 1; coxsackievirus CHARACTERIZATION OF ENTEROVIRUS IN 18 and the other two samples are still in the process GASTROENTERITIS CASES IN AMAZON REGION IN 2012 the need to investigate other viral agents circulating in Cunha, C.C.C.; Silveira, E.; Alves, J.C.S.; Alves, A.S.; theof identification. population after The the results introduction find in this rotavirus study vaccine,confirm Soares, L.S.; Cortinhas, J.C.M.; Tavares, F.N.; Júnior, making it extremely important knowledge of these E.C.; Ferreira, J.A.; Wanzeller, A.L.M. agents and the assessment of impacts in the human INSTITUTO EVANDRO CHAGAS population. Financial Support: Instituto Evandro Chagas The acute gastroenteritis (GA), affecting mainly children /HV108 SVS / MS.- PHYLOGENETIC ANALYZES OF INFLUENZA A and mortality worldwide. With the advent of Rotarix (H1N1)PDM09 HEMAGGLUTININ GENE DURING AND vaccineunder five in 2006years (WHO,of age, 2009),associated many with other high viruses morbidity have AFTER THE PANDEMIC EVENT IN BRAZIL been associated with gastroenteritis, such as norovirus, Resende, P.C.; Motta, F.C.; Born, P.S.; Machado, D.; adenovirus, sapovirus among others. Some Enterovirus Caetano, B.C.; Brown, D.; Siqueira, M.M. (EV) that has been associated with acute gastroenteritis in humans remains unknown etiology, as nonpolio INSTITUTO OSWALDO CRUZ enteroviruses. These viruses remain viable for a long time into sewers, feces, water and also in the hands, detected in Brazil in May 2009, and spread extensively throughoutPandemic influenza the country A H1N1 causing [A(H1N1)pdm09] a peak of infectionwas first route and can also be transmitted by aerosols in areas during June to August 2009. Since then, it has continued withfavoring good a moresanitary efficient conditions. transmission EV is aby rounded the fecal-oral virus, to circulate with a seasonal pattern, causing high rates not enveloped, icosahedral symmetry, sigle-stranded of morbidity and mortality. Over this period, the virus RNA virus with 27-30nm in diameter. These viruses has continually evolved with the accumulation of new are resistant to ether, chloroform and acidic (pH 3.0). mutations. With this became interesting evaluate the circulation of genetic variants in Brazil, compare these albino mice. This system provides to a greater amount ofAll viral EV known particles, can increasing be propagated the chances in cell cultureof getting and to / the or follow up potential genetic markers associated with viral nucleic acid used in the PCR reactions. This study virulence.virus with Inthe this vaccine study strain we analyzeA/California/7/2009 the phylogenetic and aims to detect enteroviruses in negative diarrheal stool relationship in a collection of 220 A(H1N1)pdm09 samples for rotavirus from the Surveillance Network hemagglutinin (HA) gene sequences collected during for gastroenteritis in the period 2012. Methods: cells and after the pandemic period (2009 to 2014) in cultures (HEp 2C, RD and L-20b) were inoculated with Brazil. In addition, we have looked for evidence of viral 0,2 ml of a 1:10 fecal suspension negative for rotavirus polymorphisms associated with severe disease and belongs the Surveillance Network for gastroenteritis. compared the range of viral variants with the vaccine Maintenance medium (Sigma) supplemented with 2% strain used throughout this period. The phylogenetic analyzes in this study revealed the circulation of at least eight genetic groups in Brazil. Three (G6-pdm and G7- foetal calf serum, L-glutamyne 200mM, penicillin (100UI/ pdm) co-circulated during the pandemic period, showing ml), streptomycin (100µg/ml), HEPES 1M (pH 7.3), amphotericin B (3µg/ml) and 1.5g/l sodium bicarbonate wasOctober then 2015 added Volume and 20 –the Supplement flasks incubated 1 - Abstracts/Posters at 37°C. Those- Human Virology:an early HV pattern of viral diversification with a low XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
123 Human Virology: HV genetic distance from vaccine strain. Other phylogenetic groups, G5, G6 (including 6B, 6C and 6D subgroups), as template in sequencing reactions. From 49 tested and G7 were found in the subsequent epidemic seasons samples,nested PCR 33 samples(67.3%) were purifiedpositive for and DENV used RNA directly by from 2011 to 2014. These viruses exhibited more amino RT-semi-nested PCR, of which 26 DNA fragments were acid differences from the vaccine strain with several substitutions at the antigenic sites. This is associated with a single DENV serotype: 8 (40%) as DENV-3, 5 (25%)sequenced. as DENV-4, Twenty 4 samples(20%) as (76.9%)DENV-2 and were 3 identified(15%) as Furthermore, we observed a polymorphism associated with a theoretical decrease in the vaccine efficacy. one serotype resulting in an overall prevalence rate ofDENV-1. concurrent Six samples infections were of identified23.1% with with the more following than reinforcingwith severe/fatal previous cases reports at residue that described 222 of the this HA residue gene. distribution: 4 (15.4%) with two DENV serotypes (50% asThis a potential was significantly virulence marker. associated This with study severe provides disease new with DENV-2 and DENV-3, 25% with DENV-3 and DENV- information about the circulation of some viral variants 4 and 25% with DENV-2 and DENV-4); samples from two in Brazil, follows up potential genetic markers associated dengue cases (7.7%) were detected with three DENV serotypes (DENV-2, DENV-3 and DENV-4). DENV-3 was current vaccine against more recent A(H1N1)pdm09 detected in 13 (50%) samples, including the ones with strainswith virulence may be reduced. and allows Financial infer Support: if the efficacy DECIT, ofCNPq, the single or concurrent infections, being the predominant FAPERJ. serotype of the outbreak. On the basis of phylogenetic analyses, DENV-1 isolates belong to genotype V. DENV-2 HV116 - SPATIAL-TEMPORAL CO-CIRCULATION OF sequences grouped to American-Asian genotype, DENV- DENGUE VIRUS 1, 2, 3 AND 4 ASSOCIATED TO CO- 3 samples to genotypes I and III and DENV-4 samples INFECTION CASES IN CONTAGEM, MINAS GERAIS, BRAZIL: A FOUR WEEK SURVEY demonstrated the presence of the four DENV serotypes Marinho,P.E.S.; Andrade,E.H.P.; Figueiredo,L.B.; andto genotype more than I and one II. genotype This is the for first DENV-3 report and that DENV-4, clearly Vilela, A.P.P.; Rosa,J.C.C.; Oliveira,J.G.; Zibaoui,H.M.; besides the occurrence of concurrent infections with Araújo, V.E.M.; Ferreira,P.C.P.; Abrahão, J.S.; Kroon, two or three serotypes during a short period of time E.G. in Contagem, Minas Gerais, Brazil. Keywords: Dengue 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS virus; Contagem; co-circulation; concurrent infectious. 2. CENTRO DE PESQUISAS RENE RACHOU: FIOCRUZ MINAS 3. SECRETARIA MUNICIPAL DE SAUDE DA Financial Support: CAPES, CNPq, FAPEMIG/ CNPq/ PREFEITURA DE CONTAGEM PRONEXHV117 Dengue - ANTIVIRAL /INCT-Dengue. ACTIVITY OF MAYTENUS IMBRICATA EXTRACTS AGAINST FLAVIVÍRUS In dengue endemic countries the co-circulation of Marinho, P.E.S.; Rodrigues, V.G.; Duarte, L.P.; Kroon, multiple Dengue virus (DENV) serotypes in the same E.G. area has been described. Contagem is a city located in the State of Minas Gerais, in the Southest region of Brazil. UNIVERSIDADE FEDERAL DE MINAS GERAIS In 2013, a dengue epidemic occurred in Contagem with Members of the Flavivirus genus which belongs to the Flaviviridae family, as Dengue virus (DENV) and the Yellow fever virus (YFV), and emerging viruses as St. 22,808 notified cases until May from a total of 23,436 total of 49 acute phase plasma samples from patients Louis encephalitis virus (SLEV), are arboviruses with notified cases in 2013, of which three patients died. A clinically suspected of dengue admitted to Geraldo Pinto high burden in global public health. Despite the efforts, Vieira Hospital in Contagem, were collected during there is no dengue vaccine, unlike yellow fever, whose four weeks of May, 2013. All patients were residents of vaccine is safe and effective.Antiviral drugs approved Contagem or neighboring cities. RNA of DENV serotypes 1, 2, 3 and 4 was detected by RT-semi-nested PCR there is a clear necessity for safe and effective drugs targeting the C-prM region of its genome. Positive semi- against these any flaviviruses viruses. In arethis unavailable. context, plants, Consequently, and their
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
124 Human Virology: HV therapeutic use in popular medicine, have provided HV118 - KIR GENES POLYMORPHISM IN COINFECTED the development of several drugs today widely used PATIENTS WITH HUMAN IMMUNODEFICIENCY VIRUS in the clinic. The Maytenus imbricata species is an (HIV) AND HEPATITIS C VIRUS (HCV) endemic plant in Brazil and its antiviral activity was Nunes, C.; Massolini, V.M.; Barbosa, F.H.; Nunes, C.; not investigated yet. This study aimed to evaluate the Barbosa, A.N.; Silva, G.F.; Grotto, R.M.T.; Pardini, antiviral activity of M. imbricata against DENV-4, SLEV M.I.M.C. and YFV. Screening of FSEAT, SEM and SEAT extracts obtained from M. imbricata roots against DENV-4, SLEV SAO PAULO STATE UNIVERSITY “JULIO DE MESQUITA FILHO” and YFV was carried out by means of the MTT technique. Selectivity indexes (SI) were obtained ranging from 7.7 Human vulnerability to HIV infection is not uniform, to 10.3 for DENV-4; 3.8 to 6.9 for SLEV; and from 5.4 virological and host factors are determinants on the to 8.3 for YFV.In virucidal activity tests against these risk of transmission and natural infection progression. viruses SI ranging from 13,6 to 20,9 against DENV-4; KIR genes polymorphisms have been being associated 9.1 to 19.4 against SLEV; and 11.2 to 13.5 against YFV with progression of HIV infection. Several studies have were obtained. When the extracts were incubated with been performed in HIV mono-infected patients, but is 106 pfu of virus for 5, 15, 30 minutes and 1 hour, there unknown about the relation of these polymorphisms was a decrease of up to 3 log10 (SEAT against YFV) in viral titer compared to the untreated control, and this action increased to maximum virucidal action after 1h HCVin HIV/HCV coinfected coinfection. and its Theassociation goal of thiswith studyclinical was and to of incubation. The extracts showed no activity in the virologicalevaluate KIR parameters. genes polymorphisms Materials and in Methods: patients HIV/The pre- and post-treatment of in vitro infections. None of study included 251 samples which were divided into three groups (Group 1: 100 HIV mono-infected; Group other DNA and RNA viruses, enveloped or not. This screeningthe extracts allowed showed us significant to also argue antiviral that activity the virucidal against HCV). Determination of subtypes (HIV) and genotypes activity of the extracts against DENV, SLEV and YFV is (HCV)2: 100 mono-infectedwas performed HCV; using Group RT-PCR 3: 51 Co-Infectedand sequencing. HIV/ not only due the envelope presence since, with the KIR genes polymorphisms were determined by PCR- exception of EMC, all other viruses tested presented SSP. Clinical and laboratory data were collected from an envelope. This suggests that active substances of patients’ medical registers. Results: The results showed the extracts may have selective action on the Flavivirus the genes KIR3DL3, KIR3DP1, KIR2DL4 and KIR3DL2 in viral envelope. The mechanism of action of the antiviral all patients due to this genes are considered framework activity of the extracts remains to be elucidated, but it genes. The genes more frequent were KIR2DL1 (G1:99%; can be concluded that M. imbricata has a potential to G2:95% and G3:100%), KIR2DL3 (G1:93%; G2:95% and continue to be studied. It is advantageous because it G3:92%), KIR2DS4 (G1:90%; G2:93% and G3:98%), presents relevant activity not only against DENV, but KIR3DL1 (G1:92%, G2:95% and G3:100%) and KIR2DP1 (G1:99%; G2:93% and G3:100%). The gene more rare Keywords: Antiviral, Flavivirus, Maytenus imbricata. was KIR2DS3 (G1:28%; G2:35% and G3:37%). The also against other flaviviruses without antiviral therapy. results obtained are according the previously described.
Financial Support: CAPES, CNPq, FAPEMIG/ CNPq/ polymorphism and clinical (aids or asymptomatic PRONEX Dengue /INCT-Dengue. disease)No significant and virological association (HIV (P>0.05) viral load, between (HIV antigenicity KIR genes
coinfected patients was found by this study. Conclusion: Theand absence cytopatogenic of correlation effect) between parameters the polymorphism in HIV/HCV of KIR genes with progression of HIV infection in coinfected suggests that, in this particular condition, the
progression by the HCV than the aids development in presence of HIV may influence much more the disease October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
125 Human Virology: HV
of the positive patients). Relationship between severe 9). dengue and the infecting serotype was not observed. itself. Financial Support: FAPESP (Process 2013/21214- In these patients, symptoms usually associated with HV119 - EPIDEMIOLOGICAL ASPECTS OF DENGUE the disease have higher prevalence indeed, except by CASES CONFIRMED BY MULTIPLEX-NESTED PCR, IN arthralgia. The worrying is that currently Alagoas state ALAGOAS suffers an outbreak of Zika virus and exclusion criteria Lira, E.L.; Lima, A.R.V.; Muller, V.M.; Leite, R.B.; for dengue disease is the normal level of platelets. This Pacheco, L.M.M.; Borges, A.A. may be generating underreporting or misdiagnose on 1. UNIVERSIDADE FEDERAL DE ALAGOAS these infections in Alagoas state. Financial Support: 2. HOSPITAL ESCOLA DR. HELVIO AUTO Dengue is a mosquito-borne viral disease caused by MinistérioHV122 - PREVALENCE da Saúde/CNPq/SESAU-AL/ OF TYPE-SPECIFIC FAPEAL. HPV AMONG four dengue virus serotypes (DENV 1–4), belonging FEMALE UNIVERSITY STUDENTS FROM NORTHERN to the genus Flavivirus (family Flaviviridae). Global BRAZIL incidence of dengue has increased 30-fold in the past Sousa, M.S.; Vieira, R.C.; Monteiro, J.S.V.; Manso, E.P.; 50 years and nowadays this disease is endemic in more Santos, M.R.M.; Prazeres, B.A.P.; Costa, C.C.S.; Henning, than 100 countries. In 2014, Brazil recorded 591,080 J.S.L.; Trindade, J.Q.; Ishikawa, E.A.Y.; Tsutsumi, M.I.; cases of suspected dengue and Alagoas state had the Ferrari, S.F.; Lima, K.V.B. second highest incidence rate of dengue with 399.6 cases per 100 thousand inhabitants. Although Alagoas 1. UNIVERSIDADE FEDERAL DO PARÁ state has dengue epidemics almost every year, there 2. UNIVERSIDADE FEDERAL DE SERGIPE 3. INSTITUTO EVANDRO CHAGAS Human papillomavirus (HPV) infection is associated with is no scientific records about the disease in the region. cervical cancer, the most frequent cancer in women from analysis.Therefore, Sera this studysamples describes were theobtained epidemiologic from Hospital profile northern Brazil. Assessment of the short-term impact of Schoolof patients Helvio with Auto, acute which dengue, is state confirmed reference by tomolecular dengue HPV vaccination depends on the availability of data on disease treatment, between January and September 2014. The study included patients presenting within the the pre-immunization period, although these data are currentlythe prevalence unavailable of type-specific for the study HPV inregion. young The women aim inof were obtained by questionnaire completed by patient this study was to estimate the distribution of all mucosal responsefirst seven and days from of clinicalmedical illness. records. Epidemiological Molecular analysis data HPV genotypes, including low- and high-risk HPV was performed by reverse transcription-PCR (RT-PCR), types, in unvaccinated college students from northern followed by multiplex nested PCR (M-N-PCR) using set Brazil. Specimens were collected from 265 university primers anneal to the NS5 gene of Flavivirus. The STATA students during routine cervical cancer screening. The MP13 software carried out the statistical analysis. Of HPV DNA was assessed by Polymerase Chain Reaction the 127 samples analyzed, 44 (34.64%) had detectable and positive samples were genotyped by Restriction RNA DENV (2 DENV-2 and 42 DENV-4). The mean day of Fragment Length Polymorphism. Most students (85.7%) illness for positive patients was 3.5 (standard deviation, had normal cytological results. The prevalence of HPV 0.97) e the mean age was 27.27 years old (standard deviation, 14.73). More than 50% positive patients infections and non-vaccine high-risk HPV genotypes. reported severe headache (88.64%), pain behind the Thewas 25.3%most prevalent (67/265), type with was a high HPV-61 frequency (5.3%), of followedmultiple eyes (68.18%), pain muscle (77.27%) and high fever by types 82, 16, 59, and 6. Multiple infections were (97.73%). These cases, 72.73% showed a decrease of associated with high-risk and possibly high-risk HPVs. leukocytes, however, 54.55% of them had a normal We demonstrated a high prevalence of HPV infection platelet count. Also noted that among the warning in university students from northern Brazil. Vaccine signals for severe dengue only abdominal pain had a high-risk types were relatively rare, emphasizing the strong correlation (p 0.018) with low platelets (71.43% predominance of carcinogenic genotypes that are not
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
126 Human Virology: HV prevented by the currently available vaccines. Our study patients. In this context, this study evaluated the highlights the need to reinforce cytological screening association between the presence of HIV variant B’ in in women from northern Brazil, and promote the early diagnosis and treatment of the precancerous lesions the progression of HIV infection. Material and Methods: associated with cervical cancer. Financial Support: This patients HIV/HBV coinfected and, their relationship with study was supported by Fundação de Amparo à Pesquisa patients was used as source to amplify and sequencing do Estado do Pará (FAPESPA), Instituto Evandro Chagas thePlasma region RNA HIV viral gp120 isolated C2-V3 from in patients 54 HIV/HBV coinfected coinfected with (IEC) and Universidade Federal do Pará (UFPA). HBV. The sequences obtained were used to infer the phenotype V3 loop. Clinical Data were collected using the HV123 - HIV GP120 V3 LOOP TIP AND HIV INFECTION patients’ medical registers. Results and Conclusion: The PROGRESSION IN PATIENTS COINFECTED WITH HIV AND HEPATITIS B VIRUS difference (P >0.05) for progression to aids among the Santos, F.M.; Zugaib, R.; Massolini, V.M.; Souza, L.R.; results showed that there was no statistically significant Silva, G.F.; Grotto, R.M.T.; Pardini, M.I.M.C. variants from HIV/HBV coinfected patients with V3 loop 1. MOLECULAR BIOLOGY LABORATORY, effect of the variant B ‘seems to be lost by the presence phenotype GPG or GWG, suggesting that the “protective” TRANSFUSION BLOOD CENTER, BOTUCATU of HBV. Financial Support: FAPESP. MEDICAL SCHOOL, UNESP, BOTUCATU-SP, HV124 - ALLELIC AND GENOTYPE FREQUENCIES OF BRAZIL 2. TROPICAL DISEASES DEPARTMENT, HUMAN PLATELET ANTIGENS IN PATIENTS WITH BOTUCATU MEDICAL SCHOOL, UNESP, HEPATOCELLULAR CARCINOMA DUE TO CHRONIC BOTUCATU-SP, BRAZIL HEPATITIS C 3. DEPARTMENT OF INTERNAL MEDICINE, Santos, F.M.; Picelli, N.; Silva, G.F.; Pardini, M.I.M.C.; BOTUCATU MEDICAL SCHOOL, UNESP, Grotto, R.M.T. BOTUCATU-SP, BRAZIL 1. MOLECULAR BIOLOGY LABORATORY, 4. DEPARTMENT OF BIOPROCESS AND TRANSFUSION BLOOD CENTER, BOTUCATU BIOTECHNOLOGY, SCHOOL OF MEDICAL SCHOOL, UNESP, BOTUCATU-SP, AGRICULTURAL SCIENCES, LAGEADO BRAZIL EXPERIMENT STATION. SAO PAULO STATE 2. DEPARTMENT OF INTERNAL MEDICINE, UNIVERSITY, UNESP BOTUCATU MEDICAL SCHOOL, UNESP, HIV and HBV infections compose some of the biggest BOTUCATU-SP, BRAZIL public health problems. The HIV in coinfection with HBV 3. DEPARTMENT OF BIOPROCESS AND accelerates the evolution of liver diseases caused by BIOTECHNOLOGY, SCHOOL OF hepatitis B. Those patients could have more consequences AGRICULTURAL SCIENCES, LAGEADO than the monoinfected. In the coinfected individuals, the EXPERIMENT STATION. SAO PAULO STATE risk of cirrhosis and mortality increases, and, in some UNIVERSITY, UNESP cases, the hepatitis B virus can be reactivated. Thus, the The Chronic Hepatitis C is result of the Hepatitis C Virus (HCV) infection. The disease constitute a public progression of diseases are important to improve the discovery of biological factors that can influence the health of the population. Patients infected by HIV virus and, approximately 1-4% of the patients with chronic subtype B, are the most common in Brazil. They are Hepatitishealth problem C can duedevelop to progressive hepatocellular hepatic carcinoma. fibrosis characterized by the presence of the GPG sequence of Although the HCV target cells are hepatocytes, the viral amino acids found in the V3 loop region. Some types of RNA has already been found in others cells, including virus has the sequence GWG in the V3 loop region, which platelets. Human platelets express several types of are called variant B’. Studies showed that the patients antigens on their surfaces, among these, are the Human with the variant B’ has slow progress to AIDS when Platelet Antigens (HPA). Polymorphisms on HPA compared with non-carriers of this variant but these similar to the HLA polymorphisms, and they have been studies were performed only using HIV monoinfected associated to some diseases, including the HCV infection. October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
127 Human Virology: HV
Studies have shown that HPA polymorphism may reactivation are more common than previously thought. perform an important role on the response to treatment Today, VZV is recognized as the most common cause of and progression of the disease caused by HCV, however, viral encephalitis and is the second most common cause no study has reported any relation between the presence of viral meningitis after enteroviruses. Neurological of hepatocellular carcinoma and polymorphisms of manifestations include encephalitis, myelitis, meningitis, the HPA system yet. DNA isolated from 65 patients cranial neuritis, and vasculitis. Since the introduction with chronic Hepatitis C and hepatocellular carcinoma was used as source for HPA-1 genotyping using PCR- in the CNS at the beginning of the 1990s, the number SSP. Demographic, clinical e virology parameters were of DNA amplification by PCR for the diagnosis of VZV collected from medical registers of patients. As a control (CSF) samples from patients with typical symptoms of group, were used patients presenting HCV without viralof diagnosed CNS infection cases from has 2012 increased. to 2013 Cerebrospinal were tested using fluid hepatocellular carcinoma with HPA – 1, genotyped by real time PCR assays for varicella zoster virus (VZV). the same methodology related to the study conducted Each sample was immediately processed for nucleic by Verdichio Moraes et al (2009). The Hardy–Weinberg acid extraction using an automatic nucleic acid extractor equilibrium was performed to evaluate the distribution (Qiagen, Germany) and then analyzed by real time PCR of allelic frequency of HPA-1 in patients infected with assays. Varicella virus genome was found in 13 of the 391 HCV with hepatocellular carcinoma and control group. (3.3%) of CSF samples analyzed. Most patients included The Chi-square test was used to investigate possible in this study (22%) aged 36-50 years; 19% aged 50- 75 years; 14% aged 20-35 years; 13% aged 2-8 years, on the studied groups. Of the 65 patients included in and 11% were younger than 1 year old. Our results thisassociations study 58 of (87.9%) the HPA-1 were genotypes men, 43 (65.15%) and/or alleles were showed that the neurologic complications of varicella Caucasian, 47 (71.21%) presented viral load upper infection continue to occur despite the availability of an effective vaccine. In addition, in viral infections for distribution50UI/mL, suggesting of HPA-1 among active the infection. patients infected Despite with not PCR assays presented provide reliable diagnostic tools HPC,existing with significant and without differences hepatocellular in genotype carcinoma, frequency there forwhich timely specific initiation treatments of appropriate are available, therapy the quantitative and for was a deviation from Hardy–Weinberg equilibrium. The strategies. Financial Support: CAPES. patients with hepatocellular carcinoma than without rapid assessment of the efficacy of antiviral treatment hepatocellularHPA -1b allele found,carcinoma, was significantlysuggesting higherthat the in HCV-HPA HV129 - DETECTION OF THE RECOMBINANTS GII. -1b could be a genetic marker of progression, from P7/GII.6 AND GII.P22/GII.5 NOROVIRUS STRAINS the chronic hepatitis C to hepatocellular carcinoma. IN HOSPITALIZED CHILDREN, FROM MANAUS, Financial Support: FAPESP. AMAZONAS, BRAZIL, DURING 2012 AND 2014 Hernandez, J.M.; Silva, L.D.; Junior, E.C.S.; Lucena, HV125 - REAL TIME PCR DETECTION OF VARICELLA- M.S.S.; Soares, L.S.; Mascarenhas, J.D.P.; Gabbay, Y.B. ZOSTER VIRUS DNA IN CEREBROSPINAL FLUID IN 1. PROGRAMA DE PÓS GRADUAÇÃO EM PATIENTS WITH NEUROLOGICAL DISORDERS VIROLOGIA Barbosa, T.F.; Figueiredo, C.A.; Oliveira, M.I.; Silva, 2. SEÇÃO DE VIROLOGIA, INSTITUTO P.E.; Pereira, F.C.; Curti, S.P. EVANDRO CHAGAS INSTITUTO ADOLFO LUTZ Norovirus (NoV) consists of small round virion with a Varicella zoster virus (VZV) is ubiquitous throughout single-stranded RNA genome. NoV is responsible for the world. Initial infection with VZV results in varicella, outbreaks and sporadic cases of nonbacterial acute which is typically seen in children aged 1–9 years. In most gastroenteritis worldwide. This agent suffers a dynamic temperate climates, more than 90% of people are infected process of mutation and recombination, leading to the before adolescence. Recent data suggest that central emergence of new strains that cause global epidemics. nervous system (CNS) complications caused by VZV
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology:The recombination HV usually occurs in the ORF1/ORF2 XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
128 Human Virology: HV overlapping region, allowing the appearance of strains HV136 - EVALUATION OF HEMODIALYSIS PATIENTS with different genotypes in polymerase and viral capsid WITH ACUTE HEPATITIS C EMPLOYING AN ADAPTED ANTIBODY AVIDITY ASSAY AND COMPARISON TO A some positive samples for NoV were recombinants. COMMERCIAL TEST region. The objective of this study was confirming if So, four samples collected from hospitalized children Magalhães, J.; Figueiredo, A.S.; Coimbra, L.; Sousa, with diarrhea, being three obtained in 2012 and one in P.F.; Hasselmann, B.; Almeida, A.J.; Peres, L.R.; Zenatti, 2014 were tested by reverse transcription-polymerase V.R.; Lampe, E.; Lewis-Ximenez, L.L. LABORATORY OF VIRAL HEPATITIS/OSWALDO CRUZ FOUNDATION C,D1,D3)chain reaction gene. In (RT-PCR) order to using investigate specific the primers potential for NoV the recombinantpolymerase (Mon genotypes, 431/432/433/434) another PCR using and capsidthe primers (Cap Acute hepatitis C virus (HCV) infection is usually Mon 431 and G2SKR was done targeting the junction asymptomatic leading to chronicity in at least 70% of region. The PCR products were sequenced and the the cases. It is frequently undetected due to the lack sequences edited in BioEdit Sequence Alignment Editor (v.7.2.5) software. Phylogenetic analyses were performed infection. Antibody avidity testes detect the change of with the MEGA 6.06 software. To determine the antibodyof serological avidity markers along with specific disease to progression. the early phase Despite of the existence of avidity assays for research, there is no nucleotide sequence was analyzed with reference strains licensed kit for clinical use in Brazil. Here we report the obtainednucleotide from breakpoint, GenBank the andORF1/2 Norovirus junction Genotyping consensus use of an Adapted Avidity Assay to evaluate the avidity Tool version 1.0 in Simplot software v.3.5.1. The three samples from 2012 showed the GII.P7 genotype for the comparison to a commercial avidity test. Plasma samples viral polymerase and GII.6 to the capsid. The junction wereprofile from of hemodialysis 17 hemodialysis patients patients with diagnosed acute HCV with and acute the HCV after outbreaks in 2007 and 2013. Date of infection subjected to Norovirus Genotyping Tool version 1.0. and seroconversion were established. Fourteen patients Thesequence analysis of in ORF1/ORF2 Simplot software confirmed showed this recombination result when had monthly sample collections from the 1st to the 6th between the nucleotide 174-176 as compared with the month (mo) after infection; three patients had monthly prototype GII.P7 (AB258331) and GII.6 (AB039778). sample collections from the 7th to the 10thmo after The only sample from 2014 was characterize in the infection; sample collection after one year ranged from polymerase region as genotype GII.P22 and showed 13th to 16thmo. The Adapted Avidity Assay was developed negative result in the capsid region. When the junction in the Laboratory of Viral Hepatitis by the addition of a dissociating agent (guanidine) to the protocol of the GII.5 was demonstrated. The analysis showed the Anti-HCV IgG ELISA commercial kit (DiaSorin). The Simplotregion wassoftware done therecombination recombinant at genotype 212 nucleotide GII.P22/ compared with the prototype GII.P22 (AB233471) and calculated and HCV phases of infection were statistically GII.5 (AF397156). These results revealed the presence differentiated95% confidence (p intervals0.001): recent for avidity acute indexes(up to the (AI) 4th were mo) th th of NoV recombinants causing gastroenteritis in sporadic with AI up to 33.9%,⎕ late acute (5 to the 6 mo) with AI cases in North of Brazil. The continuous surveillance is of 48.2-70.6% and chronic (after the 7thmo) with AI of important to observe the norovirus evolution and the 75.0-93.0%. Four patients had high AI values by 4.6mo emergence of new strains, with potential of cause local (81-97.6%), while three patients maintained low AI (50- outbreaks that can spread to other regions. Financial 74.8%) even after one year. The results of the adapted assay were compared to a commercial test: samples from acute (4th-5th, n=23) and chronic phase (after 12th, Support: Evandro Chagas Institute, PPGV/IEC/FAPESPA. n=2) were tested. Adapted Avidity Assay presented a sensitivity of 78.2% (acute HCV up to 70.6%): 32.7±20% (mean±standard deviation) for the 4thmo, 52.9±28% for 5thmo and 101.2±6% after 12thmo. None of the acute
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV samples was identified by the commercial kit (acute XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
129 Human Virology: HV
HCV up to 37%): 77.7±24% for the 4thmo, 84.9±23% using software and aligned using Bioedit 7.0 (Ibis for 5thmo and 87.9±12% after 12th Therapeutics, CA, USA). Phylogenetic analysis was 100% for both tests. In conclusion, the antibody avidity performed using MEGA 4.0.1. Trees were visualized evolution is highly variable. Higher aviditymo. Specificity indexes were was using the TreeView program. Results: From a total of reached, on average, after the 8thmo. The adapted assay 293 samples, 49 (17%) were positive for HBoV, with a had better performance then commercial test to detect acute HCV infection. The Adapted Avidity Assay is useful October. The total of 34.6% was positive in children with for routine diagnosis of acute HCV and epidemiological 1higher year old,prevalence 10.2% wasbetween positive April/ in childrenMay, and withSeptember/ 2 years studies. Financial Support: Instituto Oswaldo Cruz (IOC), old, and 12.2%, in children with 4 years old. Phylogenetic National Institutes of Health (NIH), Conselho Nacional analysis of six sequences revelated strains of HboV group
Coordenação de Aperfeiçoamento de Pessoal de Nível Superiorde Desenvolvimento (CAPES). Científico e Tecnológico (CNPq) e that1. Conclusion: HBoV infections, We confirmed which theare presence also common of HBoV during DNA earlyin patients infancy, with play ARI. an Moreover, important findings role in provide the diagnosis evidence of HV137 - INFECTION OF HUMAN BOCAVIRUS (HBOV) acute respiratory viral infections; therefore, monitoring IN CHILDREN IN 2010, SÃO PAULO, BRAZIL this virus becomes important as a differential diagnosis Silva, P.E.; Paulino, R.S.; Benega, M.A.; Paiva, T.M.; in viral infections of the respiratory. Financial Support: Figueiredo, C.A.; Curti, S.P.; Afonso, A.M.S.; Santos, CAPES. K.C.O.; Silva, D.B.B.; Barbosa, T.F.; Oliveira, M.I. HV139 - ENCEPHALITIS EXPERIMENTALLY INDUCED INSTITUTO ADOLFO LUTZ WITH JURONA VIRUS IN MICE BALB / C ADULTS Human bocavirus (HBoV) is a new member of the Araujo, L.M.; Cavalcante, M.S.B.; Santos, D.S.; Diniz, Parvoviridae family. Viruses are a cause of upper and J.A.P.; Araujo, S.C. lower respiratory tract disorders. In children it is the major cause of death outside the neonatal period. INSTITUTO EVANDRO CHAGAS HBoV has been isolated from nasopharyngeal aspirates Viral infections are major causes of diseases that affect of children with respiratory symptoms. Studies have both human and animal population, constituting a major described the isolation of two novel HBoV goups: HBoV2 public health problem inducing the research institutes and HBoV3. Objective: To study the occurrence of HBoV interest in the study of the pathogenesis caused by viral in samples of nasopharyngeal aspirates of children with agents. It is the Jurona virus, a negative-strand RNA virus acute respiratory infection (ARI). Materials and Methods: isolated by Evandro Chagas Institute (IEC) in 1962, of A retrospective cross-sectional study for respiratory Haemagogus sp. mosquitoes and proposed for inclusion viruses was carried out with nasopharyngeal aspirates in the Rhabdoviridae family and Vesiculovirus genus (NPAs) collected from 300 patients with ARI from 0 to after serological studies. The objective of this research 5 years of age, in 2010. Samples were processed at the was to analyze the clinical signs of experimentally Adolfo Lutz Institute. DNA was extracted from a sample of adults and determine the presence of viral antigens in parenchymainduced encephalitis brain along with the Jurona infection. virus inThe BALB survey / c mice was instructions200 μL of nasal (Roche, aspirate Penzberg, using the Germany). High Pure The Viral detection Nucleic conducted after approval by the Ethics Committee on ofAcid viruses Kit® purification,was done by following Real Time the PCR, manufacturer’s using the Taqman System (Applied Biosystems, New Jersey, USA), Animal Use (ECAU) of the IEC under the protocol 05/2015. (7500 Real Time PCR systemW - Applied Biosystems). throughA total of intranasal 44 female (in) mice for BALB three / cconsecutive of approximately days in8 Sequenceswith specific for primers phylogenetic and probes analysis in awere thermal performed cycler eachweeks nostril were used,to the 22 infected inoculated group with and viral 22 solution with PBS 10μL for using the Big Dye Terminator Cycle-Sequencing Ready the control group. The animals were daily observed for Reaction (Applied Biosystems, CA, USA) and resolved neurological symptoms and analyzed after euthanasia in at automated ABI Prism 3130. Sequences were edited the 4th, 8th, 12th and 16th days after inoculation. Brains
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
130 Human Virology: HV cuts to 70 uM were performed for immunohistochemical virus (HHV) 3 (13.6%), 5 with Dengue virus (DENV) processing. It was observed that the clinical signs of (11.7%), 1 with Human herpes virus 1-2 (2.3%) and 1 infected animals were very evident in the 8th DPI, which with Human herpes virus 5 (2.3%). Nausea or vomit was had spiked hair, curved spine, anorexia, weight loss and ataxia, and on the 16th day all animals were recovered. The Immunohistochemistry showed the presence of viral nonepresent of inthe 80.0% patients (4/5) positive of the for DENV-positive HHV. The analysis patients, of antigens distributed throughout the parenchyma brain, the64.5% polymorphonuclear (20/31) of the neutrophils ENTV-positive (PMN) patients showed and that in mainly in the cerebral cortex. The results showed that the the patients in the HHV-positive groups presented an Jurona virus demonstrated tropism for CNS cells, being increase in PMN cells (mean of 81%) when compared capable of causing clinical and neurological symptoms with the DENV (mean=30.92%) and ENTV (mean= of encephalitis, but its virulence mechanism appeared 30.92%) groups. This manuscript contributed to the to be mild, not being a lethal agent for an infectious knowledge of the epidemiological distribution of viral process, that did not cause the death of the infected agents in CNS infections in children. DENV was detected host. Despite the Jurona virus not be lethal to animals, in 11% of CSF samples, it raises the relevance of DENV in CNS infection. The correlation between the etiology of response in the host, requiring investigation in the study diseases and the associated clinical features reinforces ofwe the observe neuropathogenesis. their ability to stimulateKeywords: an Vesiculovirus, inflammatory the weakness of cytology and biochemical parameters Viral Encephalitis, Signs and Symptoms, Mice. Financial for the diagnosis of infections in the CNS. Financial Support: CNPq.
HV142 - EPIDEMIOLOGY OF VIRAL MENINGITIS IN A Support:HV144 CNPq/ - IS CAPES/ THERE FAPEMIG. A SIMPLE AND ROBUST DENGUE ENDEMIC AREA BIOMARKER THAT CAN BE USED IN PREDICTING Oliveira, D.B.; Canidiani, T.M.; Franco-Luiz A.P.M.; RISK OF DISEASE IN HTLV-I–INFECTED INDIVIDUALS Fares R.C.G.; Almeida G.M.F.; Abrahão, J.S.; Coimbra, Gadelha, S.R.; Leal, V.N.C.; Azevedo, S.M.M.M.; R.S.; Kroon, E.G.; Rios, M. Carréra, K.A.F.; Bispo, N.J.; Júnior, J.F.; Bezerra, H.D.; Garcia, A.M.O.; Pellizzoni, T.A.; Santos, M.L.; Marin, 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. HOSPITAL INFANTIL JOÃO PAULO II, FHEMIG L.J.; Carvalho, L.D. 3. FOOD AND DRUG ADMINISTRATION, USA 1. UNIVERSIDADE ESTADUAL DE SANTA CRUZ 4. RENE RACHOU, FUNDAçãO OSWALDO CRUZ 2. CENTRO DE REFERÊNCIA EM PREVENÇÃO, In Brazil from 2010 to 2014, 42,267 cases of meningitis ASSISTÊNCIA E TRATAMENTO with a probable viral cause were reported but only 2.74% HTLV-1 causes a persistent and highly dynamic infection and it has associated with neoplasic disorders as well as 70 cerebrospinal liquid (CSF) samples from children withof the the viral presumptive agents were diagnosis identified. of viral Our meningitis. work analyzed This why some people infected with HTLV develop diseases work aimed to investigate the suspected cases of viral associateddegenerative with inflammatory viruses and diseases.other not. So Early far itbiomarkers is unclear have been studied. In this study, HTLV positive viral infection and determine the virus agent involved. individuals, symptomatic or not, attended at Centro Thenmeningitis to correlate using the molecular viral agent techniques diagnosed to with confirm clinical the de Referência em Prevenção, Assistência e Tratamento - CEPART in Itabuna have been monitored. Although there Our work analyzed 70 cerebrospinal liquid (CSF) are many individuals registered, about 50 are active samplesfindings andfrom cytochemical children with parameters the presumptive in CSF of diagnosis patients. work was approved by the CEP. After signing the TCLE, itand is haveapplied been a structured confirmed questionnaire by Western Blotand test.collected The parametersof viral meningitis. were analyzed The viral according agents CSFwere to identified the etiology. by samples for hematogical, biochemical, immunological Virusesreal time were PCR. detected The clinical in 44 findingsCSF samples and cytochemical(62.9%): 31 and parasitological analyses and co-infections with Enterovirus (ENTV) (70.4%), 6 with Human herpes research. Besides, all individuals have been evaluated
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
131 Human Virology: HV by a neurologist, in order to detect early alterations Objective: Our primary objective was further attempting associated with virus. As described in the literature, to genotype rotavirus strains which were previously the majority of monitored individuals are female, black, characterized as untypeable. Material and Methods: Stool with low socioeconomic and educational. In addition, samples were obtained from infants and young children most of the individuals was asymptomatic. Among the hospitalized for acute gastroenteritis in the course ofa analyzed co-infection, syphilis was the most prevalent. case-control study to assess vaccine effectiveness in Belém, Pará, Northern Brazil, from May 2008 to May 2011. ELISA RV-positive fecal samples were used for There were no significant changes in blood count, viral dsRNA extraction and reverse transcription. G and renal and liver function tests or general inflammatory P genotyping was performed by RT-PCR and, in a second themarkers. nervous Increased system has levels a high of triglyceridepercentage of (>150mg/ lipids in theirdL) and composition, cholesterol dyslipidemia (>200mg/dL) can werebe related detected. to viral As targeted at RV types. Untypeable strains by RT-PCR were pathogenesis. Besides, alterations in levels of lipids can subjectedstep, by seminested-PCR to oligonucleotide using sequencing. G or P specific Results: primers Of be an initial event of pathogenesis. The dyslipidemic 122 samples tested it was possible to determine 114 G individuals will be monitored in order to observe genotypes, as follows: G12 (60.5%, n=69), G1 (21.9%, if there is difference in the manifestation of clinical n=25), G2 (11.4%, n=13), mixed G infections (3.4%, disease compared to individuals without dyslipidemia. n=4), G3 (1.7%, n=2) and G9 (0.8%, n=1). A P genotype Keywords: HTLV-1; lipid disorders; Itabuna, Bahia. Financial Support: UESC. (4.5%,could be n=5) assigned and mixed to 109 P samples infections including (3.4%, n=4).P[6] (56.8%, Strains HV146 - HIGH INCIDENCE OF G12 ROTAVIRUS n=62), P[8] (26.6%, n=29), P[4] (10.1%, n=11), P[9] GENOTYPES AMONG CHILDREN HOSPITALISED FOR ACUTE DIARRHEA IN BELÉM, PARÁ, BRAZIL, IN THE bearing unusual G and P specificities, represented were POST-ROTAVIRUS VACCINE INTRODUCTION PERIOD found including G12P[6] (47.8%, n=56), G12P[9] (3.4%, Fecury, P.C.M.S.; Bezerra, D.A.M.; Justino, M.C.A.; amongn=4) and children G3P[9] hospitalized (0.8%, n=1). for acute Conclusion: gastroenteritis. G12P[6] Linhares, A.C.; Mascarenhas, J.D.P.; Oliveira, A.S.L.; represented a significant proportion of typed strains Soares, L.S.; Guerra, S.F.S. Additional unusual genotypes such as G12P[9] and 1. INSTITUTO EVANDRO CHAGAS for continuous monitoring of circulating RV strains in G3P[9] were also characterized, underscoring the need 2. FACULDADE METROPOLITANA DA the post-vaccine era in Brazil and else where. Keywords: AMAZÔNIA Acute gastroenteritis, Rotavirus, Unusual Genotypes, Belém, Pará. Financial Support: Fundação Amazônia Gastroenteritis is the second leading cause of death Paraense de Amparo à Pesquisa (FAPESPA); Instituto in children under 5 years of age worldwide, and Evandro Chagas (IEC). rotavirus (RV) is the most common agent, accounting for approximately 197,000 deaths yearly in children <5 HV147 - SPATIAL DISPERSION OF DENGUE IN CITY years of age. RV belongs to the Reoviridae family, genus OF SÃO PAULO FROM 2008 TO 2013 , it is devoid of envelope and has an icosahedral Rotavirus Ferreira, A.C.; Chiaravalloti-Neto, F.; Mondini, A. triple-layered capsid. The virus genome contains 11 segments of double-stranded RNA (dsRNA) that codes 1. FACULDADE DE CIÊNCIAS FARMACÊUTICAS- for 12 proteins:six structural proteins (VP1-VP4, VP6 e UNESP VP7) andsix non-structural proteins (NSP1-NSP6). VP4 2. FACULDADE DE SAÚDE PÚBLICA-USP and VP7 proteins make up the outer layer shell of the Dengue fever is the most important arthropod-borne viral infection in the world and affects 390 million people The public health impact of RV disease, its genotypic per year. The number of reported cases in Brazil has been diversity,virion and monitoring define 37 Pof and circulating 27 G genotypes, RV strains respectively. is strongly drastically increasing since the 80’s due to several factors recommended since either new or emerging strains may such as rapid growth and urbanization, precarious living potentially pose a threat to current vaccination strategies. conditions, absence of vector control and an effective
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
132 Human Virology: HV surveillance, as well as an obsolete public health HV149 - HCV/HIV COINFECTION COULD INTERFERE management. Virus and vector evolution, alongside IN THE PERFORMANCE OF ANTI-HCV TESTING USING DRIED BLOOD SPOT SAMPLES (DBS) disease scenario. Araraquara - a medium-sized city at the Flores, G.L.; Almeida, A.J.; Pilotto, J.H.; Potsch, D.F.V.; serotype/lineage shift also play an important role in the central portion of São Paulo state - presented an increase Amendola-Pires, M.M.; May, S.; Brandão, C.E.M.; in the number of cases since 2007. If compared to nearby Miguel, J.C.; Lewis-Ximenez, L.L.; Lampe, E.; Villar, cities where epidemics occur since 2001, the explosion of L.M. cases in Araraquara was late. To understand the factors that explain why dengue has been expanding so quickly 1. FUNDAÇÃO OSWALDO CRUZ 2. UNIVERSIDADE FEDERAL DO RIO DE is the key to improve strategies to prevent and to stop JANEIRO this process. We have mapped reported cases of dengue from 2008 to 2013 using the Kernel density estimator to detect clusters of dengue cases to better understand the C virus (HCV) have the same routes of transmission Human immunodeficiency virus (HIV) and hepatitis spread of the disease in the city. The major advantage of (parenteral and sexual). The prevalence of co-infection this technique is the rapid visualization of affected areas study group. The use of alternative biological samples, suchHIV / as HCV dried ranges blood from spot 30% (DBS) to 75%samples, depending may increase on the 2013without were the recoveredinfluence of from political the Informationdivisions or populationSystem on the access for the diagnosis of HCV infection, especially Diseasesat risk. Official of Compulsory data on dengueDeclaration. reports Data from from 2008 6,225 to in high risk groups, which may be co-infected with reported cases were analyzed and geocoded using the HIV. This study aims to investigate the performance of cartographic database containing census tracts division an enzyme immunoassay (EIA) adapted for anti-HCV of Araraquara. Rural areas were excluded from this detection in DBS samples among individuals infected by analysis. The major incidence was in 2011 with 1,211.83 cases per 100,000 inhabitants and the lowest was in 2009 of 524 subjects were recruited from two hepatology HCV, HIV/HCV, HIV and susceptible individuals. A total with 18.44 cases per 100,000 inhabitants. In 2008, two ambulatories and one infectious diseases ambulatory in Rio de Janeiro. DBS and serum samples were obtained of the city were observed. These clusters were displaced from each subject and tested for anti-HCV using tosignificant the northwest clusters in at2010 the coveringcentral and a new northeast portion portion of the commercial EIA (Murex HCV version 4.0, Diasorin). city, which is less urbanized and surrounded by huge Suppliers’ instructions were followed for serum samples (20 µL of sample + 180 µL of diluent) while for DBS, central region was observed. The same central cluster couldrural areas.be seen In in 2011, 2012 a and single 2013, significant which presented cluster at also the diluent volume was decreased (100 µL). As results, 230 sample volume was increased five fold (100 µL) and a smaller cluster at the northeast region. The general monoinfected HCV, 147 monoinfected HIV, 48 coinfected geographic distribution of dengue showed a similar pattern each year, but the central portion of the city this study. Sensitivities of anti-HCV testing in DBS HIV/HCV and 99 healthy subjects were included in played an important role in the dispersion of the disease. samples were 93.5% and 83.3% among monoinfected The next step will be investigating environmental and socioeconomic features to discover possible risk HCV and coinfected HIV/HCV groups, respectively. factors for dengue in different areas of the city. Financial 100% among monoinfected HIV and healthy subjects groups,Specificities respectively. of anti-HCV Anti-HCV EIA using could DBS be weredetected 98.6% in DBSand
Support: FAPESP 2013/02338-9. HIV individuals, but assay sensitivity was lower among samples from monoinfected HCV and coinfected HCV/
FinancialHIV+/HCV+ Support: group comparedCAPES, CNPq, to HCV+ FAPERJ. group indicating a possible influence of HIV infection in test performance.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
133 Human Virology: HV
HV162 - KINETICS OF DENGUE VIREMIA AND reason patients over 60 years produce higher levels of ASSOCIATION WITH SEROTYPE, IMMUNE RESPONSE, viremia should be further investigated, could be related NS1 ANTIGENEMIA AND DEMOGRAPHIC VARIABLES to comorbidities, generally most active in this age group. De Santis, B.; Cabello, P.H.; Nogueira, R.M.; de Filippis, Financial Support: Coordenção de Apefeiçoamento de A.M.B. Pessoal de Nível Superior – CAPES and Oswaldo Cruz Institute, FIOCRUZ. FUNDAÇÃO OSWALDO CRUZ Several factors have been implicated in dengue severity HV164 - PREVALENCY OF HUMAN PAPILLOMAVIRUS and viremia levels may be an important biomarker IN NORMAL/INFLAMMATORY CYTOLOGY of clinical outcome. In this context, we evaluated the Fonseca L.P.S.; Silva, A.K.; Ferreira, L.S.S.; Paixão, dynamics of viremia related to variables: infecting C.G.S. da; Abraão L.M.L.; Mello, W.A.; Silvestre, R.V.D. serotype, immune status, days of illness, severity, gender 1. INSTITUTO EVANDRO CHAGAS and circulating NS1 levels. By qRT-PCR, viremia was 2. UNIVERSIDADE DO ESTADO DO PARÁ The human papilloma virus (HPV) belongs to the state of Rio de Janeiro. In house IgG EIA determined Papillomaviridae family and is an epitheliotropic DNA primaryquantified and in secondarysera of 237 dengue confirmed infections. dengue The cases samples from viruses that infect cutaneous and mucosa like uterine were from cases from the periods of introduction and cervical cells, of those with sexual activity. HPV are circulation of DENV-1 (1986-1996), DENV-2 (1990- divided in two groups, High and low risk types, the 2007), DENV-3 (2000-2003) and DENV-4 (2011-2012). infection with high-risk HPV can lead to precancerous lesions and are associated to co-factors such smoking, alcohol use, number of pregnancies, use of oral MedianThe cases viremia were of classified serotypes according1, 2, 3 and to 4 thewere clinical equal outcome in dengue and severe dengue (WHO/2009). contraceptives for long periods, genetic factors, young age at sexual initiation and immunosuppression may worse, culminating in the development of precursor that,to, respectively, regardless of162.40 the infecting RNA copies/ml, serotype, 0.14 patients RNAc/ml, with 139.80 RNAc/ml and 580.00 RNAc/ml. Results show lesions and cervical cancer. Due to the high prevalence world wide of cervical cancer, and based in global ml) than patients with secondary infection (0.18 log studies is necessary to conduct tests for detection primary infectionp<0.0001). had higher Nevertheless, viral load (2.22no association log RNAc/ viral DNA-HPV combined with Papanicolaou test, that was observed between viremia and disease severity increase the precision of diagnosis and the power of a (RNAc/ml)p=0.922). (Patients over 60 years had the highest positive molecular test associated to a early disease detection. For this study were used Hybrid Capture levels of viremia (2.73 log RNAc/ml) to the detriment second generation test to identify previously the positive samples and High-risk or low-risk HPV. Subsequently we ml)of patients (p in the age groups 0-12 (0.74 log RNAc/ml), 13-19 (1.40 log RNAc/ml) and 20-59 (2.01 log RNAc/ =0.001). Viremia decreased as the day of first test by HPV Linear Array kit that is able to identify until was observed on days 0-1, and then levels of viremia used DNA amplification by PCR following genotyping symptoms progressed; its peak (2.25 log RNAc/ml) 37 types of HPV. Were analyzed 399 samples diagnosed p=0.002). There was no were gradually decreasing in the days 2-3 (2.01 RNAc/ association between viremia and gender (p=0.194), with normal/inflammatory cytology in conventional PAP ml) and 4-5 (1.34 RNAc/ml) ( in CH2 test. Considering only positive samples, we have viremia and levels of circulating NS1 (p=0.958), test. Of these 56/399 (14%) were positive for HPV-DNA (89%) were high-risk infected. After HPV typifying, the the presence of lower levels of viremia during secondary 6/56 (11%) samples detected as low-risk and 50/56 infections,regardless as infecting was observed serotypes. defervescence These findings concomitant indicate with decreased viremia, as already described by other most prevalent is HPV 16 with 11/50(22%) followed authors. In this study, the immune status, days of disease 52,by HPV5956, 58 and 9/50(18%). 68 are detected The HPV too. 18 In was HPV present low-risk in and age range were factors associated to the dynamics 3/50(6%) and other types HPV 31, 33, 35, 39, 45, 51, of viremia kinetics, but not with illness severity. The October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology:types HV we found 2/6 (33%) of HPV61 and HPV54, 55, XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
134 Human Virology: HV
samples were positive for the mutation I222V, which show the importance to adopt the molecular HPV tests has been previously associated with reduced sensitivity in62 routine e 72 with services one and infection screening 1/6(1.6%). programs These to diagnose results to OST. Since reports on presence of resistant strains high risk infections that is more associated to disease and permissiveness mutations are growing, it is vital predisposition. These results can be used to indicate the that this monitoring is strengthened in Brazil, also in follow up maintenance of women with normal cytology groups associated with worsening disease and immune but HPV infected with high risk types. Keywords: HPV, impairment. Financial Support: FAPERJ, Brazilian cervical screening programs, Pap Test, HPV diagnostics. Ministry of Health, CNPq.
HV169 - HIGH CIRCULATION OF NON-POLIO FinancialHV165 - RESISTANT Support: MS INFLUENZA / SVS / IEC. VIRUS SURVEILLANCE ENTEROVIRUSES AMONG CHILDREN WITH ACUTE IN BRAZILIAN POPULATION GASTROENTERITIS IN BELÉM, PARÁ, NORTHERN Matos, A.R.; Caetano, B.C.; Motta, F.C.; Siqueira, M.M. BRAZIL Tavares, F.N.; Mota, B.D.L.; Monteiro, J.C.; Machado, LABORATÓRIO DE VÍRUS RESPIRATÓRIOS E DO SARAMPO, IOC, FIOCRUZ R.S.; Freitas, F.B.; Wanzeller, A.L.M.; Linhares, A.C. INSTITUTO EVANDRO CHAGAS with neuraminidase inhibitors, such as oseltamivir Diarrheal disease is one of the most common causes of The therapy against influenza is currently performed morbidity and mortality among infants, young children and the elderly throughout the world. A causative agent (OST). Our laboratory, a National Influenza Center in in approximately 40% of diarrheal cases still remains virusesBrazil, haswith beenH275Y monitoring resistance Influenzamutation, some resistance of them to undiagnosed. Currently, the genus Enterovirus contains presentingtreatment in this recent alteration years. We before have treatment,found A/H1N1Pdm09 suggesting four species of enterovirus (EV) affecting humans (EV- community transmission. Some of them presented A to D), comprising more than 100 serotypes. The enteroviruses are transmitted through fecal-oral and respiratory routes and can be associated with sporadic Brazilianpermissiveness population, mutations, by analyzing which favor resistance viral fitness. markers. This cases and outbreaks of gastroenteritis. In Brazil there Initially,project aimssamples to monitor from sentinel resistant surveillance Influenza network A virus inof are few studies that show the detection or relationship nine states in Brazil were evaluated. In 2014 and 2015, between enterovirus and acute gastroenteritis, and our lab has received 1107 samples, 103 were positive for no molecular epidemiologic studies about diarrheal diseases and the prevalence of non polio enteroviruses are available.Viral RNA from 175 diarrheic samples was H3N2Influenza is in A/H1N1Pdm09 accordance with and the 497 circulation for Influenza pattern A/H3N2, that extracted and enterovirus detection was performed by real time RT-PCR. This predominance of Influenza A/ by rRT-PCR assay using a primer pair and probe that NA gene was screened for H275Y resistance marker, byis being pyrosequencing. observed in the 77 world. (74,7%) Influenza samples A/H1N1Pdm09 presented samples were subjected to semi-nested PCR for reliable pyrograms, and the mutation was not found. It amplifies a fragment within the 5’NCR. All positive is important to note that this marker frequency is low confirmation. The reaction targeting the conserved 5’ for E119V resistance marker, by pyrosequencing. 314 NCR amplified fragments of approximately 440 bp and (63,2%)(~2%). Also, samples Influenza presented A/H3N2 reliable NA pyrograms,gene was screened and this isolation155 bp respectively. in RD and HEp2 Positive cell lines samples undergoing presenting three Ct≤35 blind mutation was not observed, but it is important to note passages.were clarified Enterovirus with chloroform typing was and performed subjected through to viral that E119V frequency is even lower. NA full sequencing, partial VP1 sequencing using 222 and 292 primers. Of by Sanger method, is being done for these samples. the 175 diarrheic samples tested, 29.4% (37 samples), 15.4% (4 samples) and 23.8% (5 samples) were positive for enterovirus among patients aged 0-1 year, 1-2 year So far, we have identified viral permissive mutations, and >3 years respectively. Of these, 46 (26.3%) were V241I and N369K, in Influenza A/H1N1Pdm09 samples, asOctober observed 2015 Volume in 20 previous – Supplement years. 1 - Abstracts/Posters Influenza A/H3N2 - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
135 Human Virology: HV
coding at position 508 in protein. The investigation of SNP rs12979860 showed that 67% of resolving patients Cytopathicpositive by effect rRT-PCR was foundand all in samplesonly a single with cell Ct≥35 or both were RD had the protective genotype CC. Moreover, risk analysis andsubjected HEp2 in to 16 semi-nested samples (9.1%). RT-PCR Reactions for confirmation.for molecular revealed that SNPrs12979860 CC genotype (OR 7.49, characterization have therefore been conducted. The results showed that it was possible to detect enterovirus 1.17, 95% CI 1.00-1.36, P=0.045) and no MSM behavior (OR95% CI9.91, 2.32-24.15, 95% CI P=0.001), 0.98-100.00, age of P=0.052)first intercourse are likely (OR semi-nested PCR) for all tested samples. This study predictors for spontaneous resolution for HCV infection. haswith detected the same a efficiencyhigh prevalence in both (26.3%) assays (rRT-PCR of NPEV and in Conclusions: It was possible to establish a relationship diarrheic samples, even though we had not tested the between the SNP rs12979860 CC genotype andHCV stool samples for others viral pathogens. Although our clearance in the patients’ groups selected for analysis. preliminary results show a high circulation and a possible Financial Support: FAPESP,CAPES,CNPq. association of enteroviruses with acute diarrheic disease among children under 5 years old, additional studies are HV174 - DETECTION AND GENOTYPING OF warranted to better assess this association, taking into SAPOVIRUS AND ENTERIC ADENOVIRUS IN CHILDREN account that some points need to be better investigated WITH ACUTE GASTROENTERITIS IN BELÉM, PARÁ, including genotypes, possible mixed infections with DURING 1990-1992 other pathogens and asymptomatic shedding by healthy Resque, H.R.; Costa, L.C.P.N.; Siqueira, J.A.M.; Junior, E.C.S.; Portal, T.M.; Linhares, A.C.; Gabbay, Y.B. 1. INSTITUTO EVANDRO CHAGAS/SVS/MS children. Financial Support: Instituto Evandro Chagas/ 2. UNIVERSIDADE DO ESTADO DO PARÁ SVS/MS.HV170 - THE STUDY OF POLIMORFISMS THAT INFLUENCE THE SPONTANEOUS RESOLUTION OF Acute gastroenteritis (AGE) is one of the most common HEPATITIS C VIRUS INFECTION causes of morbidity and mortality, especially involving Andrade, S.T.Q.; Provazzi, P.J.S.; Miura, V.C.; Carvalho, children from developing countries. Sapovirus (SaV) and L.R.; Carneiro, B.M.; Rossi, L.M.G.; Fachini, R.M.; enteric adenovirus (AdV) are included among the agents Grotto, R.M.T.; Silva, G.F.; Valêncio, C.R.; Neto, P.S.; that can cause AGE. SaV is a member of the Caliciviridae Cordeiro, J.A.; Nogueira, M.L.; Rahal, P. family, with a single-stranded RNA genome and is
INSTITUTO DE BIOCIÊNCIAS LETRAS E CIÊNCIAS and GV can affect humans. Human adenovirus (HAdV) EXATAS belongsclassified to into the sevenAdenoviridae genogrops of which GI, GII, GIV The hepatitis C virus (HCV) is associated chronic and in the genus Mastadenovirus, which has 52 serotypes active hepatitis, cirrhosis, and hepatocellular carcinoma. infecting humans, subdivided familyinto seven and isspecies classified (A- Approximately 20% of HCV infections are spontaneously G) related to ocular, respiratory, gastrointestinal and resolved. Viral and host factors have been associated urinary infections. HAdV has a linear DNA genome with a with spontaneous and treatment-related HCV clearance. positive polarity and has no envelope. The study aimed to Single nucleotide polymorphisms (SNPs) in immune detect and genotype SaV and HAdV in 172 fecal samples system genes have been associated spontaneous from children with AGE, collected during a surveillance clearance of HCV infection. Objectives: This study study carried out in a low income community located in investigated the existence of substitutions in the MAVS Belém, between 1990-1992. Samples were submitted to gene and examined if the rs12979860 polymorphism of a Reverse Transcription Polymerase Chain Reaction (RT- IL-28B differ between spontaneous HCV clearance and chronic patients. Methods: Genomic DNA samples from 40 resolving and 40 chronic HCV patients were analyzed PCR)/Nested-PCR for SaV detection, using the primers for substitutions in two innate immune genes. Results: P289/290 and SV13-F/R and SV14-F/R (first step) and The results showed that all patients maintained the SV-F22/SV-R2 (second step). For HAdV detection, the respectively.primers Hex1deg/Hex2deg The nucleotide and sequence NeHex3deg/NeHex4deg, was determined to first and second rounds were used for the Nested-PCR, codonOctober “TGC”2015 Volume at MAVS 20 – Supplementgene responsible 1 - Abstracts/Posters for the cysteine - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
136 Human Virology: HV by direct cycle sequencing and the chromatograms changes and hyperplasia reticulum-histiocytic in kidneys, were analyzed using the BioEdit software and compared liver and spleen. Initial clinical condition in humans is with others registered in GenBank, and phylogenetic sudden, with moderate fever, headache, low back pain clustering was carried out using the MEGA 5.0 program, and myalgia, lasting for 1or 2 days. OBJECTIVE: Evaluate with the neighbor-joining method, with 1000 bootstrap clinical signs of experimental encephalitis induced by replicates. Overall positivity found to SaV was 2.9% Piry virus on adult mice. METHODOLOGY: 20 ten weeks
GIV (n=1) and GV (n=2). A subset of 72 samples was two groups (Infected and Control) and evaluated for 10 (5/172), of which were genotyped as GI (n=1), GII (n=1), days.old albino The researchmale adult was BALB/c conducted mice wereafter used,the approval divided inof the Animal Use Ethics Committee of IEC under protocol 41tested (n=8), for HAdV,Specie presenting A type 18 a(n=1), positivity Specie of 45.8% C type (33/72), 1 (n=2) andbeing type sequenced 2 (n=1), 39.4% and Specie (13/33) D of(n=1) those. were Specie observed. F type The results demonstrated the circulation of HAdV with brainsnº 06/2015. in each The nostril animals with a were concentration inoculated of intranasally 1:10-5 and a high frequency in Belém, with the prevalence of type theby drippingcontrol group with received a 10μl suspensiona suspension of of Pirynon-infected infected brains. After the inoculation, the animals were observed respiratory and ocular infections. Regarding SaV, a lower twice a day and the clinical signs and weight registered. frequency41. It was was also observed, identified with other a types small responsible prevalence forof Quantitative analysis performed using GraphPad Prism genogroup GV, reinforcing the need for further studies 5.0. RESULTS: Control group showed absence of clinical to obtain epidemiological data about these viruses in signs for encephalitis and weight gain. Infected group Brazil, especially in the Amazon Region, where there is a showed severe weight loss and typical encephalitis lack of data about these virus concerning the beginning clinical signs, such as: spiked fur, curling of the spine, of the 1990’s. Keywords: sapovirus, adenovirus, ataxia, anorexia and hind paws paralysis. CONCLUSION: gastroenteritis, children. Financial Support: Instituto Piry virus showed to be a potent experimental Evandro Chagas; FAPESPA. encephalitis inducer on mice, and could be a good experimental model to the study of viral encephalitis. HV177 - CLINIC SIGNS EVALUATION OF Financial Support: Instituto Evandro Chagas. EXPERIMENTAL ENCEPHALITIS INDUCED BY PIRY VIRUS ON ADULT MICE HV178 - PHYLOGENETIC ANALYSIS OF DENGUE VIRUS Santos, D.S.; Cavalcante, M.S.B.; Araújo, L.M.; Araújo, SEROTYPE 4 FROM SERA SAMPLES COLLECTED S.C.; Diniz, J.A.P. DURING THE 2014 EPIDEMIC PERIOD IN MACEIÓ Lira, E.L.; Sabino-Santos Jr., G.; Feitosa, R.C.S.; Muller, INSTITUTO EVANDRO CHAGAS V.M.; Figueiredo, L.T.M.; Borges, A.A. Viral encephalitis are the main depressant disturbances of the nervous system, in which are characterized 1. UNIVERSIDADE FEDERAL DE ALAGOAS 2. UNIVERSIDADE DE SãO PAULO deregulations leading to permanent neurological DENV is an enveloped virus and comprise four distinct sequels.by promoting Arboviruses motor are deficits RNA based and immunologicalzoonosis and serotypes (DENV1-4) that belong to the genus Flavivirus, transmitted by arthropods. About 190 arboviruses were family Flaviviridae. In Brazil, DENV 1–3 were responsible isolated in the Amazon region by Instituto Evandro for about 5 million cases of DENV infection during 1990– Chagas (IEC), among these, 32 cause human pathology 2009, resulting in more than 15,000 reported cases of causing fever, hemorrhagic disease and encephalitis, dengue hemorrhagic fever and about 1,000 DENV- of which 15 species belongs to the Rhabdoviridae related deaths. DENV-4 reemerged in Brazil in 2008, 30 family. Piry virus is one of these, it was isolated by the years after its last detection in the country; the site of the reemergence was Amazonas State, Northern Brazil. of a marsupial (Philander opossum). In experimental infectionsfirst time inby 1960Piry virus in Belém, on mice Pará, there Brazil, were in occurrences the viscera however the origin of strains in circulation in state had not of encephalomyelitis, myocarditis, connective tissue beenIn Alagoas characterized. State, DENV-4 Therefore, was we first perform identified phylogenetic in 2012,
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
137 Human Virology: HV analyze of the strains isolated from two autochthonous by the viruses, which in severe cases can evolve to febrile patient in Maceió city. Sera samples were obtained death. Asymptomatic cases can occur, as well as intense from patients attended at Hospital School Helvio differentiated symptomatology, such as retro-orbital Auto, during the 2014 epidemic period of dengue and pain and thrombocytopenia in DENV and chronic molecular diagnosis was performed by nested-multiplex polyarthralgia in CHIKV. In the seasonal context of the RT-PCR. For the phylogenetic analysis was used partial weather from Brazilian northern region, the presence sequence of the NS5 gene (primers FG1 e nDEN-4). A of a common vector of transmission for both diseases database containing paired of partial gene NS5 of our emphasizes the importance of the health surveillance of two clinical strains and strains from GenBank (n=63) these arboviral infections. In this context, this work is a was prepared for phylogenetic analysis. We used the descriptive study that aims to present the epidemiological maximum likelihood algorithm based on the model TN93 data for DENV and CHIKV in the Brazilian northern region, + G + I, as implemented in software MEGA6.06. Clinical for the period between 2010 and 2015. Epidemiological strains from Maceió city (sample ID 151H and 628H) reports of the Secretariat of Health Surveillance have are in genotype II cluster and they have more similarity with the strain isolated in Boa Vista, Roraima, in 2010, dengue. In 2010, 98,632 cases were reported, 119,398 (GenBank accession no.JN559741). Worth mentioning revealed a decrease in the number of notified cases of that the 151H strain - positive in reaction with Flavivirus in 2013, 15,781 in 2014 and 26.444 cases in 2015. cases were notified in 2011, 42,158 in 2012, 49,547 is 153.2, being the most prevalent serotypes: DENV1 primersgenera-specific and stood primers in an isolated - generated branch, just instead an unspecific of along andCumulative DENV4. incidenceFor CHIKV, (/100,000 only data inhabitants)for the years2014 for DENV and withband the in 628H nested-multiplex strain, suggesting PCR witha probable specific-species mutation. Further studies are needed to analyze complete genomes the north region of which 856 were indigenouscases of patients from Alagoas state. Such studies will more 2015 were available, and 1,040 cases were notified in fully elucidate the geographic dispersal dynamic of DENV-4 and help to identify whether there occurrence Thesein 2014, informations but only 584 disclosed were confirmed. in the epidemiological In 2015, 945 of other genotype in state. Financial Support: Ministério indigenous cases were notified, being 879 confirmed. since there was a decrease in the number of cases reports confirm the importance of health surveillance, daHV179 Saúde/CNPq/SESAU-AL/ - HEALTH SURVEILLANCE FAPEAL. AT THE BRAZILIAN control programsthat extend throughout the year (e.g., NORTHERN: CASES OF DENGUE AND CHIKUNGUNYA thenotified. work Such of surveillance results can teams be attributed with focus to prevention on eliminating and FEVER Barroso, W.S.; Monteiro, A.H.; Alves, S.D.; Baraúna, cases). Financial Support: Faculdade metropolitana da R.A.; Alves, E.P.B. amazôniathe vectors (FAMAZ). and the accurate confirmation of suspected FACULDADE METROPOLITANA DA AMAZÔNIA HV181 - CONCOMITANT INFECTION OF ROTAVIRUS In Brazil several diseases are considered to be challenges GENOTYPES IN HOSPITALIZED CHILDREN WITH for the public health, with emphasis for the arboviral ACUTE GASTROENTERITIS IN BELEM, PARÁ, BRAZIL diseases such as dengue (DENV) and chikungunya Serra, A.C.S.; Bezerra, D.A.M.; Guerra, S.F.S.; Soares, (CHIKV). DENV is a serious health problem in the world L.S.; Bandeira, R.S.; Penha Junior, E.T.; Mascarenhas, that has a wide clinical spectrum. The disease is caused J.D.P. by a virus which is spread to the people by a bite of an infected arthropod of the Aedes genus (Aedes aegypti INSTITUTO EVANDRO CHAGAS is the main vector). CHIKV virus is also transmitted Rotaviruses (RV) are described as important agents of by mosquitoes of the Aedes genus. Chikungunya is an acute gastroenteritis in humans, especially in children up acute, subacute or chronic febrile disease. Both DENV to 5 years of age, causing about 197,000 deaths annually. and CHIKV are oligosymptomatic diseases, which are Taxonomically, it belongs to the Reoviridae family, genus clinically similar due to the febrile syndrome caused Rotavirus
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV , being classified using a binary combination XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
138 Human Virology: HV
HV185 - ORAL MUCOSA PERSISTENCE OF EPSTEIN- capsid proteins, in which VP7 designates the genotype BARR VIRUS (EBV) IN HUMAN IMMUNODEFICIENCY G(GxP[x]), (Glycoprotein) based onand theVP4 properties the genotype of theP (sensitive two outer to VIRUS (HIV) INFECTED PATIENTS UNDER ANTIRETROVIRAL THERAPY Santos, L.S.; Azevedo, K.M.L.; Oliveira, L.H.S. Protease). In general, RV are classified as common or withusual, infection but a significant by multiple percentage genotypes (4,9%) is of offundamental circulating UNIVERSIDADE FEDERAL FLUMINENSE importance,strains are classified since it ascan unusual. be related In this with context, the emergence the study HIV infected patients can present low immune status, of unusual genotypes, which may represent a challenge being more vulnerable to EBV associated diseases. to immunizing licensees. Samples from a total of 77 However, after introduction of highly active antiretroviral faecal specimens were selected of which 11 of that therapy (HAART),the frequency of EBV associated presented a pattern of mixed infection, obtained from tumors has decreased. The aim of our study was to investigate the persistence of EBV oral infection in HIV positive patients using HAART,through the analysis of thechildren period ≤5 of years May of 2008 age whoto May participated 2011. The in viral the projectdsRNA samples obtained in 2010 and 2014,in order to verify was“Rotavirus extracted Case-Control from fecal “,suspensions carried out and in Belém, subjected PA, to in if the virus DNA could still be detected in oral mucosa. RT-PCR followed by Semi-Nested-PCR for genotyping of Sampling consisted of 50 oral scrapes (25 collected in samples. The amplicons of the Semi-Nested-PCR were 2010 and 25 in 2014,from the same subjects) of HIV- infected patients,18 years or older,selected in Doenças of circulating genotypes. Products from the RT-PCR and Infecciosas e Parasitárias Service, Hospital Universitário Semi-Nested-PCRpurified from the agarosewere sequenced gel, aiming and the the identification sequences Antônio Pedro (UFF). The whole blood and serum were obtained were analyzed phylogenetically. Nine samples also obtained, in 2014,to determine EBV infection. DNA from oral and whole blood samples was extracted 11 to VP4 gene. The phylogenetic analysis for VP7 gene genotypedamplified by the RT-PCR samples were as G2, sequenced G1 and G12 for with VP7 similaritygene and by general and nested polymerase chain reactions. ranged from 93% to 98% if compared to prototypes. For by specific kits following detection and typing of EBV VP4 gene the samples were clustered with the genotypes antibodies presence using immunoenzymatic assay. The patientsThe sera age of ranged patients from were 34 analyzed to 73 years,most for specific of them EBV 96% in relation to the prototype. Sequencing was done 3 and inP[4], 7 samples P[8] and detected P[6], and by the Semi-Nested-PCR, similarity was ofand 85% from to these, two samples presented the mixed genotype with analysispresented showed count that higher all thethan oral 200 samples CD4+ cells/mmwere EBV DNA positiveundetectable but 16(64%) HIV load remained in both periods positive of at time. least The 4 years first later. After typifying, the investigation of this material combination P[4]+P[8] and the remaining grouped with revealed that 8(32%) and 15(60%) were positive andP[8], genotypes P[4] and P[6].observed The studywere G2,demonstrated G1, G12 for the VP7 mixed gene genotypic combination P [4] + P [8] in two samples contrast, 6(24%) and 4(16%) samples were positive mixed infection by rotavirus are necessary for a better for type EBV-1 1 and 2, EBV-2,respectively, respectively, in the at last first analysis. moment. The In understandingand P[4], P[8], of P[6] the fororigin VP4 and gene. the evolution Studies involving pattern of RV. Financial Support: Instituto Evandro Chagas (IEC) 8%) in both periods of time. All the specimen obtained incoinfection 2010 could (EBV be 1typed, and 2) but frequency in 4 (16%) was samples,from equal (2/25, Tecnológico (CNPq). 2014,this could not be done. The sera analysis revealed / Centro Nacional de Desenvolvimento Cientifico de that all patients were EBV positive and their whole blood samples were negative for EBV molecular detection. Although oral EBV DNA frequency in HIV infected patients has decreased at the second moment,it still can be considered high in comparison with HIV negative populations. Even though all the patients were positive October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
139 Human Virology: HV for serological testing, EBV DNA could not be found in carrier also increased their risk of becoming a carrier whole blood,suggesting that the viral load was too low to (p = 0.0017, ic95% 15.4098 to 33.7902) strengthening be detected. Our study showed that EBV DNA presence intrafamilial transmission as a risk factor. We conclude in oral mucosa of HIV positive people decreased over that women with HBV in Roraima have a heterogeneous the years. It is possible that this event could be linked distribution of races, were from 20 to 39 years old, don’t to antiretroviral treatment,however this hypothesis has have the vaccine immunization schedule for HBV, found to be better evaluated. Financial Support: Pro-Reitoria to be carrier during pregnancy and having contact with de Pesquisa e Pós-Graduação da Universidade Federal hepatitis B carrier increases the risk of contracting this Fluminense (PROPPi-UFF). virus.
HV186 - EPIDEMIOLOGICAL PROFILE OF WOMEN HV192 - RECOVERY AND DETECTION OF GII WITH HEPATITIS B BETWEEN 2009 TO 2013 IN NOROVIRUS FROM READY-TO-EAT FOODS BY THE WESTERN AMAZON, RORAIMA, BRAZIL TRIZOL® REAGENT AND REAL-TIME RT-PCR Granja, F.; Barros, J.A.; Lima Junior, W.P.; Acosta, Luz, I.S.; Melgaço, F.G.; Miagostovich, M.P. P.O.A.; Naveca, F.G.; Lima Junior, M.M. FUNDAÇÃO OSWALDO CRUZ 1. UNIVERSIDADE FEDERAL DE RORAIMA Viral foodborne outbreaks represent an increasingly 2. CORDENADORIA GERAL DE VIGILANCIA important public health concern and norovirus (NoV) EPIDEMIOLOGICA DE RORAIMA is major cause of food poisoning and outbreaks of 3. INSTITUTO LEONIDAS E MARIA DEANE/ gastroenteritis. NoV belongs to family Caliciviridae and FIOCRUZ is a nonenveloped virus with a single-stranded RNA Roraima is part of the western amazon with a high (ssRNA) genome. The Norovirus genus is subdivided prevalence of HBV, the only hepatitis considered into 6 genogroups, with GI, GII, and GIV causing human a sexually transmitted disease, which has a high disease. The most prevalent human NoV strains belong transmissibility. this study aimed to describe the to GII, genotype 4 (GII.4). Ready-to-eat (RTE) foods have been considered as the causative food vehicles Roraima between 2009 and 2013. We used data from in described foodborne NoV outbreaks and the HBV carriers’ epidemiological profile in the state of contamination of these foods is in most cases caused For the statistical analysis, we performed chi-square by an infected food handler. Most foodborne viruses are andSINAN student's (diseases t test. information Our study systemshowed notification).223 women whom represent 43.13% of the total sampled carriers, viruses in foods currently relies upon the use of real-time throughout the period observed the predominance of difficult to cultivate in cell culture. The detection of these 2 men (X = 9,771, p = 0.0018). among the race, we found and can deliver quantitative data. Process or internal a predominance of brown with 61.7% compared to controls,RT-PCR (RT-qPCR) including becausemurine itnorovirus is sensitive, 1 (MNV-1), specific, rapidmust 24.2% white, 11.2% indigenous, and 3.13% black (X2 = 178.05, p <0.0001). in terms of age, the prevalence was negative results. In general, the strategy for detection between 20 to 39 years (53.8%), followed by 40 to 59 ofbe food-borneused to monitor viruses the inefficiency food samples and to identifyconsists false-of 3 years with 27.8%; 11.6% up to 19 years and 6.7% for 2 those over 60 years (X = 120.40, p <0.0001). only 27.8% material and molecular detection. The aim of this study reported to have a complete vaccine immunization wassteps: to virus evaluate extraction, the TRIzol purification® reagent of theon viralthe recoverygenomic 2 schedule and 72.2% incomplete or none (X = 63.48, of GII NoV from ham and turkey meat samples and to p <0.0001). An important fact was that 74.7% (x2 = detect NoV from these foods by RT-qPCR using MNV-1 65,308, p <0.0001) of patients reported to be suffering as process control. The food samples were purchased at during their pregnancy, these data might indicate that contaminated with 250µL of faecal samples containing prevention of mother-to-child transmission (PMTCT). GIIa local NoV. food MNV-1 store wasand dividedpropagated in 25g in aliquots RAW 264.7 artificially cells an efficient prenatal can lead to HBV detection and the We observed that people who had contact with a HBV and 106 genome copies were used on the food samples.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
140 Human Virology: HV
The recovery method was based on TRIzol® reagent as Serological markers for HBV and HDV were studied in 21 patients with HBV. After informed consent, blood was performed by the use of the manual QIAmp Mini kit. After collected, plasma was separated for analysis of HBsAg reversepreviously transcription, described andcDNA purification was submitted of the to RNART-qPCR, was antigen, anti-HBc Ag, HDV IgM and HDV IgG by ELISA and the data analysis was performed using the ABI 7500 (kit Wantai). Viral load was evaluated using real-time RT-qPCR instrument. Quantitative data showed that the PCR for the S gene region of HBV. The results showed TRIzol® method resulted in a recovery of GII NoV with two isotypes. Three were positive for anti-HDV IgM and 1,67% to 13,35% from turkey meat samples. Moreover, fourfive seropositivepositive for anti-HDV patients withIgG, revealing HDV antibodies frequencies to the of efficiencies of 21,79% to 62,22% from ham samples, and 14.3% and 19%. Two individuals had both markers for 69,99% from ham samples, and 9,68% to 48,09% from HD V (9.5%). The 5 patients three are asymptomatic, turkeyMNV-1 meat was recoveredsamples. The with assays efficiencies could react of 15,13% different to including seropositive with both markers indicating to the presence of residual components from the tested foods, and the detection method was able to recover GII NoV from ham and turkey meat samples with variables coinfection. Positivity for HBsAg was 95% (20/21), for ofanti-HBcAg viral load was with 100%, symptoms and in was61% attempted: (13/21) of sixthem cases the wereaverage asymptomatic, viral load was four 613.75 had no IU/ml. information The relationship available, recovery efficiencies. Financial Support: National Council and three patients developed jaundice, headache and ofHV195 Scientific - SEROLOGIC and Technological MARKERS Development. OF HEPATITIS B IN abdominal pain. We concluded that the asymptomatic COINFECTION AND CLINICAL SYMPTOMATOLOGY status of 14.3% in patients infected with HDV is atypical, ASSOCIATED IN RISK GROUPS OF ENDEMIC REGION because it should accelerate the progression for HUANTA (AYACUCHO-PERU) cirrhosis or liver cancer, and the occurrence of fulminant Mayta, H.E.M.; Mamani, Z.E.W.; Murillo, C.A.; Punil, forms in cases of superinfection, which are common in L.R.; Hermosilla, J.J.; Ore, R.M.; Mormontoy, Q.C.; youth from hyperendemic areas. Keywords: HBV; HDV; Carrasco, CH.M.; Mallqui, M.H.; Cayulla, Q.D.; Berna, anti-HBcAg,;HBsAg; anti-HDV IgM; HDV IgG; Viral load. E.C.; Contreras, P.E.; Alvan, V.M.; Cabezas, S.C. Financial Support: VRI-UNMSM. 1. NATIONAL UNIVERSITY OF SAN MARCOS HV199 - ANALYSIS OF THE PRESENCE OF HUMAN 2. FACULTY OF BIOLOGICAL SCIENCES PAPILLOMAVIRUS (HPV) IN HEAD AND NECK CANCER 3. NATIONAL HEALTH INSTITUTE Badial, R.M.; Provazzi, P.J.S.; Calmon, M.F.; Dias, M.C.; This study aimed at understanding relationship between Affonso, V.R.; Junior, W.A.S.; Rahal, P. serum markers, symptoms of hepatitis B virus (HBV), hepatitis delta virus (HDV), and viral loads in individuals 1. UNIVERSIDADE ESTADUAL PAULISTA diagnosed with hepatitis B, and analyzing the frequency 2. FACULDADE DE MEDICINA DE MARÍLIA of infection. Hepatitis B is a disease of universal 3. UNIVERSIDADE DE SÃO PAULO distribution with infection rates from 0.1% to 20%. Head and neck cancer is the sixth most common type of In the world over 2 billion people have been infected cancer worldwide and affects approximately 550.000 individuals annually. In this group of neoplasms, million have acute hepatitis, according to the WHO, and tumors appear in different anatomical locations of the 15with million HBV, also350 havemillion HDV, become a subviral chronically satellite infected,that requires five aerodigestive tract in which the larynx is responsible HBV for its life cycle. Chronic HBV carrier may be infected for most cases. Epidemiological data indicate the with HDV, and generate superinfection or coinfection, consumption of tobacco and alcohol as the main risk and evolve to chronicity, liver failure. The average factors for malignant transformation, and genetic endemicity in Perú, could be changed by migration from susceptibility and infection with HPV virus are risk areas of high to low endemicity. The province of Huanta factors too. The HPV virus is transmitted sexually and is is hyperendemic for HBV and for the presence of HDV. associated with the presence of cervical lesions and the In 1996, 5.1% of children aged 4 had HBV infection. occurrence of cervical and anogenital carcinomas. More
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
141 Human Virology: HV
applying a questionnaire and explanations of the study a single biological sample collection was performed. The dependingthan 200 different on their types association of HPV withhave thebeen development identified and of prevalence observed was 0% for anti-HCV and HBsAg, cancer.classified In manyinto two patients distinct with groups, oropharyngeal high risk andcarcinomas, low risk 0.9% for anti-HBc, and 92.5% anti-HBs, vaccination which were not present traditional risk factors coverage against HBV was 99.8%. Around 56% of the
HPV infection virus as the causative agent. Thus, the aimassociated of this with study head was and to analyzeneck cancer, the presenceit was identified of HPV forvolunteerswere prevention of unableinfection. to Regarding define hepatitis, the transmission but the and identify viral types in 35 head and neck carcinoma ofmajority hepatitis (70.8%) 61,7% identified of volunteers the HBV vaccinebelieve as thateffective the samples of non-smokers and non-drinkers. For this transmission occurs through contact with contaminated purpose polymerase chain reaction (PCR) was carried blood or secretions, while 30.3% do not know the ways of transmission. Additionally, we also observed that 27,1% of volunteers have been hospitalized, but only 2,1% out using the oligonucleotide primers PGMY09/11 and received a blood transfusion. Among volunteers 11,6% GP5 +/6 + for HPV detection and then sequencing by the Sanger technique for identification of virus genotypes. the movement of HBV and HCV is considerably low in this As a result it was observed the presence of HPV in five city.have Keywords: body piercing hepatitis and/or B, tattoos. hepatitis The C, results seroprevalence, show that 6samples in another out oftwo thirty-five and the analyzedHPV-58 in samples one sample. (14,28%), The adolescents. Financial Support: CNPq, CAPES. obtainedbeing identified results are the in HPV-16 agreement in two with samples, the literature the HPV- that shows the presence of high-risk HPV types in squamous HV209 - MOLECULAR EPIDEMIOLOGY OF STRAINS cell carcinomas. Keywords: HPV; cancer; head and neck. OF RESPIRATORY SYNCYTIAL VIRUS ISOLATED IN Financial Support: FAPESP e CAPES. BELEM CITY, PARA, BRAZIL Santos, V.M.; Ferreira, D.L.; Barbagelata, L.S.; Ferreira, HV205 - ANALYSIS OF SEROPREVALENCE FOR J.A.; Souza, E.M.A.; Sousa Junior, E.C.S.; Medeiros, R.; HEPATITIS C (HCV) AND HEPATITIS B (HBV) IN A Santos, M.C.; MELLO, W.A. GROUP OF ADOLESCENTS WITH IMMUNIZATION 1. INSTITUTIONAL SCHOLARSHIP PROGRAM COVERAGE FOR SCIENTIFIC INITIATION, EVANDRO Reichert, C.O.; da Cunha, J.; Branco, F.R.P.; Maselli, CHAGAS INSTITUTE L.M.F.; Bydlowski, S.P.; Spada, C. 2. NUCLEUS OF TROPICAL MEDICINE, 1. UNIVERSIDADE FEDERAL DE SANTA FEDERAL UNIVERSITY OF PARÁ CATARINA 3. EVANDRO CHAGAS INSTITUTE 2. FACULDADE DE MEDICINA DA The human respiratory syncytial virus (HRSV), it is one of UNIVERSIDADE DE SAO PAULO the main pathogens causing acute respiratory infection Viral hepatitis is caused by infection with any of at least (ARI). Studies made by the World Health Organization in 2010 indicate that the HRSV is responsible in the world virus (HBV), hepatitis C virus (HCV), hepatitis D virus for more than 60% of diseases of the lower respiratory (HDV),five distinct and viruses:hepatitis hepatitis E virus A(HEV). virus (HAV),Infections hepatitis caused B tract in children, which 50-90% developed bronchiolitis by hepatitis B virus (HBV) and Hepatitis C (HCV) are and 5-40% developed pneumonia. The virus infects considered public health problems, given that all in 3-7% of healthy adults and 10% in high-risk groups. The world, about 400 million people are infected with HRSV displays seasonal pattern, occurring epidemics HBV and 200 million with HCV. Our study assessed in the fall and winter in countries with temperate prevalence of markers of infection and immunization climate and during the rainy season in countries with with HBV and HCV infection marker in adolescents (10- tropical climate. The HRSV presents great genetic and 15 years), elementary school students in the city of Lages antigenic variability, mainly in glycoprotein G, whose (SC), Brazil. A total of 439 volunteers were enrolled in the study period of one year (2009-2010). After two subgroups, HRSV A and B, which show 12 and 20 differences allow the classification of the HRSV into October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
142 Human Virology: HV genotypes, respectively. In this context, studies have degree of recovery of CD4+ T-cells. One hundred and been developing around the world in order to analyze nineteen (119) HIV-1-infected patients were followed the genetic diversity of HRSV and the circulation factors for six months, before (ART-naïve) and after initiation of this vírus. The objective of this study is to characterize of HAART, and divided according to CD4+ T-cells count: genetically the HRSV strains isolated in Belém city, Pará from 2011 to 2014. In the period of the current study, the mm3. All were evaluated at intervals of 60, 120 and 180 material used was 122 positive samples for HRSV based daysCD4+ of <200, treatment 200-to-350 to parameters: and CD4+ viral T-cells load (RNA-HIV-1), >350 cells/ on the database of the Respiratory Virus Laboratory of CD4+ and CD8+ T-cells, cell viability (apoptosis). The Evandro Chagas Institute. All positive samples for HRSV inhibition of viral replication was effective at 60 days of were conducted for genetic characterization of the G therapy, and the recovery in mean CD4+ T-cells count was achieved in all groups, as well as the number of viable cells. However, only the group who began therapy with andprotein nested and PCR identification to identify subgroups of subgroups to HRSV through A and four B; main steps: a) partial amplification of F gene by RT-PCR 3. We concluded that after six months of sequencing d) phylogenetic analysis. The results showed therapyCD4+ T-cells the recovery >350 cells/mm3 was incomplete reached in values HIV-1-infected of above thatb) the of total122 positive amplification cases offor the HRSV G gene in the by majority RT-PCR; ofc) patients500 cells/mm who started HAART with a CD4+ T-cells count samples, 110 (90,2%), the patients were between 0 and 3, and that only individuals who 4 years old. The viral subgroup was determined in 122 samples being all HRSV B. Analysis of G gene sequencing mmof <3503 reached cells/mm a satisfactory recovery. Keywords: HIV-1, was performed in 58 samples and it is possible to identify HAART,started HAARTART-naïve, with CD4+ CD4+ T-cells, T-cells cell counts viability, of >350 apoptosis. cells/ the Buenos Aires (BA) genotype in 100%. The virus Financial Support: CNPq, CAPES. circulation occurred especially between the months from March to July. It was noticed that the HRSV was HV213 - PREVALENCE OF LOW AND HIGH-ONCOGENIC more frequent in children <5 years old. The BA genotype RISK HPV IN PATIENTS WITH CYTOLOGICAL belonging to HRSV B was predominant in our region DIAGNOSIS OF CERVICAL INTRAEPITHELIAL NEOPLASIA OF LOW AND HIGH-GRADE LSIL, HSIL that previous studies show the circulation of HRSV (CIN I, II AND III) moreduring common the period in studied.periods Theof rains seasonal and profilenatural confirms climate Silva, A.K.; Ferreira, L.S.S.; Paixão, C.G.S. da; Oliveira changesin tropical regions, which occurs between March O.S.; Abraão L.M.L.; Junior, L.B.D.; Fonseca, L.P.S.; Mello, W.A.; Silvestre, R.V.D. 1. INSTITUTO EVANDRO CHAGAS andHV210 July. - FinancialEVIDENCE Support: OF THE CNPq/IEC/MS/SVS/FAMAZ. BENEFITS OF HAART IN 2. UNIVERSIDADE ESTADUAL DO PARÁ HIV-1 IN EARLY INFECTION 3. LABORATÓRIO PAULO AZEVEDO Joel da Cunha, J.; Maselli, L.M.F.; Reichert, C.O.; Silva, The presence of Human Papillomavirus (HPV) in the A.L. de O., Bydlowski, S.P.; Spada, C. cervix, especially the high-risk oncogenic types (HR- 1. UNIVERSIDADE FEDERAL DE SANTA HPV) have a causal role in the development of cancer CATARINA of the uterine cervix, being the more incident in the 2. FACULDADE DE MEDICINA DA northern region of Brazil, demonstrating the need for UNIVERSIDADE DE SAO PAULO preventive action and control over the infection with the The depletion de CD4+ T-cells in individuals infected virus and its pathogenic effects on the uterine cervix in order to reduce the incidence and mortality of cancer. is reversed when the use of highly active antiretroviral The study aims to investigate the prevalence of HPV therapywith human (HAART), immunodeficiency however, this recovery virus does type-1 not (HIV-1) always infections, low and high- oncogenic risk in women aged permit the CD4+ T-cells levels achieve their baseline 20 to 50 years, by spontaneous demand, with cytological values, remaining thus doubt the best moment to begin diagnosis of cervical intraepithelial neoplasia low injury antiretroviral therapy and therefore obtaining a greater (CIN I, LSIL) and high injury (CIN II and III HSIL) in the
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
143 Human Virology: HV metropolitan region of Belem. Was collected for analysis, and B are the ones that present most clinical importance smears of uterine cervix from routine gynecological, designed for diagnosis of HPV infection with second generation Hybrid Capture kit (QIAGEN, Gaithersburg, havein humans two antigenically as well the and trivalent genetically influenza distinct vaccine strains, that consists of two strains of type A and B. Influenza B virus the detection of HPV types were made using Linear Array only one is the annual vaccine. These viruses have a HPVUSA), Genotyping for positive Test screening. kit (ROCHE The PCRMannheim, amplification Germany) and highB/Yamagata/16/88 genetic variability, and thereby B/Victoria/2/87, monitoring circulating of which according to the manufacturer protocols. Were processed immunization update, in order to minimize the economic andstrains social of influenza impact on B publicviruses health. is essential, With thecontributing objective to a total of 718 samples in CH2 test. Of these, 123/718 cytological(17%) were analysis, HPV positive, we included being only 112/123 16 patients (91%) for were the in the North and Northeast of Brazil, through genetic study,positive because for HR-HPV they andpresent 11/123 low (9%)or high-intraepithelial for LR-HPV. After analysischaracterize of genes the Influenza encoding B the virus surface strains, glycoproteins circulating lesion in their cytology. Of these, 14 samples were hemagglutinin (HA) and neuraminidase (NA), positive diagnosed with CIN I, being 9 positive for HR-HPV and samples were collected from July 2014 to July 2015. 5 were negative by CH2 test, 1 with Carcinoma, positive for HR-HPV and as CIN II, being negative for HPV in CH2. nucleic acid by Polymerase Chain Reaction preceded by reverseThe samples transcription were subjected (RT-PCR) to and amplification sequencing of of viral the with CIN I. Where, 2 samples showed the type 51, the HA and NA genes. 34 samples were sequenced for the 58After in other typing 2 weresamples, identified the type viral 66 typesin more in 2 6 ones samples and HA gene and eight for the NA gene. Analysis of the HA the 52 in one sample. One of the samples with CIN I gene in samples from 2014 showed that both strains had multiple infections for more than one type (51 and 66). The type 58 was found in carcinoma sample. Any lineage was the predominant one. In 2015, two samples, one viral type was reveled in CIN II sample. The results of influenza B viruses had circulated, and the Victoria show the role of HPV as central etiological factor, in the uterine cervix lesions in the study, but suggest a different nobelonging mutations to thethat lineage confer Bresistance / Yamagata to antiviral / 16/88, drugs have pattern as the incidence of HR-HPV types. Revealing an currentlybeen identified. used. InThe the phylogenetic analysis of the analysis NA, there showed were inconsistent clinical effect with about the prevention of that most samples sequenced in 2014 grouped with HR-HPV types, not covered by current vaccines for the strains belonging to the B Victoria strain, however, the for cancer of the uterine cervix. Keywords: HPV, Cervical Yamagata lineage, as well the vaccine was not consistent virus. Influencing, also, on the prevention and screening withcomponent the predominantly of the vaccine circulating strain in 2014strain. was However, of the B/in 2015 the circulating strains grouped with the vaccine Intraepithelial Neoplasia. Financial Support: MS/SVS/ IEC/CNPq.HV214 - GENETIC CHARACTERIZATION OF to the recommended immunization for current year. INFLUENZA B VIRUS STRAINS CIRCULATING IN THE Thestrain disagreement belonging to between the B/Yamagata circulating lineage, strains agreeing and NORTH AND NORTHEAST REGIONS vaccine strains reinforces the clear need for surveillance Silva, A.M.; Santos, M.C.; Junior, E.C.S.; Barbagelata, L.S.; Ferreira, J.A.; Medeiros, R.; Mello, W.A. vaccine, especially in those countries that adopt a of Influenza virus for the formulation of appropriate 1. EVANDRO CHAGAS INSTITUTE 2. NUCLEUS OF TROPICAL MEDICINE, FEDERAL UNIVERSITY OF PARÁ trivalent formulation of the influenza vaccine. Keywords: Influenza B, Genetic Characterization, Influenza vaccine. Financial Support: IEC/MS/SVS/FAMAZ. virusInfluenza belonging is an acute to the respiratory Orthomyxoviridae infection family, of viral which origin, is self-limited and easily transmitted, caused by influenza comprisedOctober 2015 of Volume the genres 20 – Supplement A, B and 1C. - TheAbstracts/Posters Influenza virus - Human A Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
144 Human Virology: HV
HV216 - MOLECULAR EPIDEMIOLOGY OF NOROVIRUS ASSOCIATED TO PEDIATRIC HOSPITALIZATIONS BEFORE AND AFTER THE INTRODUCTION OF four(5/9): samples GII.P7/GII.6 are under (n=2), laboratory GII.P12/GII10 analysis. (n=1), We observed GIIP4/ ROTARIX® VACCINE IN BELÉM, NORTHERN BRAZIL duringGII.17 (n=1)this study and the GII.P7/GII.14 circulation of (n=1). 5 variants, The remaining including Santos, L.F.P.; Bandeira, R.S.; Gabbay, Y.B.; Siqueira, the unusual Yerseke_2006a in the post-vaccination J.A.M. period. Recombination events were present in both periods, which it has not yet been described in Brazil, INSTITUTO EVANDRO CHAGAS showing greater variability of genotypes, mainly in In Brazil, in recent years there was an increase in the post-vaccination period. Keywords: Norovirus, the number of children hospitalized due to infection Gastroenteritis, Recombinant, Variants. Financial by norovirus (NoV). This virus is transmitted by Support: Instituto Evandro Chagas; FAPESPA (Edital nº fecal-oral route and it is clinically characterized by diarrhea, vomiting, nausea and abdominal cramps. Its genome is organized into three open reading frames 006/2014).HV218 - MOLECULAR EPIDEMIOLOGY OF STRAINS (ORF) showing strong mutation rate, with frequent HUMAN RHINOVIRUS (HRV) CURRENT IN BELÉM homologous recombination events. The purpose of this CITY, PARA, BRAZIL study was to establish the NoV-molecular epidemiology Lima, S.T.; Vergueiro, M.V.B.; Santos, C.M.; Sousa in cases of pediatric hospitalizations, before and after Junior, E.C.; Ferreira, D.L.; Souza, E.M.A.; Mello, W.A.; the introduction of Rotarix® vaccine in 2006 in Belem- Sousa, R.C.M. PA. A total of 108 samples previously characterized by 1. EVANDRO CHAGAS INSTITUTE polymerase gene (RdRp) were tested, being 62 in the 2. NUCLEUS OF TROPICAL MEDICINE, FEDERAL UNIVERSITY OF PARÁ The Human Rhinovirus (HRV) is among the most wasfirst performedperiod of collection using a One-Step (pre-vaccination) RT-PCR Kit and targeting 46 in the common viral agents associated with upper respiratory regionssecond (post-vaccination).C and D from VP1 gene. Partial In case genome of a disagreementamplification tract infections, being that pathogen recognized as the between the two regions genotyped (RdRp and VP1), the major cause of the common cold. The development of molecular methods has been providing studies on the junction region between ORFs 1/2 was considered to diversity of the HRV, thus allowing the characterization of confirm a recombination event. Samples classified as GII. the different strains that circulate throughout the world, and the association of this agent with the most severe editedP4/GII.4 in were Bioedit analysed and bymaximum P2 region likelihood to determine method the cases of respiratory infections such as bronchiolitis withcurrent 1000 variants. bootstrap Nucleotide replicates sequences was applied. were An aligned/ overall and pneumonia. Aiming to detect and characterize HRV strains associated with cases of severe acute respiratory positivity of 80.5% (87/108) was achieved by VP1 region, syndrome (SARS) in the city of Belém, Pará, Brazil, 224 of which 83.9% (73/87) samples were classified as GII.4; samples from patients with SARS attended at hospitals 4.6% (4/87) as GII.3; and 1.1% (1/87) as GII.8. Another were analyzed from January 2013 to January 2014. Sample analysis was developed using 3 major steps: were9 samples characterized were analyzed by P2 region, to confirm demonstrating recombination the presenceevent. Of theof 573 variants. samples Inclassified the pre-vaccination as GII.4, 49 (67.1%) period RNAv by RT-PCR Real-time and conventional RT-PCR; anda) extraction c) sequencing of viral of the RNA viral (RNAv); genome. b) amplificationAmong the 224 of analyzed samples 59 (26.3%) were positive for HRV, inthe 2003, following while were in the observed: post-vaccination: US95_96 (30.6%-15/49)Yerseke_2006a between 1998/2000 and Kaiso_2003 (38.8%-19/49) being 22 of these possible to characterize the species of
(2.1%-1/49) in 2009, Den Haag_2006b (16.3%-8/49) eight (36.3%) as HRV-C and one Enterovírus-68 (EV-68). NoHRV HRV-B by sequencing, was detected. with The 13 age(59%) distribution classified shows as HRV-A, that disagreementbetween 2008/2009 between and the Newgenotypes Orleans_2009 observed (12.2%-by both 6/49) in 2010-2011. Nine samples (10.3%-9/87) had patients aged 0 to 4 years old concentrated the majority October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV regions, being confirmed recombination event in 55.5% XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
145 Human Virology: HV of cases diagnosed for HRV during the study period (n be described as it follows: DENV-1 was mainly detected from 2009 to 2012; DENV-2 was detected from 2008 infections in adults with 19 cases (32%). Regarding the = 23, 39%). We notice also the significant number of afterto 2012; 2012. DENV-3 phylogenetic was identified reconstructions in 2006 ofand 4 noserotypes longer whichmonthly is distributionusually associated of HRV with in Belém,the period it was of verifiedhighest weredetected conducts after 2007from and61 finally,complete DENV-4 genome, was detected rainfallcirculation in our predominantly region. The inresults the first express half ofthe the rate year, of in this period: Twelve DENV1, nine DENV2, thirty-six infection relevant for HRV, showing that this virus is a DENV3 and tem DENV4. Were founded circulating on São important agent with regard to respiratory infections in Belém, Pará, Brazil. The genetic characterization amino acids for each lineage; three subgroups of DENV2 performed in our study showed that circulation of José do Rio Preto: two lineages of DENV1, with specific species A and C of HRV in period analized with distinct include 2006 samples and for other group with strains fromwith specific2011 to amino2008. acidsDENV changes3 and DENV4 for one showed group thatone other studies. The EV-68 has been detected sporadically lineage each one and the serotypes circulating are the inserotypes/genotypes cases of respiratory in infection each species, and recently corroborating has caused with same as described previously, on Brazil. The epidemic an outbreak of respiratory infection in the United States. behavior of the serotypes in the region of São José do Rio Preto agrees with other data obtained from other studies performed in Brazil, suggesting that the co-circulation of FinancialHV220 - MOLECULAR Support: IEC/SVS/MS. SURVEILLANCE AND DYNAMICS multiple serotypes resulted in competition, and genetic OF DENGUE VIRUS IN A MEDIUM SIZE CITY OF diversity. The constant surveillance of DENV in endemic BRAZIL, DURING NINE EPIDEMIC SEASONS regions, it is important to understand the mechanisms Zini, N.; Vedovello, D.; Ullmman, L.S.; Zini, N.; of introduction, disappearance or extinction and Bronzoni, A.M.R.V. de M.; Terzian, A.C.B.; Colombo, replacement of serotypes, genotypes or lineages. T.L.; Lopes, J.C.C.; Cury, A.A.F.; Chiavanotti-Neto, F.; Financial Support: Fapesp, CNPq and CAPES. Teixeira, M.M.; Araújo Junior, J.P.; Drumond, P.R.B.P.; Nogueira, M.L. HV222 - EPIDEMIOLOGICAL INVESTIGATION OF THE INFECTION ASSOCIATED TO HUMAN T-LYNPHOTOPIC 1. FACULDADE DE MEDICINA DE SÃO JOSÉ DO VIRUS (HTLV) IN PUBLIC FACILITIES OF BELÉM CITY, RIO PRETO PARA, BRAZIL: PRELIMINARY RESULTS 2. UNIVERSIDADE ESTADUAL PAULISTA 3. UNIVERSIDADE FEDERAL DE MATO GROSSO Almeida, D.S.; Almeida, C.P.S.; Silva, I.C.; Pinheiro, 4. SECRETARIA MUNICIPAL DE SAÚDE DE SÃO B.T.; Coelho, J.L.; Nobre, A.F.; Ferreira, L.S.C.; Pereira, JOSE DO RIO PRETO C.C.C.; Morais, L.A.; Ribeiro, J.F.; Queiroz, F.M.; Viana, 5. FACULDADE DE SAÚDE PUBLICA M.N.S.A.; Santos, F.S.; Araujo, M.W.L.; Costa, C.A.; 6. UNIVERSIDADE FEDERAL DE MINAS GERAIS Sousa, M.S. 7. UNIVERSIDADE FEDERAL DE JUIZ DE FORA UNIVERSIDADE FEDERAL DO PARÁ Dengue virus (DENV) is a public health problem, Human T-lymphotropic Virus (HTLV) is a retrovirus especially in tropical regions that present favorable associated with highly lethal lymphoproliferative disease, environmental for mosquito vector development. This neurodegeneratives debilitations and opportunistic infections. The transmission occurs primarily by Dengue cases in São José do Rio Preto, during nine breastfeeding or unprotected and continuous sexual epidemiologicalstudy presents aseasons molecular (2006 surveillance to 2014). of During confirmed this intercourse with an infected person. In Brazil, the areas time, the four serotypes have been detected, representing with the highest prevalence of infection are located a hyperendemicity. Patients with typical symptoms in the North and Northeast. The city of Belém, State of Pará, has the third highest prevalence of infection among Multiplex-Nested-PCR. A total of 1,774 samples were blood donors among capitals of the Brazilian states. positiveof Dengue for had any blood DENV. collected The serotypes for identification circulation using can The aim of the study was to investigate the HTLV in the
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
146 Human Virology: HV
HV223 - IMPORTANCE OF RECOGNIZING cases to establish actions that prevent the spread of ORTHOPOXVIRUS INFECTIONS AMONG HEALTH viralpopulation infection of Belém,and possible given the associated importance pathologies. of finding PROFESSIONALS, BRAZIL MATERIAL AND METHODS: We investigated people Costa, G.B.; de Oliveira, J.S.; Bonjardim, C.A.; Ferreira, aged over at least 18 years, which pass for public places P.C.P.; Abrahão, J.S.; Kroon, E.G.; Trindade, G.S. in Belém, from November 2014 to July 2015. Blood samples were subjected to anti-HTLV antibody screening LABORATÓRIO DE VÍRUS, DEPARTAMENTO DE MICROBIOLOGIA, INSTITUTO DE CIÊNCIAS by enzyme-linked immunosorbent assay (ELISA). The BIOLÓGICAS, UNIVERSIDADE FEDERAL DE MINAS GERAIS viral type were performed by nested PCR followed by enzymaticconfirmation digestion. of infection The virus and phylogenetic the identification analysis was of Despite the eradication of smallpox, orthopoxviruses performed using analysis of nucleotide sequences of the (OPV) are still a concern due to the possible use of 5 ‘LTR region. People with infection were targeted and Variola virus as a biological weapon, as well as the registered for periodic clinical evaluations in outpatient increase outbreaks of zoonotic OPV worldwide, such as Tropical Medicine Center in Federal University of Monkeypox virus and Cowpox virus which are endemic in Pará. RESULTS: 721 people were investigated, with a Africa and Europe respectively. In Brazil, Vaccinia virus mean age of 43.7 years, from 79 districts of the large (VACV) is a causative agent of Bovine Vaccinia (BV), Belém, mainly women (62.8%), brown (73.6%), with an exanthematous disease that affects dairy cattle and medium to high education (57.8%) and with family humans in rural areas. In humans, ulcerated, necrotic income below or equal to the minimum wage (78.4%). and painful lesions are observed mainly on hands (because of its close contact with infected animals during milking). However, lesions can spread to secondary body infection,The infection three was with identified HTLV-2 ininfection 13 (1.8%) and peoplea sample over to sites such as forearms, arms and face. Other signals and be35, determined. in which nine The wereinfection confirmed occurred with mainly the HTLV-1in men systemic symptoms are also reported, such as fever, (53.8%), brown (66.7%), with low education (53.8%) lymphadenopathy, headache and myalgia. Even endemic and low family income (84.61%). Phylogenetic analysis in several Brazilian regions, many cases of BV still go undetected. Most cases are unnoticed to the public or Transcontinental, Cosmopolitan subtype (HTLV-1a). health service, since health and veterinary professionals CONCLUSION:of five HTLV-1 The samples prevalence grouped of HTLV them infection in Subgroup-A found among the population of Belém is similar to highest BV with other most common vesicular diseases. Thus, have difficulty to diagnostic the disease, often confusing ever reported for one of the Brazilian capitals (Salvador- our goal was to investigate the knowledge and training BA), diverging by the predominance of males in Belém. of health care workers for attending cases of BV. We The investigated subjects were brown in majority with conducted an epidemiological survey and collected low education and family income. Financial Support: 39 serum samples in an endemic area for BV. Most of This study was supported by Fundação de Amparo individuals are women (92,3%), distributed in 6 different à Pesquisa do Estado do Pará (FAPESPA), Secretaria Health Care Units of the city. Professional category are Municipal de Saúde e Meio Ambiente de Belém (SESMA), Nurses (n=6; 15,4%), Nursing Technicians (n=12; 30,7%), Instituto Evandro Chagas (IEC), Conselho Nacional de Community Health Workers (n=13; 33,3%) and others (n=8; 20,5%). Only 8 individuals (20,5%) attended cases Universidade Federal do Pará (UFPA). of BV, demonstrating some knowledge about the disease. Desenvolvimento Científico e Tecnológico (CNPq) and To detect neutralizing antibodies anti-OPV a plaque reduction neutralizing test was chosen. It was found 12 seropositive individuals (30,7%) with antibodies titers
smallpox eradication, the importance of poxviruses hasranging decreased from 100 in human to 6400 medicine, neutralizing not units/ml.being unusual After the total unpreparedness of health professionals about October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
147 Human Virology: HV the clinical and epidemiological aspects related to OPV. this region. Keywords: Phylogenetic Characterization, Indeed, our data show that most health professionals, Dengue virus 4, Genotype II. Financial Support: Conselho who are in direct contact with infected individuals, poorly have some knowledge about the disease. As result of this (CNPq) and Fundação de Amparo à Pesquisa do Estado deNacional Goiás (FAPEG). de Desenvolvimento Científico e Tecnológico and medical centers, setting precedents to nosocomial deficiency, OPV infections could easily spread to hospital HV226 - HUMAN PAPILLOMAVIRUS GENOTYPES are needed in disease surveillance, diagnostics, and IN ORAL CAVITY FROM HIV-INFECTED AND HIV- infectioninfections control. of difficult Keywords: to treat. Bovine Clearly, Vaccinia, improvements Vaccinia UNINFECTED INDIVIDUALS virus, health professionals, knowledge, epidemiology. Silva, C.O.; Santos, L.S.; Pereira, O.M.D.; Azevedo, Financial Support: CAPES, CNPq e FAPEMIG. K.M.L.; Almeida, N.K.O.; Oliveira, L.H.S. UNIVERSIDADE FEDERAL FLUMINENSE HV225 - PHYLOGENETIC CHARACTERIZATION OF DENGUE VIRUS SEROTYPE 4 IN GOIÁS, BRAZIL, 2013 Human papillomavirus (HPV) infection still needs more Cunha, M.P.; Guimarães, V.N.; Oliveira, T.S.; Souza, studies in order to clarify the tropism of this virus in M.B.L.D.; Cardoso, D.D.P.; Almeida, T.N.V.; Fiaccadori, others sites of the body than the genital tract. The aim of F.S. this work was to investigate demographic and biological aspects of HPV infection in the asymptomatic mouth INSTITUTO DE PATOLOGIA TROPICAL E SAÚDE mucosa from HIV positive patients compared with non PÚBLICA - UNIVERSIDADE FEDERAL DE GOIÁS HIV controls. Methodology: Oral swabs from 77 HIV- Four serotypes of Dengue virus (DENV-1-4) cause infected people and 120 HIV-negative people living in dengue infection and spread rapidly causing a worldwide Rio de Janeiro, Brazil, were collected to determine the
Brazil in 1982 and reemerged in 2008. This work aimed restriction fragment length polymorphism and topublic present health the problem.phylogeny DENV-4 and based was on first the isolated envelope in sequencingHPV status. assays Polymerase were chainperformed reaction to amplification, detect and gene (E) of DENV-4 isolated during epidemics occurred genotyping the virus. Demographic and lifestyle data in 2013. DENV-4 positive samples were subsequently were obtained through a structured questionnaire and recorded on a SPSS-18 data bank. Results: Most of HIV positive people had a moderate immune status and partialsubjected envelope to RNA gene extraction (363bp). and All RT-PCRnucleotide amplification sequences were under antiretroviral therapy. Oral HPV was found fromusing Goiás DENV-4 were specific aligned primers with other for the sequences sequencing available of the predominantly in HIV positive group (p value = 0.003), at the GenBank, representing all DENV-4 genotypes, as well as HPV co-infections (p value = 0.021). HPV 6 was using the Clustal X2 program and edited using Jalview the prevalent genotype, regardless the HIV infection or demographic data. HPV 53, strongly associated to HIV was inferred with jModelTest program according the positivity (p value = 0.000), was also the most common Akaikesoftware. information The evolution criterion model (AIC),that best and fits a theNeighbor- dataset genotype found in the oral cavity of HIV infected women Joining (NJ) and Maximum Likelihood (ML) methods (p value = 0.001). Women from both groups had a high available in the software MEGA6 were used in order frequency of HPV multiple infections (80%). Conclusions: to analyze the phylogenetic relationship. The analyzes Despite the increased oral HPV prevalence associated to demonstrated that all isolates of DENV-4 from Goiás HIV infection, non oncogenic types predominated in both belong to genotype II and grouped with sequences from samples. Reinforcing previous study, HPV 53 seems to be countries in Americas and others Brazilian states. Similar a common genotype in HIV infected female population results were found in others studies, demonstrating from Rio de Janeiro, Brazil. Financial Support: PROPP- the circulation of DENV-4 in Brazil. In conclusion, this UFF; FAPERJ.
Brazil and this results highlighting the importance ofstudy the iscontinuous the first reportmonitoring of DENV-4 of emerging detected viruses in Goiás, in
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
148 Human Virology: HV
HV227 - KIR GENES POLYMORPHISM IS ASSOCIATED HV229 - SEROLOGICAL PROFILE OF ROTAVIRUS WITH PROGRESSION OF FIBROSIS IN HCV INFECTION FROM 2014 TO JULY 2015 AT CENTRAL MONOINFECTED AND HIV/HCV CO-INFECTED LABORATORY OF PUBLIC HEALTH OF AMAPÁ (LACEN- PATIENTS AP) Nunes, C.; Massolini, V.M.; Barbosa, F.H.; Barbosa, Marques, J.P.; Almeida, R.R.P.; Rêgo, M.O.S.; Rodrigues, A.N.; Silva, G.F.; Grotto, R.M.T.; Pardini, M.I.M.C. A.P.S.; Cavalcante, M.S.; Mendonça, A.; Lopes, I.G.; D’Athaide, E.S. SAO PAULO STATE UNIVERSITY 1. LABORATÓRIO CENTRAL DE SAÚDE Hepatitis C is dependent of the viral and host factors, PÚBLICA DO AMAPÁ 2. UNIVERSIDADE FEDERAL DO AMAPÁ theAlthough genetic the polymorphism fibrosis evolution have been during associated the chronic with Among the acute diarrheal disease (ADD) the rotavirus polymorphism have already been associated with the (RV) have been highlighted as responsible for affecting progressionthe fibrosis of progression the HIV infection. in the In last the years.same way, KIR studies genes have already been demonstrated the association of the and developing countries, causing more than 197,000 KIR genes polymorphism and cirrhosis development deathsmainly childrenper year. under This the study age of aimedfive years, to inanalyze developed the during the course of Chronic Hepatitis C. But is unknown about the relation of these polymorphisms and the LACEN-AP, from 2014 to July 2015. These analyzes were madeserological possible profile by consulting of rotavirus LACEN-AP infection database, identified with at this context, the goal of this study was to evaluate KIR help of the Amapá Laboratory Environment Manager, in fibrosis progression in HIV/HCV co-infected patients. In order to assess the number of serological tests for the RV research conducted during the proposed period as andgenes Methods: polymorphisms The study in HIV/HCVincluded 151co-infected samples patients which wereand its divided association into withtwo groupsfibrosis (Groupprogression. 1: 100 Materials mono- the number of rotavirus positive samples and their frequency.well as identification The data ofwere their organized serological and profile analyzed with genes polymorphisms were determined by PCR-SSP. infected HCV; Group 2: 51 Co-Infected HIV/HCV). KIR year of 2014, 95 tests were carried out for RV research usingaccording enzyme to the immunoassays scientific literature and, fromreview. this During total, the14 For staging of hepatic fibrosis was used the METAVIR results were considered positive (14.7%). From January withsystem, few where septa, F0F3 meansnumerous the septa absence where of fibrosis,the outline F1 to July 2015, we obtained a greater amount of suspected ofportal nodules fibrosis can be without seen, and septa, F4 F2cirrhosis. fibrous Results: expansion The cases and rotavirus positive samples than the entire year of 2014, 20 samples (20.2%). These results show between the genes KIR2DL2, KIR2DS2 and F3, F4 and; the need for the correct reporting of suspected cases to KIR2DL5results showedwith F3 in a group significant 2, suggesting association that this (P<0.05) genes access molecular diagnostic information, which allows
of Amapá. It is necessary to subsidize tools to implement identification of the circulating RV genotype in the State time,are related that the with KIR advanced genes KIR2DL2, fibrosis KIR2DS2 HIV/HCV and co-infected KIR2DL5 the sentinel networks, achieving improved monitoring patients. Conclusion: The results suggesting, for the first and control of the DDA. Despite of the implementation of the RV vaccine in the national vaccination program, it could be used as biomarker to fibrosis progression in is necessary ongoing molecular studies to determine the HIV/HCV co-infected patients and, this result suggesting that the presence of HIV may influence the HCV infection. requiring the expansion of the health surveillances of RV Financial Support: FAPESP (Process 2013/21214-9). totrue advance efficacy the of the timely vaccine. diagnosis. RV is a public Keywords: health rotavirus, problem,
serological profile, diagnosis, sentinel networks.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
149 Human Virology: HV
HV230 - LOW GENETIC DIVERSITY OF HTLV-1 IN one virus infecting the same family. Financial Support: INTRAFAMILIAL TRANSMISSION This study was supported by Fundação de Amparo Almeida, D.S.; Costa, C.A.; Costa, A.R.F.; Ferreira, à Pesquisa do Estado do Pará (FAPESPA), Secretaria L.S.C.; Barbosa, S.F.C.; Lima, K.V.B.; Souza, R.C.M.; Municipal de Saúde e Meio Ambiente de Belém (SESMA), Nobre, A.F.; Almeida, C.P.S.; Pereira, C.C.C.; Morais, Instituto Evandro Chagas (IEC), Conselho Nacional de L.A.; Ishikawa, E.A.; Santos, E.J.M.; Vallinoto, A.C.R.; Linhares, A.C.; Sousa, M.S. Universidade Federal do Pará (UFPA). Desenvolvimento Científico e Tecnológico (CNPq) and 1. UNIVERSIDADE FEDERAL DO PARÁ HV232 - MOLECULAR ANALYSIS OF NOROVIRUS 2. INSTITUTO EVANDRO CHAGAS STRAINS DETECTED IN DIARRHEIC CHILDREN The high prevalence of antibodies against human T-cell FOLLOWED-UP FOR TWO YEARS DURING 1990-1992 lymphotropic virus type 1 (HTLV-1) in relatives of IN BELÉM, NORTHERN BRAZIL infected individuals demonstrated in several studies and Siqueira, J.A.M.; Costa, L.C.P.N.; Júnior, E.C.S., Portal, has been characterized in the formation family clusters, T.M.; Resque, H.R.; Linhares, A.C.; Gabbay, Y.B. become the prevalence higher than general population. INSTITUTO EVANDRO CHAGAS The importance these associated studies is to know the prevalence and minimize infections associated Norovirus (NoV) is the leading cause of non-bacterial gastroenteritis (GE) worldwide. Antigenic drifts, RNA- silent intrafamily spread needs better understanding recombination and mutation are common events that atto the HTLV-1 molecular as HAM/TSP level, to andhelp ATL.in infection In this aggregation context the may contribute to viral evolution. The purpose of this study. Objective: This study aimed to determine the study was to determine which NoV genotypes were phylogenetic relationships of HTLV-1 in intra-familial associated with acute GE among children followed-up transmission. Material and Methods: Nucleotide from birth to the age of 2 years (1990-1992) during sequences of the 5 ‘LTR region of viruses isolated from the phase III study with the RRV-TV vaccine against rotavirus (RV). A total of 3075 samples were collected one family infected by HTLV-1 were investigated. Twelve and tested for RV (4.6%) and astrovirus-HAstV (5.4%). familiesfamily groupings in their 68 previously subjects were identified investigated with more between than April 2011 and October 2012 in the Tropical Medicine randomly selected 172 samples to be tested for NoV. The Of the RV/HAstV-negative samples (n=1865), we Center, Federal University of Pará. Results: Transmission enzyme immunoassay (EIA) and RT-PCR targeting the Polimerase-RdRp and Capsid genes were used for antigen detection and genotyping, respectively. In order to more of HTLV-1 was confirmed by nucleotide similarity in accurately classify the GII.4 species, we further targeted 91.6% (11/12) families and 50% (34/68) of those viral P2 region. Possible recombination events were investigated. Vertical transmission was confirmed in to39.4% 2.2572). (13/33) By ofphylogenetic the mother-child analysis (a) relationsof 28 samples, and in region using SimPlot software. Nucleotide sequences 47.4% (9/19) of couples surveyed (P = 0.8549, 95: 0.2311 assessed through the analysis of the ORF1/2 junction viral nucleotide divergence in 11 families ranged from corresponding to cases confirmed by molecular biology, usingwere Maximum edited/aligned Likelihood by BioEdit Method and with dendograms 1000 replicates. were constructed/edited in the Seaview/FigTree softwares, zero to 0.7% and only one family was identified most Overall positivity by EIA was 15.7% (27/172). As based Subgroupsignificant A difference Transcontinental. of 1.83%. The Conclusion: low genetic All diversity cases of on RT-PCR, 9.9% (17/172) samples were positives when ofHTLV-1 the virus were observed confirmed in asalmost the Cosmopolitan all families investigated, subtype, or targeting the RdRp region; of these 47.1% (8/17) were characterized as follows: GII.Pg [n=1], GII.P3 [n=2], GII. taken as the main form of expansion of HTLV-1. The P4 [n=3], GII.P6 [n=1] and GII.P7 [n=1]. The analysis importanceconfirmed the of this expression type of study of intrafamily was evidenced transmission from the of the capsid region yielded a 48.1% (13/27) of which ability to identify differences that prove the exclusion 8 (61.5%) samples could be genotyped: GII.2 [n=1], of domestic transmission, ie, the presence of more than GII.4 [n=2], GII.6 [n=2], GII.7 [n=2], and GII.14 [n=1]. October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology:Two of HV these samples were further classified as GII. XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
150 Human Virology: HV
molecules become a possibility with this system. similar samples collected in 1987 from hospitalized childrenP4/GII.4, inas USA, based representing on the P2 region, one of andthe clusteredworld’s oldest with primary cell culture, the VNPs are observed mostly in collection of GII.4 samples. In two samples a discrepancy glialPreliminary cells. We results are also showed testing that, different in a mixed glial tumoralglial/neuron cells
incorporation to these cancer cells as well. Our studies in classification was observed when both regions were are(N2a, based U87MG, on confocal T98G and microscopy, U138MG) biochemimcalfor VNP adsorption/ assays compared: GII.P7/GII.6 and GII.Pg/GII.2; of note, both 2010,of which in two were children confirmed hospitalized as recombinants. for diarrhea Of in note,Belém. a detect VNP targeting. Also, by using bioinformatics, we homologous GII.P7/GII.6 strain was characterized in predicted(fluoescence 12 potentialand SDS-PAGE) CPPs based and mass on the spectrometry gp8 sequence. to to date on such strain circulating in our region. This They will be synthesized and tested on the same CNS With regards to GII.Pg/GII.2 strain, there are no reports cells described above for molecule delivery. Overall, the NoV strains circulating in Belém more than two decades ago,study providing gives an a insight genetic on background the genotype that specificitiesmay be useful of Financial Support: FAPERJ. in the understanding of molecular evolution of NoV main goal of this work is to find alternative tools based. strains over time. Keywords: Norovirus, Recombinant, HV240 - MOLECULAR EPIDEMIOLOGY OF DENGUE Children, gastroenteritis. Financial Support: Instituto VIRUS 1 IN BRAZIL: ADDING MOLECULAR VIRAL DATA FROM 2010 DENGUE OUTBREAK IN MINAS GERAIS STATE EvandroHV233 - Chagas;BILLIONS FAPESPA OF CHANCES (Edital nºFOR 006/2014). A CURE: USE OF Figueiredo, L.B.; Sakamoto.T.; Oliveira, D.B.; VIRAL NANOPARTICLES FOR CNS THERAPY Bonjardim, C.A.; Ferreira, P.C.P.; Kroon, E.G. Silva, J.G.; Romão, L.F.; Azevedo, E.P.; Cortines, J.R. 1. LABORATÓRIO DE VÍRUS, DEPTO DE UNIVERSIDADE FEDERAL DOR RIO DE JANEIRO MICROBIOLOGIA, ICB, UNIVERSIDADE FEDERAL DE MINAS GERAIS, BELO Glial cells account for up to 90% of the brain; they play HORIZONTE, MG, BRAZIL 2. LABORATÓRIO DE BIODADOS, DEPTO and support to neuronal cells. Many pathologies affect key roles in anti-inflammatory processes, give protection DE BIOQUÍMICA E IMUNOLOGIA, ICB, glial cells, i.e., HIV-associated neurocognitive diseases UNIVERSIDADE FEDERAL DE MINAS GERAIS, (HAND), Parkinson´s, Alzheimer´s, amyotrophic lateral BELO HORIZONTE,MG, BRAZIL sclerosis, multiple sclerosis and cancer. None of the 3. FUNDAÇÃO COMUNITÁRIA DE ENSINO SUPERIOR DE ITABIRA-FUNCESI. protocol seems to be very far on the medicine horizon. Dengue virus (DENV) is the most important arboviruses Wecited are diseases focused have on a thecure, study and thus, of alternatives a definite treatment for CNS disease affecting humans in tropical areas and is the drug delivery using a bacteriophage P22-derived viral causative agent of dengue fever and dengue hemorrhagic nanoparticles (VNP) as targeted nanocarriers. These fever. DENV belongs to the genus Flavivirus of the family VNPs are formed by two proteins: gp5 (capsid protein) 1, DENV-2, DENV-3 and DENV-4. Phylogenetic and protein mCHERRY, that can be easily manipulated to molecularFlaviviridae methods and is classified based on intonucleic four acid serotypes, sequence DENV- data assembleand gp8 (scaffolding . Furthermore, protein) fused gp8 to contains the fluoresecent a highly in vitro have been massively used for epidemiological studies of charged C-terminal region that encompasses important dengue and have demonstrating consistent inference on features to serve as a cell penetrating peptide (CPP). The dengue transmission and circulation history as well as on detection of new viral genotype and lineage. The current to assemble and incorporate the desired test molecule dengue epidemiological situation in Minas Gerais state tofirst the strategy VNPs. isHere, dependent mainly on hydrophilic the ability moleculesof P22 capsids can is characterized by co-circulation of more than three be used. The CPP-based strategy allows for more serotypes and high endemicity. In this study, we isolated freedom with the target molecule, to which liposomes dengue viruses from nine patients from Minas Gerais and micelles can be complexed and thus, hydrophobic
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
151 Human Virology: HV state in 2010 manifesting dengue fever. The molecular 2-parameter and 1000 bootstrap. The analyses evinced epidemiology was performed by sequencing the the circulation of genotypes A1 (10), the most prevalent, genomic region ranging from capsid (C) to the envelope A2 (4), F2a (2), D2 (1) and D4 (1). It was observed that (E) gene and by applying the maximum likelihood the genotype A1 had heterogeneity in the samples, not and Bayesian inference (BI) methods of molecular forming an isolated group in the tree, which would phylogeny. Phylogenetic analysis demonstrated that all suggest that it came from different subgenotypes or origins, genotype A2 was related to strains from Brazil, African- genotype V. Moreover, all samples from Minas Caribe, South Africa, and Argentina. The genotype D4 was Geraisisolates clusteredbelong to thewith DENV-1 the moreserotype recent of the lineage America/ of related to Brazilian (RO) e Caribe region strains, while DENV-1 detected in Brazil. These results reinforce the the genotype D2 was found to be related to sequences importance and applicability of phylogenetic methods from Brazil and Japan. The genotype F2a formed an for epidemiology and surveillance of DENV infection. isolated clade with strains from Venezuela and Brazil (PE, RJ, RO). Our results demonstrate the circulation of different HBV genotypes in Roraima, which are also Financial Support: CAPES/MEC e MS/SCTIE/Decit/ present in other regions of Brazil. From these results, we FAPEMIG/HV243 - PHYLOGENETICCNPq. CHARACTERIZATION OF highlight the importance of keeping the local molecular HEPATITIS B VIRUS IN RORAIMA, BRAZIL epidemiological surveillance, providing information Sousa, D.D.; Silva, C.R.S.; Lima Jr, W.P.; Barros, J.A.; about the virus’ behavior pattern and tools for better Naveca, F.G.; Souza, V.C.; Acosta, P.O.A.; Granja, F. understanding of the illness. Keywords: HBV, Genotypes, 1. UNIVERSIDADE FEDERAL DE RORAIMA Phylogeny, Amazonia. Financial Support: CNPq - apoio 2. INSTITUTO LEONIDAS E MARIA DEANE - FIOCRUZ - AM UFRRHV244 e ILMD/FIOCRUZ- EVALUATION OF- AM. OCCULT HEPATITIS B AND Hepatitis B is a relevant issue to public health worldwide, HEPATITIS C COINFECTION IN PATIENTS TREATED IN and even though there’s a vaccine available to the A REFERENCE SERVICE IN BELÉM, PARÁ, BRAZIL population, Roraima still shows high prevalence rates, Sarmento, V.P.; Freitas, P.E.B.; Brito, D.C.N.; Chagas, therefore, aiming a better understanding of its molecular A.A.C.; Barbosa, K.M.V.; Nunes, H.M.; Soares, M.C.P. traits and looking for aid tools in its epidemiological surveillance, this study objective was the phylogenetic INSTITUTO EVANDRO CHAGAS characterization of HBV genotypes circulating in Viral hepatitis are a major public health problem. Roraima State. HBV is an enveloped virus, part of the According to World Health Organization (WHO), there Hepadnaviridae family, having main transmission are 130 to 170 million people chronically infected by through via parenteral and sexual. It has a circular DNA Hepatitis C virus (HCV), and 350 million by Hepatitis B genome, partially double-stranded with about 3200 bp. virus (HBV). Occult hepatitis B is characterized by the The viral DNA was extracted from 102 blood samples detection of HBV DNA in serum or liver by polymerase of chronic hepatitis B carriers, between March 2013 chain reaction (PCR) in hepatitis B surface antigen and February 2015. Nested-PCR was performed with (HBsAg) negative patients with or without serological markers of previous viral exposure; and hepatitis C can Due to dissimilar viral load values in these samples, we be detected by the presence of antibody anti-HVC, and specific primers, to amplify a segment from the gene S. were submitted to sequencing and their identities were analyzes the presence of occult hepatitis B infection in analyzedobtained by 18 BLAST. positive The amplifications. samples were These compared fragments with positiveconfirmed hepatitis by positive C patients HVC RNA. treated Purpose: from April This study2012 an 85 sequences database selected among available to May 2015 in a reference laboratory in Belém, Pará, sequences from GenBank, and, afterwards, aligned by the Brazil. Methods: Searches were performed within the software MEGA v. 6.0, using ClustalW. The phylogenetic database of patients attending a reference laboratory reconstitution was performed using fragments of 290 with serology suggesting occult hepatitis B (total anti- bp through Maximum Likelihood method, with Kimura- HBc positive and HBsAg and anti-HBs negative), and
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
152 Human Virology: HV positive for anti-HCV. A total of 37 samples of serum as well as to quantify the monomeric anthocyanins or plasma were tested for detecting HBV DNA and HCV by the pH-differential method. The crude extracts of RNA by real time PCR. Detection limit of HBV DNA was the fruits of Fragaria x ananassa Duch. (strawberry) cultivars Camarosa, Aromas and Albion; Vaccinium (Cobas Taqman HBV Test, versão 2.0). Results: Of the virgatum (blueberry); Eugenia uniflora (pitanga, red 376 IU/mL patients, and 27 linearity were males from and 20 10 to females 170,000,000 and average IU/mL and purple varieties); Psidium cattleianum (araçá, red age was 54.2. HCV RNA was detected in 26 (70.3%) and yellow varieties); and Rubus sp. (blackberry) were samples, and HCV RNA was not detected in 11 (29.7%). assayed. Cytotoxicity was performed by sulforhodamine B assay and anti-HSV-1 activity was determined by (13.5%) were coinfected samples, with the detection plaque number reduction assay on Vero cells. The ofSix both (16.2%) HBV patientsDNA and wereHCV RNA. HBV DNA-positive,All coinfected andpatients five antiviral potential of the crude extracts was estimated had suspected infection, and tests were only ordered for and expressed as selectivity index (SI), which is the ratio HCV. Conclusions: The occurrence of occult hepatitis B between the concentration that reduced cell viability by may have clinical impact on the possible transmission 50% (CC50) and the concentration that inhibited viral of infection, and reactivation risk, contribute to the replication by 50% (IC50). Ten different concentrations liver disease progression and to the development of of each extract (1:2) were evaluated (maximum
50 and
C coinfection was detected in the samples, showing that IC50 values were calculated using non-linear regression HCVhepatocellular chronic infection carcinoma. is a Occultrisk factor hepatitis associated B/hepatitis with analyses.concentration The obtainedof 5 mg/mL), results and did the not respective provide CC high SI the occurrence of occult hepatitis B, and reinforcing values (< 1.7). However, a strong positive correlation the need to expand the diagnosis for HBV by molecular (Person r = 0.95; p biology techniques in this group. Keywords: Coinfection anthocyanin contents was found indicating that this , Hepatitis B, Hepatitis C. group of secondary ˂metabolites 0.0001) between could be SI responsible values and for the observed antiviral activity. Anthocyanin contents HV250 - ANTIHERPES ACTIVITY SCREENING OF ranged from 0.61 mg (P. cattleianum yellow variety) to BERRY FRUITS 1,377 mg (Rubus sp.), which are equivalent of kuromanin Chaves, V.C.; Feltrin, C.; Reginatto, F.H.; Simões, C.M.O. UNIVERSIDADE FEDERAL DE SANTA CATARINA extracts of anthocyanins might show better antiviral results./100 g Financial fresh weight. Support: Thus, CNPq the and evaluation CAPES. of enriched Infectious diseases are of great concern worldwide, particularly viral infections, among which those caused HV255 - HIV-1 SUBTYPE C AND BC RECOMBINANT IN by the herpes viruses occur with high incidence. The PERNAMBUCO - BRAZIL treatment of infections caused by Herpes Simplex Lima, K.O.; Leal, E.S.; Cavalcanti, A.M.S.; Salustiano, Virus (HSV) types 1 and 2 is based on drugs such as D.M.; Lacerda, H.R. acyclovir and its derivatives, but often these viruses become resistant to these drugs. Therefore, the search 1. UNIVERSIDADE FEDERAL DE PERNAMBUCO for new and effective antiviral drugs becomes of great 2. UNIVERSIDADE FEDERAL DO PARÁ 3. LABORATÓRIO CENTRAL DE SAÚDE relevance. In this context, natural products are potential PÚBLICA DE PERNAMBUCO candidates. Berry fruits are widely consumed, primarily The HIV-1 subtype B to be the most prevalent in the rich phytochemical composition, especially phenolic Northeast region of Brazil, however it presents a great compounds,for their appearance such as anthocyanins, and flavor, but the also major and compoundsdue to their diversity of HIV-1 with the presence of subtypes B, F, C and present in these fruits. Considering the increasing BF recombinants, and other minority forms. The study consumption of berry fruits, and the limited reports in aimed to evaluate the molecular epidemiology of HIV-1 the literature regarding their antiviral activity, the aims in Pernambuco - Brazil. We analyzed 169 sequences of of this study were to conduct an in vitro antiherpes the protease and reverse transcriptase of HIV-1. Sixty- screening (anti-HSV-1, KOS strain, sensitive to acyclovir) four samples were obtained in the period 2002-2003
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
153 Human Virology: HV and 105, of 2007-2009. All patients were antiretroviral presented structures genetics 28 and the 29_BF-like in therapy naïve. HIV subtyping was determined the region analyzed. The presence of recombinant BF is well documented in Bahia, with high prevalence. Thus, phylogenetic inference with the MEGA software via the detection of different URFs BF in Pernambuco reinforces likelihoodpreliminarily method by REGA (ML). subtyping The study tool revealed and confirmed the presence by the importance of these strains in the proliferation of the of two subtypes C (1.2%) and one recombinant BC. The epidemic in the country. Financial Support: CAPES – BR recombinant mosaic structure shows a predominance of (Coordenação de Aperfeiçoamento de Pessoal de Ensino C segment in the pol region, with only a small fragment Superior). B in the end of reverse transcriptase. The individual with BC Recombinant had HIV-1 recent infection and HV262 - VALIDATION OF THE SEROLOGICAL TESTING was HIV-positive partner. Despite the heterogeneity of FOR HEPATITIS B VIRUS FROM POST-MORTEM the HIV-1 epidemic in the Northeast - Brazil, subtype C BLOOD has been rarely detected in the region, its detection in Victer, T.N.F.; Sampaio, T.L.; Lima, D.S.; Rodrigues, I.P.; conjunction with a BC recombinant with recent infection Pontes, D.F.S.; Báo, S.N. corroborates data on its spread in the country. Financial 1. UNIVERSIDADE DE BRASÍLIA Support: CAPES – BR (Coordenação de Aperfeiçoamento 2. INSTITUTO FEDERAL DE BRASÍLIA de Pessoal de Ensino Superior). 3. FUNDAÇÃO HEMOCENTRO DE BRASÍLIA 4. CENTRAL DE NOTIFICAÇÃO E DISTRIBUIÇÃO HV256 - HIV-1 BF RECOMBINANTS REVEALS DE ÓRGÃOS DE BRASÍLIA DIFFERENTS MOSAIC STRUCTURES IN POL REGION 5. BANCO DE OLHOS DE BRASÍLIA AT PERNAMBUCO – BRAZIL The infection caused by the Hepatitis B Virus (HBV) is one Lima, K.O.; Leal, E.S.; Cavalcanti, A.M.S.; Salustiano, of the most discussed public health topics worldwide. D.M.; Lacerda, H.R. The risk of infection by transfusion-transmitted viruses, 1. UNIVERSIDADE FEDERAL DE PERNAMBUCO like HBV, may be reduced or avoided by utilizing 2. UNIVERSIDADE FEDERAL DO PARÁ laboratorial sensitive screening tests that search for 3. LABORATÓRIO CENTRAL DE SAÚDE PÚBLICA DE PERNAMBUCO Blood from post-mortem organs and tissue donors can South America has a higher frequency of BF recombinants specific serological HBV markers (HBsAg and anti-HBc). than other continents, revealing the importance of them pre-mortem samples allowing for the possibility of false in the HIV epidemic in the region. Furthermore, in Brazil positivespresent some and falsespecific negative properties immunoassay when compared results. withThe tests used for the screening post-mortem donors should be validated with cadaveric blood samples to reduce the CFRshave beenBF were identified recently most discovered of Circulating in Pernambuco Recombinant (CRF risk of infectious disease transmission by transplants. 70Forms and (CRFs)71_BF). BF The (08/14) study aimed present to evaluate in the world, the molecular and two The aim of this study was to evaluate the validation epidemiology of HIV-1 in Pernambuco. We analyzed the parameters of anti-HBc used for cadaver donor screening 169 sequences of the protease and reverse transcriptase for hepatitis B. Materials and Method: This study included of HIV-1. Sixty-four samples were obtained in the period 53 sera of organ and tissue cadaver donors. All of them 2002-2003 and 105, 2007-2009. All patients were were tested for HBsAg and anti-HBc using the Architect antiretroviral therapy naïve. Subtyping was determined chemiluminescent immunoassay (Abbott, EUA), which was our reference and the only manufacturer validated phylogenetic inference with the MEGA software via the for post-mortem blood samples. The samples were also likelihoodpreliminarily method by REGA (ML). subtyping The study tool showed and confirmed a frequency by tested for HBsAg and anti-HBc using the following tests: of 4.7% (n = 08) of BF recombinants in Pernambuco, Elecsys electro-chemiluminescent immunoassay (Roche, Swiss), CLIA Architect (Abbott, Germany), and ELISA in patterns of genetic mosaics, named like Unique Murex (DiaSorin, Italy). Soronegative samples were Recombinantnortheast - Brazil. Forms In(URFs). five strainsHowever, there three was recombinant diversity spiked with International Standard Anti-HBc Antibody
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
154 Human Virology: HV
can result in tissue-invasive disease. The main objective of the study was to monitor HCMV positivity in patients (WHO, #95/522). Results: The prevalence of HBV by anti- undergoing HSCT in one of the Brazil’s reference centers Elecsys,HBc, HBsAg when Architect compared and Elecsys to testsArchitect, were 4%presented (2/50), of bone marrow transplants (Hospital Araújo Jorge), 0% (0/52) and 12.8% (6/47), 0% (0/42), respectively. located in Goiânia, Goiás. For that, blood samples from (PPV) and negative predictive value (NPV) of 100%, all 48 patients undergoing HSCT from bone marrow or 93%,sensitivity 40%, (SE), 93% specificity(n=46), respectively. (SP), positive Due predictive to the reduced value peripheral blood, autologous or allogeneic types were number of true positive samples of anti-HBc, Elecsys screened for antigen pp65, by antigenemia (AGM), and Murex validation assays were performed by spiking using a commercial kit (CMV Brite ™ Turbo Kit -IQ seronegative samples with 1:500, 1:1000 and 1:5000 Products, Groningen, The Netherlands). One sample was obtained from each patient before transplant, and Elecsys validation presented SE and VPP of 100% at after that, samples were obtained weekly up to three 1:500(proportion: (n=42) standardand at 1:1000 sera/cadaver (n=29), serum).SE 39% Anti-HBc and VP months after the transplant. After that period, samples 100% at 1:5000 (n=28); while anti-HBc Murex presented were obtained at every other week up until six months SE and VPP of 100% at 1:500 (n=42), SE of 95% and after the procedure. Until now, 48 patients are being VPP of 100% at 1:1000 (n=42), SE 12% and VP 100% at monitored, 32 (66.6%) are autologous recipients and 1:5000 (n=42) proportions of spiking. Conclusion: The 16 (33.4%) are allogeneic recipients of stem cells from high rate of positive samples found demonstrates the importance of evaluating the validation parameters of (56.2%) are male and 21 (43.8%) are female and the anti-HBc to void the unnecessary discarding of donated averagebone marrow age of recipients and/or periferal is 41.3 years. blood. Of Fromthe 48 these, patients, 27 organs. Keywords: HBV, tissue transplantation, donors, 47 (98%) were also positive for anti-HCMV antibodies tissue banks, serologic test. Financial Support: National (IgG) by serology. From the total 274 blood samples Agency for Health Surveillance (ANVISA) and National obtained from the 48 patients (average of 6 samples per patient), 41(85.4%) were positive for the HCMV
Counsel for Scientific and Technological Development that were positive were collected positive before the (CNPq)HV277 (grants - PROSPECTIVE #440181/2014-3 STUDY and 440029/2014-7). OF HUMAN transplantationpp55 antigen. Interestingly,procedure. All 23/41 41 positive (56%) receptors samples CYTOMEGALOVIRUS INFECTION IN PATIENTS had clinical manifestation of active HCMV infection, UNDERGOING HEMATOPOIETIC STEM CELLS and pancytopenia was the most frequent intercurrence. TRANSPLANTATION Borges, F.P.S.; Abreu, M.N.; Santos, H.C.P.; Correa, T.S.; and two of these (40%) had graft-versus-host disease, Dabilla, N.A.S.; Silva, L.P.; Arantes, A.M.; Fiaccadori, Among the 41 positive recipients, five (12.1%) died, F.S.; Souza, K.M.C.; Cardoso, D.D.P.; Souza, M.B.L.D. results highlight the importance of monitoring patients affecting the skin and liver, and classified as grade II. The 1. UNIVERSIDADE FEDERAL DE GOIÁS undergoing HSCT for active HCMV infection since the 2. HOSPITAL ARAUJO JORGE, ASSOCIAÇÃO DE conditioning period (pre-transplantation). Studies COMBATE AO CÂNCER EM GOIAS Nested-PCR and to estimate the viral load by Real-Time. The Human Cytomegalovirus (HCMV) is an important Financialare being Support: conducted Fundação in order de to findApoio the a viralPesquisa DNA em by cause of morbidity and mortality in immunocompromised Goiás (FAPEG); Conselho Nacional de Desenvolvimento patients such as hematopoietic stem cells transplant (HSCT) recipients. After primary infection with de Goiás (UFG). HCMV, the virus may become latent in multiple Científico e Tecnológico (CNPq); Universidade Federal organs, and viral replication can be reactivated during immunosuppression and may also be transmitted to the patient through an infected organ during transplant. The HCMV infection is characterized by asymptomatic viremia, which may progress to HCMV syndrome, which
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
155 Human Virology: HV
HV278 - CALICIVIRUS DETECTION IN SAMPLES FROM HV279 - SEARCH FOR EPSTEIN-BARR VIRUS (EBV) CHILDREN ATTENDED IN A HOSPITAL IN GOIÂNIA, IN PLASMA SAMPLES OF PATIENTS WITH SYSTEMIC GOIÁS, BRAZIL LUPUS ERYTHEMATOSUS (SLE) TREATED AT A Dabilla, N.A.S.; Leite, R.A.; Sousa, T.T.; Oliveira, A.C.R.; REFERENCE CENTER IN PARÁ STATE, BRAZIL Almeida, T.N.V.; Correa, T.S.; Borges, F.P.S.; Fiaccadori, Brasil-Costa, I.; Silva, M.J.M.; Meireles, L.T.; Barros, F.S.; Cardoso, D.D.P.; Souza, K.M.C.; Souza, M. I.C.; Santos, B.R.; Oliveira, A.P.G.; Melo, J.M.; Silva, F.M.; Polaro, A.A.; Souza, W.T.; Kahwage, C.B.; Monteiro, LABORATORIO DE VIROLOGIA HUMANA, INSTITUTO DE PATOLOGIA TROPICAL E SAUDE T.A.F. PUBLICA, UNIVERSIDADE FEDERAL DE GOIAS. 1. INSTITUTO EVANDRO CHAGAS The calicivirus (norovirus and sapovirus) are important 2. HOSPITAL JEAN BITAR cause of acute gastroenteritis. These agents are Systemic Lupus Erythematosus (SLE) is a chronic transmitted by the fecal-oral by direct contact, ingestion autoimmune disease which can course with different of contaminated food or water, through ingestion of clinical manifestations for each patient and is aerossolized viral particles or contact with fomites. characterized by periods of activity and remission. Norovirus outbreaks are common in semi-enclosed Disease activity is measured by clinical scores using environments such as hospitals and schools. The SLEDAI (SLE Disease Activity Index), which may objective of this study was to investigate the occurrence attribute scores from 1 to 24. Scores greater than 4 are of calicivirus in children up to six years of age, with or considered active disease. The etiology and pathogenesis without symptoms of gastroenteritis that were attended in a hospital in Goiânia, Goiás. Sample collection period development have been associated with viral infections. began in May 2014 and will extend until December 2015. Inof this SLE context, has not one been of most fully studied clarified, viruses however, is Epstein- SLE Samples are being extracted by methodology described Barr Virus (EBV), formally named Human herpesvirus 4 by Boom et al. (1990) and screened by RT-PCR with (HHV-4). From June to September 2014, were collected 5 ml of whole blood of 85 SLE patients from Jean Bitar Viral load will also be determined by qRT-PCR. To date, Hospital, a reference center for SLE treatment in the specific primers for the polymerase and capsid region. Pará state. A volume of 200 µl of plasma was used for the positive for norovirus. None of the samples were positive extraction of DNA using the QIAamp viral DNA Mini® kit for50 samplessapovirus were until tested, now. Fromand 28% the positive(14/50) patients, of them were43% (QIAGEN). All plasma samples were subjected to ELISA for detecting IgM and IgG antibodies against EBV-VCA. the highest positivity rate was among children under In addition, the extracted DNA was used in quantitative two(6/14) years were of age. female The and main 57% symptoms (8/14) recorded are male, were and Polymerase Chain Reaction (qPCR) for EBV genome
The results highlight the importance of norovirus in thediarrhea etiology (14/14), of acute fever gastroenteritis. (13/14) and Studies vomiting are (8/14). being detection and quantification, targeting at the EBNA1 conducted to determine the viral load by real-time PCR, gene. Overall 91.8% (78/85) of patients were female in order to correlate between viral load and symptoms. wereand 55% IgG-positive. (44/80) had The active presence disease. of InEBV serological genome testswas There are also being carried out tests to determine 37.6% (32/85) were IgM-positive and 98.8% (84/85) the secretor status of these children so that they may loads of two plasma samples were 85,028 and 298 detected in 2.4% (2/85) of the patients and the viral by noroviruses. Financial Support: Conselho Nacional correlate with susceptibility/resistance to infection copies/ml of plasma. There was no association between Coordenação de Aperfeiçoamento de Pessoal de Nível witheither the serology aim of assessing or molecular the role detection/quantification of EBV infection and Superiorde Desenvolvimento (CAPES); Universidade Científico Federal e Tecnológico de Goiás (CNPq); (UFG). viraland disease load in activity. plasma Thisin the is thedevelopment first study ofin SLE.our regionThere was a predominance of females, as corroborated by
disease activity, the fact that 37.6% of patients were literature. Although without statistical significance with October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
156 Human Virology: HV
EBV-IgM positive suggest a possible relationship with UFG constitutes an important tool for the establishment SLE development but further and broader studies are of the entomological and viral surveillance system in the needed to best assess this issue. Keywords: Systemic Goiás State. Keywords: Molecular Monitoring, Dengue Lupus Erythematosus, Epstein-Barr Virus, ELISA, qPCR, virus, Mosquitoes. Financial Support: Fundação de Amparo à Pesquisa do Estado de Goiás (FAPEG). viralHV281 load. - Financial MOLECULAR Support: MONITORING IEC/SVS/MS. OF DENGUE HV282 - DETECTION AND GENOTYPING OF VIRUS IN GOIÂNIA, GOIÁS – PRELIMINARY STUDY ASTROVIRUS AND SAPOVIRUS IN FECAL SAMPLES Carneiro, R.S.; Fiaccadori, F.S.; Cunha, M.P.; Souza, FROM CHILDREN HOSPITALIZED FOR ACUTE M.B.L.D.; Cardoso, D.D.P.; Silva, H.H.G.; Silva, I.G. GASTROENTERITIS IN BELÉM, PARÁ Portal, T.M.; Quinderé Neto, G.A.; Reymão, T.K.A.; 1. LABORATÓRIO DE VIROLOGIA, INSTITUTO DE PATOLOGIA TROPICAL E SAÚDE PÚBLICA, Lucena, M.S.S.; Mascarenhas, J.D.P.; Linhares, A.C.; UNIVERSIDADE FEDERAL DE GOIÁS Justino, M.C.A.; Resque, H.R.; Gabbay, Y.B. 2. LABORATÓRIO DE BIOLOGIA E FISIOLOGIA 1. UNIVERSIDADE DO ESTADO DO PARÁ DE INSETOS E XENODIAGNÓSTICO 2. INSTITUTO EVANDRO CHAGAS Dengue virus (DENV) is the most important arbovirus Astrovirus (AstV) and sapovirus (SaV) are common viral transmitted by mosquitoes. Aedes aegypti mosquitoes pathogens that cause gastroenteritis (GE) worldwide. are responsible for the urban transmission of DENV due to its adaptation to the environment. In the West- Central region of Brazil there are no data evaluating the andHuman MLB-2. AstVs The are SaVs classified comprise into seven eight genogroups,classic types fourand occurrence of this agent in this specie of arthropods. In ofother which five (GI, new GII, type GIV, named and GV) HAstV known VA1, to VA2, infect VA3, humans. MLB-1 this study was performed a DENV molecular monitoring AstVs and SaVs spread by fecal-oral route, through in mosquitoes captured in the Campus I of the Federal person-to-person contacts or through the ingestion University of Goiás (UFG), located in the eastern region of contaminated food and water. During outbreaks of Goiânia, aiming to establish a surveillance system of the elderly, as well as young children are more prone to develop clinically relevant symptoms. This study buildings and academic units such as healthcare colleges, focused on the detection and molecular characterization DENV in the city. In the Campus I/UFG are situated many university hospital, engineering schools, classes centers, of HAstV and SaVs in fecal samples collected from the library and anthropological museum, thus, a place hospitalized, diarrheic children, from March 2012 to April 2015 in Belém, Pará, Northern Brazil. Stool May to December 2014 adult mosquitoes were collected samples were subjected to viral RNA extraction and weeklywith great within flow academic of students units and using institution traps (HORST)servers. From with aspirator. The insects were separated by species and The nucleotide sequence was determined by direct cycle sex, after screening, were stored in pools containing sequencingtested by RT-PCR and the using chromatograms AstV- and- SaV- were specific analyzed primers. with 20 specimens at -80°C. The 87 pools obtained were BioEdit software and compared with other sequences macerated and the suspensions were submitted to the deposited in the GenBank. Of the 219 samples collected viral ssRNA extraction followed by Multiplex-Nested- 100 had already been tested for both HAstV and SaV,
The results demonstrated that from the 87 pools respectively. Four AstV samples were sequenced, two RT-PCR for DENV detection and serotype identification. analyzed, one pool was DENV positive (1.15%). The ofwith which 15% being (15/100) characterized and 6% (6/100)as HAstV-1 positivity and two rates, as sample was characterized as serotype DENV-4, which HAstV-2. The remaining eleven samples could not be is in accordance with the epidemics data in Goiás in this year. These are preliminary data from a study that analysis were inadequate. All the 6 SaV-positive samples is being conducted in Goiânia, Goiás to detect DENV wereconfirmed sequenced: by sequencing, three were due characterized that the sequences as genogroup for in mosquitoes. The development of DENV molecular GI.1, two as GI.2 and one as GII.1. As observed in studies conducted in Brazil and elsewhere, HAstV-1 was researchOctober 2015 from Volume mosquitoes 20 – Supplement in the Laboratory1 - Abstracts/Posters of Virology/ - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
157 Human Virology: HV predominant, followed by HAstV-2. SaV GI.1 was also the most frequently detected SaV genotype in sporadic GE months of study period. Vomiting, fever and dehydration cases, and the GI.2 is regarded as an emerging genotype. wereDecember recorded 2001 among(20.8%-5/24), NoV-positive as compared children, to theat otherrates Our results highlight the potential importance of AstV and SaV as a cause of severe, childhood gastroenteritis respectively. During the NoV-infection, was observed 4-5 and warrant the conduct of more studies of in order episodesof (19.2%-5/26), of vomiting (36.4%-8/22), (14.3%), with anda child (26.7%-8/30), showing 18 to fully establish the role of AstV and SaV as relevant episodes (X2=7.9614; P=0.0048, in comparison with the enteropathogens in our region and all over Brazil. average of vomiting showed by other NoV-infected). The Keywords: Children Hospitalized, Gastroenteritis, mean number of evacuations per clinical period among NoV-positive patients was 2.9. 102 (88.7%) out of the UEPA; CNPq; IEC. 115 patients were treated with oral rehydration at home Sapovirus, Astrovirus, Belém. Financial Support: CAPES/ level. All children investigated had less than one year HV290 - CHARACTERIZATION OF NOROVIRUS- old, being NoV most prevalent in children >6-9 months. INFECTION IN CHILDREN WITH ACUTE None positive patient required hospitalization. This GASTROENTERITIS: A RETROSPECTIVE STUDY IN study provided great information about NoV-circulation, BELÉM, PARÁ as it allowed accessing epidemiological and clinical data, Siqueira, J.A.M.; Rocha, I.M., Júnior, E.C.S.; Justino, as well as some molecular records in children before M.C.A., Gabbay, Y.B. the widely use of rotavirus-vaccine in Brazil, which INSTITUTO EVANDRO CHAGAS occurred in 2006, since has changed the background of viral infections that cause acute GE worldwide. Norovirus (NoV) gained increasing relative importance Keywords: Norovirus, gastroenteritis, children. Financial after introduction of rotavirus (RV) vaccines. Besides Support: Instituto Evandro Chagas; FAPESPA (Edital nº of being recognized as the worldwide main cause of gastroenteritis (GE) outbreaks, NoV is currently known to contribute substantially to the burden of GE 006/2014).HV292 - MOLECULAR INVESTIGATION OF in children at both hospital and community levels. The RESPIRATORY VIRUSES IN ASYMPTOMATIC purpose of this study was to investigate NoV-infections CHILDREN FROM GOIANIA-GOIAS in children follow-up for diarrheic episodes between Castro, I.A.; Costa, L.D.C.; Oliveira, A.C.R.; Souza, M.B.L.D.; Cardoso, D.D.P.; Costa, P.S.S.; Fiaccadori, F.S. children were recruited to participate in a study that aimed2001/2002 to investigate in Belém, infections Northern by Brazil.RV, of Overall,which 1.225 900 1. INSTITUTO DE PATOLOGIA TROPICAL E feces were collected, being a subset of 303 samples SAUDE PUBLICA 2. FACULDADE DE MEDICINA RV-negative, randomly selected to be tested for NoV (233 diarrheic and 70 normal). Samples were screened Acute respiratory infection (ARI) is a major cause of for NoV antigen by Enzime Immunoassay (EIA) and morbity and mortality worldwide, particularly among those reacting positive were subjected to a semi- children, and most of these infections are caused by nested RT-PCR targeting at the RNA Polimerase Viral viruses. Respiratory viral infections can cause symptoms ranging sore throat, cough, coryza, sneezing, fever and positivity rate was yielded by EIA, of which 17 (54.8%) gene (RdRp) region. Overall, a 10.2% (31/303) NoV- seized great advantages with the advent of molecular techniques,airflow obstruction. and new challenges Since the were 80s, diagnosisunveiled. Usage of ARIs of were subsequently confirmed by semi-nested RT-PCR, PCR-based methods for screening has been optimized including 2 genogroups (GI: 17.6%-3/17; and GII: 82.4%- 14/17). Sequencing of 13 samples showed the following investigations. Moreover, new possibilities arose, such showngenotypes: among GII.P4 diarrheic (53.8%-7/13), children, GII.P21 as compared (38.5%-5/13) to non- asthe simultaneous workflow, specificity detection and of sensibility multiple ofpathogens the clinical in and GI.P7 (7.7%-1/13). A higher prevalence rate was the same sample and the detection of pathogens in respectively. An elevated prevalence rate was found in asymptomatic individuals. Several studies have reported diarrheic children: 11.2% (26/233) and 7.1% (5/70), October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
158 Human Virology: HV the presence of respiratory viruses in asymptomatic cervical intraepithelial neoplasia (CIN I), high-grade a latent or persistent infection in respiratory airways. cervicalclassified intraepithelial into low-grade neoplasia intraepithelial (CIN II and lesions III) and or children with significant rate of detection, suggesting carcinoma in situ. Until today, there are approximately and further investigations are needed to fully understand 200 HPV types already known. However, not all of them theThese presence findings of canrespiratory affect clinical viruses management in patients with of ARIs no are associated with malignant transformation. So, the ARI symptoms. Based on this background, the aim of the determination of the HPV type is necessary to serve as the study was investigate the presence of viral respiratory basis for a complete treatment. Therefore, the objective pathogens in asymptomatic pediatric patients in of this study was to genotype an isolate of HPV found in a Goiânia – Goiás. Between august 2012 and 2013, 61 patient with low-grade cervical intraepithelial neoplasia with a history of syphilis. The sample was collected from healthcare centers. Respiratory samples were screened a 38-year-old black woman that had syphilis. The DNA bychildren Multiplex with Nested-PCRfour to 14 years for detectionold were recruitedof 16 common in five was extracted from the sample and fragment of L1 gene respiratory viruses. From 61 samples, nine had at least one virus detected. Only one patient had more than one virus detected. The viral detection rate found was 14.8%. inwas 2% amplified agarose using gel PCR electrophoresis. technique with Next, the degenerate the DNA primers MY09/11. The amplified product was visualized detected (30%), followed by Rhinovirus (20%) and Sequence quality was assessed by using Staden package. AdenovirusParainfluenza (20%). viruses Frequency were the mostof episodes frequent was pathogens higher Thewas type purified of the and HPV twice sample sequenced was determined in both directions. through during the dry season, period marked by low relative air sequence identity using BLAST. A neighbor joining humidity and rainfall. The obtained results reinforces the phylogenetic tree was constructed in order to assess importance of respiratory viruses in pediatric population the evolutionary relationships between this sample and and the presence of these pathogens in asymptomatic other HPV isolates. With this methodology, we were able children is an important matter for consideration, especially to delineate control and prevention measures was present in the lesion. Sequence analysis showed that theto successfully virus that infected amplify the the patient HPV DNA, was confirmingHPV type 71. that This it type of HPV is a low-risk virus, which normally leads to knowledgeconcerning gaps ARIs. about Hence, circulation this study of is these the firstpathogens. of the the formation of warts. However, little is known about Keywords:kind in the Respiratoryregion, and theviruses; data providedasymptomatic tried tochildren; fill the the pathologies related to this type of HPV and it was multiplex-PCR. Financial Support: Fundação de Amparo found in a CIN I lesion. If not treated fast, this lesion may à Pesquisa de Goiás – FAPEG. develop and be a major problem to the patient’s health. If this HPV type are emerging in Brazil, it is important to HV295 - FIRST REPORT OF HUMAN PAPILLOMAVIRUS state that the tetravalent vaccine do not cover it. Further TYPE 71 ASSOCIATED WITH CERVICAL studies are required in order to verify the frequency of INTRAEPITHELIAL NEOPLASIA IN THE STATE OF this type of HPV in Brazilian’s population. Therefore, this SERGIPE, NORTHEASTERN BRAZIL Barreto, D.M.; Araújo, E.D.; Barros, G.S.; Serra, I.G.S.S.; of HPV-71 in the state of Sergipe, Northeastern Brazil. Barreto, D.M.; Gurgel, R.Q.; Batista, M.V.A. study becomes important because it is the first report UNIVERSIDADE FEDERAL DE SERGIPE Financial Support: CNPq, CAPES and FAPITEC/SE. Human papillomavirus (HPV) is considered the most common sexually transmitted infectious agent. HPV presents tropism for the mucosal region, and it adheres to its cellular machinery of the host causing mutations in the cell replication process and leading to a change known as hyperplasia. In addition, it is associated with different diagnoses affecting the cervix: they are
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
159 Human Virology: HV
HV297 - LACK OF ASSOCIATION BETWEEN HTLV-1/2 the possible relationship between HTLV infection and INFECTION AND SYSTEMIC LUPUS ERYTHEMATOSUS the development of SLE. Furthermore, it is important to IN THE NORTH REGION OF BRAZIL emphasize that the Amazon region is an endemic area Freitas, F.B.; Silva, M.J.M.; Meireles, L.T.; Barros, I.C.; for HTLV and this is one of the few studies that have Santos, B.R.; Oliveira, A.P.G.; Melo, J.M.; Silva, F.M.; investigated HTLV infection in patients suffering from Macedo, O.; Freitas, R.C.; Freitas, D.O.; Reis R.M.; an autoimmune disease. Financial Support: Instituto Moura, A.; Linhares, A.C.; Souza, W.T.; Kahwage, C.B.; Brasil-Costa, I. Ministério da Saúde. Evandro Chagas/ Secretaria de Vigilância em Saúde/ 1. INSTITUTO EVANDRO CHAGAS HV299 - IDENTIFICATION OF DENGUE VIRUS IN 2. HOSPITAL JEAN BITAR AEDES AEGYPTI AND AEDES ALBOPICTUS LARVAE IN THE CITY OF BELO HORIZONTE DURING AN INTEREPEDEMIC PERIOD associationThe infection with by Humana variety T lymphotropicof diseases including virus type slowly 1/2 Miranda, D.P.J.; Figueiredo, L.B.; Calixto, R.S.; Marins, progressive(HTLV-1/2) ismyelopathy, endemic in Southknown America as HTLV-1-associated and has a close K.; Sonoda, I.; Bonjardin, C.A.; Ferreira, P.P.; Kroon, E.G. (TSP). HTLV can dysregulate immune system by high myelopathy (HAM)/tropical spastic paraparesis 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. CONTROLE DE ZOONOSES- SECRETARIA damage and the dysregulation of T cells that leads to MUNICIPAL DE SAÚDE immunologicaltiters of antibody abnormalities which lead in to T inflammatorycell functions. tissueThus, Dengue virus is the most important human arboviral HTLV-1 infection has been considered to play a role in pathogen worldwide. World Health Organization various autoimmune diseases such as arthritis and estimates that over 40% of the population is at risk systemic lupus erythematosus (SLE). The aim of this of acquiring dengue and it is estimated there to be cross-sectional study was to investigate the prevalence 390 million dengue infections per year. There are two of HTLV infection in individuals with SLE. A sample of 85 important vectors of Dengue virus (DENV) throughout the world: Aedes aegypti and Aedes albopictus. In (ACR) for SLE criteria, participated in this study. The Brazil outbreaks of dengue has been associated with individualspatients fulfilling were screenedthe American for the College presence of Rheumatology of total anti- the presence of Aedes aegypti, due to its high capacity to spread and adapt to human environment. The linked assay (ELISA). In addition, all whole blood samples introduction of Aedes albopictus in Brazil in 1986 is wereHTLV-1/2 subjected antibodies to q in serum samples using an enzymepol especially worrying because it can readily transmit major gene to determine the types (HTLV-1 or HTLV-2) and PCR for the amplification of the arthropod –borne viruses such as Dengue virus and Chikungunya virus. Belo Horizonte, the capital of Minas with a mean age of 30±12 years who were diagnosed as Gerais, has been suffering from dengue outbreaks since havingviral load. SLE 92% about (78/85) one year of theago. sample The SLE were Disease from Activitywomen 1996. Three major outbreaks have already occurred Index (SLEDAI) ranged from 1 to 24, with an average of in Belo Horizonte: one in 1998 with approximately 9. Most of the examined population was composed of 86,000 cases, another one in 2010 with 51,755 cases white (36%) and black (36%) ethnicity. The frequency of and in 2013 with over 90,000 cases. This study aimed important lupus manifestations in these patients were: to identify DENV in larvae of Aedes spp from oviposition joint pain (56%); swelling (44%); fever (36%); alopecia traps displayed in all nine administrative districts of (20%) and skin patches (12%). All 85 patients were Belo Horizonte city. To perform this study, ovitraps were displayed in residential areas of Belo Horizonte for one and no HTLV proviral DNA could be detected. The data week, during January and November of 2011 and 2012. presentednegative for herein the presence are preliminary of anti-HTLV-1/2 and a larger antibodies sample The eggs from ovitraps were counted and subsequently size with the SLEDAI analysis and the use of a control hatched in laboratory. After eclosion, each larva was group with other autoimmune diseases or healthy individuals are required for a better understanding on October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology:identified HV based on morphological characteristics. A XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
160 Human Virology: HV total of 4.492 larvae of Aedes aegypti (137 pools) and albopictus were tested for dengue by PCR. Three pools of 1.685 of Aedes albopictus (125 pools) were tested for Aedes aegypti were positive for DENV and two serotypes DENV. Six pools (4,3%) of Aedes aegypti were positive for DENV. Three pools of DENV-1, two pools of DENV-2 e Aedes albopictus. One hundred one pool of DENV-3. None of Aedes albopictus pools were andwere six identified sera from (DENV-1, patients with DENV-4). dengue DENV-4 symptoms was were also positive for dengue in this period. The results show that testedidentified for inDENV. two pools Twenty of three sera were positive for the presence of the three serotypes of DENV in larvae dengue DENV and DENV-4 was more prevalent, followed could be a determinant factor for the intensity and risk of dengue transmission in Belo Horizonte. Financial was detected in larvae of Aedes spp from Belo Horizonte by DENV- 3 and DENV-1. This was the first time DENV-4 PRONEX-DENGUE FAPEMIG. patients. The results suggest that dengue surveillance Support: CNPq, CAPES, DECIT/MS, INCT-DENGUE, inand larvae the first could epidemic be a useful with additionalthe circulation tool ofto DENV-4detect the in HV300 - DENGUE VIRUS SURVELLAINCE IN LARVAE presence of a new serotype at the beginning of a new OF AEDES AEGYPTI AND AEDES ALBOPICTUS FROM NINE SANITARY DISTRICTS OF BELO HORIZONTE, MS, INCT-DENGUE, PRONEX-DENGUE, FAPEMIG. MINAS GERAIS, BEFORE THE LARGEST DENGUE epidemic cycle. Financial Support: CNPq, CAPES, DECIT/ OUTBREAK HV312 - GENETIC CHARACTERIZATION OF FOUR Miranda, D.P.J.; Figueiredo, L.B.; Calixto, R.S.; Sonoda, PHLEBOVIRUSES (BUNYAVIRIDAE, PHLEBOVIRUS) I.; Bonjardin, C.A.; Ferreira, P.P.; Kroon, E.G. ISOLATED IN THE BRAZILIAN AMAZON REGION Neto, J.P.N.; Nunes, M.R.T.; da Silva, S.P.; Medeiros, D.B. 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. CONTROLE DE ZOONOSES- SECRETARIA de A.; de Lima, C.P.S.; Cardoso, J.F.; Vianez Júnior, J.L. MUNICIPAL DE SAÚDE da S.G.; Sousa Júnior, E.C.; Pinto, E.V.; Carvalho, V.L.; Martins, L.C.; Vasconcelos, P.F. da C. Dengue is a systemic viral infection transmitted to humans by Aedes spp mosquitoes. The only prevention INSTITUTO EVANDRO CHAGAS toll for dengue is vector control as there is no vaccine, The Brazilian Amazon is considered one of the richest nor any effective drugs available. In Brazil, dengue cases ecosystems in the world in terms of biodiversity. have been well documented since 1981. Since then, Destruction of this naturally stable ecosystem can result dengue has spread to almost all Brazilian states. Belo in emergence of new arboviruses in the Amazon region. Horizonte has registered many outbreaks since 1986. Genus Phlebovirus members, compose an antigenically The largest dengue epidemic occurred in 2013 with related group of viruses, which has a considerable medical more than 90 thousand cases. The natural transmission importance. These viruses are basically maintained in of DENV from an infected female to its progeny (transovarial transmission) can be an important form In the Brazilian Amazon, 22 phleboviruses have been of maintenance of the virus in the city. The objective isolated,nature by whose wild vertebrates nine of them and have phlebotominae not been recognized sandflies. of this study was to identify DENV in larvae of Aedes by the ICTV, and four not grouped into known serological aegypti and Aedes albopictus from nine sanitary district group. This study aimed to genetically characterize and of Belo Horizonte before the peak of the largest dengue evaluate the evolutionary aspects of 4 members of the genus Phlebovirus (Family Bunyaviridae) isolated in in patients’ serum. Ovitraps were displayed in the nine Brazilian Amazon region. Nearly complete nucleotide sanitaryoutbreak districtsand compare of Belo with Horizonte, dengue serotypes during January identified of sequences for each of the genomic RNA segments (SRNA, 2013 as part of the vector surveillance program of the MRNA and LRNA) were obtained for Tapara virus and city. Larvae were hatched from ovitrap paddles which Uriurana virus, however, Anhanga virus and Urucuri were separated by areas and pooled in vials. The number virus were partially sequenced. Materials end Methods: of larvae per pool varied from 2 to 50 and the number A total of 4 phleboviruses were used in the study and of analyzed pools per sanitary district varied from 2 to obtained from the virus collection of the Department 10. Sixty seven pools of Aedes aegypti and 10 of Aedes of Arbovirology and Hemorrhagic Fevers, Brazil, and
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
161 Human Virology: HV corresponded to liphylized viruses after low passage however, data on the association between positivity history in newborne mice. Viruses were propagated in VERO cells, harvested after 80-90% CPE and used for controversial. The aim of this study was to monitor RNA extraction using the MagnaPure LC total Nucleic patientsand/or NoVundergoing load and allogeneic also patients’ hematopoietic prognosis stem are stillcell Acid isolation kit. Nucleotide sequences were obtained transplant for NoV-positivity, and to associate it with by the pyrosequencing method using the GSFLX 454 clinical conditions presented by the patients. For this, next generation sequencer (NGS). Genomes were 22 patients were monitored in a 2 years period (from assembled using the De Novo strategy implemented in the GS De Novo Assembler, Newbler v3. Final genomes From the 22 patients 13 (59 %) were positive for NoV. were visualized in the Geneious v7. Results: Genomic PatientsOctober/2012 were predominantly to October/2014) adults, by averaging SYBRGreen 35 qPCR.years organization and genetic characteristics (conserved of age (4 to 61 years old). The mean duration of viral motifs, glycosylation sites, cysteine residues) were shedding was 81.5 days (ranging from three to 363 days) consistent with that observed in members of the genus and the main symptoms that patients experienced were Phlebovirus previously studied. The analysis of genetic fever, abdominal pain, vomiting and diarrhea. Of the 22 relatedness, as well as the evolutionary aspects using the patients, seven (31.8%) did not present graft-versus- phylogenetic analysis and evaluation of segment genomic host disease during NoV excretion. The viral load in fecal permutation, showed that the studied phleboviruses samples of the patients varied from 1.03 x 101 doesn’t show any evidence of the reassortment, to 2.90 x 105 when compared to members of the Candiru complex. 3.80 x 104). The peak excretion NoV particles occurredCG / mL Conclusion: The results of this study contributed to on average 39 CGdays / after mL of the fecal transplant suspension (ranging (average from of1 further studies on genetic evolution and molecular to 181 days). These results point to the urgent need of epidemiology of phleboviruses, and for the development including NoV and HAdV screening in the routine exams of molecular methods for rapid genome detection of Amazon phleboviruses associated with human disease. importance of all Health Units to comply with a preventive protocolof transplanted against patients. nosocomial The findings infections also thathighlight is also the effective against viruses. The data also corroborate to the FinancialHV314 Support: - MONITORING IEC/SVS/MS and OFCAPES. NOROVIRUS fact that immunosuppressed patients are at risk for viral AMONG PATIENTS UNDERGOING ALLOGENIC infection, and may also contribute to viral dissemination HEMATOPOIETIC STEM CELL TRANSPLANT due to prolonged viral shedding, constituting a possible Correa, T.S.; Dabilla, N.A.S.; Lemes, L.G.N.L.; Borges, reservoir of viruses. Keywords: norovirus, allogeneic F.P.S.; Fiaccadori, F.S.; Cardoso, D.D.P.; Souza, K.M.C.; stem cell transplant, diarrhea, graft-versus-host disease, Arantes, A.M.; Souza, M. nosocomial infection. Financial Support: Fundação de 1. UNIVERSIDADE FEDERAL DE GOIAS Apoio à Pesquisa em Goiás (FAPEG), Conselho Nacional 2. HOSPITAL ARAÚJO JORGE de Desenvolvimento e Pesquisa (CNPq) e Programa de Pós-Graduação em Biologia da Relação Parasito- Noroviruses (NoV) are considered the leading cause Hospedeiro (PPGBRPH). of non-bacterial epidemic gastroenteritis outbreaks, resulting in impact on public and private health systems worldwide. These outbreaks occur more frequently in semi-closed places, with agglomeration of people, such as hospitals. These agents are also associated with sporadic cases of gastroenteritis in people of all ages. NoVs are transmitted by the fecal-oral route, by person-to-person contact, ingestion of contaminated food or water, contact with fomites, or even by aerosols produced during vomiting. In immunocompromised patients, there is evidence of prolonged viral shedding;
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
162 Human Virology: HV
HV316 - COMPARISON OF TWO DENGUE 48 hours. Also, this technique can be used in any clinical TITRATION TECHNIQUES TO DEVELOPING A isolates, regardless of whether or not this virus plaque. BEST METHODOLOGY FOR MEASURING SPECIFIC Further experiments are being conducted in order to NEUTRALIZING ANTIBODIES IDENTIFICATION use this same DENV strains to perform PRNT’s in FACS Zini, N.; Versiani, A.F.; Ribeiro, M.R.; da Silva, G.C.D.; Vedovello, D.; da Fonseca, F.G.; Nogueira, M.L. platform.HV318 - Financial RESPIRATORY Support: VIRUS CAPES/ OUTBREAK FAPESP. IN AN 1. FACULDADE DE MEDICINA DE SÃO JOSÉ DO INDIAN VILLAGE IN THE SOUTHEAST OF PARA STATE, RIO PRETO BRAZIL 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS Ferreira, J.A.; Barbagelata, L.S.; Souza, E.M.A.; Santos, Dengue (DENV) infections represent the most important M.C.; Medeiros, R.; Mello, W.A. arboviral disease in the world in terms of epidemiologic 1. SECTION OF VIROLOGY, EVANDRO CHAGAS impact. Recent data indicates that 390 million dengue INSTITUTE, SECRETARY OF SURVEILLANCE infections occurs per year, of which about 96 million IN HEALTH, MH result in infections ranging from minimally symptomatic 2. NUCLEUS OF TROPICAL MEDICINE-UFPA to severe. The World Health Organization considers In august 2014, the Especial de Saúde Indígena (Sesai) the plaque reduction neutralization test (PRNT) as the reported an outbreak of respiratory disease in the Assurini ethnic Indians in the village of Trocará, Tucuruí, levels of anti-DENV neutralizing antibodies. However, southeast of Para, Brazil. The investigation began this“gold method standard” is totime-consuming characterize and and quantify not suitable circulating for after about 90 Indians had developed symptoms of strains virus that do not form plaques in cell culture. acute respiratory infection (ARI). Our study aimed to Fluorescence-activated cell sorting (FACS) has been determine the viral etiology of this ARI outbreak which used to detect virus-infected cells in recent studies. occurred in august 2014. Overall, 27 nasopharyngeal FACS-based methods have been developed to follow aspirate samples were processed at the respiratory virus infections and determine titers of virus in a rapid and laboratory, Evandro Chagas Institute, Belem, Brazil. Viral effectively manner. In order to adapt our laboratory nucleic acid was extracted from the clinical specimen routine with this new technique, this study compared using a commercial kit according to the manufacturer’s the titers of DENV 1, 2, 3 and 4 clinical isolates obtained instructions. The detection of viral genome was by plaque assay (pfu) and by FACS (ffu). Also, we performed by quantitative (real time) polymerase performed kinetics of infection by FACS to identify how chain reaction preceded by reverse transcription (qRT- many time is necessary to identified DENV-infected cells genes of the Influenza A virus (FluA) and Influenza B virusPCR), (FluB),using specific Human detectors respiratory (primers syncytial and virus probes) (HRSV), the cellsby flow lines. cytometry. Initially, For DENV1 the first strain goal, was positive titrated sample in VERO for Human metapneumovirus (HMPV), Human adenovirus andDENV BHK-21 were isolated cells using and up propagated to 10-5 dilution. in C6/36 In VERO,and VERO the (HAdV), Human rhinovirus (HRV), Human coronavirus titers obtained through plaque assay were 2.108 pfu (HCoV) and Human bocavirus (HBoV). Of the 27 samples, and through FACS were 1.108 ffu. In BHK-21 cells, was one was considered inappropriate since it showed not observed plaque formation, but the titration could absence of human RNase p, being excluded from our be performed by FACS and the titer was 6.108 ffu. The analysis. In the remaining, 19 (73.1%), were positive others 3 serotypes were also titrated by FACS. For the for one or more viruses investigated. One (5.2%) was viral kinetics of cell infection, we utilize the same DENV positive for Human bocavirus; three (15.8%) for Human strains with the same dilutions and evaluate the viral adenovirus; 11 (57.9%) for Human rhinovirus and nine presence in 24, 48, 72 and 96 hpi. In all four serotypes (47.4%) for Human coronavirus OC43. We also observed but there is a peak of viral presence at 48 hpi. This means and three with HCoV OC43. Three of the Indian had a thatthe virus FACS can assay already is an improvementbe identified in over culture the plaque after 24 assay hpi, fatalfive co-detectionsoutcome; two withof these HRV were including positive, two one with for HAdV HRV because reduce the infection period from 5-7 days to 24- October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
163 Human Virology: HV and one showing a dual infection involving HRV and HPV infection was collected. DNA was extracted and the HAdV. Data obtained from the indigenous population Polymerase Chain Reaction (PCR) assay was employed showed that HRV and HCoV OC43 are accounted for a to amplify a fragment of L1 gene. Two sets of primers these relatively isolated Indian communities have low or evensignificant no immunity proportion against of severe common ARI cases. respiratory It is likely viruses that (MY09/11 and GP5+/6+) were used in order to increase and can experience more serious illness. An additional 87.3%the sensibility of the samples of the test were in atested nested positive PCR. The for amplifiedHPV. The products were purified and sequenced. We observed that such as HRV and HCoV, which are in general associated withimportant common finding cold. was Our the data association highlight of the other importance viruses, typesprimer were pair detectedGP5+/6+ in was the capable samples, to whichdetect showsmore HPVthat of regularly monitoring the occurrence of respiratory theresamples is athan great primers diversity MY09/11. of these Severalviruses differentcirculating HPV in viruses in these relatively isolated Indian populations, our country. Most of the women studied here presented in the Amazon, particularly in view of their likelihood lesions in the cervix, which explains the high rate of of potentially developing more severe illness. Financial positives. These results highlights the importance of a
the vaccine and to serve as basis for the development Support:HV322 IEC/SVS/MS. - MOLECULAR DETECTION OF HUMAN ofsurveillance better diagnostic program and in ordertreatment to assess methods. the efficacy Financial of PAPILLOMAVIRUS IN WOMEN WITH CERVICAL LESIONS FROM THE STATE OF SERGIPE, NORTHEASTERN BRASIL Support:HV323 CNPq, - EPIDEMIOLOGICAL CAPES and FAPITEC/SE. EVALUATION OF Batista, M.V.A.; Barros, G.S.; Araújo, E.D.; Serra, PATIENTS ATTENDED IN A SCREENING PROGRAM I.G.S.S.; Reis, J.D.R.; Gurgel, R.Q. FOR CERVICAL CANCER AND PRECURSOR LESIONS Oliveira, O.S.; Mello, W.A.; Silvestre, R.V.D.; Silva, UNIVERSIDADE FEDERAL DE SERGIPE A.K.; Ferreira, L.S.S.; Fonseca, L.P.S.; Paixão, C.G.S. da; Papillomaviruses (PV) are circular double stranded Abrão, L.M.L.; Junior, L.B.D. mucocutaneous skin of several species of mammals, 1. INSTITUTO EVANDRO CHAGAS birdsDNA virusesand reptiles. that Human specifically papillomavirus infect epithelial (HPV) oris 2. UNIVERSIDADE DO ESTADO DO PARÁ 3. PAULO AZEVEDO LABORATÓRIO the main etiological factor for cancer development in the uterine cervix. Tumors associated with HPV In recent decades, the countries of Latin America in the cervical region are common and constitute a have been subjected to political, economic and social serious public health problem, especially in developing transformations that have caused changes in the countries like Brazil, where the population does not these countries, the infectious diseases stand out as much education, preventive exams and the proper treatment asmorbidity chronic anddiseases mortality such profileas cervical of the cancer, population. in which In ofhave the easy disease. access Until to information today, there by are not approximately having sufficient 200 infection with human papillomavirus (HPV) is associated HPV types already known. However, not all of them are with the disease development and its precursor lesions. associated with malignant transformation. Therefore, In addition to the aspects related to HPV infection, there are several other behavioral and demographic factors population is important, since different viral types have that are also related to a relative risk of developing differentthe identification pathological of the features.viral types In that addition, are infecting high-risk the uterine cervix cancer. This research is characterized as an HPV types that are not covered by the tetravalent vaccine observational, epidemiological, descriptive, quantitative have been reported with elevated frequency in some cross-sectional study, in which were investigated 589 regions of Brazil. Consequently, the aim of this study women from Belém City. Each participant answered was to assess the diversity of HPV types in samples from to a clinical and epidemiological questionnaire and women of Sergipe state, Northeastern Brazil. In order to collected cytological material for the Pap smear test. do this, cervical samples from 63 women with suspected The calculation for determining the sample size was
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
164 Human Virology: HV
the bioterrorism attack with anthrax in 2001 (USA), context, it was calculated the average age of the patients mainly because almost 80% of world population have involvedperformed, and using performed confidence the frequency interval (CI) analysis of 95%. including In this no immune protection anymore. Currently, variola the variables: native city, level of education, marital virus stocks are only supposed to exist, with WHO status, smoking, alcoholism. Of the 589 patients involved authorization, in two labs - CDC (USA) and Vector in the current study, the average age was 37.1 years old. (Russia). However, the existence of illegal stocks may be A total of 75% of the investigated patients lived in the possible. In addition, with current biotechnology tools, is capital and other 25% came from the municipalities also possible to obtain this virus using genetic engineer. of the State of Pará. Among the participants 52.1% Considering these factors, some developed countries have established policies for preparation and warns against a smallpox re-emergence, such as maintenance (307/589), has finished high school, 22.2% (131/589) with primary education and 11% (65/589) with higher troops. In Brazil, if any bioterrorism attack with variola education. Only 0.5% (3/589) was literate. About marital virusof strategic happens, new certainlyvaccines stocksmilitaries or vaccinatingof Brazilian specific Army status 31.6% (186/589) is married, 27.3% (160/589) prepared for biodefense would act. They have never thesingle, consumption 4.5% (26/589) of alcoholic divorced, drinks 32.6% and (192/589)tobacco: 6.5 had % been vaccinated since the extinguished campaign. a stable union and 0.8% (5/589) was widow. Regarding
(32/589) of patients were smokers, 11.5% (68/589) are willTherefore, evaluate in thethis presencework we orinvestigate, absence offor VACV the first total time, IgG former smokers and 81.5% 480/589) are nonsmokers. the antibody levels of that specific military group. We A total of 35.5% (209/589) of patients consume alcohol, 10.2% (60/589) abandoned consumption and 52.6% incubatedneutralizing with antibodies. 1:100 diluted VACV strainserum. WR The (1µg/mL) colorimetric was considering(306/589) did the not greater ingest alcoholicpredisposition drinks. Itof is developing important immobilized on a 96-well flat-bottomed plate and then malignantto develop diseases health care of genital actions, location. specifically In this for context, women, conjugate and measured by an ELISA plate reader at 450 a better understanding of epidemiological factors that nm.response Serum was from assessed 95 militaries using species-specific of that specialized antihuman troop make certain groups develop the oncotic pathology with have already been collected. The cut-off for this assay greater vulnerability are essentials in developing better (absorbance measures: negative < 0,20; undetermined health care programs. Financial Support: Fapespa. - 0,20 to 0,24; positive > 0,24) was determined using serum from 37 individuals not vaccinated and 30 HV325 - ANTIBODY LEVELS AGAINST SMALLPOX IN individuals vaccinated during 60s or 70s decades. Sera MILITARIES OF THE BRAZILIAN ARMY INVOLVED IN of 45 militaries were tested, 5 samples were positive BIODEFENSE (11%), 1 undetermined (2%) and 39 negative (87%). Cruz, N.V.G.; Peralta, R.H.S.; Damaso, C. Positive sera will also be tested for VACV neutralization 1. INSTITUTO DE BIOLOGIA DO EXÉRCITO using micro plaque reduction neutralization test (PRNT). 2. UNIVERSIDADE FEDERAL DO RIO DE Our project will contribute for militaries strategies in JANEIRO biodefense, in terms of establish vaccination policies 3. UNIVERSIDADE FEDERAL FLUMINENSE or vaccines stock against smallpox threat. Financial Since smallpox was declared eradicated by the world Support: CAPES, CNPq, Faperj. health organization (WHO) in 1980, the smallpox HV336 - PREDICTION OF MHC CLASS I EPITOPES IN vaccination, in which vaccine production is used another HUMAN PAPILLOMAVIRUS PROTEINS orthopoxvirus - vaccinia virus (VACV), was discontinued. Batista, M.V.A.; Prado, F.O.; Rocha, P.A.S. Nowadays, variola virus (Poxviridae family, Orthopoxvirus UNIVERSIDADE FEDERAL DE SERGIPE by the Centers for Disease Control and Prevention Human papillomavirus (HPV) is the major cause of genus), the causative agent of smallpox, is classified cervical cancer worldwide. Tumors associated with any deliberate release of variola virus increased after HPV in the cervical region are common and constitute (CDC) as a category “A” bioterrorism agent. The fear of October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
165 Human Virology: HV a serious public health problem. Until now, there are HV338 - ANALYSIS OF THE PREVALENCE OF THE approximately 200 HPV types already known. However, DC-SIGN -366 A/G (RS4804803) AND JAK1 A/G only 18 HPV type are associated with malignant (RS11208534) POLYMORPHISMS IN DENGUE AND transformation, which are called as high-risk HPVs. CONTROL PATIENTS IN PARNAÍBA, PIAUÍ, BRAZIL Although there are a tetravalent vaccine available, it Pereira, A.C.T.C.; Souza, L.G.; Viana, R.M.M.; Ferreira, cannot prevent against all high-risk HPV types. In this G.P.; Coelho, L.F.L.; Pereira, A.C.T.C.P. way, wider spectrum vaccines should be developed in order to prevent HPV infections. The epitope prediction 1. UNIVERSIDADE FEDERAL DO PIAUÍ 2. UNIVERSIDADE FEDERAL DE ALFENAS is a useful tool for vaccine design because we could assess structural properties, cross-reactions and Dengue is a disease that manifests itself in different recognition by the immunoglobulins in a cheaper and clinical forms, fact attributed to the complex relationship faster way, working with large amounts of data so that between virus and host. Among host factors studied various experimental stages of vaccine development can be abbreviated. Therefore, this study aimed to predict polymorphisms of CD-209 gene and the rs11208534 MHC class I epitopes in HPV proteins that could be used in recent years there are rs4804803 -336A/G SNP for human immunization based on the distribution of prevalence of these polymorphisms, correlating them HLA-A loci polymorphisms across populations. In order withSNP A/Gdengue of JAK-1 symptoms gene. Thispresented study, wein adetermined population the of to do this, a local database was created for all HPV protein Parnaíba, state of Piauí, Brazil. In preliminary results, the control sample of 105 subjects were compared with with information regarding their physicochemical and structuralsequences characteristics. retrieved from UsingProtein/NCBI IEDB Analysis database, Resource, along by Dengue virus (DENV), and were genotyped for epitopes for these proteins were predicted using polymorphisms26 samples from by patientsquantitative with confirmedreal-time PCR. infection We NetMHC tool according to the most frequent HLA-A compared the frequencies of the genotypes and alleles of alleles. The analysis showed that 43 epitopes were the polymorphisms studied between population controls highly immunogenic, and they presented high identity with other HPVs. These epitopes are intrinsically were observed in the frequencies of genotypes and alleles associated with the response of more than 70% of the ofand patients patients. and For control. both Alsogenes, the no analysis significant of the differencesprevalence HLA-A alleles in the world population. Finally, these of symptoms in individuals with the G allele, showed epitopes were mapped into the 3D structure of HPV fewer symptoms than homozygous AA. The differences surface. Therefore, it was possible to predict a MHC class inno thesignificant protective difference, effect or despiterisk conferred these patients by the Ghaving allele Iproteins, epitope set confirming in HPV proteins their accessibility with high immunogenicity on the protein could be related to the modulation of the pathogenesis that may present a response in >70% of individuals of DENV during infection conferred by a complexity of worldwide, being a strong candidate for an epitope- factors, including intrinsic genetic characteristics of the based vaccine with high capacity to activate immune host, besides environmental factors. Financial Support: response and the possibility of cross-protection among CNPq, CAPES, FAPEPI. different HPV types. These promising results can serve as basis for further studies to develop synthetic peptides and test their immunological response, which could lead to new prophylactic strategies to prevent cervical cancer.
Financial Support: CNPq, CAPES and FAPITEC/SE.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
166 Human Virology: HV
HV340 - CIRCULATION PROFILE OF RESPIRATORY HV342 - MOLECULAR CHARACTERIZATION OF VIRUSES IN GOIANIA, GOIAS NOROVIRUS STRAINS DETECTED IN HOSPITALIZED Castro, I.A.; Costa, L.D.C.; Oliveira, A.C.R.; Souza, CHILDREN DURING A THREE-YEAR STUDY IN BELÉM, M.B.L.D.; Cardoso, D.D.P.; Costa, P.S.S.; Souza, K.M.C.; PARÁ, BRAZIL Fiaccadori, F.S. Reymão, T.K.A.; Silva, L.D.; Teixeira, D.M.; Lucena, M.S.S.; Justino, M.C.A.; Mascarenhas, J.D.P.; Linhares, 1. INSTITUTO DE PATOLOGIA TROPICAL E SAUDE PUBLICA A.C.; Gabbay, Y.B. 2. FACULDADE DE MEDICINA INSTITUTO EVANDRO CHAGAS Acute respiratory infection (ARI) remain a major Acute gastroenteritis (AGE) remains an important public cause of morbity and mortality in children worldwide, health problem all around the world, accounting for particularly among developing countries. Evaluation of billions of cases and millions of deaths every year, mainly in developing countries. In the last years, Norovirus infections can help to identify risk groups and design (NoV) has emerged as an important cause of AGE, healthincidence, control etiology measures. and seasonal Although profile some of studies respiratory have affecting people of all age groups, especially children tried to observe seasonal patterns for respiratory viral infections in Brazil, no data is available for Mid- broad genetic diversity, which might potentially favors West region so far. The surveillance for Acute Severe itsunder escape five yearsfrom andthe host the elderly. immune Norovirus system presentsleading to a Respiratory Syndrome (SRAG) headed by Brazilian successive infections by different strains. The aim of this Ministry of Health for Mid-West region have just been study was the detection and genotyping of NoV strains established and few results were observed, due to the from stool samples of children hospitalized for AGE low number of samples collected. Given that, our study aimed the molecular investigation of viral respiratory pathogens in children from Goiânia – Goiás during one byin Belém,Enzyme Pará, Immunoassay Northern Brazil.(EIA). FromThe positive March/2012 samples to year. Between august 2012 and 2013, 225 children with March/2015 434 stool samples were screened for NoV and G2SKR, which target the polymerase-capsid junction centers. We designed a Multiplex Nested-PCR protocol regionwere subjected of NoV genome to RT-PCR and generatesusing primers amplicon Mon of 431/432 550 bp. forfour detection to 14 years of 16 old common were recruitedrespiratory in viruses, five healthcare divided A semi-nested PCR was followed in samples from which in three different reactions. Respiratory viral pathogens were detected throughout the entire study period. primers used in this step were COG2F and G2SKR, which Viral detection rate showed positive correlation with targetamplification the C region could of not viral be capsid, yielded resulting in the infirst an step.amplicon The relative air humidity and rainfall, with positive cases of 390 bp. These amplicons occurring mainly during the rainy season, period of the subjected to direct sequencing. Results were analyzed year comprising months with high relative air humidity using the software Bioedit (v.7.2.5) were furtherand sequences purified were and (RH) and high amount of rainfall. RSVA and B peaked compared to other sequences deposited in the GenBank. between January and March 2013, trimester marked by Phylogenetic trees were constructed using MEGA (v. predominantly between April and June 2013, during the EIA and sequences were obtained from 71 (76.3%) NoV RHhigh fall RH after and a rainfall.long rainy Influenza season. HBoV viruses positive were detectedsamples positive6.0). A positivity samples. rate Genotyping of 21.4% showed (93/434) the waspredominance yielded by peaked at April 2013, and Rhinovirus, which was the most frequent virus detected, showed no clear detection Orleans and Sydney variants. In addition, the following of GII.4 (88.7%- 63/71) strains, corresponding to New inpattern. Goiânia, These using findings molecular provide techniques the first data and contributing enrich the genotypes were also found: GII.2 (1.4%- 1/71), GII.6 knowledgeto delineate aboutthe circulation these pathogens profile of in respiratory Brazil, especially viruses (1.4%- 1/71), GII.7 (2.8%- 2/71) and GII.17 (2.8%- Mid-West region. Financial Support: Fundaçao de 2/71) strains. Noticeably, a recombination between Amparo a Pesquisa de Goias - FAPEG. admittedGII.P7/GII.6 for wasAGE in identified Belém; furthermore, in two samples. a broad This genetic study October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology:showed HV a significant prevalence of NoV among children XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
167 Human Virology: HV diversity of strains circulating in this period (2012- positive for any of the investigated viruses, 116 (33.9%) genotyping of circulating NoV strains, allowing for a better2015). understanding Our findings highlightof viral evolution, the need particularly for continuous with were positive for the Influenza A (H3N2), 45 (13.3%) regards to the emergence of new strains with pandemic (H1N1pdm).for Influenza OurB, 150 data (43.8%) showed for that HRSV the and viral 31 ARIs (9%) were for potential. In addition, NoV genotyping seems critical moreHMPV. frequent No positive in children sample wasand detectedyoung adults, for Influenza especially A since a truly successful NoV vaccine will need to confer during July and August 2014 and from March to May protection against various epidemiologically important 2015. HRSV was predominant accounting for 43.8% of types. Financial Support: Fapespa; CNPq; Instituto the positive samples. Continuous monitoring of the viral etiology in ARIs is of particular importance in regard to implementation of the prevention and control measures EvandroHV344 -Chagas/SVS/MS. SURVEILLANCE OF INFLUENZA A AND B VIRUSES, HUMAN RESPIRATORY SINCICIAL VIRUS AND HUMAN METAPNEUMOVIRUS IN THE NORTH MS.including the introduction of effective, strain specific AND NORTHEAST REGIONS OF BRAZIL composition of vaccines. Financial Support: IEC/SVS/ Barbagelata, L.S.; Gomes, E.R.; Santos, M.C.; Filizzola, HV345 - HUMAN RHINOVIRUS DETECTION AMONG E.M.A.; Ferreira, J.A.; Gonçalves, M.S.; Silva, A.M.; PATIENTS WITH ACUTE RESPIRATORY INFECTION IN Medeiros, R.; Mello, W.A. GUARAPUAVA-PR Morais, F.S.; Carraro, E. 1. INSTITUTO EVANDRO CHAGAS 2. NUCLEO DE MEDICINA TROPICAL-UFPA UNIVERSIDADE ESTADUAL DO CENTRO-OESTE Acute Respiratory Infections (ARI) are typically Acute respiratory infections (ARI) are the most characterized by sudden onset and course with variable common cause of morbidity around the world, severity; they occur at high frequency and prevention resulting in a huge impact in the health and economy of populations. Respiratory viruses are the leading of seeking for medical care and abstention activity pathogens causing ARI, and human rhinovirus (HRV) aroundcan be difficultthe world. to achieve.ARIs account ARIs arefor theabout leading 2.2 million cause deaths annually; it is estimated that 90-95% of cases are investigate the frequency of HRV detection among ARI caused by viruses including: the Influenza A virus (FluA) casesis the ofmost Guarapuava-PR common identified city, nasal virus swab in these samples cases. were To and Influenza B viruses (FluB), Human respiratory collected from symptomatic patients in a local health syncytial virus (HRSV) and Human metapneumovirus center from June to August 2014. The collected samples (HMPV). This study aims to determine the prevalence were processed and tested for molecular detection of of ARIs caused by these viruses in community setting in HRV by polymerase chain reaction preceded by reverse Northern and Northeastern of Brazil. From July 2014 and transcription step (RT-PCR), with primers targeting a June 2015, 1,987 clinical specimens (nasopharyngeal region of the virus genome that comprise part of the 5’ aspirates or swabs) were collected from patients with noncoding region, the entire VP4, and the 5’ terminus symptoms of ARI in the states of Pará, Amazonas, Acre, region of the VP2 gene. In the period of the study 74 Maranhão, Amapá, Roraima, Paraíba, Pernambuco e samples were collected: 16 in June, 19 in July, and 39 Rio Grande do Norte and sent to the Respiratory Virus in August. The median age of patients was 39 years Laboratory of the Evandro Chagas Institute, for viral old, ranging from 1 to 79. The recorded frequency for diagnosis research. Viral nucleic acid was extracted each symptom presented by patients was: coryza 96%, from the clinical specimens using a commercial kit. cough 72%, headache 61%, myalgia 57%, sore throat The detection of viral genome was performed by real- 54%, chills 42%, and fever in 32%. Thirteen samples time Polimerase Chain Reaction preceded of Reverse yielded a positive result for the presence of HRV by RT- PCR, representing 18% of total. Four of the HRV positive probes to Flu A (H3N2 and H1N1pdm), Flu B, RSV and samples was from patients under 10 years old, three HMPV.Transcriptase Of 1,987 (qRT-PCR), patients analyzed, using specific 342 (17.2%) primers were and from patients between 11 and 20 years old, one between
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
168 Human Virology: HV
21 and 30, two between 51 and 60, and one from a Biosystems, USA). The sequences was aligned by the patient major than 60 years old. The recorded frequency Bio Edit program (v.7.1.3.0) and compared with others for each symptom presented by HRV positive patients registered in GenBank and Norovirus Genotyping Tool was: coryza 92%, cough 77%, sore throat and myalgia version 1.0. During the studied period were analyzed 54%, fever 38%, and chills in 30% of patients. Ten of 102 samples from 109 patients, collected from August the positive samples (77%) were collected in August, 2014 to June 2015. Among the samples analyzed, 28 relative period to the second half of the Winter season were symptomatic children and 74 asymptomatic in Brazil. the results of this short-term study show that children, and the positivity of NoV at these sites was HRV is frequent among the ARI cases of Guarapuava population, infecting people of all ages and causing highly variable symptoms, ranging from common cold Regarding15.7% (16/102). age distribution In positive was cases observed 31.2% that (5/16) the wereNoV symptomatic and 68.8% (11/16) asymptomatic. in this little group was similar to the observed in the to influenza like illness. The frequency of HRV detection cases.were more Among frequent the asymptomatic in the age groups cases, the0-12 age months group (2/2with this pathogen and showing its impact on the health of - 100%) and 24-36 months (2/14 - 23%) in symptomatic localcurrent population. literature, Financial confirming Support: the high Coordenação circulation de of -17.5%). Among the positive samples sequenced, three Aperfeiçoamento de Pessoal de Nível Superior (CAPES) werethe highest genotyped number with of the cases presence was over of GII.P4,36 months GII.P7 (7/40 and e Fundação Araucária de Apoio ao Desenvolvimento GII.P12 genotypes. The results demonstrated that NoV is important etiologic agents in cases of gastroenteritis among children attending day care centers. The virus CientíficoHV346 - DETECTIONe Tecnológico OFdo Estado NOROVIRUS do Paraná. IN CHILDREN circulated asymptomatically in most of the period WITH AND WITHOUT GASTROENTERITIS FROM analyzed, enlightening a relevant aspect, indicating CHILDREN’S DAY CARE OF ANANINDEUA-PA that asymptomatic infections with NoV these sites are a Rodrigues, E.A.M.; Lima, A.B.F.; Lucena, M.S.S.; frequent event. This information highlights the need of Gusmão, R.H.P.; Araújo, E.C.; Bandeira, R.S.; Silva, a continuous surveillance to avoid outbreaks in scholar M.M.; Rocha, D.C.; Mascarenhas, J.D.P.; Soares, L.S.; environments. Keywords: norovirus, children’s day Gabbay, Y.B.; Silva, L.D. care, gastroenteritis. Financial Support: Evandro Chagas INSTITUTO EVANDRO CHAGAS Institute. Acute gastroenteritis (AGE) is a public health problem HV350 - DETECTION OF HUMAN BOCAVIRUS worldwide and an important infant mortality cause. The IN CHILDREN HOSPITALIZED WITH ACUTE norovirus (NoV) are considered the main responsible for GASTROENTERITIS IN NOTHERN REGION, BRAZIL nonbacterial AGE outbreaks occurred in ship, nursing Lima, A.B.F.; Pantoja, K.C.; Mascarenhas, J.D.P.; Soares, home and educational environments, such as children’s L.S. day care. This study aimed to detect NoV in stool samples from children attending in the public children’s day care 1. UNIVERSIDADE DO ESTADO DO PARÁ localized in Ananindeua, Para. Samples from children 2. INSTITUTO EVANDRO CHAGAS until six years old were collected in the children’s day Human Bocaviruses (HBoV) are agents primarily care Essência Ananin and Irmã Dulce. The NoV detection associated to respiratory tract diseases, however a rising was realized by enzymatic immunoassay (EIA) and number of reports have been correlating their presence reverse transcription-polymerase chain reaction (RT- to acute gastroenteritis episodes, which represents a PCR) with nucleic acid extracted by silica method. serious public health issue. HBoV belongs to Parvoviridae The semi nested RT-PCR and RT-PCR was performed family, are non-enveloped, and their genome consists of a single-stranded DNA that encodes four distinct proteins: VP1-VP2 (structural), and NP1-NP2 (non-structural). genome.by amplification The genotyping of the regionswas performed A (JV13I/JV12Y using the andBig Four species are currently described (HBoV1 to HBoV4), DyeJV12Y/NoroIIR) Kit® in ABI Prismand B (Mon3130xl 431/432/433/434) DNA Sequencer (Applied of NoV and HBoV2, 3 and 4 are major associated to diarrhea.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
169 Human Virology: HV
Despite the role of HBoV in this context remains unclear, assessed DENV transmission in São José do Rio Preto several studies indicate the presence of this virus in (SJRP) from 2010 to 2014. We analyzed blood samples stool samples. Thus, investigations to detect HBoV in from febrile patients who were attended at health care diarrheal episodes become necessary to evaluate this centers in SJRP. DENV detection was performed using potential as acute gastroenteritis agent, especially in multiplex RT-PCR, using Flavivirus generic primers, rotavirus post-vaccination period. Objective: Detect based on the genes of the non-structural protein (NS5), HBoV in children hospitalized with acute gastroenteritis in northern region of Brazil in 2012. Material and primers. We analyzed 1549 samples, of which 1389 were Methods: Fifty samples received in 2012 from National positivefollowed for by NS1 nested-PCR by rapid test. assay One with thousand species-specific and eight- Rotavirus Surveillance Network, obtained from children were analyzed. For HBoV detection, viral nucleic acids seven samples (78%) were confirmed as positive by wereunder extracted five years from of agestool and samples negative and to submitted rotavirus to A multiplex RT-PCR: DENV-4, 48.5% (528/1087); DENV-1, Polymerase Chain Reaction (PCR), followed by Nested- 41.5% (449/1087); DENV-2, 9.5% (104/1087); and co- PCR, aiming to amplify a nucleotide fragment of 576 bp. infection (5 DENV-1/DENV-4, 1 DENV-1/DENV-2), 0.5% Results: Positivity rate for HBoV on analyzed samples genotype(6/1087). and Phylogenetic the showed analysis a relationship of the DENV-4between grouped isolates fromthe isolates SJRP and identified isolates from in this the study northern with region the American of South America. Amino acid substitutions found in proteins E, was 8% (4/50), which 75% (3/4) were originated NS1, NS3, and NS5 of DENV-4 were considered common from Amazonas state, and 25% (1/4) from Acre state. among samples from SJRP, and these changes did not Male were more affected (75%, 3/4) and HBoV was occur in regions of interaction, or in the active sites of identified in two distinct months, February (50%, 2/4) viral proteins described in the literature, suggesting that onlyand Octobersymptom (50%, observed 2/4). Regardingamong positive to immunization, group was these changes in the primary sequence of the protein 25% (1/4) of patients received rotavirus vaccine. The cannot interfere with their functions. Taken together, our circulation in association to acute gastroenteritis in data shows the detection and emergence of new dengue northerndiarrhea. Conclusions:Brazil, and suggest, The present even findings in long-term, reveal HBoVtheir serotype in a new region and reiterate the importance of possible emergence in this infection, reassuring the surveillance programs to detect and trace the evolution importance of their surveillance in diarrheal episodes. of DENV. Keywords: Dengue. Serotypes. Genotype. Viral Keywords: human bocavirus, gastroenteritis, children. proteins. Financial Support: FAPESP, CAPES. Financial Support: IEC, CNPq.
HV359 - DENGUE VIRUS SURVEILLANCE: EMERGENCE OF DENV-4 IN THE CITY OF SÃO JOSÉ DO RIO PRETO, SP, BRAZIL Colombo, T.E.; Araújo, G.C.; Souza, F.P.; Mazaro, C.C.P.; Vedovello, D.; Mondini, A.; Junior, J.P.A.; Santos, I.N.P.; Reis, A.F.N.; Costa, F.R.; Cruz, L.E.A.A.; Casagrande, L.; Regatieri, L.J.; Junior, J.F.J.; Bronzoni, R.V.M.; Nogueira, M.L. 1. UNESP 2. FAMERP 3. PREFEITURA DE SÃO JOSÉ DO RIO PRETO 4. UNIVERSIDADE FEDERAL DO MATO GROSSO Dengue is the most common arbovirus infection worldwide and is caused by four distinct serotypes of the Dengue virus (DENV). In the present study, we
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
170 Human Virology: HV
HV360 - DETECTION OF ARBOVIRUS IN ADULT MOSQUITOES TRAPPED IN RIO DE JANEIRO, BRAZIL: and orthobunyaviruses. After 12 months of continuous IMPROVEMENTS OF THE SURVEILLANCE SYSTEM trappingRT-PCR for22,202 flaviviruses, and 52,000 alphaviruses, mosquitoes were phleboviruses collected Santos, L.L.R.; Cadar, D.; Ribeiro, M.S.; de Meneses, in the cities of Rio de Janeiro and Nova Iguaçú, M.D.F.; da Silva, J.L.; Giordano, M.C.D.; Schmidt- repectively. Flavivirus RNA was detected in 01 pool from Chanasit, J.; Ferreira, D.F.; Campos, R.M. Rio and 13 pools from Nova Iguacu, respectively. Sanger sequencing of the amplicons demonstrated the presence 1. DEPARTAMENTO DE VIROLOGIA, INSTITUTO of different genotypes of DENV serotype 4 and DENV DE MICROBIOLOGIA PAULO DE GÓES 2. WHO COLLABORATING CENTRE FOR base to determine the underlying causes of the seasonal ARBOVIRUS AND HAEMORRHAGIC FEVER serotype 2 respectively. Our findings may provide a solid REFERENCE AND RESEARCH, BERNHARD of the mosquito vector species. This information can be NOCHT INSTITUTE FOR TROPICAL fluctuations of DENV activity and the relative abundance MEDICINE used as a basis for vector control programs and might 3. LABORATÓRIO CENTRAL DE SAÚDE provide an early warning of the presence of DENV in the PÚBLICA NOEL NUTELS state of Rio de Janeiro. Financial Support: FAPERJ, BNI (Germany). Arthropod-borne viruses (arboviruses) may cause human disease, ranging from mild febrile illness to HV361 - ANALYSIS OF VP4, VP6 AND VP7 GENES encephalitis and death. Most of the characterized human OF G1P[8] ROTAVIRUS STRAINS CIRCULATING IN pathogenic arbovirus species belong mainly to 3 families: AMAZON REGION, AFTER ROTAVIRUS VACCINE Togaviridae, Flaviviridae, and Bunyaviridae. During the INTRODUCTION last decade several countries worldwide have been Santos, F.S.; Soares, L.S.; Guerra, S.F.S.; Lobo, P.S.; facing the burden of introduction and re-introduction of Penha Junior, E.T.; Sousa Júnior, E.C.; Lima, A.B.F.; arboviruses such as dengue virus (DENV), chikungunya Justino, M. C. A.; Linhares, A.C.; Mascarenhas, J.D.P. virus, Japanese encephalitis virus, and West Nile virus in urban areas. Arboviruses-are a very diverse group. In Worldwide, it was recently estimated that group A Brazil, DENV is the most important arbovirus causing rotaviruses (RVA) account for about 197,000 deaths of hundreds of deaths annually. The city of Rio de Janeiro children aged 0-5 years, with the major disease burden is an important tourist destination. Thus, it has been occurring in low-income countries. The monovalent, playing an important role on arbovirus introduction oral rotavirus vaccine Rotarix® (GlaxoSmithKline into Brazil. The last DENV epidemic in the state of Rio de Biologicals, Wavre, Belgium) contains a human-derived Janeiro was caused by co-circulation of DENV serotypes 4 and 1 and the number of cases reached 213.058. Brazilian National Immunization Program in 2006. Many questions remain unanswered regarding the G1P[8] rotavirus strain and was introduced into the accounting for approximately 50% of cases of rotavirus- of vectors, seasonal variation, abundance of infected relatedG1P[8] gastroenteritis genotype appear during dominant childhood. in several Several settings, studies mosquitofactors that females influence and the DENVmovement outbreaks. of vectors The between ecology have shown the broad antigenic and genetic diversity of RVA strains, hence the importance of monitoring changes - at the molecular level - of outer capsid proteins workhuman represent modified an environment observational and ecologic urban forest study may of (VP4 and VP7) as well as of the middle capsid protein theinfluence circulating the course arboviruses of DENV in vectors. epidemics. Six Theareas present were chosen in the city of Rio de Janeiro and Nova Iguaçu, as outer shell VP7 and VP4 proteins, whereas VP6 relates trapping sites of adult mosquitoes using BG Sentinel® VP6. Serotype/genotype specificities are defined by traps and aspirators. After morphological species assess the genetic variability of the structural VP4, VP6 to group- and- subgroup specificities. Objective: To according to species and homogenized. Extracted RNA samples from children hospitalized for acute diarrhea fromidentification homogenized on chilled mosquito tables mosquitoespools was screenedwere pooled by inand Belém, VP7 genes Pará, fromBrazil, G1P[8] from 2009strains; to 2011.obtained Methodology: from stool
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
171 Human Virology: HV
to detect and genotype herpesviruses in cerebrospinal analyzed. All samples were subjected to polymerase chainRNA extracts reaction from preceded 8 G1P[8]-positive by reverse fecaltranscription samples were(RT- the Northern Brazilian Region, whose samples were PCR) and the cDNA was further subjected to sequencing sentfluid (CSF)to the of Enterovirus patients with Laboratory meningoencephalitis of the Evandro from using the Big Dye Terminator® Kit (Applied Biosystems) Chagas Institute for viral infection research. The study method, as described by the manufacturer. Results: population was predominantly composed of adults Sequencing analyses of structural genes VP4, VP6 and (58.5%). Mean age of patients studied was 34 years, and the minimum age 2 months and the maximum 83 and 98.1% nucleotide similarity rates, respectively. years. All CSF samples were subjected to DNA extraction, WhenVP7 from analyzing the 8 deduced G1P[8] strains amino showedacid sequences 97.9%, of 98.1% VP6, followed by two PCR reactions - one using consensus rates of 96.2, 94.5%, and 93.1% were observed, 2 and EBV that amplify 518bp, and the other for detection respectively.VP4 and VP7 Regarding proteins the of G1P[8]lineage samples,of the samples similarity the primers Herp1/Herp2 for detection of CMV, HSV-1, HSV- VP4 gene belonged to lineage 3, the VP6 gene belonged 275bp. Herpesvirus genotyping was performed through to genotype I1 and regarding VP7 gene all samples theof VZV automatic using VP22sequencing and VM20 of nucleotide primers that bases. amplifies From January to July 2015 were received 65 CSF samples in RVA strains clustered into the same clade, although not the Laboratory of Enterovirus. The overall prevalence groupingbelonged intoto lineage the same 1. Conclusion: lineages for Overall VP4 and the VP7genes 8 G1P[8] of the vaccine samples showing a divergence between most prevalent (38.1%), followed by the HSV-1 (33.3%) andof herpesviruses VZV (14.3%). was We could32,3% not (21/65) identify and the EBV genotype was the in samples. This study highlights the need for continuous the G1P[8] strains circulating in our region and vaccine associated with infection by herpesviruses. The high to genetic variability, since the vaccine used in Brazil prevalence3 samples (14.3%). of EBV observed The age groupin this wasstudy not may significantly be due to possessesmonitoring homologous of rotavirus genotype G1P[8] strains composition. with regards Key the fact that more than 90% the general population has latent EBV infection. Our data highlight the major role VP7, vaccine of Herpesvirus as a cause of meningoencephalitis in our words: Rotavirus, G1P[8] genotype, genes VP4, VP6 and region and warrant the conduct of further and broader HV372 - HERPESVIRUS DETECTION AND GENOTYPING IN MENINGOENCEPHALITIS IN Herpes viruses and meningoencephalitis. NORTHERN BRAZILIAN study on this subject. Keywords: cerebrospinal fluid, Monteiro, J.C.; Scerni, R.M.; Brasil-Costa, I.; Monteiro, HV377 - MOLECULAR PROFILE OF GROUP A T.A.F.; Linhares, A.C.; Tavares, F.N. ROTAVIRUS IN THE WESTERN AMAZON, BRAZIL Neves, M.A.O.; Linhares, A.C.; Silva, L.D.; Gabbay, INSTITUTO EVANDRO CHAGAS Y.B.; Silva, M.C.M.; Loureiro, E.C.B.; Soares, L.S.; Herpesviruses infect more than 90% of the world’s Mascarenhas, J.D.P.
These viruses are large double-stranded DNA and show INSTITUTO EVANDRO CHAGAS abilitypopulation to establish and persist a lifelong indefinitely latency in in sensory a latent ganglia form. Group A rotaviruses (RVA) are the main etiological viral and to invade and replicate in the central nervous system (CNS). Both primary infection and reactivation years of age worldwide, resulting in more than 197,000 can cause neurological disease, including meningitis and deathsagents ofannually. acute gastroenteritis In 2005, it was in childrenrecorded less the than largest five encephalitis. Herpes meningoencephalitis is a severe outbreak of acute diarrheal disease associated with the neurological condition. It’s the most common cause of RVA in Brazil, with most cases in the city of Rio Branco, sporadic viral encephalitis wich is potentially fatal. Usually Acre state. Objective (s): This study aimed to describe the herpes encephalitis cases are associated with infection by Herpes simplex (HSV-1 and HSV-2). In untreated cases of age in the city of Rio Branco, Acre, Brazil. Materials the mortality rate is approximately 70%. This study aims andgenotypic Methods: variability From ofJanuary RVA in tochildren December under 2012, five years 488
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
172 Human Virology: HV fecal samples were analyzed from diarrheeic and non- cellular secretory routes promoting its own secretion diarrheic children who were either admitted to a local via exosomes. To better understand the effects of Nef on general hospital or sought for treatment at an outpatient the exocytic pathway, we investigated whether this viral unit. The association was evaluated by the chi-square by T lymphocytes. We showed that both CD4 and MHC-I moleculesfactor modifies are secreted the composition in exosomes of exosomes from T cells released and Positivetest (χ2) specimens considering for CI: RVA 95% were and tested p <0.05. by Polymerase RVA were that the expression of Nef reduces the amount of these Chainidentified Reaction by enzyme-linkedpreceded by Reverse immunosorbent Transcription assay. (RT- proteins in exosomes. To investigate the functional role genes (P for this novel activity of Nef, we performed in vitro HIV-1 type) and subsequent sequencing of nucleotides of at infection assays in the presence of distinct populations leastPCR) 20%for amplification of the genotypes. of VP7 Results: (G type) RVA and wasVP4 detected of exosomes. We demonstrated that exosomes released by CD4+ T cells, but not CD4- HIV-1 infection in vitro. Because CD4 is the main in 18.3% (44/241) of the children with acute diarrhea receptor for HIV-1 infection, these T cells, results efficiently suggest inhibit that and in 1.2% (3/247) of the non-diarrheic children CD4 molecules displayed on the surface of exosomes (P<0.001), with overall RVA-positivity of 9.6% (47/488). can bind to envelope proteins of HIV-1 hindering virus The most common genotype was G2P[4] with 43.2% interaction with target cells and infection. Importantly, (19/44) of the diarrheic cases, followed by G12P[8] CD4-depleted exosomes released by CD4+ T cells of(27.3%, VP7 gene 12/44), revealed G3P[6] the existence (18.2%, 8/44),of lineages G3P[8] II, I (4.5%,and III expressing Nef have a reduced capacity to inhibit HIV-1 for2/44) the and RVA G12P[6] G2, G3 and (2.3%, G12, 1/44). respectively. Phylogenetic As to VP4 analysis gene infection in vitro. These results provide evidence that Nef promotes HIV-1 infection by reducing the expression of CD4 in exosomes from infected cells, besides the original knowledgelineages III the of typescirculation P[8], of V RVA of P[4] variants and Iafter of P[6] rotavirus were role of Nef in reducing the CD4 levels at the cell surface. vaccineidentified. introduction Conclusion: in This Brazil study and allowed elsewhere, expanding since the Financial Support: FAPESP. occurrence of either unusual our emerging genotypes may pose a challenge to vaccination strategies. HV383 - APPROACH SYNDROMIC STUDY DONE IN Keywords: Rotavirus, children, diarrhea. Financial THE MUNICIPALITY PARAUAPEBAS, PARA, BRAZIL Support: Coordenação de Aperfeiçoamento de Pessoal Martins, L.C.; Azevedo, R.S.S.; Cardozo, V.J.R.; de Nível Superior (CAPES), Instituto Evandro Chagas Barbagelata, L.S.; Mascarenhas, J.D.P.; Mendes, (IEC). Y.G.; Soares, M.C.P.; Mello, W.A.; Rodrigues, S.G.; Vasconcelos, P.F.C. HV379 - NEF NEUTRALIZES THE ABILITY OF INSTITUTO EVANDRO CHAGAS EXOSOMES FROM CD4+ T CELLS TO ACT AS DECOYS DURING HIV-1 INFECTION de Carvalho, J.V.; de Castro, R.O.; da Silva, E.Z.; Silveira, The region of Carajás, more specifically the city of P.P.; da Silva-Januário, M.E.; Arruda, E.; Jamur, M.C.; of people from other states of the country, due to the Parauapebas, presented since the 1980s a huge influx Oliver, C.; Aguiar, R.S.; da Silva, L.L. discovery of important local mineral reserves. From 2000 to 2014 the population more than doubled. This 1. FACULDADE DE MEDICINA DE RIBEIRÃO fact led to the spread of both diseases endemic to the PRETO region as the introduction of new diseases. This study 2. DEPARTAMENTO DE GENETICA UFRJ seeks through syndromic study detect the circulation Nef is an HIV-1 accessory protein that promotes viral and prevalence of antibodies to different infectious replication and pathogenesis. A key function of Nef agents in the population of Parauapebas -PA. The is to ensure sustained depletion of CD4 and MHC-I active syndromic approach study was conducted from molecules in infected cells by inducing targeting of these proteins to multivesicular bodies (MVBs), and of Parauapebas. The study included 152 patients, 85 ultimately to lysosomes for degradation. Nef also affects withJanuary febrile to November syndrome, / 201314 jaundiced-hemorrhagic, in the Municipal Hospital 17
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
173 Human Virology: HV diarrheal and 36 respiratory. For laboratory investigation and Cidofovir (CDV). To accomplish this objective, the was conducted direct techniques aiming at isolating the effective concentration (EC50) for the two drugs were infectious agent or genome detection (cell culture, blood calculated from plaque assays in BSC-40 cells. Comet- smear, PCR and RT-PCR) and indirect techniques to detect shape assay and DNA replication analysis were done in
VACV. The F13L and E9L ORFs were sequenced to search specific antibodies (ELISA and HI). Among the patients fororder polymorphisms to confirm the associatedaction of the with two ST-246drugs against and CDV Br- classified with respiratory syndrome were detected B (8), Respiratory Syncytial Virus (2), Adenovirus (3); resistance, respectively. The EC50 from both drugs varies onInfluenza the diarrheal A H3N2 syndrome(2), Influenza spectrum, A H1N1 were (4), Influenzadetected two samples of Rotavirus and tree of Norovirus ; for the icteric cases, were detected chronic hepatitis B (4), Interestingly,significantly for the different two phylogenetic strains (from clades 0.0054 of Br-VACVto 0.051 μM for ST-246 and from 27.14 to 61.23 µM for CDV). acute Hepatitis B (1), Hepatitis A (4) and hepatitis C showed differences regarding their EC50 values. For ST-
(2); in patients with febrile syndrome, case of malaria 246, the mean EC50 for group 1 is 0.0065 µM compared to
(Plasmodium falciparum); three isolates of dengue virus; 0.0424 µM for group 2. For CDV, the mean EC50 for group detection of IgM antibodies to dengue (15), Mayaro (6) 1 is 33.28 µM compared to 54.67 µM for group 2. ST-246 and ORO (2); as well as hemagglutination-inhibiting strongly inhibits the production of extracellular virus for antibodies primarily for arbovirus of the Flavivirus all isolates from group 1 Br-VACV in concentrations as genus. Was also conducted for HIV and HTLV serology, however, all samples were negative. In the municipality of comet-shaped plaques was achieve only at the higher low as 0.0125 μM. For group 2, the maximum inhibition infectious agents, so the epidemiological surveillance for some inhibition of their DNA replication in the presence controlof Parauapebas/ of these diseases PA is should the movementbe intense, mainly of various due ofconcentration CDV, but a wide tested variation (0.1 μM). was All found Br-VACV (from presented 12% to to migratory characteristic of this population. Financial sequencing of the F13L and E9L ORFs showed that Br- VACV95% inhibitiondo not present in different the polymorphisms strains). Amplification associated with and Support:HV387 - VALE/IECIN VITRO SUSCEPTIBILITY TO ST-246 AND resistance to these drugs. Overall, our results shown that CIDOFOVIR CORROBORATES THE PHYLOGENETIC the susceptibility of different Br-VACV to ST-246 and CDV SEPARATION OF BRAZILIAN VACCINIA VIRUS correlates with the phylogenetic division of these viruses STRAINS INTO TWO CLADES into two clades. Additionally, ST-246 and CDV proved to Rodrigues, N.F.S.; Pires, M.A.; Oliveira, D.B.; Assis, F.L.; be effective drugs against wild VACV strains and thus Costa, G.B.; Kroon, E.G.; Mota, B.E.F. are of great importance as potential compounds to treat UNIVERSIDADE FEDERAL DE MINAS GERAIS individuals during BV outbreaks in Brazil. Keywords: Vaccinia virus, Brazilian strains, ST-246, Cidofovir. VACV strains have been isolated from milking cows and Financial Support: CNPq E PRÓ-REITORIA DE PESQUISA dairy workers in Brazil, during outbreaks of a zoonotic DA UFMG (PRPQ-UFMG). disease called Bovine Vaccinia (BV). Phylogenetic studies from our group showed that Brazilian VACV (Br-VACV) are separated in two clades, named group 1 and group 2. Group 1 Br-VACV was shown to have small viral plaques in cell cultures and low virulence in murine model, while group 2 Br-VACV presented larger plaques and higher virulence in mice. There is no approved treatment for VACV infections, but ST-246 (an inhibitor of OPV extracellular virus production) and Cidofovir (an inhibitor of viral DNA replication) are now under clinical trials. The main objective of this work was to evaluate the susceptibility of Br-VACV to ST-246
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
174 Human Virology: HV
HV395 - ECO-EPIDEMIOLOGICAL STUDY OF S segment. A total of 62 rodents belong to six genus HANTAVIRUSES CIRCULATING IN WILD RODENTS were captured: Rodentia – Sigmodontinae: 44 Akodon IN THE MUNICIPALITY OF RIO CLARO, AFTER spp., 1 Euryoryzomys russatus, 8 Oligoryzomys nigripes, THE FIRST CONFIRMED CASE OF HANTAVIRUS 2 Oxymycterus sp. and 2 Sooretamys angouya; Rodentia PULMONARY SYNDROME IN RIO DE JANEIRO STATE – Murinae: 1 Mus musculus and 4 Rattus rattus. The – PRELIMINARY RESULTS total capture success was 5.8%, for a capture effort of Oliveira, R.C.; Guterres, A.; Teixeira, B.R.; Strecht, L.; 1190 traps. Three (4.8%) rodents were seroreactive, Fernandes, J.; Bosco Jr, J.; Penna Jr, J.M.; Rontani, R.; two specimens of the species Oligoryzomys nigripes and Leonardo, R.; Oliveira Jr, R.J.; Fonseca, L.X.; Oliveira, one Akodon cursor. Two samples were RT-PCR positive S.V.; Meneguete, P.; Dias, C.M.G.; D’Andrea, P.S.; Lemos, for hantavirus, one Oligoryzomys nigripes and one E.R. Akodon cursor. Viral characterization is under analysis. The circulation of a potential pathogenic hantavirus 1. INSTITUTO OSWALDO CRUZ 2. SECRETARIA DE SAÚDE DE RIO CLARO the risk areas of human disease. Financial Support: 3. SERVIÇO DE VIGILÂNCIA EM SAÚDE emphasizes the need for additional local studies to define Although Rio de Janeiro State is considered a non- endemic area for Hantavirus Pulmonary Syndrome FIOCRUZ/CNPq.HV396 - POLYOMAVIRUS BK DETECTED IN CSF SAMPLES OF ASEPTIC ENCEPHALITIS: THE of HPS in the municipality of Rio Claro, Medio Paraíba CAUSATIVE AGENT OR JUST AN ASYMPTOMATIC Region.(HPS), recently In May our2015, group a 34-year-old reported the man first was human admitted case REACTIVATION to the General Hospital Nossa Senhora da Piedade, with Nunes, C.F.; Urbano, P.R.P.; Haziot, M.E.J.; Olival, G.S.; Vermudez, J.E.V.; de Oliveira, A.C.P.; de Oliveira, A.C.S.; 6 days after illness onset. A serum sample was collected Romano, C.M. andinfluenza-like tested for symptoms. hantavirus He by died serology of respiratory and molecular failure 1. INSTITUTO DE MEDICINA TROPICAL - USP analyses. The patient presented high titres of IgM against 2. IRMANDADE DA SANTA CASADE recombinant nucleocapsid protein (N) of the Juquitiba MISERICÓRDIA DE SÃO PAULO hantavirus genotype. Viral genome was detected by 3. INSTITUTO DE INFECTOLOGIA EMILIO RIBAS as Juquitiba genotype. To better understand the eco- The two most common and widely spread human epidemiologicalreverse transcription scenarios PCR, inand this the area, virus we was carried confirmed out a polyomaviruses, BK virus (BKV) and JC virus (JCV) serosurvey to estimate hantavirus prevalence in rodents infect latently about 70-80% of healthy adults. Both captured in sites of probable infection of the patient. viruses establish latency in the urinary tract and can be reactivated in immunossupression conditions such as the patient`s workplace and one around the patient’s AIDS or transplant recipients. JCV might cause a severe and residence.Captures were In each conducted area two in five transects trapping trappings areas: four were in often fatal disease in these patients, named progressive established and placed in peridomestic environments, multifocal leucoencephalopathy (PML), but although shrub and forest borders. Each capture station was up to 60% of AIDS patients also shed BKV in the urine equiped with Sherman® and Tomahawk® live traps there have been few reports of BKV-related neurological placed 10 m apart, in linear ground transects of 20 disease in AIDS. BKV meningoencephalitis is very rarely capture stations, and inspected in the early morning has a fatal outcome when associated with AIDS. The clinical picture is devastating, resulting in death. To our and euthanized in accordance with the Guidelines for knowledge, there are about ten cases of BKV-related theon five Care consecutive and Use ofdays. Laboratory Each animal Animals was anesthetized of Oswaldo neurologic disease reported in literature so far. Samples Cruz Foundation, Brazil. Rodent serum samples were screened by ELISA for IgG antibodies to hantavirus from patients with suspected meningitis or encephalitis using Andes virus as antigen. Antibody-positive rodent (MEs)of the was cerebrospinal examined for fluid BKV (CSF) or JCV specimens using a generic obtained PCR samples were submitted to RT-PCR to amplify partial October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
175 Human Virology: HV
and epidemiological data were evaluated by review of JCV or BKV. None of the patients had PML and JCV was medical records. hRSV positive samples were analyzed notdirected detected to AgT in gene,these or samples. specific RealBKV TimeDNA PCRhowever, for either was by conventional RT-PCR to amplify the G and F genes, detected in four of twenty nine samples (14%), obtained and subtyping was carried out by nucleotide sequencing. in 2012 and 2013. Two patients were male and two Results: A total of 70 hRSV positive were analyzed, was female. All of them showed neurological symptoms being 55 (78.5%) type A and 15 (21.5%) type B. Forty- compatibles with meningitis or encephalitis and as far as nine (70.0%) of them were viral mono-infection, and we know, they were HIV-1 negative. Generic PCR for the 21 (30.0%) were co-infection. The median age was 5.8 eight types human herpesvirus was performed and the months (IQR 1.7-11.0), and 54% were female. Eleven female patient was positive for HSV-1 and one of the male patients had co-morbidities among the study population. patient, presented EBV con-infection. Although we can Fever, respiratory distress, oxygen therapy and antibiotic not discard the presence of other viruses that were not use were reported for the majority of patients, nine investigated here, the importance of the presence of BKV children needed intensive care, and one patient died due in the CSF sample can not be dismissed, in particular, the to other factors unrelated to the respiratory condition. patient that only tested positive for BKV. In conclusion, Up to the time were found twenty-eight samples of our study demonstrates that BKV in CSF is not unlikely type A with inserts of 72 nucleotides, correlating with and since it can be the causative agent of meningitis and the genotype ON1 and at least three samples of The or encephalitis, this virus must be investigated in higher group B showing insertion of 60 nucleotides, related frequencies in suspected cases of aseptic MEs. Financial with the genotype BA. Conclusion: It was not observed Support: Fundação de Amparo a Pesquisa do Estado de association between the presence of HRSV mono- or São Paulo - FAPESP. co-infection or viral genotype with disease severity. The data is an important role to guide the prioritization HV402 - MOLECULAR CHARACTERIZATION AND of research into novel antiviral therapies, and in the CLINICAL EPIDEMIOLOGY OF HUMAN RESPIRATORY implementation of preventive measures to avoid the SYNCYTIAL VIRUS (HRSV) IN HOSPITALIZED nosocomial spread of this pathogen. Keywords: Human CHILDREN, BRAZIL respiratory syncytial virus; molecular epidemiology; Moreira, F.B.; Rosario, C.S.; Pereira, L.A.; Nogueira, G glycoprotein; genetic variability. Financial Support: M.B.; Vidal, L.R.R.; Raboni, S.M. Coordenação de Aperfeiçoamento de Pessoas de Nível 1. UNIVERSIDADE FEDERAL DO PARANÁ Superior (CAPES). 2. HOSPITAL DE CLINICAS DA UNIVERSIDADE HV425 - ANTI-COXSACKIEVIRUS ACTIVITY OF FEDERAL DO PARANÁ CAULERPIN ESTER DERIVATES Human respiratory syncytial virus (hRSV) is an Souza, S.J.M.; Veras, R.M.A.; Melo, D.M.; Lima, A.R.V.; important cause of acute respiratory infections. It is Vieira, P.H.S.; Oliveira, J.M.; Vieira, A.C.S.; Santos, highly prevalent among children until two years old, and B.V.O.; Moreira, M.S.A.M.; Santos, J.M.; Borges, A.A.; usually associated with bronchiolitis and pneumonia. Muller, D.M. The hRSV, a paramyxovirus virus, has a single strand UNIVERSIDADE FEDERAL DE ALAGOAS important factor that contributes to hRSV outbreaks is Coxsackievirus B5 (CVB5) belongs to the genus RNA with 10 genes, which codifies 11 proteins. An the surface proteins F and G genetic variability, which Enterovirus and the Picornaviridae family. The virion are responsible for entry and dissemination of virus is a naked icosahedron, and the genome is compo sed in the host cells. This study reports genetic variability, of single-stranded RNA. CVB5 infections are often asymptomatic but may occasionally result in severe pediatric patients hospitalized at a referral academic diseases of the heart, pancreas, and central nervous hospital,clinical and Southern epidemiological Brazil. Methods: profile Thisof hRSV cross-sectional detected in system. The group at highest risk of CVB infections study included samples from pediatric patients attending are children and the immunocompromised. Due to the from July 2011 to May 2013. Clinical, demographic, absence of vaccines and antiviral drugs, there is a high
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
176 Human Virology: HV necessity to develop an antiviral strategy against CVB5. HV430 - NTEGRATION STATUS OF THE HPV 16 Natural products have an extensive chemical diversity and GENOME AND ITS RELATION WITH THE CYTOLOGICAL are a traditional source of drug molecules with promising RESULTS IN WOMEN ASSISTED IN A ROUTINE OF biological activities. Marine organisms have played a GYNECOLOGY PUBLIC SERVICE IN BELÉM – PARÁ - relevant role among the natural products. Caulerpin is BRAZIL a bisindole alkaloid which is isolated mainly from green Paixão, C.G.S da; Silva, A.K.; Fonseca L.P.S.; Oliveira algae of the genus Caulerpa. Caulerpine has shown O.S.; Ferreira, L.S.S.; Abraão, L.M.L.; Junior, L.B.D.; biological activities such as anticancer, antimicrobial, Farias, S.L.; Mello, W.A.; Silvestre, R.V.D. herpes vírus). Here we show the activity of caulerpin 1. INSTITUTO EVANDRO CHAGAS 2. UNIVERSIDADE DO ESTADO DO PARÁ esterantinociceptive derivates anti-inflammatory (CED) against coxsackie and antiviral vírus. (against The 3. LABORATÓRIO PAULO AZEVEDO cytotoxicity of CED against VERO E6 cells was carried 4. HOSPITAL DO SERVIDOR PÚBLICO MILITAR out by using the MTT colorimetric method and found DO PARÁ that the maximum concentration used (250 µM) did not show cytotoxic effect. For the post-treatment assay, The high-risk HPV types have been associated causally the Vero E6 cells monolayers were infected with CVB5 with cancer of the uterine cervix. During viral replication, suspensions. After 1h, the supernatant was removed the genome remains in the episomal form, however the and the cells monolayers were treated with different viral DNA can integrate into the host genome resulting in a concentration of caulerpin ester derivates (250, 125, deregulation in the transcription, inducing the malignant cellular status. Fragile sites in the HPV E2 gene are well 37ºC. The effect of CED against the CVB5 was evaluated associated to integration and tumorigenesis. The purpose by62,5 replication e 31,25 µM), inhibition, and were which incubated was measured for five by days MTT at of this study is to evaluate the physical condition of the assays. There was a inhibition of 40 and 16% of viral hpv 16 genome, as epissomal or integrated, and relates infection when the infected monolayer was treated with it to possible alterations present in cytological exam. 250 and 125 µM of CED, respectively. The results showed The samples were obtained from a screening program that CED has a potential anti-CVB5 activity. Additional in gynecologic patients attended in basic health unit of studies are under development in our laboratory using Marco district. The analysis of physical condition of the different strategies (pre-treatment, virucidal and time of viral genome was made by PCR to HPV 16 E2 gene in addiction assay) to evaluate if caulerpine ester derivates six different regions covering the segment 2701- 3916nt have more activity in other step of the viral replication and observed in agarose gel 2%. We detect 77 positive cycle. Keywords: antiviral, Coxsackievirus, caulerpin. samples for HPV in the study, where 16 samples were Financial Support: CAPES, FAPEAL, MCT, FINEP, CNPq positive to HPV 16. Integration was observed in 3/16 INCT-INOFAR/CNPq. occurred(18.75%) on and HPV 13/16 16 (81.25%)3345-3568 exhibited nucleotide the episonalregions. Afterprofile. evaluation The disruption of cytology, most allfrequent positive in samples E2 HPV 16for geneHPV
in accordance with other works that integration could be16 presentrevealed despite no significant the cytology changes. is in This normal study conditions. indicates The integration could be used as predictive marker since it is considered a late event in the progression of uterine cervix neoplasia showing the importance of the molecular tools in routine programs. Financial Support:
IEC/SVS/MS.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
177 Human Virology: HV
HV438 - CCR5 GENOTYPES IN HIV-POSITIVE groups of Roraima population. Keywords: CCR5, HIV, PATIENTS IN RORAIMA, BRAZIL Immunogenetic, Rs333, Polymorphism. Financial Corado, A. de L.G.; da Silva, G.A.V.; Leão, R.; Granja, F.; Naveca, F.G. Support:HV439 FIOCRUZ/ILMD. - FIRST AUTOCHTHONOUS CASES OF 1. INSTITUTO LEÔNIDAS E MARIA DEANE CHIKUNGUNYA FEVER IN MANAUS CITY – AMAZON, 2. LACEN BRAZIL 3. UNIVERSIDADE FEDERAL DE RORAIMA do Nascimento, V.A.; Monteiro, D.C. da S.; de Souza, The CCR5 gene is located on the short arm of chromosome V.C.; Corado, A. de .L.G.; Naveca, F.G. three (3p21.31), containing a coding region of 1055 INSTITUTO LEÔNIDAS E MARIA DEANE base pairs. The expression of the wild type gene leads to the formation of a protein that acts as a receptor for The Chikungunya virus (CHIKV) is an Arthropod-borne several chemokines. However, a deletion of 32 base pairs virus transmitted by the bite of infected Aedes aegypti and gives rise to the Rs333 polymorphism, which results in Aedes albopictus female mosquitoes. It is an RNA virus the production of partially functional or non-functional that belongs to the Togaviridae family, genus Alphavirus. receptors. This gene deletion or partial deletion is one of the fundamental immunogenic factors protective Asian and West African. The most common symptoms of Three genotypes have been identified, namely ECSA, against HIV infection. Thus, information regarding the CHIKV infection are high fever and arthralgia. Outbreaks presence of the Rs333 polymorphism is important for caused by CHIKV occurred in countries of Africa, Asia, medical decisions, mainly for HIV patients. Furthermore, immunogenetics studies focusing on the prevalence of Europe and the Indian and Pacific Oceans. However, in CCR5 genotypes in Roraima State, even in healthy people, Americas. In Brazil, between July and August 2014 the late 2013, the virus circulation was first detected in the were not found in the literature. In order to determine the prevalence of Rs333 polymorphism, we designed first imported CHIKV fever cases were recognized and a cross-sectional study with HIV patients living in in September of that year the first autochthonous cases Roraima, which were attended at the Central Laboratory the Amazonas State Health Surveillance Foundation were confirmed in the state of Amapá. On July 15, 2015, and seventeen samples were collected, submitted to no travel history. At the same day, plasma samples of Roraima State (LACEN/RR). A total of one hundred were(FVS/AM) collected reported and sent six CHIKVto Instituto suspected Leônidas cases e Maria with and agarose gel electrophoresis. Three of these samples Deane (ILMD), Fiocruz unit in the Amazonas State, for weregenomic excluded DNA extraction,from the analysis: followed one by because PCR amplification the patient arboviral testing. At the virology lab, samples were was from a foreign nationality, and the other two could tested negative for Dengue virus (DENV) NS1 antigen and further submitted to viral RNA extraction, followed by probe-based Real Time PCR (RT-qPCR) for DENV and not be PCR amplified. Two genotypes were found in our CHIKV detection. The CHIKV RT-qPCR used protocol CCR5delta32cases; 106 (90.6%) was not CCR5/CCR5 found in andthis 11population. (9.4%) CCR5/ The was previously developed at ILMD. Three samples were CCR5delta32. Nevertheless, the genotype CCR5delta32/ positive for CHIKV (Ct values: 23.83; 27.56 and 30.51), was similar to the one found in other studies like in and this result was immediately reported to the health Londrinaprevalence (9.6%) of CCR5delta32/delta32 and in Salvador (8.8%). found inOther this statesstudy authorities, which increased vector control measures at showed a lower prevalence as in Pernambuco (4.0%) and patients’ neighborhood. On July 16, 2015, those three in the state of Pará (2.6%). Roraima is one of the newest samples were further tested by a previously published states of the Brazilian Federation and became one of the RT-qPCR protocol with the same results. Plasma samples principal mining centers in the country during the 70s and 80s, which attracted Brazilians from other regions between 48 to 96h pi, an extensive cytopathic effect was were also inoculated in C6/36 and VERO cells, and raising the population miscegenation rates. Further clearly seen in both cell lines. Cells supernatants were studies are been conducted with healthy individuals to compare rates of the Rs333 polymorphism in booth To identify viral genotype, a fragment of E1 gene was submitted RT-qPCR, which confirmed CHIKV isolation. October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
178 Human Virology: HV
evolution process. The phylograms from the sequences analysis. Genetic results showed that those samples of the individual genes displayed distinct patterns of belongPCR amplified, to the ECSA sequenced genotype. and Moreover, submitted sequences to phylogenetic were evolutionary history among them and also in comparison closely related to previously published samples from to the previous phylogram (8,3 Kb segment of 4 genes). Feira de Santana – BA, differing from those circulating These phylograms presented smaller co-divergence in closest cities like Boa Vista, Roraima. The Amazonas times, less cladogenesis and sequence diversity, and State health authorities are on high alert to prevent a discrepant positions of distinct taxa. Furthermore, at huge CHIKV fever epidemic since the environmental least 3 recombination events among the EBOV strains of conditions in North Brazil are far favorable for arboviral this epidemic were detected and statistically tested with transmission. Keywords: Arbovirus; Chikungunya; the RDP, of which one is presented here. The present Diagnosis; Autochthonous Cases. Financial Support: results show that currently is occurring a greater and
PPSUSHV441 – FAPEAM/DECIT; - PHYLODYNAMICS Fiocruz. AND MOLECULAR thisfaster epidemic. diversification The evolutionof the EBOV process viral cloud,is not with uniform gene HISTORY OF ZAIRE EBOLAVIRUS IN THE ONGOING amongflow including, genes, pointingand does to not a faster subsidize viral evolution the theoretical within WESTERN AFRICA EPIDEMIC speculations about an adaptation process of the viral Pedrosa, P.B.S., Silva, J.R. cloud, for example resulting in reduced virulence rather 1. LEIBNIZ UNIVERSITÄT HANNOVER than greater one. Both phylograms for the genes VP35, 2. CENTRO DE PESQUISA EM VIROLOGIA - USP which encodes one of the greatest viral type I IFN- – FACULDADE DE MEDICINA DE RIBEIRÃO PRETO and molecular decoy against the humoral response as thesignaling sGP isoform) interfering are moleculeof small diversity and GP (pro-inflammatory and cladogenesis. Hemorrhagic fevers are serious public health problems and inherently linked to the threat of pandemics. From the end of 2013 up until now overcame the worst epidemic ever of EHF (in the case, caused by EBOV – Zaire ebolavirus), comprising more than 27,000 cases and over 11,000 casualties (lethality approaching 50%). Little is known about the circulating EBOV generating EHF episodes. The aim of this study was the characterization of the phylodynamics of the epidemic, the potentialconcerning detection data regarding of filoviral to virologymolecular and events immuno- (i. e. pathophysiologyrecombination), andof the the EHF analysis presented of the on significance the epidemic. of This study is based on 124 sequences (genes NP-VP35- VP40-GP segment ~8,3 Kb) from EBOVs of the epidemic and Cuevavirus (Lloviu) as outgroup. The resolution of phylograms was performed using the MrBayes 2.4.5 with the evolution model GTR (general time-reversible). The program RDP 4.3 was employed to validate putative recombination events using a Clustal-Omega alignment not longer than 18,8 years ago, in 3 major distinct clades, withfile. The time EBOV of co-divergence strains within of approximatelythe epidemic co-diverged 11, 17, and 18,7 years. The cladogenesis and diversity of this viral cloud provides indirect evidence for an augmented
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Human Virology: HV IMMUNOBIOLOGICALS IN VIROLOGY - IV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
180 Immunobiologicals in Virology: IV
IV10 - IFN-Α AND CXCL8: INNATE SERUM under treatment, as well as to understand HCV MOLECULES FOR MONITORING CHRONIC HEPATITIS C TREATMENT WITH PEGYLATED IFN-Α2A/2B Financial Support: FAPEMIG ASSOCIATED WITH RIBAVIRIN pathogenesis during PEG-IFN-α2A/2B/RIB treatment. IV38 - IMMUNOGENIC CHARACTERIZATION OF Cardoso,L.M.; Coelho dos Reis, J.G.A.; Menezes, E.G.; RECOMBINANT VP1 PROTEIN OF HEPATITIS A VIRUS Teixeira, R.; Cambraia, R.D.; Martins Filho, O.A. da Silva Junior, H.C.; de Azevedo, M.L.B.; Galler, R.; 1. FIOCRUZ-MINAS Medeiros, M.A. 2. AMBULATÓRIO DE HEPATITES VIRAIS DO INSTITUTO ALFA DE GASTROENTEROLOGIA FUNDAÇÃO OSWALDO CRUZ DO HOSPITAL DAS CLÍNICAS DA UFMG The hepatitis A virus (HAV) is the primary etiologic agent Despite the high prevalence of hepatitis C virus (HCV) of acute viral hepatitis and is estimated to cause tens of infection worldwide, the mechanisms involved in the millions of new infections each year worldwide. Currently, pathophysiology of chronic HCV infection are yet to be there are commercially available vaccines against HAV well established and biomarkers for monitoring disease based on inactivated and attenuated viruses. However, progression are not assertive. Therefore, this study the high cost of production hinders the introduction of aimed at increasing the understanding of the soluble these vaccines into the routine of developing countries. innate immunity factors associated to treatment. The In this context, the use of recombinant proteins of HAV study included 61 patients infected with HCV genotype may represent an alternative model to existing vaccines. 1, which were submitted to antiviral therapy with The aim of this work was to characterize the immune response induced by recombinant VP1 protein (rVP1) in mice. The rVP1 was obtained from Escherichia coli system pegylated IFN-α 2A/2B associate ribavirin (PEG-IFN- and combined with two adjuvants, aluminum hydroxide subdividedα2A/2B/RIB) according between to 2006their therapeutic and 2008, response at Hospital as (Al(OH)3 non-respondersdas Clínicas/UFMG. (NR=6), The HCV-infectedrecidivating (REC=14) patients wereand mice were divided into six groups and immunized with ) and saponin-based adjuvant. Female BALB/c3 sustained virologic response (SVR=24). Cytokines , (ii) 3, (iii) Al(OH)3 the following formulations: (i) 20μg rVP1+Al(OH) chemokines (CCL2, CCL5, CXCL8, CXCL9 e CXCL10) were 2μg rVP1+Al(OH) , (iv) 20μg rVP1+saponin, assessed(IL-1β, IL-4, in serum IL-6, IL-10, samples IL-17, by IFN-α,cytometric IFN-γ, bead TNF) array and isotypes of anti-VP1 IgG antibodies were determined (v) 2μg rVP1+saponin, (vi) saponin. The titers and (CBA). This methods is multiplexed analysis, after a by in-house developed enzyme-linked immunosorbent assay (ELISA). To evaluate cross-reactivity of anti-VP1 are entered prior to acquisition and read by FCAP Array software.flow cytometer The results equipped allowed and for Based the characterization on keywords that of commercial ELISA. The rVP1+Al(OH)3 induced Th2 polarization,antibodies with while HAV, rVP1+saponinsera were analyzed generated by a modified a Th1 before and after treatment. The levels of all cytokines and Th2 balanced immune response. Saponin-based anda panoramic chemokines profile were of statistically serum cytokines higher and in patients chemokines with adjuvant allowed the administration of lower dose of chronic HCV infection as compared to healthy controls, rVP1 without affecting the intensity of the response. demonstrating that there is an overall production of those Preliminary results indicate that anti-VP1 antibodies factors during chronic HCV infection. Before treatment, induced by the formulation containing the saponin- based adjuvant showed cross-reactivity with HAV. These results suggest that rVP1 might be useful to develop IFN-α was increased significantly in NR patients when a new vaccine against hepatitis A. Financial Support: tocompared NR during to SVR treatment. patients. CXCL8 However, was the decreased levels of inIFN-α NR CAPES, Instituto Oswaldo Cruz (FIOCRUZ) and Bio- whenincreased compared significantly to SVR in before SVR patients treatment. when The compared present Manguinhos (FIOCRUZ). responseresults suggest in patients that molecules with chronic such hepatitis as IFN-α Cand infection CXCL8 may be important innate factors to confirm therapeutic October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
181 Immunobiologicals in Virology: IV
IV53 - CELLULAR AND HUMORAL IMMUNE RESPONSE with later phenotypic changes in T-lymphocytes, IN HEALTHY VOLUNTEERS VACCINATED AGAINST particularly in CD4+ T-cells with selective up-regulation INFLUENZA VIRUS (H1N1) IN THE PRESENCE OR of CD28 and CD54 in this subset or CD28 on CD8+ T-cells. ABSENCE OF ADJUVANT Giarola-Silva, S.; Teixeira-Carvalho, A.; Mourão, of activated B cells and low cytokine production. Both In addition, we found significant increase in frequency M.M.; Campi-Azevedo, A.C.; Silva, M.L.; Martins, M.A.; Batista, M.A.; Coelho-Dos-Reis, J.G.; Antonelli, L.R.V.; innate and adaptive immune compartment, which vaccines were accompanied by distinct profiles on Peruhype-Magalhães, V.; Ribeiro, J.G.L.; Elói-Santos, might represent a phenomenon directly related with S.M.; Machado, A.M.V.; Martins-Filho, O.A.; Araújo, M.S.S. However, it is important to emphasize that both vaccines arethe presence/absenceable to activate macrophages, of adjuvant inT theand H1N1 B-cells vaccines. subset CENTRO DE PESQUISAS RENÉ RACHOU and protective against H1N1 virus. Financial Support: FAPEMIG, CAPES, CPqRR. and non adjuvanted vaccines were used in Brazil. However,During the the 2009 immune influenza mechanisms pandemics, triggered both adjuvanted by both IV61 - VIRAL PROTEINS EXPRESSION IN BHK-21 vaccines remained to be deeply assessed. Therefore we CELLS GROWING IN SERUM FREE MEDIA evaluated the kinetics of the innate and adaptive immune Suárez-Patiño, S.F.; Bernardino, T.C.; Pereira, C.A.; response in the peripheral blood of volunteers following Astray, R.M.; Rezende, A.G.; Lemos, M.A.N.; Jorge, S.A.C. Twenty healthy Brazilian volunteers with no history of 1. INSTITUTO BUTANTAN H1N1 vaccination in the presence/absence of adjuvant. previous H1N1 vaccination received the monovalent 2. UNIVERSIDADE DE SAO PAULO H1N1 vaccine in the presence (n=10) or absence (n=10) vaccine is actually based on the viral antigens expression post-immunization. To this aim, several parameters usingThe development molecular ofbiology an efficient technologies and safe recombinantand several wereof adjuvant, used to and characterize were evaluated the innate at 0/1/3/7/30 and adaptive days expression platforms. viral vectors and eukaryotic cells immune responses, including clinical and hematological evaluation, serology, cell immunophenotyping and production of recombinant proteins since they allow a analysis of intracellular and plasma cytokines. Our have been recognized as the most efficient tool for the results showed that all vaccinated volunteers displayed properly fold, and yield native-like post-translational high efficiency and the obtained protein conserve the assessed by hemmaglutination inhibition assay. Only however current biotechnological approaches of cell adjuvantedprotective vaccine levels ofinduced anti-influenza alterations antibodiesin leucogram, as culturemodifications. need to eukaryotic avoid the cellsuse ofare serum cultured due with to the serum, high costs, lot-to-lot variation and risk of contamination with after the immunization. Adjuvanted vaccine promoted viruses, mycoplasmas and prions. thus, our aim was to earlywith changes a significant in phenotypic increase features in granulocytes of monocytes one with day express rabies virus glycoprotein (rvgp) and hepatitis c virus non-structural protein 3 (ns3) in bhk-21 cells in and FcgRI as well as the increase in the percentage of serum free culture based on semliki forest virus system. CCR5increased and frequencyCCR2. Non-adjuvant of pro-inflammatory vaccine induced monocytes a late for this, bhk-21 cells adapted to 5 commercial serum free involvement of monocytes subsets with decrease of media (sfm): vp-sfm, hybridoma-sfm, mab medium and CCR2. Regarding the adaptive immunity, adjuvanted cho-s-sfm ii were infected with recombinant sfv particles carrying rvgp or ns3 genes. samples were analyzed by phenotypic changes in both CD4+ and CD8+ T-cells elisa (rvgp) and sensolyte520® hcv protease assay kit (increasedvaccine sponsored percentage a pro-inflammatoryof CD69,CD25, HLA-DR, profile CD28, with CD54, CCR5,CCR5, CXCR3 and CXCR4) besides increased cultured in different serum free medium while bhk-21 B cell subpopulations. These alterations occur in a (ns3). rvgp expression reached 1 to 2 ug/10^6cells expression in serum free systems showed adequate IL-6. In contrast, non-adjuvant vaccine was associated supplemented with fbs reached 1.5 ug/10^6cells. ns3 Octobermicroenvironment 2015 Volume 20 with – Supplement significant 1 - Abstracts/Posters levels of circulating - Immunobiologicals in Virology: IV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
182 Immunobiologicals in Virology: IV
relation to cells cultured supplemented with serum. our relationship between gene transcription and protein resultsproteolytic demonstrate activity, with that higherrvgp and fluorescence ns3 expression values in expression20 ml of culture was studied medium by measuring in 100 ml gpv shake and flasks. gpvmrna the bhk-21 cells adapted in serum free culture were similar amounts by elisa and rt-qpcr, respectively. results to expression in cells growth in dmem supplemented and discussion: in previous studies we demonstrated the production of high levels of gpv by s2 cells. here INSTITUTO BUTANTAN we show the relationship between the expression with 10% of fbs. Financial Support: FAPESP, CNPq, IV89 - ZOONOTIC VIRUS ANTIGENS EXPRESSED IN expression induction. our data show that the kinetics INSECT CELLS: RABIES, MAYARO AND CHIKUNGUNYA profile and the amount of transcripts generated after Puglia, A.L.P.; Jorge, S.A.C.; Wagner, R.; Pereira, C.A.; Astray, R.M. canof heterologous be a valuable gene and transcription/metabolization,helpful approach in optimizing as measured by the specific mrna evaluation by rt-qpcr, 1. INSTITUTO BUTANTAN bioprocesses. similarly to the study accomplished with 2. INSTITUT DE RECHERCHE DE L’ECOLE DE gpv expression, mayv and chikv antigens are being BIOTECHNOLOGIE DE STRASBOURG produced in s2 cells, following optimized protocols. Many zoonotic viruses circulate in brazil, as rabies virus (rv), chikungunya (chikv) and mayaro (mayv). rabies is FinancialIV133 - Support: SAPONIN CAPES/ FRACTION FAPESP/ QB90 CNPq. OF QUILLAJA virtually impossible to eradicate due to the persistence BRASILIENSIS INDUCES ROBUST HUMORAL AND in wild animals. it still requires constant vigilance and CELLULAR IMMUNITY IN A BOVINE VIRAL DIARRHEA new prevention tools. the autochthonous transmission VIRUS VACCINE MODEL of chikungunya virus (chikv) was recently reported in Cibulski, S.P.; Silveira, F.; Mourglia-Ettlin, G.; Teixeira, brazil. the vectors, aedes spp mosquitoes, are widely T.F.; dos Santos, H.F.; Yendo, A.C.; de Costa, F.; Fett- distributed through the country, what can result in a Neto, A.; Gosmann, G.; Roehe, P.M. serious chikv outbreak in the next years. besides that, in the rainforest regions circulates the mayaro virus 1. UNIVERSIDADE FEDERAL DO RIO GRANDE (mayv) another alphavirus of medical concern. there DO SUL is a real possibility for the urbanization of this virus 2. INSTITUTO DE PESQUISAS VETERINÁRIAS through its transmission by aedes spp vector, as already DESIDÉRIO FINAMOR 3. UNIVERSIDAD DE LA REPÚBLICA demonstrated in laboratory. strategies for the control and prevention of mayv and chikv infections are evidently Infectious diseases remain as major causes of morbidity needed. the development of vaccine platforms using and mortality worldwide, especially in poor and insect cells is one of the most promising approaches developing countries. Many vaccines require adjuvants for producing important antigens. d. melanogaster in order to potentiate immune responses. Triterpenoid saponins extracted from Quillaja saponaria Molina have eukaryotic expression system for the expression of a long history of usage as vaccine adjuvants. A similar severalschneider viral 2 (s2)antigens. cells objectives: have been the used aim as of an this efficient study saponin fraction has been extracted from Quillaja is to establish recombinant s2 cells expressing the brasiliensis leaves, named QB90, which was found with main antigens of those viruses. the work presented potential adjuvant to levels comparable to that of Quil will focus on the studies for rabies glycoprotein (gpv) A®; in addition, QB-90 was less toxic than Quil A®. The analysis of expression. methods: important antigens aim of this study was evaluate the adjuvant potential of of the three viruses were cloned in s2 plasmid vectors QB90 in a bovine viral diarrhea virus (BVDV) vaccine under the control of d. melanogaster promoters. stable model in mice. The animals were immunized twice recombinant s2 cells were cotransfected with expression (day 0 and day 14) either with BVDV antigen plus vectors as pmtgpvhis along with hygromycin resistence QB90 (100 µg) or with unadjuvanted antigen. Humoral vector. recombinant cells were cultured in suspension and cellular immunity were evaluated two weeks after boosting. Antibodies were measured by indirect ELISA forOctober 48 or2015 72 Volume h with 20 an– Supplement inoculum 1 of- Abstracts/Posters 5 x 105 cells/ml - Immunobiologicals in in Virology: IV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
183 Immunobiologicals in Virology: IV and cellular immunity by delayed type hypersensitivity (DTH), lymphoproliferation, cytokine release and single by lymphoproliferation assays. Intranasally delivered IQB90reactions elicited and significant serum IgG T celland responses IgG1, and as mucosal determined IgA responses at nasal passages and at distal systemic thecell QB90-adjuvanted IFN-γ production. vaccine. Serum levelsA robust of anti-BVDVDTH response IgG, sites such as the, large intestine and vaginal lumen. wasIgG1 observed and also in IgG2b mice wereimmunized significantly with QB90, increased as well in These results suggest that ISCOMs formulated with the as increased splenocyte proliferation and high levels of QB90 fraction of Quillaja brasiliensis may be a suitable Th1-type cytokines. The QB90 adjuvanted vaccine was alternative adjuvant for vaccines. Financial Support: and CD8-T lymphocytes. These results above results demonstratealso shown to that induce the theBVDV production antigen offormulated IFN-γ by CD4-with CNPq,IV263 FINEP - and CAPES/UDELAR. CARAJAS VIRUS INDUCES QB90 as adjuvant elicits robust cellular and humoral NEUROINFLAMMATION ON ADULT BALB/C MICE immune responses in mice. Financial Support: CNPq, Cavalcante, M.S.B.; Diniz, J.A.P.; Rodrigues, A.P.D.; Santos, D.S.; Araújo, L.M. 1. UNIVERSIDADE ESTADUAL DO PARÁ FINEPIV134 and - IMMUNE CAPES/UDELAR. STIMULATING COMPLEXES FROM 2. INSTITUTO EVANDRO CHAGAS Quillaja brasiliensis SAPONINS: AN ALTERNATIVE ADJUVANT FOR VACCINES In viral infections, the host innate immune response Cibulski, S.P.; Mourglia-Ettlin, G.; Teixeira, T.F.; is established through the production of cytokines, Quirici, L.; Gosmann, G.; Roehe, P.M.; Ferreira, F.; aiming to avoid viral replication and the elimination Silveira, F. the central nervous system are: activation of glial cells, 1. UNIVERSIDADE FEDERAL DO RIO GRANDE peripheralof the invasive immune agent. system Clear recruitment, signs of inflammation including the on DO SUL 2. INSTITUTO DE PESQUISAS VETERINÁRIAS infecting viral agents have been useful models to the DESIDÉRIO FINAMOR studyproduction of encephalitis of pro inflammatory by allowing the mediators. examination Rodent of 3. UNIVERSIDAD DE LA REPúBLICA In the last decades, a great deal of research effort process of the brain. Carajas virus, a rhabdovirus of the has been dedicated to the search for novel vaccine Vesiculovirusseveral mechanisms genus, and was regulations isolated fromof the phlebotomiesinflammatory adjuvants. Saponins and its formulations as immune (Lutzomya spp) collected in Serra Norte, in Carajás region stimulating complexes (ISCOMs) have shown to be of the Pará state. Although it has been isolated for over two capable of inducing potent humoral and cellular immune decades, little is known about the pathogenic potential responses, enhanced cytokine production and activation to human and animal health, as well as concerning adult mice pathogenesis. OBJECTIVE: The objective of the immunological activity of ISCOMs formulated with this study was to evaluate the immune response of the of cytotoxic T cells. Here, we report for the first time a saponin fraction extracted from Quillaja brasiliensis central nervous system of Carajas infected mice, from (QB90 fraction) as an alternative to classical ISCOMs cytokine production. MATERIAL AND METHODS: Eight based on Quil A® (IQA). The QB90 ISCOMs (IQB90) was prepared by injection of ethanol-dissolved cholesterol a control group and an infected group. The animals were and phospholipids into an aqueous solution of QB90 inoculatedweeks old adultintranasally BALB/C micewith werehomogenized used and dividednewborn in and antigen (ovalbumin). The IQB90 so prepared typically consisted of 40-50 nm, spherical, cage-like usinginfected the brains.Cytometric The Bead quantification Array (CBA) of kit cytokines following wasthe in vitro by murine bone marrow-derived dendritic cells. manufacturer’sperformed in ainstructions. flow cytometer The results (BD FACS were Canto analyzed II), particles. These nanoparticles were efficiently uptaken In mice, subcutaneously inoculated IQB90 induced by GraphPad Prism 5 Software, using the ANOVA One- way test, Bonferroni multiple comparison posttest with responses, robust delayed type hypersensitivity (DTH) P<0,05. RESULTS: It was observed that Carajas virus strong specific serum IgG, IgG1 and IgG2a antibody October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
184 Immunobiologicals in Virology: IV
of moisture. It is highlighted that all samples showed up animalscaused an between inflammatory the 15 processth and 16 inth thepost central infection nervous day. withinalso verified the limits the influenceestablished of byflask the size Brazilian on the legislation variation system in BALB/C mice, leading to death 60% of the (5%). Financial Support: Lanagro-SP (MAPA) and Immunobiologicals and Biopharmaceutical Laboratory controlThere was group a significant 10 days spikepost ofinoculation. the cytokines CONCLUSION: IL-6, IL-10, (FCF – USP). FromIFN-γ, discovered TNF, IL-12P70 data, and it is MCP-1 possible in tocomparison assert that with Carajas the IV365 - EVALUATION OF SEROCONVERSION INDUCED nervous system of adult mice after intranasal inoculation. BY AN IMMUNE COMPLEX VACCINE OF INFECTIOUS Financialvirus induces Support: an inflammatory INSTITUTO EVANDRO response CHAGAS.on the central BURSAL DISEASE FOR EXTENSION OF SHELF LIFE Orsi, M.A.; Benites, C.I.; Lima, T.S.; Leal, F.S.; Fortunato, IV309 - DETECTION OF RESIDUAL MOISTURE IN E.C.; Ashimine, R.; Zaroni, M.M.H.; Rodrigues, R.L.; AVIAN VIRAL LYOPHILIZED VACCINES SUBMITTED Pinto, L.A.; Perussi, A.P.; Reischak, D. TO OFFICIAL QUALITY CONTROL 1. NATIONAL AGRICULTURAL LABORATORY Orsi, M.A.; Benites, C.I.; Leal, F.S.; Lima, T.S.; Bexiga, 2. MINISTRY OF AGRICULTURE, LIVESTOCK N.M.; Saldaña Gonzales, R.; Stephano, M.A. AND FOOD SUPPLY 1. NATIONAL AGRICULTURAL LABORATORY, The Infectious Bursal Disease (IBD) is one of the MINISTRY OF AGRICULTURE, LIVESTOCK most common diseases of poultry worldwide and AND FOOD SUPPLY it is an important cause of immunosuppression or 2. SCHOOL OF PHARMACEUTICAL SCIENCE, immunodepression in chickens. Prophylaxis of many SÃO PAULO UNIVERSITY avian diseases is based primarily on active immunization Newcastle disease (ND) is an infectious bursal (IBD) through the use of live vaccines. The emergence of highly and bronchitis (IB) disease whose prophylaxy is mainly virulent IBDV requires the development of IBD vaccines realized with avian alive lyophilized vaccines. The Avian capable of working in the presence of relatively high Health Unit at LANAGRO-SP is responsible for the avian levels of maternal antibodies. In order to overcome this vaccines’quality control. The residual moisture is an problem, a vaccine which combines an intermediate plus important physicochemical analysis because it measures IBD vaccine virus strain complexed with serum against the virus was developed. In quality control, vaccine product stability and indirectly evaluation quality for a effectiveness can be assessed by serological tests, period.water content The aim inof this the paper final productwas determine leading the to moisture a direct among which seroconversion stands as one of the most important techniques. Seroconversion is performed batches were analyzed containing 100 to 5000 doses of the viral vaccines submitted to official control. 43 present in the serum after immunization, thus indirectly indicatingto check thevaccine. production The Avian of Health virus specificUnit of Lanagro-SP antibodies (tablets and 2-10 mL flasks), according: 9 ND batches (5 is responsible for the quality control of commercially Lukert,labs – LaSota, Tabic MB, B1, 2512VH, CL/79 and LIBDV and VG-GA strains); strains); 11 IB batches 13 IBD available avian vaccines in Brazil. This study aimed to (5batches labs - (7H120 labs and - GBV-8, B-48 Winterfield,stains); 6 Combined GM97, V877, batches 228E, (2 determine the production of antibodies against IBD in labs - Massachussets+LaSota and H120+LaSota strains); serum samples obtained from poultry experimentally 4 Complexed from 1 lab (antibody+ antigen).The residual infected with an immune complex vaccine to verify the moisture were determinated in the sample bottles possibility of shelf life extension from 18 to 24 months. (triplicate) by Moisture Analyzer Computrac® Vapor Three batches of vaccine (up to 6 months after expiration Pro RX (Arizona Instrument) at constant temperature date) were tested three times in independent runs. For of 100°C and 30 sec to bottle purge with nitrogen. The each batch, 10 SPF day-old birds were subcutaneously results ranged from 0.84 to 1.91% for ND vaccines, 0.53 vaccinated and kept in BSL-3 isolator. For each run, to 3.24% for IBD, from 0.41 to 1.30 for IB, 0.45 to 1.89 one BSL-3 isolator with unvaccinated birds (SPF) was for Combined and 0.59 to 0.77% for Complexed. It was kept as negative control. Indirect ELISA method (IBD
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
185 Immunobiologicals in Virology: IV commercial kit) was used for the detection of anti-IBD containing the pseudoparticles were harvested 48 h later antibodies after 21 days (p.i). In ELISA test for IBD, there are differences between positive and negative sera 7.0, BHK-21 and Hek-293T cells were seeded in 6-well for 84 vaccinated and for the 71 unvaccinated birds, platesand the and supernatants we used different were quantified ratios pps:cell by qRT-PCR. (10 and Huh 50) respectively. In addition, when comparing the results to available the entry of ppHCV-RVGP in different time of sera from vaccinated and unvaccinated birds by post infection. The proteins Gag of MLV and E1E2 of HCV were detected by western blotting in the ppHCV and cell extract. Results and Conclusion: We observed that negativeELISAi IgG/IgM predictive the valuesvalue. wereThis pointshigh (100%): to the accuracy,fact that vaccinatedsensitivity, birds’ specificity, sera showed positive positive predictive results value in andthe RVGP on supernatant is very similar among them, about ELISA test, while unvaccinated birds sera (negative 10independent4 of cell line the quantification of ppHCV- control) tested negative for IBD. Our results indicate that RVGP was not able to adhere and entry in the different immune complex vaccine was effective to induce the cell copiesline. The RNA-RVGP/µL. western blotting This detected showed theus thatpresence ppHCV- of production of protective antibodies in vaccinated birds Gag and E1 proteins both supernatant as cell extract. for IBD through a single inoculation, suggesting that While E2 protein was detected in the cell extract, this shelf life could be extended from 18 to 24 months (two suggests that E2 isn’t incorporated to ppHCV. Thus, we years). Financial Support: LANAGRO-SP, MAPA.
IV388 - STUDY OF MECHANISM OF PSEUDOPARTICLES line.deduced Financial that less Support: efficiency FAPESP; in RVGP CNPq. protein expression ENTRY IN DIFFERENT CELL LINES occurs by difficulty of ppHCV-RVGP entry in the cells Bernardino, T.C.; Suarez, S.F.P.; Pereira, C.A.; Astray, R.M.; Coroadinha, A.S.; Soares, H.; Jorge, S.A.C. 1. INSTITUTO BUTANTAN 2. INSTITUTO DE BIOLOGIA EXPERIMENTAL E TECNOLÓOGICA Rabies is an ancient zoonotic disease and today still causes more than 60,000 human deaths around the globe each year. The causative agent belongs to the genus Lyssavirus, family Rhabdoviridae, its genome is a single-strand, negative sense RNA and encodes for protein, RNA polymerase and glycoprotein (RVGP). The RVGPfive proteins: is only protein nucleoprotein, exposed in phosphoprotein, surface of viral particle matrix and it’s mediator in adhesion and to entry in the host cell and it able to conferring protective immunity against rabies. The expression of capsid proteins Gag and Pol of Murine leukemia virus (MLV) is able to generate the virus pseudoparticles, thus a variety of proteins has been incorporated with success in the pps, like the membrane proteins E1 and E2 of Hepatitis C virus (HCV). Objective: The aims this study is available the mechanism of pseudoparticles and detection of structural proteins that form of ppHCV. Methods: To generate ppHCV-RVGP, 293T cells were transfected with expression vectors encoding and pCMVRVGP) using lipofectamine. Supernatants the viral components (pCMVGag/Pol, pCMVE1E2 October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Immunobiologicals in Virology: IV PLANT AND INVERTEBRATE VIROLOGY - PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
187 Plant and Invertebrate Virology: PIV
PIV14 - FIRST REPORT OF GRAPEVINE REOVIRUS component 4. The resulting 386 bp amplicon was cloned INFECTING CABERNET SAUVIGNON GRAPEVINE IN and sequenced (accession no. KR074408) and found to BRAZIL share 98% nucleotide identity with component 4 of the Fajardo, T.V.M.; Al Rwahnih, M.; Nagata, T.; Melo, F.L. GCSV isolate from Brazil (KR107530). To our knowledge Brazil is the second country, after the U.S.A., where GCSV 1. EMBRAPA UVA E VINHO has been reported in grapevine. Further RT-PCR analyses 2. UNIVERSITY OF CALIFORNIA have been undertaken to better establish the prevalence 3. UNIVERSIDADE DE BRASÍLIA of GCSV and to evaluate its potential effects on grape Grapevine Cabernet Sauvignon reovirus (GCSV) was yield and on wine quality. Financial Support: EMBRAPA (Project 02.13.14.002). in California by deep sequencing analysis in 2015 (Alfirst Rwahnih described et onal., grapevine2015). Subsequently, cv. Cabernet a SauvignonBrazilian PIV19 - EVALUATION OF THE USE OF YELLOW STICHY GCSV isolate was discovered as a member of a mixed TRAPS IN MONITORING VIRULIFEROUS WHITEFLIES viral infection. The infection was in a Vitis vinifera TO BEGOMOVIRUS Souza, T.A.; Hallwas, M.; Inoue-Nagata, A.K.; Filho, in the municipality of Bento Gonçalves, State of Rio M.M. Grandecv. Cabernet do Sul, Sauvignon Brazil. The vine symptoms in an experimental in this host were field 1. UNIVERSIDADE DE BRASÍLIA those of severe grapevine leafroll disease. The Brazilian 2. EMBRAPA HORTALIÇAS GCSV isolate was characterized from a total nucleic acid extract of 30g of bark scrapings that had been Viruses of the genus Begomovirus (Family Geminiviridae) enriched for double-stranded RNA. Sequencing data represent a large group of plant viruses that cause were generated from a complementary DNA library that considerable losses to agriculture worldwide. The was constructed by Macrogen Inc. (Seoul, Korea) from natural spread of begomoviruses is based exclusively that extract. The Illumina HiSeq 2000 platform was used to generate about 20 million reads. CLC Genomics Bemisia tabaci (Hemiptera: Aleyrodidae) species on their transmission by whiteflies, belonging to the Workbench software (CLC Bio, Qiagen, USA) was used complex. It is essential that epidemiological studies on for quality trimming and de novo contig assembly begomovirus diseases are carried out considering the from the reads. All contigs were analyzed using NCBI insect vector monitoring. The most used strategy for BLASTX program against the viral RefSeq database. About 0.8% (166,800) of the reads, assembled into ofwhitefly time. These monitoring trapped is theinsects use ofare traps therefore (yellow prone sticky to cards) exposed to field conditions for a specific period twenty five contigs with lengths from 289 to 3849 bp, temperature and water. As currently it is not known if degradation caused by the influence of light, wind, ofwere the identified sequences as from homologous the ten togenomic GCSV. The components sequence the use of these insects is adequate for virus detection (accessioninformation numbers in those KM236567contigs was and sufficient KM378720 to cover through 96% purposes, the objetive of this study was to develop a KM378728) reported by Al Rwahnih et al. (2015). The protocol for begomovirus detection in card trapped nucleotide sequence identities of the Brazilian sequences insects. Three DNA extraction methods were tested, as compared with those of the Californian isolate ranged from 94-98%. The genomic sequences for the Brazilian in the card for a reliable virus detection. Virus-free well as the length of time that the whitefly can be left strain of GCSV have been deposited in the GenBank under accession numbers KR107527 through KR107536. To tomato leaf for 48 hours. After the feeding period, the whiteflies were allowed to feed on a begomovirus infected from fresh plant material from the original source and card (BioControle) and exposed to the sun in a glass confirm the NGS identification, dsRNA was extracted cageviruliferous for one whitefliesto seven days, were in adhered two repetitions. in a yellow For sticky DNA pair Ctg468F (5’ACGTTGGATCAACTAGCCGAAG3’) and extraction, the following methods were compared on Ctg468Rwas analyzed (5’TATTCACGAGGCTCAGACGACT3’). by RT-PCR using the specific PCR Primers primer had been designed from the sequence of viral genomic their efficiency, cost and processing time: Proteinase-K, October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant andCTAB Invertebrate and Virology: CHELEX PIV DNA was extracted from whiteflies XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
188 Plant and Invertebrate Virology: PIV removed from the cards after 1,2,3,4,5,6 and 7 days of tests. Sixty days after grafting, one leaf of each grafted exposure. The DNA quality was tested by PCR using and RNA extracted using Trizol reagent according to It was concluded that the Proteinase-K method was theplant manufacturer`s was collected, viralinstructions. particles The were nucleic semi-purified acids universal primers for begomoviruses and for whiteflies. were sequenced by Illumina plaform. As a result, it was When evaluating the incubation time in the traps, in a possible to assemble 1.249 contigs where the largest, one-daythe best exposure, method for the DNA virus extraction was detected for the in whiteflies.93.3% of with 10.517 nucleotides, showed 99% coverage and 99% identity with Sweet potato virus G - SPVG (genera and 4-day exposure, in a 5-day exposure, 33.3 for 6-days Potyvirus, family Potyviridae) when compared to andwhiteflies, 20% for 86.6% 7-days. in aThe 2-day decrease exposure, in the 80.0% virus in detection a 3-day sequences from GenBank. It was also possible to detect upon longer incubation times is possibly related to the SPCSV to two contigs of 8.475 nucleotides (with the desiccation of the insects in prolonged exposure 91% coverage and 91% identity to RNA-1) and 7.534 to the sun, thus causing degradation of the virus DNA. nucleotides (86% coverage and 86% identity to RNA the yellow sticky cards, and the exposure time of the with 2.668 nucleotides with 95% coverage and 95% trapsMonitoring must be of planned viruliferous taking whiteflies into consideration can be done the usingvirus identity2), respectively. when compared And finally, to GenBankone contig sequences. related to Further SPFMV degradation in the trapped insects. Financial Support: to detect the viruses in each plant separately. Financial Tecnológico – CNPq e Fundação de Apoio a Pesquisa do Support:research CAPES.will focus on the designing of specific primers DistritoConselho Federal Nacional – FAP-DF. de Desenvolvimento Científico e PIV30 - INTERCEPTION OF WHEAT MOSAIC VIRUS PIV25 - VIRAL METAGENOMIC ANALYSIS OF SWEET (WMOV) IN MAIZE SEEDS FROM USA POTATO GENOTYPES Fernandes, F.R.; Botelho, S.R.A.; Duarte, M.F.; Barbosa, Souza, C.A.; Bezerra, B.M.; Calaça, M.M.; Orílio, A.; A.V.; Lau, D.; Sanches, M.M. Blawid, R.; Resende, R.O.; Ribeiro, S.G.; Melo, F.L.; 1. EMBRAPA QUARENTENA VEGETAL Pereira-Carvalho, R.C. 2. EMBRAPA RECURSOS GENÉTICOS E 1. UNIVERSIDADE DE BRASÍLIA BIOTECNOLOGIA 2. EMBRAPA RECURSOS GENÉTICOS E 3. FACULDADE ANHANGUERA BIOTECNOLOGIA 4. EMBRAPA TRIGO The sweet potato (Ipomoea batatas L.) presents (Triticum aestivum) and maize (Zea mays) crops in most consumed food in the world. In Brazil, sweet potato NebraskaHigh Plains and disease other (HPD)High Plains was first States described in United in wheatStates issignificant the most globalrelevant importance crop in the being Northeast, currently which the is sixth one since 1993. The causal agent is a negative sense RNA virus of the most appreciated vegetables by the population. in the genus Emaravirus, referred to as High Plains virus This culture can be affected by several pathogens. (HPV), or Wheat mosaic virus (WMoV). The virus has Among these, viruses are considered the main problem since been found in Israel, Chile, Argentina, Australia and reducing drastically crop yield due to the vegetative has a host range that includes economically important propagation of sweet potatoes. The co-infection of sweet plants such as wheat, maize, barley (Hordeum vulgare), potato by Sweet potato feathery mottle virus – SPFMV oat (Avena sativa), rye (Secale cereale) and some weeds. (genera Potyvirus, family Potyviridae) and Sweet potato HPD symptoms and severity vary considerably from mild chlorotic stunt virus – SPCSV (genera Crinivirus, family Closteroviridae) cause the devastating disease known as The virus is transmitted by the eriophyd wheat curl mite sweet potato virus disease. In order to check the viral Aceriato severe tosichella and include which mosaic, is also thechlorosis vector and/or of Wheat necrosis. streak diversity in sweet potato samples from producing areas mosaic virus (WSMV), often found in mixed infections of the Northeast, branches of 40 plants were grafted on with WMoV. There is no report of WMoV in Brazil until Ipomoea setosa, widely used in sweet potato indexing the moment and the recent detection of the pathosystem
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
189 Plant and Invertebrate Virology: PIV
Aceria tosichella BRMV isolate was obtained from plants of common bean represented by WMoV introduction. Two accessions of cultivar ‘Pérola’. The plants showed typical symptoms maize seeds from/WSMV USA being in country introduced has alerted to Brazil the threat were of viral infection: severe mosaic, leaf deformation subjected to phytosanitary analysis. About two and three and blistering. After analysis of the material through weeks after sowing, symptomatic leaves were tested at transmission electron microscopy, typical crystalline the Plant Quarantine Laboratory of EMBRAPA Genetic inclusions of comovirus were observed. Because this Resources and Biotechnology. Symptomatic samples cultivar is resistant to the Bean common mosaic virus, tested WMoV positive by enzyme-linked immunosorbent it was possible to rule out a double infection with this two viruses. The isolate was maintained and propagated PCR and sequencing. The WMoV-positive plants were in bean plants of the same cultivar and also stored in a chlorotic,assay (ELISA) with and varying were degrees confirmed of byleaf quantitative striping. The RT- -80 C freezer to preserve the original material. For the selection of resistant material, 132 accessions were sown in 2.5 kg pots with three pots per accession and presence of WMoV was confirmed as revealed by the three plants per pot, with one pot as a negative control. PCRexpected products fragment revealed amplified that the using WMoV the isolates HPVFW414/ had a After germination, inoculation was carried out on young 99HPVREV565 to 100% primernucleotide pair. Sequenceidentity with analysis WMoV of amplified isolates seedlings showing partially expanded primary leaves, from Australia and USA. To our knowledge, this is the using as source of inoculum leaves of symptomatic plants macerated in potassium phosphate buffer 0.1M, pH 7.2 The expanding distribution of this emerging virus is amended with carborundum 600 mesh. From the 147 first confirmed report of WMoV interception in Brazil. inoculated accessions, 144 showed typical symptoms of severe economic impact on two major crops - wheat and susceptibility according to the adopted disease scale. The corn.significant Financial because Support: of its EMBRAPA. potential to cause additional access BGF750 had a severe hypersensitivity response showing necrosis on petioles and subsequent plant PIV35 - IDENTIFICATION OF RESISTANCE TO Bean death. The access IPA 5047 displayed local chlorotic and Rugose Mosaic Virus (BRMV) IN ACCESSES OF COMMON BEAN GERMPLASM vein necrosis followed by plant death. All three accesses Cândida, D.V.; Faria. J.C.; Dianese, E.C. mayvery bedefined regarded necrotic as potential lesions. sourcesThe access of resistance Rico 23 showed genes 1. UNIVERSIDADE FEDERAL DE GOIÁS to BRMV on bean. Keywords: comovirus, mosaico-em- 2. EMPRESA BRASILEIRA DE PESQUISAS desenho, hypersensivity response, Phaseolus vulgaris. AGROPECUÁRIA Financial Support: CAPES. The disease known as bean rugose mosaic, also known PIV41 - PHYLOGENETIC ANALYSIS OF BRAZILIAN Bean rugose mosaic Chrysanthemum stunt viroid ISOLATES REVEALS virus (BRMV), has been recently observed in common HIGH VARIABILITY AND SUGGESTS DIFFERENT as “mosaico-em-desenho” caused by bean (Phaseolus vulgaris INTRODUCTIONS and Beans, located in Santo Antonio de Goias, Goias Gobatto, D.; Daròs, J.A.; Harakava, R.; Eiras, M. State, Brazil. The importance L.) fieldsof this atdisease EMBRAPA increases Rice especially in conditions that enable infection of young 1. INSTITUTO BIOLÓGICO plants, when there is the presence of other viruses and 2. INSTITUTO DE BIOLOGÍA MOLECULAR Y under sequential cultivation of susceptible common CELULAR DE PLANTAS bean varieties. Currently, there is limited molecular Chrysanthemum (Dendranthema spp.) is one of the most characterization of BRMV with the consequently lack of information on its genetic diversity, and control moving billions of dollars yearly in several countries, measures using germplasm resistance. Thus, the includingpopular flowers Brazil. producedMore than and 70% marketed of the worldwide, Brazilian objective of this work was the analysis of common bean production are concentrated in the State of São Paulo. accesses from the germplasm bank with the potential Chrysanthemum stunt viroid (CSVd), genus Pospiviroid, to be used as sources of resistance to BRMV. In 2013 a is currently considered the most important pathogen
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
190 Plant and Invertebrate Virology: PIV in the chrysanthemum-producing industry. CSVd germplasm from other countries. Financial Support: situations, the plants are symptomless, facilitating incites colour-break and retards flowering, but in many CNPqPIV44 (Processo: - MORPHOLOGICAL 471796/2011-5). ANALYSIS OF BM-5 CELL chrysanthemum varies and depends on the genetic LINE AFTER TRANSFECTION WITH TWO ISOLATES backgroundits spread in of thethe host field. and The growth severity conditions. of symptoms In order in OF BOMBYX MORI NUCLEOPOLYHEDROVIRUS FROM to assess the genetic variability of Brazilian CSVd isolates, CUBA samples were collected in the main chrysanthemum Sanches, M.M.; Sihler, W.; Barros, A.M.R.; Martinez- producing regions of the state of São Paulo, in the Zubiaur, Y.; Souza, M.L. municipalities of Atibaia, Artur Nogueira and Holambra. 1. EMBRAPA RECURSOS GENETICOS E Leaves were ground in liquid nitrogen and homogenized BIOTECNOLOGIA in the presence of a mixture of water-saturated phenol 2. CENTRO NACIONAL DE SANIDAD and extraction buffer (125 mM Tris-HCl, pH 9.0, 0.75% AGROPECUARIA SDS, 15 mM EDTA, 100 mM 2-mercaptoethanol). Total The Baculoviruses are pathogens that infect arthropods. RNA was fraccionated by chromatography on non- Their genome has double-strand DNA and they ionic cellulose CF11, following alcohol precipitation are members of the Baculoviridae family, genus Alphabaculovirus. Colonies of Bombyx mori maintained in subjected to RT-PCR with primers designed for CSVd and resuspended in sterile water. Purified RNAs were Cuba presented symptoms of midgut exudation, change of color, reduction of mobility, necrosis and death. Initial products (~354 base pairs) were eluted from agarose gel full-length genome amplification. The amplified DNA analysis of the infected larvae showed the presence of and sequenced directly. The sequences were aligned with polyhedra. The patterns of DNA digested with restriction the Clustal W software, and compared with CSVd isolates enzymes were similar to those described for Bombyx from other countries, deposited at the National Center mori nucleopolyhedrovirus (BmNPV). The objective for Biotechnology Information. Phylogenetic analysis was of this work was to transfect the DNA of two BmNPV carried out based on multiple sequence alignment using isolates from Cuba, in order to study their production in MEGA (version 5.2) software with Neighbor Joining cell culture. The isolates, one from a colony with larvae method. CSVd sequence variants formed four groups originated from Colombia and another isolate from in the phylogenetic tree, with the Brazilian variants a colony with larvae originated from Thailand were being distributed in three of these groups. One of the tested. The cell line BM-5 was transfected with the DNA variants obtained from the chrysanthemum variety from these isolates using Cellfectin reagent (Invitrogen). ‘Zembla’, from Artur Nogueira, belongs to the group I, Initially, cells were seeded at a density of 8x105 per and shared a clade with variants from China, Austria, the 60mm2 with unsupplemented TNMFH Medium. The Netherlands, Japan, Hungary, Belgium, England, Canada Cellfectin reagent (30µl) and BmNPV DNA (1µg) were and France. In the second group, two Brazilian variants individually diluted with 1,5 mL TNMFH Medium with no obtained from the variety ‘Puritan’, from Holambra and Artur Nogueira, clustered with variants from Germany, minutes at room temperature, the mixture was added to USA, Italy and South Korea. In the third group there serum, and then combined. After the incubation for five are four Brazilian CSVd variants, one originated from hours and then the transfection mixture was replaced Atibaia, of the ‘Pellee’ variety, which shares a clade withthe cells. 3 mL The TNMFH plates completewere incubated medium. at 27°CAlso, duringDNA from five with isolated variant from United States, Australia Autographa californica multiple nucleopolyhedrovirus and Japan, while the other three variants of varieties (AcMNPV) and DNA from Anticarsia gemmatalis multiple ‘Sandra’, ‘Puritan’ and ‘Pellee’ from Artur Nogueira and nucleopolyhedrovirus (AgMNPV)-isolate 2D were Holambra, share a clade with a Japanese variant. These transfected in BM-5 cells as controls. Morphological alterations were monitored by light microscopy during origin of the Brazilian CSVd isolates seem to be related findings suggest that this genetic variability and the with different introductions of imported contaminated cytopathic effects such as nuclear hypertrophy and five days. Cells infected with BmNPV presented typical October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
191 Plant and Invertebrate Virology: PIV occlusion bodies formation. Polyhedra production was observed after 72 h p.i in both BmNPV and AcMNPV fragments of 1300bp, 1100bp (double band) and 400bp, infected cells. As expected no polyhedra was observed whichrestriction resembles profiles werethose similar of bipartite in all samples, begomoviruses. with MspI in cells infected with AgMNPV-2D, and the majority of the cells appear to be completely lysed due to apoptosis, a primer directed to the coat protein region in the as already described for this virus-cell interaction. The DNA-ADirect sequencinggenome, indicated of the the RCA-amplified presence of DNA, an isolate using ultrastructure of the two virus isolates visualized by of Euphorbia yellow mosaic virus. In conclusion, the presence of a begomovirus was consistently observed are single nucleopolyhedrovirus. Financial Support: in plants with severe symptoms, possibly a mechanically FAP-DF.Transmission Electron Microscopy confirmed that they non-transmissible begomovirus. Characterization of this
PIV45 - A BEGOMOVIRUS IS A PUTATIVE CAUSAL disease. Financial Support: CNPq. AGENT OF INTERNERVAL CHLOROSIS AND CURLING virus is being carried out to confirm the etiology of this IN SOYBEAN LEAVES PIV46 - METAGENOMIC ANALYSIS OF VIRAL SPECIES Tavares, M.L.; Nakasu, E.Y.T.; Inoue-Nagata, A.K. IN NATIVE PLANTS FROM THE CERRADO BIOME Santos, F.M.B.; Brant, P.M.; Blawid, R.; Melo, F.L.; 1. UNIVERSIDADE DE BRASILIA 2. CENTRO NACIONAL DE PESQUISA EM Orílio, A.; Resende, R.O.; Lima, M.; Ribeiro S.; Pereira- HORTALIÇAS Carvalho, R.C. Brazil is the world’s largest soybean exporter, with 1. UNIVERSIDADE DE BRASILIA a cultivated area of about 30 million hectares. 2. EMBRAPA HORTALIÇAS 3. EMBRAPA RECURSOS GENÉTICOS E that cause a great impact in several economically BIOTECNOLOGIA importantBegomoviruses crops, are such whitefly-transmitted as tomatoes, cotton, geminiviruses cassava and The Brazilian Cerrado is the second largest biome beans. Although they are not economically important in Brazil with a major diversity of native trees and in soybean, four begomovirus species were reported shrubs, natural reservoirs of pathogenic microorganism infecting these plants: Bean golden mosaic virus (BGMV), including viruses. These are responsible for high Sida micrantha mosaic virus (SiMMV), Sida mottle virus economic losses especially in cultivated crops. (SiMoV) and Soybean chlorotic spot virus (SoCSV). The Studies on viruses infecting Cerrado trees are rare. aim of this study was to identify the etiological agent However using modern techniques of viral detection, of a novel soybean disease characterized by severe metagenomics, and bioinformatics we expect to stretch leaf curling of top leaves. Twenty-three symptomatic our knowledge about our tree-associated viruses. soybean leaf samples were collected in Luziânia (GO). The main objective of this work is to detect novel viral Serological tests using antibodies against Tomato species infecting native plants from Cerrado with the spotted wilt virus (TSWV), Tomato chlorotic spot virus aid of metagenomics. Thus, 71 seedlings from 29 tree (TCSV) and Groundnut ringspot virus (GRSV) were species showing viral symptoms. were collected from a negative, indicating absence of these tospoviruses in plant nursery at NOVACAP (Brasília, Distrito Federal). the plants. Virus preparations from seven randomly selected samples were used for mechanical inoculation followed by nucleic acid extraction and then submitted Next-GenerationPlants were first subjectedSequencing to half-purificationusing NGS sequencing process Nidera). However, inoculated plants did not present any technology by Illumina platform HiSeq 2000. Sample symptomsin two soybean after one varieties month (Wehrmannof incubation. - Then, W79 total / Rr DNA and analysis included the de novo assembly of sequences, was extracted from each collected leaf and subjected to consisting of 5.005.013 million reads generated by the joint data analysis. Assembled sequences produced with the restriction enzyme MspI 2.162 contigs that were subjected to BLASTX analysis Rolling Circle Amplification (RCA), followed by digestion (Basic Local Alignment Too Search). To validate the presence of circular DNA viruses in. the DNA plants. amplification The RCA was confirmed in all DNA samples, suggesting the October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant andresults, Invertebrate RT-PCR Virology: was PIV employed using specific primers XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
192 Plant and Invertebrate Virology: PIV
others only in susceptible plants. These results suggest the metagenomic data analysis revealed mainly the the existence of differences between viral populations presencedesigned ofon sequencesidentified matchingRNA virus RNA sequences. viruses Asincluding result, present in resistant and susceptible plants. Subsequent viral species that infects arthropods. Financial Support: cloning and complete genomic sequencing of these CAPES, EMBRAPA. their genetic diversity, and determine if the expansion PIV48 - BEGOMOVIRUS DIVERSITY IN RESISTANT ofviruses the use will of resistant allow the cultivars species may identification, result in changes unravel in AND SUSCEPTIBLE TOMATO PLANTS Rego, C.M.; Nakasu, E.Y.T.; Inoue-Nagata, A.K. characterization of the variants present in resistant the virus population composition in the field. Further 1. UNIVERSIDADE DE BRASÍLIA plants may provide insights to the durability and 2. EMBRAPA HORTALIÇAS Support: CNPq, FAPDF, EMBRAPA Hortaliças. Tomato (Solanum lycopersicum) is one of the main efficiency of the resistance genes in tomatoes. Financial vegetables grown in the world, but the occurrence of PIV58 - MYCOVIRUS DETECTION AND plant diseases can cause substantial production losses in IDENTIFICATION IN Hevea brasiliensis this crop. Begomovirus infections (family Geminiviridae) Fonseca, P.L.C.; Xavier, A.G.; Vaz, A.B.M.; Badotti, F.; generally occur at high frequency in tomatoes, posing Martins, P.M.; Santos, V.L.; Abrahão, J.S.; Trindade, serious constraints to its production in Brazil. Currently, G.S.; Chaverri, P.; Goés-Neto, A. the use of resistant cultivars is the most effective method for controlling begomovirus diseases, even 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS though these plants are only moderately resistant and 2. PONTIFÍCIA UNIVERSIDADE CATÓLICA DE thus not immune. Our aim was to perform a preliminary MINAS GERAIS 3. UNIVERSIDADE ESTADUAL DE FEIRA DE assessment of the diversity of begomoviruses in resistant SANTANA (cv. BRS Sena) and susceptible (cv. H-9553) tomato 4. CENTRO FEDERAL DE EDUCAÇÃO cultivars. Therefore, 117 symptomatic leaf samples TECNOLÓGICA DE MINAS GERAIS 5. ICA DE MINAS GERAIS the municipality of Luziânia-GO. A total of 45 samples 6. UNIVERSITY OF MARYLAND from both cultivars were collected in the same field at were collected from symptomatic plants of the hybrid 7. UNIVERSIDADE ESTADUAL DE FEIRA DE H-9553, and 72 samples for the hybrid BRS Sena, since SANTANA begomovirus infection symptoms in resistant plants are Hevea brasiliensis is the best producing plant of latex and natural rubber in the world. This plant species is susceptible to several diseases caused by fungi and universalmilder and begomovirus more difficult degenerate to identify thanprimers. in susceptible Fifty-six viruses. In plant tissue, there are many symbiotic resistantcultivars. (77% Viral tested infection positive) was confirmedand 44 susceptible by PCR (97%) using organisms that can interact and help in plant protection tomato samples were PCR-positive for the presence of against pathogens, as the endophytic fungi. Mycoviruses begomoviruses. The viral DNA from these samples was commonly occur in endophytic fungi and they can play an important role in mutualistic interactions between subsequently digested with MspI restriction enzyme, the fungus and the host plant. The main mycovirus infurther order amplified to visualize by rollingthe polymorphism circle amplification in the viral and families are those with genome composed by double- stranded RNA: Hypoviridae, Chrysoviridae, Totiviridae, were observed, being the pattern of Tomato severe Partitiviridae, and Reoviridae. However, nothing is known rugosegenome virus restriction the predominant. profiles. This Seven begomovirus different profilesspecies about the impact of mycoviruses in H. brasiliensis. Thus, is considered to be the most prevalent in the tomato crop the study of the mycovirus diversity is an important and in Brazil. Variations in the restriction profiles indicate following approach is proposed: First, the endophytic fungirequired will be scientific isolated investigation. from native rubber For this tree reason, individuals the appearedthe presence exclusively of different in viralresistant species/strains/variants plants, while two in the collected tomato plants. Additionally, two profiles October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
193 Plant and Invertebrate Virology: PIV in Amazon region. The fungal isolates will have their inhabitants. Because of the intense and overlapping total RNA extracted by EZNA Fungal RNA Mini Kit and system of cultivation, vegetable crops suffer constant digested with the enzymes DNAse 1, Nuclease S1 and disease problems, including infections by Turnip mosaic RNase A. After digestion, the samples that still have virus (TuMV, Potyvirus), which causes economic losses in RNA will be selected by two distinct methodologies: different species of Brassicaceae. TuMV is comprised of aforementioned most common mycovirus families, (ii) It is transmitted by aphids in a non-persistent manner shotgun(i) qPCR metagenomics amplification (metavirome), with specific which primers comprises for the andfilamentous has the elongatedbroadest particlesdocumented with host a ssRNA range genome. of any potyvirus. Isolates of TuMV have been characterised in several countries, however, there is a lack of knowledge normalizationthe following stepsof (i)cDNA tagmentation, metagenomic (ii) amplification,library, (v) about TuMV genetic diversity in South America, including denaturation(iii) purification and dilution (iv) validation, of metagenomic quantification cDNA library, and Brazil, where sporadic observations of its occurrence (vi) mixing of the prepared cDNA metagenomic library have been reported. The goals of our work were to with the default PhiX virus library, (vii) charging the identify and characterise TuMV isolates from Chinese cabbage (Brassica rapa) in São Paulo State. Surveys and in the MiSeq (Illumina). The generated data sets will sample into the flow cell for massive parallel sequencing in the municipalities of Divinolândia and São José do Rio Pardo,collections state were of São performed Paulo, where in commercial more than fields 60% located of the abe DELL analyzed server in (Xeon) accordance Linux withambient a flowchart (Ubuntu designedv. 12:04) plants showed symptoms of yellowing, mosaic, necrotic andspecifically the following for this purpose.programs The PRINSEQ pipeline willv0.20.4 be run and in rings and necrosis. Electron microscopy observations USEARCH v.8.0.1623, BLASTn v. 2.2.30+; scripts get_ all_taxonomy.pl:, assignment_filter.sh: and singletons.pl:; 750 nm in length. The virus isolates reacted positively and databases GenBank Release 207.0 and MetaVir will revealed the presence of flexuous elongated particles ca. be used to bioinformatic analysis. This work proposes After total RNA extraction and RT-PCR with degenerate primers,in PTA-ELISA 700 withbp DNA a specific fragments TuMV correspondentpolyclonal antiserum. to the of mycoviruses in endophytic fungi, contributing to cylindrical inclusion (CI) cistron were successfully futurea methodology studies in for the the areas detection of diversity, and identificationecology and biotechnology. Keywords: qPCR, metavirome, pipeline, alignments for the nucleotide CI sequences deposited mycoviruses, fungal endophytes, Hevea brasiliensis. inamplified Genbank and were sequenced. carried out Comparisons using Clustal and W software. multiple Financial Support: National Science Foudantion. Phylogenetic analyses (Mega 5.2 software) revealed that TuMV isolates clustered in four different clades. Isolates PIV63 - Turnip mosaic virus INFECTING CHINESE of TuMV Chinese cabbage characterized here clustered CABBAGE IN THE STATE OF SÃO PAULO: GENETIC in the same clade, supported by 100% bootstrap values DIVERSITY AND INCIDENCE and showed 99% nucleotide identity, belonging to the Eiras, M.; Rodrigues, L.K.; Chaves, A.L.R.; Brunelli, Basal TuMV group. It is worth noting that another TuMV K.R.; Harakava, R.; Kitajima, E.W.; Walsh, J.A. Brazilian isolate obtained, in 2007, from horseradish 1. INSTITUTO BIOLÓGICO crops, from Divinolândia, had 83% nucleotide sequence 2. SAKATA SEED SUDAMERICA identity, and belongs to the TuMV World group. These 3. ESCOLA SUPERIOR DE AGRICULTURA LUIZ DE QUEIROZ Brazilian TuMV isolates, and point to the importance of 4. UNIVERSITY OF WARWICK increasingresults confirmed the studies the of high this virus genetic in brassicas variability in amongBrazil. Brazilian vegetable production was estimated at 19 million tonnes, of which the state of São Paulo was Financial Support: FAPESP (Proc. 2014/22594-2). responsible for 4 million tonnes. Recent data shows that the central market of São Paulo city handled US$ 3 billion, for a consumer market of up to 20 million
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
194 Plant and Invertebrate Virology: PIV
PIV71 - EVALUATION OF RESISTANCE TO Melanaphis PIV73 - METHYLATION PATTERN ANALYSIS AND sacchaRI IN SUGARCANE AND THE INFLUENCE ON IDENTIFICATION OF CANDIDATE GENES FOR TRANSMISSION OF Sugarcane yellow leaf virus Sugarcane mosaic virus (SCMV) RESISTANCE IN Gonçalves, M.C.; Rodrigues, M.P.; Pinto, L.R.; Salas, SUGARCANE F.J.S.; Gasparino, E.C.; Creste, S.; Perecin, D.; Landell, Silva, M.F.; Pinto, L.R.; Melloni, L.M.; Medeiros, C.N.F.; M.G.A. Creste, S.; Gonçalves, M.C. 1. INSTITUTO BIOLÓGICO 1. UNIVERSIDADE ESTADUAL PAULISTA 2. UNIVERSIDADE ESTADUAL PAULISTA 2. INSTITUTO AGRONÔMICO DE CAMPINAS 3. INSTITUTO AGRONÔMICO DE CAMPINAS 3. INSTITUTO BIOLÓGICO This work focused on the evaluation of resistance Mosaic caused by Sugarcane mosaic virus (SCMV) is in sugarcane (Saccharum spp.) to the sugarcane one of the main viruses infecting sugarcane worldwide. aphid Melanaphis sacchari (Zehntner), the main Studies on large-scale transcriptomic analysis and vector of Sugarcane yellow leaf virus (SCYLV), a major methylation status of genomic DNA contribute to concern for sugarcane production worldwide. Five understand the molecular bases of resistance to sugarcanes varieties, IACSP95-5000, IACSP93-3046, mosaic. This study aimed to evaluate changes in DNA IACSP95-5094, IACSP96-3076 and SP71-6163, chosen methylation patterns of sugarcane inoculated with SCMV due to their economic importance in the main Brazilian by using the MSAP (Methylation-sensitive amplified sugarcane growing areas were evaluated in terms of polymorphism) approach. Moreover, candidate genes aphids’ behavior and reproduction by the traditional for mosaic resistance were screened by the cDNA-AFLP antixenosis and antibiosis approaches. In order to gain technique. Two contrasting varieties for SCMV (strain a more comprehensive view, EPG (Electrical Penetration Rib-1) resistance were mechanically inoculated along Graphs) was used as a key technique to detect differences with respective mock inoculated controls. Leaf samples in the feeding behavior of M. sacchari. The aphid were collected at 24, 48 and 72 hrs. post inoculation showed a notable preference for IACSP96- 3076 and (hpi). The samples’ genomic DNA was screened against higher population growth indexes on IACSP95-5000. 14 selective primers for the MSAP enzyme combinations We found favorable parameters in the insect behavior EcoRI/MspI and EcoRI/HpaII, producing a total of on variety SP71-6163, what reinforces its previously 576 bands for IAC91-1099 (susceptible) and 522 for known high susceptibility to SCYLV infection. We also IACSP95-5000 (resistant). For each variety the banding demonstrated by these experiments the existence of pre patterns were compared between the inoculated sample and respective control at the different sampling time behavior of M. sacchari in the plant and subsequently points. The selective combinations EcoRIaga/HpaIIaca, and post-phloematic penetration factors influencing the EcoRIaca/HpaIIaca, EcoRIaga/HpaIIttg, EcoRIaca/ HpaIIttg and EcoRIaca/HpaIIgag showed changes in the fellowshipthe transmission from CAPES. of SCYLV. Financial Support: FAPESP/ EcoRIaga/ BIOEN (2008/56146-5). M.P.R. was recipient of a master HpaIItcg only for IACSP95-5000. Natural methylation (no inoculated)methylation wasprofile around for both 1.56% varieties and 1.53%, whereas respectively, for IAC91-1099 and IACSP95-5000. Eight differentially expressed transcribed fragments (DTFs) derived from cDNA-AFLP were cloned and sequenced. Six of these fragments showed similarity with transcripts
inoculationin SUCEST-FUN treatment database, from significant combinations at 1e-5 EcoRIacg/ E-value. MspttgThese transcripts,(IACSP95-5000, similar 24hpi) to DTFsand EcoRIagc/Mspaca under artificial (IAC91-1099, 24, 48 hpi; IACSP95-5000, 48 hpi) showed up to 98% identity with maize proteins in NCBI database October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
195 Plant and Invertebrate Virology: PIV while transcripts similar to DTFs from EcoRIagc/ Mspaca and EcoRIacg/Mspact (IACSP95-5000, 24hpi) several studies have shown that viral co-infection may showed up to 97% identity with sorghum and maize increaserather than the time distinct to purge selection slightly deleterious coefficients. mutations. Actually, hypothetical proteins. Potential Pfam domains were aggregation on the genome-wide selective patterns in protein interactions, glucose-fructose oxidoreductase baculoviruses.This is the first Financial evidence Support: of the impact CNPq. of nucleocapsid andidentified regulation for stress by miRNA-mediated responses, mediation gene silencing of protein- via RNA interference. The changes in DNA methylation PIV90 - HOST RANGE, VECTOR AND GEOGRAPHICAL pattern and the potential domain related to RNAi DISTRIBUTION OF A Brevipalpus - TRANSMITTED reinforce the connection between gene expression and VIRUS CAUSING RINGSPOTS IN Ligustrum SPP epigenetic pathways in sugarcane resistance to mosaic. Kitajima, E.W.; Tassi, A.D.; Caceres, S.; Aguirre, A.; Costa, N.; Calegario, R.F. M.F.S. is recipient of a PhD fellowship from CAPES. 1. ESC SUP AGR L QUEIROZ Financial Support: FAPESP/BIOEN (2008/56146-5). 2. EE BELLA VISTA PIV75 - IMPACT OF SINGLE AND MULTIPLE 3. EE CONCORDIA BACULOVIRUS PHENOTYPES ON GENOME-WIDE 4. UNIV.FED.PARANÁ PATTERNS OF SELECTION Ligustrum sinensis Fernandes, J.E.A.; Andrade, M.S.; Morais, B.M.; Melo, described in Concordia, Argentina, by Vergani in 1942, F.L. and“Lepra demonstrated explosiva de ligustrinato be transmitted ( by Tenuipalpus)” was UNIVERSIDADE DE BRASÍLIA pseudocuneatus (Acari: Tenuipalpidae), junior synonym The baculoviruses are a group of insect viruses with for Brevipalpus obovatus. A similar disease was large dsDNA genomes, and their primary infection is reported in Curitiba, PR, Brazil, in 1991, in L. lucidum, triggered by rod-shaped enveloped virions embedded and associated with cytopathology similar to some in a crystalline protein matrix. Each virion may contain Brevipalpus-transmitted viruses (BTV) and referred to one (single phenotype, SNPV) or more nucleocapsid as Ligustrum ringspotvirus (LigRSV). This virus was (multiple phenotype, MNPV) within an envelope, also found in L. lucidum in 1993, in Piracicaba, SP, Brazil depending on the viral species. The MNPVs experience an and demonstrated to be transmitted by B. phoenicis. obligatory co-infection event during primary infection, Ultrastructural studies revealed cell alterations typical which may increase the likelihood of recombination, for the cytoplasmic type of BTV (BTV-C), as the Citrus complementation and the levels of competition within leprosis virus C (CiLV-C). Further observations made the infected cell. Although it is generally assumed that in several parts of Brazil (SP, PR, DF), indicated that LigRSV was also present in L. sinensis, and demonstrated baculoviruses, only limited evidence has been provided to be transmitted by Brevipalpus mites collected from toco-infection support these have significantlyclaims. Therefore, impacted we theinvestigate evolution the of Ligustrum impact of these two morphotypes on baculoviruses was found showing chlorotic spots on their leaves, infected plants. A still unidentified arboreal evolution using genomic data sampled both at the and cytopathology typical of BTV-C in Curitiba, being possibly be infected by LigRSV. Recent surveys on L. sinensis in Bella Vista and Concordia, Argentina, wideintraspecific patterns and instead interspecific of on individual level. We estimatedgenes. At the found symptomatic plants associated with Brevipalpus dN/dS for each gene, but we focused on the genome- infestation., with cytropathology characteristic of BTV-C, intraspecific level, our analysis shows that the MNPVs Ligustrum ringspot are identical. Due to historical factor, have a more heterogeneous selection profiles than the wea strong suggest evidence the name that “lepraLigustrum explosiva leprosis of ligustrina” virus (LigLV) and phenotypes.SNPVs. However, Taken at together, the interspecific these results level suggest no differences that the for this virus now on. Cross infestation experiments of in the selection profiles were observed for the two mites collected from L. lucidum or L. sinensis suggest be the result of a differential response time to selection that symptoms observed in these plants are caused by heterogeneity observed at the intraspecific dataset may October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
196 Plant and Invertebrate Virology: PIV the same virus. Sections of Brevipalpus-mite collected Aphis fabae resulted in infection of Japanese spinach. from LigLV-infected L. sinensis revealed a situation similar to that of CiLV-C in viruliferous B. yothersi with presumed viral particles present between adjacent cells materialThe causal indicated virus was the purified causal agent following was an a isolateprotocol of usedCMV of the midgut, prosomal gland and neighbour tissues, by Duffus et al.(1986). Genome sequencing of purified suggesting a persistent circulative mode of virus-vector ELISA. Transmission electron microscopy of leaf tissues relationship. Based on cytopathology, LigLV might be a subgroup A. This identification was also confirmed by Cilevirus. However, no information regarding its genome concentration of virions in infected cells, which may is available yet, but is distinct from CiLV-C since primers formfrom infectedcrystalline Japanese inclusions. spinach There confirmed are previous the very reports high and antibody for this virus do not detect LigLV.. The proper of wilting in Japanese spinach, but caused by an isolate Brevipalpus mite vector requires of Broad bean mottle virus additional works, because analysis of the Breviplapus register of similar disease caused by CMV. Financial miteidentification population of found the in LigLV-infected plants revealed Support: FAPESP, CNPq. (BBMV), and this is the first that they are commonly mixed (B. yothersi, B. obovatus and occasionally B. californicus). Financial Support: PIV121 - NS1 PROTEIN OF INFLUENZA A VIRUS DECREASES BACULOVIRUS REPLICATION IN INSECT CELL LINES FapespPIV91 (2014/08458-9). - AN ISOLATE OF Cucumber mosaic virus Vieira-Almeida, E.C.; Arruda, G.L.; Santos, G.R.; CAUSING WILTING AND DEATH OF JAPANESE SPINACH Resende, R.O.; Ribeiro, B.M.; Oliveira, V.C. (Spinaca oleracea) IN CAMPINAS, SP, BRAZIL 1. UNIVERSIDADE FEDERAL DO TOCANTINS Kitajima, E.W.; Yuki, V.A.; Mituti, T.; Rezende, J.A.M.; 2. UNIVERSIDADE DE BRASÍLIA Andrade, S.; Kitajima, J.P.
1. ESC SUP AGR L QUEIROZ protein that has been related to the inhibition of 2. INST.AGRON.CAMPINAS interferon-mediatedNS1 protein of Influenza antiviral A defense virus is and a nonstructural inhibition of 3. MENDELICS host mRNA synthesis by RNA suppression mechanisms. In plants, the NS1 protein activity promotes the RNA data from 2006 mention around 5000 growers with a total silencing suppression. This study aimed to evaluate the output“Spinach” of ca. is still 34 tonnes, a marginal mostly vegetable produced crop at in the Brazil. Southern IBGE action of the NS1 protein in different insect cells through heterologous expression using recombinant baculovirus. is the species Tetragonia expansa (Aizoaceae), the New For this, a recombinant derived from Autographa Zealandand Southeastern spinach. The states. true The spinach large majority(Spinaca ofolearaceae “spinach”- californica multiple nucleopolyhedrovirus (AcMNPV) Chenopodiaceae), refereed to commonly as Japanese denominated vAcNS1, containing the NS1 gene under spinach is cultivated in small scale, mostly for the oriental the control of the viral polyhedrin (polh) gene promoter community. A severe wilting of Japanese spinach in high was constructed. Infections with wild type AcMNPV, incidence was observed in a commercial plantation of BmNPV and AgMNPV viruses and co-infections with Monte D’este (Tozan) farm. Samples were received at the recombinant vAcNS1 in different insect cells were the IAC for diagnosis. Preliminary electron microscopic analyzed in order to determine the effect of NS1 protein examination of extracts from disease plants revealed a on production of wild type polyhedral inclusion bodies high concentration of isometric particles indicating a (PIB). At 48 h post infection, the cells were harvested and possible viral etiology. Mechanical transmission assays pelleted. The PIBs number was determined by counting resulted in infection of several varieties of Japanese the number of polyhedral per milliliter of medium, using spinach, reproducing the original symptoms. Local a hemocytometer and a light microscope. Counting was lesions resulted in inoculated Chenopodium quinoa, C. repeated twice in four different tissue culture plates for amaranticolor and Gomphrena globosa and systemic each virus analyzed. Surprisingly, the PIB production infection of Nicotiana tabacum, N. glutinosa and N. obtained with the wild type viruses decreased with the benthamiana, Cucumis melo. Preliminary assays with NS1 expression in all host cells when co-infected with
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
197 Plant and Invertebrate Virology: PIV vAcNS1. When AcMNPV was co-infected with vAcNS1 segment of the ChPV gene NS-1. The presence of viral in AcMNPV-permissive Spodoptera frugiperda (Sf- DNA was revealed by agarose gel electrophoresis and 21) and Trichoplusia ni (BTI-TN-5B1-4) cells, the PIB staining with ethidium bromide. Genomes of ChPV were number decreased 1.8-fold and 1.5-fold, respectively, than AcMNPV alone. The co-infection of BmNPV with A. diaperinus may play some vAcNS1 in AcMNPV-nonpermissive Bombyx mori (BM- roledetected in ChPV in 3/13maintenance (23%) in of the the environment. specimens sampled.The role 5) cells caused a decrease on PIB production of 3.2-fold, forThese such findings coleopter reveal as athat source for transmission of ChPV when compared to BmNPV infection control. Similarly, to chickens remains to be further examined. Keywords: AgMNPV wild type co-infected with vAcNS1 produced Poultry, beetles, aveparvovirus, runting-stunting a PIB number 4.8-fold lower than AgMNPV in AcMNPV- syndrome (RSS), PCR. Financial Support: CAPES, CNPq semi-permissive Anticarsia gemmatalis (UFL-AG-286) and FINEP. cells. These results suggest that the expression of NS1 protein during baculovirus infection has adverse effects PIV166 - SEPARATION OF CITRUS TRISTEZA VIRUS on the expression of the polyhedrin protein or on GENOMIC VARIANTS BY MICROGRAFTING AND baculovirus replication in all insect cells lines studied. In CHARACTERIZATION BY QPCR Martins, E.C.; Harper, S.; Teixeira, D.C.; Bové, J.M.; of the NS1 protein on the activity of different baculovirus Dawson, W.O.; Wulff, N.A. order to confirm these results, we will analyze the effect promoters, on viral DNA replication and in the budded 1. FUNDO DE DEFESA DA CITRICULTURA virus production in different insect cells. Keywords: 2. CITRUS RESEARCH AND EDUCATION Baculovirus, insect cells, NS1 protein, replication. CENTER FLORIDA UNIVERSITY Financial Support: CNPq. 3. UMR-1332 BIOLOGIE DU FRUIT ET PATHOLOGIE PIV135 - OCURRENCE OF CHICKEN PARVOVIRUS IN ALPHITOBIUS DIAPERINUS (PANZER) COLLECTED Citrus tristeza virus (CTV) is a major destructive FROM DIFFERENT POULTRY FARMS IN BRAZIL pathogen, causing citrus Tristeza disease. CTV is phloem- limited and naturally transmitted by aphids, while Finkler, F.; Lima, D.A.; Cerva, C.; Domingues, G.; grafting is a horticultural practice that propagates CTV Teixeira, T.F.; Santos, H.F.; Cibulski, S.P.; Almeida, L.L.; as well. CTV causes quick decline, stem pitting (SP) or Roehe, P.M.; Franco, A.C. seedling yellows symptoms. Stem pitting causes reduced 1. UNIVERSIDADE FEDERAL DO RIO GRANDE vigor and the tree bear small fruits. In the case of Pera DO SUL sweet orange, cross protection is employed in São Paulo 2. INSTITUTO DE PESQUISAS VETERINÁRIAS State (SPS) to avoid SP symptoms and fruit losses. CTV DESIDÉRIO FINAMOR is a RNA virus member of the genus Closterovirus, being Alphitobius diaperinus (Panzer) (Coleoptera: the largest plant virus and any CTV isolate is a complex set of genomic variants. The main objective of this work considered a problem in poultry production, because is to separate the genomic variants of CTV from the Tenebrionidae), also known as “lesser mealworm” is main sweet orange varieties grown in SPS. Based on parasite may act as vehicle for poultry pathogens. One of the sequence of CTV genomic variants (unpublished), a suchof its pathogens, difficult controlchicken andparvovirus the possibility (ChPV), has that not such to common primer set to the three sequences and probes was performed in search for ChPV genomes in adult Sweet orange varieties Pera, Valencia, Hamlin and Natal specimensdate been identifiedof A. diaperinus in these. arthropods.Specimens ofHere, mealworm a study fromspecific nursery for each tress one were of the submitted three strains to micro was grafting designed. to were collected in poultry farms from 13 different cities isolate CTV components. From 85 plants produced by in the state of Rio Grande do Sul, Brazil. The beetles micro grafting onto Troyer seedling, 42 (49.2%) were were weighed, crushed in buffer (1:10) and submitted free of CTV as analyzed by PCR. Among the remaining to DNA extraction. One hundred nanograms of extracted 43 plants, mixture of the three source strains (VT, RB DNA were employed in a PCR designed to amplify a and T68-like) were detected in 10 plants (23.3 % of CTV
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
198 Plant and Invertebrate Virology: PIV positive plants), while a mixture of T68-like and VT-like and Crotalaria juncea were biolistically inoculated with was found in 37.2% of the plants. Mixed infection of RB- the virus alone, and 15 were inoculated with the virus like and VT-like was found in 7% of the micrografted and the alphasatellite. Plants were visually evaluated scions. VT-like alone was present in 30.2% of the plants for symptoms and PCR-tested for the presence of virus and RB-like in only a single plant (2.3%). Further and satellite at 14 and 28 days after inoculation. Yellow mosaic symptoms were observed in E. heterophylla variants present in each plant. Besides being effective in removinganalysis are CTV necessary from almost to confirm half ofthe the number plants, of shoot genomic tip grafting was useful to separate genomic variants of CTV, tomato,plants infected however with PCR the results virus indicated alone (5/15) that threeor with plants the weretwo agentsinfected (4/15). with EuYMV No symptoms alone and were one with observed the two in all CTV variant found in the original samples. agents. Interestingly, A. thaliana plants showed mild although not sufficient at the presented scale to isolate PIV238 - HOST RANGE OF EUPHORBIA YELLOW MOSAIC VIRUS AND ITS ASSOCIATED ALPHASATELLITE C.mottle juncea when plants infected inoculated with with EuYMV EuYMV alone alone (9/15) were andnot Mar, T.B.; Alves, M.S.; Barbosa, L.R.; Amaral, J.G.; infected.severe leaf When curl inoculatedwhen both withagents both were agents, present four (9/15). plants Pereira, H.M.B.; Mendes, I.R.; Fiallo-Olive, E.; Navas- showed stunting. The presence of the alphasatellite Castillo, J.; Lau, D.; Zerbini, M. 1. UNIVERSIDADE FEDERAL DE VIÇOSA two having only EuYMV. These results extend the was confirmed in two of these plants, with the other 2. INSTITUTO DE HORTOFRUTICULTURA geographical range of alphasatellites in South America, SUBTROPICAL Y MEDITERRÂNEA and indicate that the presence of the alphasatellite may 3. CENTRO NACIONAL DE PESQUISA DE TRIGO Financial Support: CAPES, CNPq and FAPEMIG. The genus Begomovirus (family Geminiviridae) includes influence the phenotype of the infection in some hosts. a number of plant viruses of economical importance for PIV239 - IDENTIFICATION OF VIRUSES ASSOCIATED WITH THE WATERMELON CROPS BY MULTIPLEX RT- possess a bipartite genome composed of two circular PCR single-strandedBrazilian agriculture. DNA Most molecules. “New World” Begomoviruses begomoviruses are Aguiar, R.W.S.; Rodrigues, A.; Garcia, M.M.V.; Alves, Bemisia tabaci to dicot G.B.; Resende, R.O.; Nagata, T. plants. Alphasatellites (previously named DNA 1) are circular,transmitted single-stranded by the whitefly DNA molecules which replicate 1. UNIVERSIDADE FEDERAL DO TOCANTINS independently but require a helper begomovirus for 2. UNIVERSIDADE NACIONAL DE BRASÍLIA systemic spread in the plant and for insect transmission. Economic losses in cucurbits are frequentely associated with virus infection. In addition to the direct reduction in plant yield, the viruses can reduce the morphological recentlyAlphasatellites in the Americas have been (Brazil, identified Venezuela) in association in association with aspect of the fruit, and depreciate its commercial value. withmonopartite bipartite begomovirusesbegomoviruses. In in screening the “Old symptomatic World”, and Viruses that are reported in Brazilian watermelon crops Euphorbia heterophylla plants (n=120, collected from Mato Grosso do Sul, Paraná, Santa Catarina and Rio in leaves of all viruses are very similar. Potyvirus and Grande no Sul) for the presence of begomoviruses, we tospovirusare difficult tonaturally diagnose infectvisually watermelon because the symptoms(Citrullus Euphorbia yellow mosaic lanatus virus (EuYMV) and Euphorbia mosaic virus-associated the diagnosis of multiple infections. This study aim was to identified the presence of alphasatellite. The alphasatellite was found in association identify), and and differentiate it may occur Watermelon in mixed infections, mosaic virus difficulting (WMV- with EuYMV in samples collected in Rio Grande do Sul 2), Papaya ringspot virus – strain Watermelon (PRSV-W), and Paraná. Dimeric constructs obtained from partial Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic restriction digestion were used to test the host range of virus (CMV) and Zucchini Lethal chlorosis virus (ZLCV) EuYMV and its associated alphasatellite. Fifteen plants by multiplex RT-PCR. The oligonucleotides prepared to each of E. heterophylla, tomato, Arabidopsis thaliana detect and differentiate WMV-2, PRSV-W, ZYMV, CMV
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
199 Plant and Invertebrate Virology: PIV and ZLCV were obtained from the conserved regions Illumina deep sequencing. After sequence trimming and assembly, 19,165 contigs were obtained with 177 hits conserved regions in RT-PCR reaction, from the cDNA of the viruses genomes, allowing the amplification of 535 bp (WMV-2), 398 bp (PRSV-W), 244 bp (ZLCV) rangingagainst thefrom virus 38 to RefSeq 2593 database. nucleotides From and those, from fifteen83 to andobtained. 214pb The (ZYMV). amplified In productsthe duplex were reactions, 644 bp (CMV),by the 99%begomovirus identity. Five species of them were were identified, begomoviruses with sequences found in combinations of oligonucleotides, it was possible to tomato plants, four in sweet potato, two in sida, and one differentiate viruses WMV-2, PRSV-W, ZYMV, CMV and ZLCV. In all reactions, the oligonucleotides used did not plants. Due to the high nucleotide identity between the contigeach in sequences euphorbia, and beans, the reference soybean, sequences, okra and passiflorait is likely that new begomoviruses were not found in this survey. correspondingshow nonspecific to WMV-2 amplifications. virus, this For may triplex be related reactions, to the optimizationit was obtained of the onlyPCR reaction the amplification and to the competition of 535 bp not reported in Brazil may suggest that the study of However, the finding of a sweet potato virus that is still detection of viruses in studies. The multiple detections tool to unravel the diversity of this virus group in the ofand/or viruses overlap developed between in this the work oligonucleotides can reduce the in cost the country.begomoviruses Financial in Support:whiteflies CNPq, is a powerfulEMBRAPA. surveillance and work in the detection and differentiation of viruses. The oligonucleotide designed allows rapid detection and PIV251 - PRELIMINARY EVALUATION OF QUILLAJA isolated differentiation of PRSV-W, WMV, ZYMV, CMV SAPONINS EFFECT ON HUMAN ADENOVIRUS 5 and ZLCV present in watermelon crops in the state of REPLICATION CYCLE Tocantins. Financial Support: CNPq. Silva, F.P.; Sperb, L.C.; Rigotto, C.; Giehl, I.C.; Spilki, F.R.; Fleck, J.D. PIV247 - DIVERSITY OF BEGOMOVIRUSES IN THE UNIVERSIDADE FEEVALE WHITEFLY (BEMISIA TABACI) Nakasu, E.Y.T.; Melo, F.L.; Nagata, T.; Michereff Filho, Adenoviruses are important waterborne enteric viruses, M.; Souza, J.O.; Ribeiro, B.M.; Ribeiro, S.G.; Lacorte, C.; have double-stranded DNA genome and belong to the Pereira, J.L.; Inoue-Nagata, A.K. Adenoviridae family. These viruses can infect humans (HAdV) and animals, and are associated mainly with 1. EMBRAPA HORTALIÇAS gastroenteritis, respiratory and conjunctivitis infections. 2. UNIVERSIDADE DE BRASILIA Secondary metabolites from plants may interfere in 3. EMBRAPA RECURSOS GENETICOS E viral infectivity. Saponins, for example, are amphipathic BIOTECNOLOGIA glycosides with surfactants proprieties and able to Begomoviruses (family Geminiviridae interact with cholesterol and other sterols. Studies have transmitted small circular ssDNA plant pathogens. demonstrated antiviral activity of saponins from the ) are whitefly- These viruses cause major losses in horticultural and barks of Quillaja saponaria against vaccinia virus, herpes bean production in Brazil, but their diversity and degree simplex virus type 1, varicella zoster virus, human sequencing methods. The aim of this study was to the present study aimed to investigate the effects of of variability are difficult to assess using traditional evaluate the diversity of begomoviruses in the vector, Quillajaimmunodeficiency saponins on viruses HAdV-5 1 andreplication. 2, and rotavirus. The effect Thus, of a Bemisia tabaci, using an Illumina sequencer commercial saponins from Q. saponaria barks (QS) and platform. Adult insects were collected in commercial a crude aqueous extract from Q. brasiliensis leaves (QB) the whitefly on the interaction of HAdV-5 with cell line A549 (human lung cancer cells) was analyzed. The cytotoxicity and crops from five different Brazilian states (MG, SP, ES, RNase treatment, viral DNA was extracted and subjected the effect on HAdV-5 replication to both samples were DF and GO). Following sample maceration and DNase/ assessed by MTT and plaque-forming units (PFU) the library with circular DNA. Nucleic acids were assays, respectively. Cytotoxicity was not observed in fragmented,to Rolling Circle linked Amplification to adaptors (RCA) and thenin order subjected to enrich to
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant andthe Invertebrate concentration Virology: rangesPIV of 0.98-15.53 µg/mL (QS) and XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
200 Plant and Invertebrate Virology: PIV
of the isolate M220 consisting of 1843 nt comprising three different concentrations of each extract were 28% of the virus genome were cloned and sequenced. 0.98-62.50 µg/mL (QB). Based on cytotoxicity results,
Thechosen mechanism to PFU assays: of interaction 12 µg/mL, was 6 evaluated µg/mL and through 3 µg/ GenbankNucleotide sequences. sequences The were generated submitted (accession to BLAST numbers (http:// differentmL to QS; methodological50 µg/mL, 25 µg/mL strategies, and 12.5 which µg/mL aimed to QB.to KT381617blast. ncbi.nlm.nih.gov/Blast.cgi) and KT585634, respectively for comparison for isolate M219- with detect a possible interference of these samples at 3 and M220) and sequences available from GenBank distinct stages of the viral replication cycle. An increase were aligned using the Lasergene software. At the 3´end the assembly of consensus sequences of M219-3 of of Quillaja saponins, suggesting a pro-viral effect. In the 2516 nucleotides and M220 of 1843 nucleotides, clones pre-treatmentin the number assayof plaques (3h before was verified viral inoculation) in the presence there 219-3-NQ and 220-WQ cover the movement protein was an increase in the number plaques when incubated (MP), and the coat protein (CP) gene, respectively, nucleotide positions 4788-5750 and 5641-6354 of the type member (NC 001749). At the 5´end of ORF1, clones conditions,with QS (207.5% Quillaja with saponins 12 µg/mL) may andinteract QB (113.5% with cellular with 219-3-A and 219-3-EL cover 540 nucleotides and 1297 membrane50 µg/mL). facilitating These results HAdV-5 suggest penetration. that, under This the ongoing tested nucleotides, respectively. The consensus sequences study will further evaluate the expression of Adv5 hexon of isolates M219-3 and M220 had 85.3% and 98.3% protein and the relation of compounds and their time of identity with NC 001749, respectively. Deduced amino addition on virus replication. Financial Support: CNPq, acid (daa) sequences of these isolates showed 95% and CAPES, FAPERGS, FEEVALE. 98.4% identity with type member MP. High degree of daa identity was observed between the CP of M219-3 PIV258 - COMPARISON OF THE NUCLEOTIDE and M220 with the type member (94.5% and 98.3%, SEQUENCES OF TWO ISOLATES OF Apple stem respectively), and with the Brazilian isolate UV01 grooving virus FROM APPLE PLANTS (95.8% and 96.6%). The daa identity between isolates Nickel, O.; Souza, E.B. de; Fajardo, T.V.M.; Barros, D.R. was 95% comparing the MP and 93.3% comparing the de CP. Financial Support: CAPES, CNPq. 1. EMBRAPA PIV261 - IDENTIFICATION OF CPMMV MOLECULAR 2. UNIVERSIDADE FEDERAL DE PELOTAS DETERMINANT INVOLVED IN SYMPTOM INDUCTION 3. EMBRAPA UVA E VINHO Zanardo, L.G.; Milanesi, D.F.; Alves, M.S.; Zerbini, F.M.; (ASGV), type-species of the Apple stem grooving virus Carvalho, C.M. genus Capillovirus, is present worldwide in Rosaceae fruit trees. Although usually latent in most commercial UNIVERSIDADE FEDERAL DE VIÇOSA cultivars, infected plants can display reduction in Cowpea mild mottle virus (CPMMV, family Betaflexiviridae, yield, death in the nursery or decline in the orchard. genus Carlavirus) is a serious problem in Brazilian Apparently decline is related to strain virulence and soybean. CPMMV is a RNA virus and has six open reading host susceptibility. We report on the comparison of frames (ORFs). CPMMV symptoms in soybean plants are two ASGV isolates from apple plants by nucleotide highly variable. It has been shown that isolates of the sequence analysis. Isolate M219-3: declining tree, severe same strain of CPMMV may exhibit necrosis or mosaic stem pitting; isolate M220: tree with normal growth, as symptoms in soybean plants cv. CD206. We believe no visible stem pitting, both cv. Fuji on Maruba-kaido that the symptoms variations can be associated with the rootstocks in SC, Brazil. Total RNA was extracted from occurrence of mutations in the viral genomes, because infected apple leaves using a silica capture protocol. successive inoculations of the same isolate change the RT-PCR primers were designed based on nucleotide symptoms pattern. So, the aim of this study was identify sequences of ASGV available in the GenBank. Five the CPMMV molecular determinant involved in the fragments of the isolate M219-3 amounting to 4353 nt symptoms induction by sequence analysis of the genome covering 67% of the virus genome; and two fragments of an isolate subjected to successive inoculations.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
201 Plant and Invertebrate Virology: PIV
CPMMV:BR:MG:09:02 isolate belonging to CPMMV-BR2 PIV264 - DIVERSITY OF SWEEPOVIRUS-ASSOCIATED strain, obtained by a local lesion in N. benthamiana plants, DNA SATELLITES IN Ipomoea indica (BLUE MORNING was submitted to mechanical inoculations in soybean GLORY): REVISITING THE SOUTHERN SPANISH plants cv. CD206 and necrosis symptoms were observed. POPULATIONS The successive inoculation in three new soybean plants Navas-Castillo, J.; Ferro, C.G.; Fiallo-Olive, E.; Zerbini, led to emergence of mosaic symptoms. To amplify the F.M. full viral genomes, the total RNA was extracted from each inoculated plant, followed by RT-PCR. Ten clones were 1. INSTITUTO DE HORTOFRUTICULTURA SUBTROPICAL Y MEDITERRÁNEA LA obtained from each viral ORF. Nucleotide sequences MAYORA were assembled using DNA BASER v.3.5 and the ORFs 2. BIOAGRO, UNIVERSIDADE FEDERAL DE were determined using ORF Finder. The sequences were VICOSA aligned in MEGA v.6.06 and the pairwise nucleotide comparisons were analyzed in SDT v2.1. Phylogenetic Begomoviruses (family Geminiviridae trees were constructed using Bayesian Inference for transmitted, plant-infecting single stranded (ss) DNA viruses that cause crop losses throughout) are the whitefly-warmer was implemented in the Datamonkey server. Sequences parts of the World. Sweepoviruses are a phylogenetically analyseseach coding showed sequence high similarityand site-specific (98-100%), selection but changesanalysis distinct group of begomoviruses that infect plants of the occurred in some sites of different viral proteins when family Convolvulaceae, including sweet potato (Ipomoea all genomic sequences were compared: one residue of batatas). Two classes of subviral molecules are often glutamic acid in the 90th position of CRP protein (ORF6) associated with begomoviruses, particularly in the Old was substituted by a glycine, one proline in 240th in World, the alphasatellites and the betasatellites. An CP (ORF5) was substituted by a serine, one glycine by analysis of sweet potato and blue morning glory (I. indica) an aspartic acid in TGB1 (ORF2, 134th position) and thirteen differences in amino acid (aa) residues were subviral circular ssDNA molecules in association with samples from Spain has previously identified small found in different portions of the viral polymerase several sweepoviruses. These molecules are non-coding (ORF1). The phylogenetic analyses exhibited a cluster among necrotic isolates for the same coding regions of to the conserved region of betasatellites, an A-rich and contain a region with significant sequence identity genome in which aa alterations were observed. Site- sequence, a predicted stem-loop structure containing the nonanucleotide TAATATTAC, and a second predicted underwent substitutions were under positive selection. stem-loop. The sweepovirus-associated satellites join an Then,specific it selectionis possible analyses that one showed or more that aa some residues aa which and increasing number of related ssDNA molecules for which proteins are involved in symptoms pattern caused by the name deltasatellites has been recently proposed. In CPMMV in soybean cv. CD206. Financial Support: CNPq, this work we have studied the diversity of deltasatellites CAPES. associated with sweepoviruses infecting blue morning glory plants by resampling the southern Spanish
uspopulations to gain insight where on they the were diversity detected and byphylogeography the first time. ofApplication these satellites of rolling-circle and the amplificationsweepoviruses (RCA) that allowedcan act as helper viruses. Financial Support: MINECO (Spain), CNPq and FAPEMIG.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
202 Plant and Invertebrate Virology: PIV
PIV265 - MELOCHIA - ANOTHER GENUS IN THE FAMILY brasilianum in Brazil. The DNA-B from this sample (2589 MALVACEAE WHICH IS HOST FOR BEGOMOVIRUSES nt) showed the highest nucleotide identity (80%) with IN BRAZIL Solanum mosaic Bolivia virus (HM585436). DNA-A from Fiallo-Olive, E.; Zerbini, F.M.; Navas-Castillo, J. sample B26 (2668 nt) showed the highest nucleotide identity (81%) with an isolate of tomato yellow spot 1. INSTITUTO DE HORTOFRUTICULTURA virus (KJ742419) from Argentina. DNA-B from this SUBTROPICAL Y MEDITERRANEA LA sample (2620 nt) showed the highest nucleotide identity MAYORA (79%) with two isolates of Sida micrantha mosaic virus 2. DEPARTAMENTO DE FITOPATOLOGIA E (HM585432 and HM585440) from Bolivia. We propose INSTITUTO DE BIOTECNOLOGIA APLICADA A AGROPECUARIA DA UNIVERSIDADE the names Melochia mosaic virus and Melochia yellow FEDERAL DE VICOSA mosaic virus for these begomoviruses. Financial Support: CNPq and FAPEMIG. The family Geminiviridae includes seven genera on the basis of phylogeny, genome organization, insect PIV267 - TWO NOVEL BEGOMOVIRUSES INFECTING vector and host range: Becurtovirus, Begomovirus, THE MALVACEOUS WEED Pavonia sp. IN BRAZIL Curtovirus, Eragrovirus, Mastrevirus, Topocuvirus and Pinto, V.B.; Silva, J.P.; Fiallo-Olivé, E.; Navas-Castillo, Turncurtovirus. Members of this family possess genomes J.; Zerbini, F.M. composed of one or two circular single-stranded DNA molecules encapsidated within twinned (geminate) 1. UNIVERSIDADE FEDERAL DE VIÇOSA 2. CONSEJO SUPERIOR DE INVESTIGACIONES quasi-icosahedral virions that are transmitted by the CIENTÍFICAS Bemisia tabaci and cause damage to important crops around the world. The genus Begomovirus is the The genus Begomovirus (family Geminiviridae) includes largestwhitefly in the family, with 307 accepted species listed in viruses that infect dicotyledonous plants and whose the most recently published taxonomic revision. In Brazil, genomes are composed of one or two molecules of begomoviruses are limiting factors for common bean and circular, single-stranded DNA. In nature, these viruses tomato production. A number of begomoviruses have are spread by the Bemisia tabaci sibling species group. been also found infecting non-cultivated plants, and it Begomoviruses cause severe diseases in economically has been suggested that these plants have been or could important crops throughout the tropics and subtropics, be a source of begomoviruses for infection of crops. Wild and are also frequently associated with non-cultivated malvaceous plants are hosts for an important number of plants. Malvaceous plants are one of the largest natural begomoviruses both in the Old World and the New World. begomovirus reservoirs in the Americas. As part of an During a survey carried out in Corumbá, Mato Grosso ongoing effort to assess begomovirus diversity and do Sul state (Brazil) on August 2014, two Melochia sp. the emergence of novel species, symptomatic Pavonia plants showing yellow mosaic symptoms were collected sp. (Malvaceae) plants were collected in the cities of Albuquerque (sample #51) and Corumbá (sample #40) in DNA barcoding using chloroplast rbcL and matK genes. Mato Grosso do Sul state, Brazil, in September 2014. Total Total(samples DNA B25 was and extracted B26). Plant from genera fresh wereleaf tissue identified and usedwith DNA was extracted and the presence of a begomovirus complete genome components (DNA-A and DNA-B) were Full-length genomic components were cloned after was confirmed by rolling-circle amplification (RCA). obtainedas a template after digestion in rolling-circle of RCA products amplification. with restriction Putative monomerization with restriction enzymes and were enzymes, cloned and completely sequenced. The cloned completely sequenced. DNA-A and -B components were bipartite genomes showed the typical organization of cloned for the two Pavonia samples. All four components the New World begomoviruses but are distantly related have the conserved nonanucleotide that contains the to species known to date. The DNA-A from sample origin of replication (5’-TAATATTAC-3’). That the A and B B25 (2624 nt) showed the highest nucleotide identity components from each sample are cognate components (82%) with Centrosema yellow spot virus (GenBank of a bipartite begomovirus is indicated by their identical acc. # JN419002), a begomovirus found in Centrosema iteron sequences (GGTG for the components from
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
203 Plant and Invertebrate Virology: PIV sample #40; GGGG for the components from sample (EuYMV) infecting Euphorbia heterophylla plants in #51) and by the digestion of the RCA products from each Brazil. The aim of this study was to evaluate whether sample with a 4-base cutter restriction enzyme, which the Rep protein of the EuYMV-associated alphasatellite indicates that they were the only two DNA components possesses RNA silencing suppressor activity. The present in each sample. All four DNA components complete coding sequence of the alpha-Rep gene of have the typical organization of New World, bipartite this alphasatellite was cloned in a binary vector and subsequently transformed in Agrobacterium tumefaciens ORFs in the DNA-B. Pairwise sequence analysis of the DNA-Abegomoviruses, indicated with that five the ORFs two in isolates, the DNA-A named and twoBR- construct in Nicotiana benthamiana plants. The plants Cor40-14 and BR-Alb51-14, have 87% nucleotide werecells. Anexamined agroinfiltration and photographed assay was performedunder UV lightwith 2this to sequence identity with each other and <82% identity with previously described begomoviruses. The two DNA-B components are 89% identical and have <79% known10 days silencingafter infiltration suppressor (dai) (HCPro to observe of Potato the expression virus Y), identity with other begomoviruses. The most closely inof greenthe presence fluorescent of theprotein candidate (GFP) proteinin the presence (alpha-Rep) of a related species is Abutilon mosaic Bolivia virus (AbMBoV) for both components. Based on the begomovirus species GFP + alpha-REP showed no signal of GFP expression demarcation criteria, each isolate comprises a new afterand alone 8 dai, (no similar other to protein). plants inoculated Plants agroinfiltrated with GFP alone, with begomovirus species for which we propose the names indicating that the expression of GFP was effectively Pavonia yellow mosaic virus (PavYMV) (BR-Cor40-14) and Pavonia mosaic virus (PavMV) (BR-Alb51-14). showed strong GFP expression even at 10 dai. Thus, Financial Support: CNPq, FAPEMIG. wesilenced. conclude Plants that the agroinfiltrated alpha-Rep protein with GFPof the + EuYMV- HCPro associated alphasatellite does not act as an RNA silencing PIV268 - ASSESSMENT OF THE RNA SILENCING suppressor. Financial Support: CAPES, CNPq, FAPEMIG. SUPPRESSOR ACTIVITY OF THE ALPHASATELLITE ASSOCIATED WITH EUPHORBIA YELLOW MOSAIC PIV272 - THE SILENCING SUPPRESSOR (NSS) VIRUS PROTEIN OF THE PLANT VIRUS Tomato spotted Mendes, I.R.; Mar, T.B.; Basso, M.F.; Fiallo-Olivé, E.; wilt virus ENHANCES HETEROLOGOUS PROTEIN Navas-Castillo, J.; Zerbini, F.M. EXPRESSION AND BACULOVIRUS PATHOGENICTY IN CELLS AND LEPIDOPTERAN INSECTS 1. UNIVERSIDADE FEDERAL DE VIÇOSA 2. CONSEJO SUPERIOR DE INVESTIGACIONES Oliveira, V.C.; Morgado, da S.F.; Ardisson-Araújo, CIENTÍFICAS M.P.D.; Resende, R.O.; Ribeiro, M.B. The majority of Old World monopartite begomoviruses 1. UNIVERSIDADE FEDERAL DO TOCANTINS (family Geminiviridae) are associated with satellite DNAs. 2. UNIVERSIDADE DE BRASÍLIA NSs is a Tomato spotted wilt virus (TSWV) protein that alphasatellitesThese can be classifiedcontains asa single alphasatellites alpha-Rep (also gene known that of gene silencing. We have previously shown that encodesas DNA1) a andprotein betasatellites essential (orfor DNAβ).replication, The genomesimilar toof thiswas protein identified expressed in infected by planta recombinant cells as a baculovirus suppressor the Rep protein encoded by the DNA-R component (vAcNSs) derived from Autographa californica multiple of nanoviruses (family Nanoviridae). Consequently, nucleopolyhedrovirus (AcMNPV) can suppress gene alphasatellites are capable of autonomous replication, silencing activity associated to egfp transcripts in but depend on the helper virus for movement, permissive and semipermissive lepidopteran insect encapsidation and transmission by the insect vector. cell lines. In this work, we showed that cell death The Rep proteins encoded by two alphasatellites induced by vAcNSs was enhanced on permissive and isolated from cotton plants in Pakistan acts also as an semipermissiveinsect cell lines. In a cytotoxicity assay, in RNA silencing suppressor. Recently, alphasatellites were comparison to the wild type AcMNPV, vAcNSs resulted found in association with Euphorbia yellow mosaic virus in an enhancement of 2% (BTI-Tn-5B1-4) and 1.5%
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
204 Plant and Invertebrate Virology: PIV
(UFL-AG-286) in cell death, respectively. The expression the biological characterization. The two genomic components of both viruses are phylogenetically related infection of insect cells with vAcNSs and a second to NW begomoviruses. Nevertheless, their DNA-A of a heterologous gene (firefly luciferase) during co- components exhibited a highly divergent 5’ half, including part of the intergenic region, the CP gene, and an AV2- recombinant baculovirus (vAgppolhfluc) showed a like gene (which is present only in OW begomoviruses). infections.significant Furthermore,increase of 25 the times vAcNSs of luciferase mean time activity to death in The deduced amino acid sequences of the CP and AV2- BTI-Tn-5B1-4 when compared to single vAgppolhfluc like proteins had very low identities with either NW wild type AcMNPV on larvae of Spodoptera frugiperda or OW begomoviruses, having greater similarity with a and(MTD) Anticarsia values weregemmatalis. significantly Bioassays lower were than performed those for by intrahaemocoelic injection of the baculovirus budded apple trees in China. The presence of conserved motifs in virus form (1 to 105 thedivergent CP and monopartite Rep coding geminivirusregions which recently are characteristic identified in of OW begomoviruses was also detected. Both viruses larvae of S. frugiperda pfu/larvae). The vAcNSs MTD values infected plants in the Malvaceae and Solanaceae families 10were5 significantly lower thanA. gemmatalis those for AcMNPV on and 6.65 days with 10 5[MTD BVs, respectively).of 4.93 and 7,45 These days results with does not seem to be transmitted by B. tabaci MEAM1, BVs, respectively] and [MTD of 4.51 a(the result latter that with is notvery entirely low efficiency). unexpected Interestingly, considering SiYSV the improve heterologous protein expression in insect cells high level of divergence of its CP. Our results indicate andshowed baculovirus that the pathogenicity TSWV-NSs and protein virulence could by efficiently probably that the origin of SiYSV and SiGYMV involves an ancient suppressing gene silence machinery in insects. Financial recombination event between a OW-like begomovirus Support: CNPq e FAP-DF. and a divergent geminivirus. Further characterization of cssDNA viruses infecting non-cultivated hosts may PIV 273 - BIOLOGICAL AND MOLECULAR shed additional light into their origin, and may lead us to CHARACTERIZATION OF TWO OLD-WORLD-LIKE reconsider the division of begomoviruses into NW and BEGOMOVIRUSES INFECTING THE NON-CULTIVATED OW viruses. Financial Support: CAPES, CNPq, FAPEMIG. PLANT Sida acuta IN BRAZIL Xavier, C.A.D.; Godinho, M.T.; Trindade, A.T.; Lima, PIV274 - COMPARATIVE ANALYSYS OF BIPARTITE A.T.M.; Silva, J.P.; Zerbini, F.M. BEGOMOVIRUS GENETIC VARIABILITY BASED ON THE DNA-A AND DNA-B COMPONENTS UNIVERSIDADE FEDERAL DE VIÇOSA Xavier, C.A.D.; Godinho, M.T.; Silva, J.C.; Sobrinho, The genus Begomovirus (family Geminiviridae) R.R.; Sande, O.F.L.; Zerbini, F.M. is comprised of viruses with one or two circular, single-stranded DNA (cssDNA) genomic components UNIVERSIDADE FEDERAL DE VIÇOSA transmitted by the Bemisia tabaci sibling species group Knowledge of how pathogens evolve and what to dicotyledonous plants, and includes important mechanisms operate in this process is critical to adopt plant pathogens responsible for severe losses in many economically important crops worldwide. Begomoviruses genus Begomovirus (family Geminiviridae) is comprised are divided into New World (NW) and Old World (OW) ofcontrol viruses strategies with a thatmono- are or efficient bipartite and single-stranded durable. The groups based on genomic organization and phylogenetic DNA (ssDNA) genome transmitted by B. tabaci, and relationships. In this study, we performed the biological includes important plant pathogens responsible and molecular characterization of Sida yellow spot virus for severe losses in many economically important (SiYSV) and Sida golden yellow mosaic virus (SiGYMV), crops worldwide. Although there are several studies two OW-like begomoviruses isolated from samples of the addressing evolutionary aspects shaping the structure non-cultivated plant Sida acuta collected in Viçosa, state of begomovirus populations, these studies are based on of Minas Gerais, in December 2011. The viral genome analysis of the DNA-A component. Here, we performed a comparative analysis of the evolution of DNA-A and clones (DNA-A and DNA-B) were generated to perform DNA-B in New World (NW) begomoviruses based on was amplified by RCA, cloned and sequenced. Infectious October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
205 Plant and Invertebrate Virology: PIV populations of four viral species infecting cultivated range of those already describe for other begomoviruses and non-cultivated hosts. Our results demonstrate that were found also for the CP, Rep, MP and NSP genes in both the DNA-B, as well as the DNA-A, segregates based on geographical origin. In most data sets analyzed, the substitutions, transversions and transitions, as well DNA-B was more variable than the DNA-A. The exception ashosts. deletions We quantified and insertions synonymous in the and CP, Rep,non-synonymous MP and NSP was Macroptilium yellow spot virus (MaYSV), for which genes. A decrease in the number of variable sites was the DNA-A was more variable than the DNA-B due to a observed during the course of the experiment, with recombination event at the interface between the Rep a corresponding increase in the number of identical gene 5’ region and the intergenic region. Nevertheless, sites to the reference genome. Suppression of the stop the DNA-B was most prone to recombination than the codons of the MP and NSP genes was observed in the N. DNA-A, with a higher number of events. Interestingly, physaloides libraries, suggesting an adaptive strategy. we detected small ORFs in the complementary-sense Determination of Shannon entropy indicated mutation strand of the large intergenic region of the DNA-B of hotspots in the N-terminal region of Rep gene, the several MaYSV isolates. These ORFs are homologous to intergenic common region in the DNA-A and DNA-B the Rep gene located in the DNA-A, indicating occurrence (CR-A and CR-B, respectively) and the long intergenic of intercomponent recombination events. Our results region between the MP and NSP genes in the DNA-B indicate the two DNA components of New World (LIR-B). Overall, the results indicate that ToSRV evolves begomoviruses have similar evolutionary histories. The as a quasispecies, with a high degree of genetic variability higher degree of genetic variability of the DNA-B may which could be partly responsible for its prevalence in functions encoded by its proteins can, to some extent, bereflect provided weaker by selection the proteins pressures encoded due by to thethe factDNA-A. the thePIV276 field. -Financial RHYNCHOSIA Support: GOLDEN CNPq, FAPEMIG. MOSAIC YUCATAN Financial Support: CAPES, CNPq, FAPEMIG. VIRUS INFECTING SOYBEAN IN CUBA Xavier, C.A.D.; Leyva, R.M.; Quiñones, M.; Acosta, K.; PIV275 - INTRA-HOST EVOLUTION OF Tomato severe Piñol, B.; Zerbini, F.M. rugose virus (TOSRV) 1. UNIVERSIDADE FEDERAL DE VIÇOSA Godinho, M.T.; Pinto, V.B.; Silva, J.C.; Zerbini, F.M. 2. UNIDAD DE EXTENSIÓN, INVESTIGACIÓN UNIVERSIDADE FEDERAL DE VIÇOSA Y CAPACITACIÓN AGROPECUARIA DE HOLGUÍN To evaluate and quantify the mutational dynamics of 3. CENTRO NACIONAL DE SANIDAD the bipartite begomovirus Tomato severe rugose virus AGROPECUARIA (ToSRV) in a cultivated and a non-cultivated host, plants 4. UNIVERSIDAD VLADIMIR ILICH LENIN DE of tomato and Nicandra physaloides were biolistically LAS TUNAS inoculated with an infectious clone and the leaves Begomoviruses (family ) are single- sampled at 30, 75 and 120 days after inoculation. Total Geminiviridae DNA was extracted and sequenced in the Illumina Bemisia ), which cause serious diseases in economically HiSeq 2000 platform. The datasets were trimmed with tabaci importantstranded DNA crops viruses in tropical transmitted and subtropical by whiteflies regions. ( In the quality score limit set to 0.01, and the assembly the Americas, begomovirus infections are common in was performed using the infectious clone sequence bean, soybean, cucurbit, pepper and tomato crops, and as reference. We inferred high rates of nucleotide also in several species of non-cultivated plants, mostly substitution for the two DNA components in both hosts: in the Fabaceae, Malvaceae and Solanaceae families. In 3.06 x 10-3 and 2.03 x 10-3 Cuba, begomoviruses have emerged as one of the main and DNA-B, respectively, in N. physaloides, and 1.38 x 10-3 pathogens that limit production of leguminous and and 8.68 x 10-4 sub/site/year for the DNA-A respectively, in tomato. These values are similar to those Dec 2014, 57 soybean samples from plants showing estimated for othersub/site/year begomoviruses the for and DNA-A for viruses and DNA-B, with begomovirus-likesolanaceous crops. symptomsIn surveys ofincluding soybean brightfields inyellow Nov- single-stranded RNA genomes. Substitution rates in the
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
206 Plant and Invertebrate Virology: PIV
proteins of plant and animal viruses in the families collected in the province of Holguín (eastern region Potyviridae and Caliciviridae. However, alignment of mosaic, blistering in the leaves and floral abortion were the RdRp revealed the presence of six conserved motifs fragment length polymorphism analyses evidenced from members of the family Partitiviridae. Interestingly, thatof Cuba). a begomovirus Rolling circle was amplificationassociated with and symptomatic restriction BLASTp searches of the putative CP revealed identity plants. Sequences of six DNA-A clones were obtained, only with the putative CP of Botryosphaeria dothidea with 99.5% identity between each other. The full- partitivirus 1 (BdPV1), a recently described divergent length sequence of one DNA-A clone (GenBank acc. partitivirus. Phylogenetic analysis based on the RdRp # KT192632), comprising 2581 nucleotides, showed grouped the virus, provisionally named Alternaria highest identity (92%) with Rhynchosia golden mosaic partitivirus 1 (AtPV1), with BdPV1, comprising a Yucatan virus (RhGMYuV, EU021216). Based on its distinct lineage in the genus Gammapartitivirus. Vertical genome organization and according to ICTV guidelines, it transmission tests showed that AtPV1 was transmitted corresponds to a distinct strain of this species. RhGMYuV to 100% of the conidial progeny, and standard curing has been reported in Rhynchosia minima in several Latin was unable to eliminate it from the host, characterizing American countries, including Cuba, and also in soybean it as a persistent virus. On the other hand, horizontal and tomato crops in Mexico and Ecuador, respectively. transmission was not possible for the tested species. We have now reported its presence in soybeans in The absence of a virus-free isogenic strain prevented us from assessing details of the virus-host interaction, and infection in soybean crops in the country. Unusual for therefore it remains unclear whether the phenotypic begomoviruses,Cuba, which is RhGMYuV also the firstseems report to be ofwell begomovirus adapted to plasticity phenomenon is associated with AtPV1 infect both cultivated and non-cultivated hosts. Financial infection. Keywords: Persistence, virus-host association Support: CAPES, CNPq, FAPEMIG. and phenotypic plasticity. Financial Support: CNPq, CAPES, FAPEMIG. PIV286 - A NOVEL MYCOVIRUS ASSOCIATED TO SAPROPHYTE Alternaria alternata BELONGS TO A PIV287 - TRANSFORMING LIFESTYLES: A VIRUS DISTINCT LINEAGE IN Gammapartitivirus CONVERTS THE DESTRUCTIVE PLANT PATHOGEN Xavier, A.S.; Barros, A.P.O.; Godinho, M.T.; Zerbini, Ralstonia solanacearum INTO A COMMENSAL F.M.; Queiroz, M.V.; Alfenas-Zerbini, P. MICROBE Xavier, A.S.; Magalhães, L.L.; Lopes, C.A.; Alfenas- UNIVERSIDADE FEDERAL DE VIÇOSA Zerbini, P. Mycoviruses are widely distributed in all major 1. UNIVERSIDADE FEDERAL DE VIÇOSA also in oomycetes, and their genomes are predominantly 2. EMBRAPA HORTALIÇAS-CNPH comprisedtaxonomic groupsof double-strande of filamentous RNA fungi (dsRNA) and yeasts,molecules. and Filamentous bacterial viruses containing single- The presence of dsRNA in an Alternaria alternata stranded DNA (ssDNA) genomes have a peculiar lifestyle strain that displays phenotypic plasticity draw our compared to other bacterial viruses, because they do interest, and the objective of this study was to perform not cause cell lysis, but rather establish a persistent the molecular and biological characterization of association with the host, often causing behavioral this putative mycovirus. The complete genome was changes. For years, an intriguing phenomenon occurred sequenced and is comprised of two dsRNA molecules, in newly farmed deforested area in Brazil characterized the largest (dsRNA1) with approximately 1796 bp, by a downward trend in the incidence of the bacterial encoding a putative RNA-dependent RNA polymerase wilt caused by Ralstonia solanacearum, after a very high (RdRp), and the smallest (dsRNA2) being 1624 bp in length, encoding the putative capsid protein (CP). attempt to elucidate the factors associated with this BLASTp searches of the RdRp revealed low identity with phenomenon,incidence during a strainthe first of cropR. solanacearum cycle in the area.(UB2014) In an partial RdRps of members of the family Partitiviridae, obtained from one of these areas was investigated. and similar low identity with polyproteins and NIb
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant andPathogenicity Invertebrate Virology: tests PIV in tomato confirmed the loss of XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
207 Plant and Invertebrate Virology: PIV virulence of this strain. To verify if the presence of in soil even in the absence of a host plant. Several economically important crops are affected by this fungus like particles (VLPs) from a UB2014 colony. Total nucleic worldwide. In this context, our objective was to detect acidsviruses were was extractedrelated to thefrom phenotype, DNase- and we purifiedRNase-treated virus- and characterize mycoviruses in S. sclerotiorum. Double-
of S. sclerotiorum. In one of them, six dsRNA segments indicatedVLPs, and itsa 9-10 ssDNA kb nucleicnature. acidThe fragmentputative ssDNA was identified. genome werestranded detected, RNA (dsRNA)suggesting was that purified this particular from 12 isolatesisolate Digestion of this VLP-purified nucleic acid with nucleases is infected by a mycovirus. These dsRNA segments are being sequenced. We obtained an isogenic virus-free line proteinswas amplified indicates with that the thephi29 UB2014-associated DNA polymerase, virus cloned is to compare the physiological characteristics between relatedand completely to species sequenced. in the genus The Inovirus profile. The of structuralvirus was the virus-infected and virus-free lines. Pronounced transmitted to the aggressive R. solanacearum strain changes were observed in the virus-infected line, GMI1000. Upon infection, GMI1000 showed abnormal including delay in mycelial growth, changes in the shape culture characteristics such as frequent aggregation and pigmentation of the colony, drastic reduction in the and the production of a brown pigment. Tomato plants number of sclerotia and low production of oxalic acid. inoculated with Rs UB2014 did not show any symptoms. The virus-free line exhibits a typical phenotype of S. Interestingly, virus-infected Rs GMI1000 caused only sclerotiorum. The virus infected line was not capable mild symptoms in tomato plants, which eventually of inducing disease under controlled conditions, while reversed so that the plants developed normally, similar plants inoculated with the virus-free line showed typical to negative controls. The presence of Rs UB2014 and symptoms of white mold. These distinctive patterns virus-infected GMI1000 in the xylem vessels of plants observed between the virus-infected and virus-free without any symptoms after 3 months demonstrates lines suggest that the mycovirus modulates these the drastic change in lifestyle of the pathogen. Assays potentiate the use of this mycovirus as a tool for studies to elucidate the mechanisms involved in the modulation oncharacteristics the mechanisms of the of host fungal fungus. pathogenicity Together, these as well findings as its ofare the under parasitic way to plant-bacteria confirm the identityrelationship. of the Keywords: virus and use as a biocontrol agent. Keywords: Mycovirus, White Ecology, phage, viral infection. Financial Support: CNPq, mold disease, hypovirulence. Financial Support: CNPq, CAPES, FAPEMIG. CAPES, FAPEMIG.
PIV288 - MOLECULAR AND BIOLOGICAL PIV304 - BIOLOGICAL AND MOLECULAR CHARACTERIZATION OF A MYCOVIRUS INFECTING CHARACTERIZATION OF A BACTERIOPHAGE THE PHYTOPATHOGENIC FUNGUS Sclerotinia SPECIFIC TO Xanthomona scampestris pv. campestris sclerotiorum Silva, F.P.; Xavier, A.S.; Vidigal, P.M.P.; Alfenas-Zerbini, Barros, A.P.O.; Xavier, A.S.; Queiroz, M.V.; Alfenas- P. Zerbini, P. UNIVERSIDADE FEDERAL DE VIÇOSA UNIVERSIDADE FEDERAL DE VIÇOSA Viruses that infect phytopathogenic bacteria have gained The mycoviruses are distributed in all major taxonomic increased interest due to their potential use as biocontrol groups of fungi. The association established between agents. Black rot, caused by the Gram-negative bacterium mycoviruses and their hosts may occur in a latent form Xanthomonas campestris pv. campestris (Xcc), is one of or can change the phenotype of the host causing hyper- the most important diseases infecting all cultivated or hypovirulence. Viruses that cause hypovirulence varieties of brassicas worldwide. This study aimed have been studied as potential agents for biocontrol to isolate and characterize bacteriophages capable of of phytopathogenic fungi. Sclerotinia sclerotiorum, infecting Xcc. To this, plants of the Brassicaceae family the causal agent of white mold, is a fungus adapted to showing symptoms of black rot, as well as rhizospheric several soil and climatic variations, and which developes soil of these plants, were collected and screened for the resistance structures that confer the ability to survive presence of bacteriophages by lysis assay. One phage
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
208 Plant and Invertebrate Virology: PIV was isolated from leaves of infected plants, and showed populations in non-cultivated hosts can provide valuable an icosahedral head with approximately 30 ± 5 nm in clues in terms of the likelihood of these population diameter and a short tail with 6 ± 0.2 nm in length and 7 to evolve and infect crops. The objective of this work ± 0.2 nm in diameter. The genome is composed of a single was to study the diversity, variability and population double-strande DNA (dsDNA) molecule. The genome was structure of begomoviruses infecting E. heterophylla completely sequenced and the analysis showed that it has in Brazil. Samples showing yellow mosaic, leaf curling, 61,830 Kpb with a bidirectional organization, encoding and stunting were collected in Amazonas, Goiás, Mato 81 predicted open reading frames (ORFs). The phage Grosso do Sul, Minas Gerais, Paraná, Pernambuco, Rio was provisionally named phiXacp1. In a susceptibility Grande do Sul and Santa Catarina between 2009-2014. test, phiXacp1 showed the ability to infect only isolates Total DNA was extracted and used as a template for of Xanthomonas campestris pv. campestris. Bacteria of related and unrelated species, including Xanthomonas cleaved with restriction enzymes, cloned and completely vesicatoria, Xanthomonas campestris pv. viticula, sequenced.rolling-circle EuYMV amplification was the only (RCA). virus RCA detected products in the were E. Ralstonia solanacearum, Clavibacter michiganensis, heterophylla samples (126 infected plants out of 165 Pseudomonas syringae pv. tabaci, Pectobacterium brasilienses, Erwinia psidii and Escherichia coli, were not 148 DNA-A clones), with >96% identity with EuYMV- susceptible to infection. Together, these results indicate BR:Taquara8880:2009tested). We identified (GenBank 139 DNA-A acc. haplotypes # JF756673). (out Two of and virulence that motivate future studies for its use as location, one corresponding to isolates from AM, GO, athat biocontrol phiXacp1 agent presents of black ideal rotcharacteristics in brassicas. of Keywords: specificity subpopulations were identified based on geographical Phages, biocontrol, Black rot disease. Financial Support: CNPq, CAPES, FAPEMIG. wereMG and genetically PE (“North”), mixed, and suggesting the other that to isolatesMS could from be thePR, RScenter and ofSC diversity (“South”). of Interestingly, the virus. One isolates recombination from MS PIV305 - GENETIC DIVERSITY AND POPULATION event was detected among isolates from Rio Grande do STRUCTURE OF THE BEGOMOVIRUS EUPHORBIA Sul, encompassing the CP, Trap, Ren and the 5’ region of YELLOW MOSAIC VIRUS the Rep gene. The vast majority of amino acid sites in the Mar,T.B.; Silva, J.C.F.; Nogueira, A.; Ramos, R.; Lemos, CP and Rep genes were negatively selected, however site P.; Lau, D.; Zerbini, F.M. 347 of Rep was positively selected. Together, our results 1. UNIVERSIDADE FEDERAL DE VIÇOSA indicate that the EuYMV population evolves rapidly, with 2. UNIVERSIDADE FEDERAL DE ALAGOAS a great potential to generate novel variants. Financial 3. INSTITUTO DE HORTOFRUTICULTURA Support: CAPES, CNPq and FAPEMIG. SUBTROPICAL Y MEDITERRÁNEA 4. CENTRO NACIONAL DE PESQUISA DE TRIGO PIV328 - VIRAL MOLECULAR DIAGNOSE ASSOCIATE WITH INSECT VECTORS ON CITRULLUS LANATUS Species of the genus Begomovirus (family Geminiviridae) (WATERMELON) AND CUCUMIS MELO (MELON) cause serious economic losses in tropical and subtropical IN THE STATE OF TOCANTINS, REGION NORTH OF crops worldwide. The emergence of begomoviruses in BRAZIL Brazil probably occurred by horizontal transfer from Teixeira, E.C.; Amui, G.C.; Lima, H.C.; Belchior, D.C.V.; non-cultivated plants after the introduction of Bemisia Ságio S.; Santos, G.R.; Sarmento, A.R.; Oliveira, V.C. tabaci Middle East-Asia Minor 1 (MEAM1). The center of diversity of Euphorbia heterophylla (Euphorbiaceae) is UNIVERSIDADE FEDERAL DO TOCANTINS located in Brazil and Paraguay, where it is an important invasive species in soybean and other crops. Reports pathogens is extremely important because it is the of possible begomovirus infection of E. heterophylla in Molecular diagnostic tests for the identification of plant Brazil date back to the 1950’s. In 2011, Euphorbia yellow such as viruses. In the north region of Brazil, in the mosaic virus (EuYMV) was described in symptomatic Stateinability of Tocantins,of some pathogens in two commercial growing in crops artificial of Citrullus media, plants collected in the state of Goiás. The study of viral lanatus (watermelon): one in dried area (W1) and
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
209 Plant and Invertebrate Virology: PIV other in lowland area (W2), besides of a crop Cucumis onto D. stramonium plants and from there serially melo (melon) crop in lowland area (M1). The leafs were mechanically inoculated in N. benthamiana for at least 17 (p105) and 20 (BR-20) times at high inoculum February 21 st of 2015 and July 24 th of 2015. The leafs pressure (1:10 dilution). Northern blot analysis, using fromcollected 49 plantsand the were insects collected were identified in order weekly to analyze between the a riboprobe derived from a fragment of the L segment, presence of Tospovirus and Carlavirus through PCR of samples from the 2nd and 16th passages of p105 and 2nd and 19th passages for BR-20 showed low levels of a for the presence of Potyvirus through ELISA (The enzyme- single species of defective interfering RNA (DI) for the linked(Polymerase immunosorbent Chain Reaction) assay) with experiment. specific primers, Total plant and former at both stages, while the latter had high levels of RNA was extracted with the Trizol (invitrogen) according two DIs as early as the 2nd passage that were succeeded to manufacturer’s instructions. In order to obtain viral by a single predominant species of DI with a smaller cDNA, reverse transcription (RT) was conducted using size at the 19th passage. Unexpectedly, however, when approximately 1 µg of viral RNA using High Capacity Kit the same samples at the same passage points were tested with riboprobes for fragments of the N and NSs primers (Agdia) for each virus group analyzed. Positives mRNAs, isolate p105 showed an extra viral RNA species results(Applied to Biosystems). Carlavirus PCRgroup were were performed obtained with with specific an that signaled strongly at a position higher than that of amplicon of 260 bp in sample collected in the W1 crop. the genomic S RNA. Moreover, this new RNA species was only present in the samples from the 16th passage, there sequenced to detect these viruses species. In the same being no sign of novel S RNA-derived molecules in the periodThese amplifiedthe presence fragments of White will Flies be further (Bemisia cloned tabaci and), samples from the 2nd passage. No sign of such S RNA- important vector for the Carlavirus derived molecules was detected for the BR-20 samples. those collected leaves. To our knowledge, this was the Furthermore, the 2nd and 16th serial passages of p105 Carlavirus occurring on were cucurbits identified in the on and 2nd and 19th passages of BR-20 were inoculated once State of Tocantins. The ELISA was performed using in N. rustica plants and evaluated for the maintenance of PathoScreenfirst report of® Poty (Agdia), according to manufacturer’s the new S-derived RNA. Results showed that there was recommendations. Positive results for Potyvirus group still some sign of the novel viral RNA species in two out were obtained in 21 samples from the W1, in 12 samples of three infected samples for p105, but their levels were th from the W2 and in 7 samples from the M1, and in both greatly diminished at the 17 passage point. In addition, crops were found Winged Aphids, important insects with a riboprobe derived from the M RNA, isolate p105 vectors of Potyvirus, and Thrips Flanklinella ssp. These showed lower levels of genomic molecules in N. rustica results are important to control measures that will be at the 17th passage when compared with the 3rd. Western developed in these areas and to compare where these blot results from N. benthamiana infected with isolate disease and vector insects have occurred in other states p105 showed that there was a slight increase in NSs of the country. Financial Support: CNPq. from the 3rd to the 17th passage, but slight decrease of N levels, which was unexpected. Interestingly, there was a PIV366 - DISCOVERY OF A NEW, POSSIBLY DIMER- notable reduction in the levels of the NSm protein both LIKE, VIRAL RNA SPECIES DERIVED FROM THE S RNA at the 16th, and in repetition, at the 17th passages. Taken OF AN ITALIAN ISOLATE OF TOMATO SPOTTED WILT together, these results present different host adaptation VIRUS AND ITS EFFECTS ON VIRAL GENE EXPRESSION strategies for isolates of a same species, TSWV, and point Bertran, A.G.M.; Resende, R.O.; Turina, M. out to the different roles of distinct plant host cellular 1. PPG-BIOMOL environments in viral replication and gene expression. 2. IB-BIOCEL 3. IPSP 03), CNPq (coop. bilateral), CNR. Financial Support: CAPES (nº p. 99999.001310/2014- Two isolates of Tomato spotted wilt virus (TSWV, Tospovirus - Bunyaviridae) coming from Brazil (BR-20) and Northern Italy (p105) were thrips-transmitted
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
210 Plant and Invertebrate Virology: PIV
PIV384 - FIRST REPORT OF MAIZE CHLOROTIC PIV389 - A NOVEL VIRAL SPECIES INFECTING DWARF VIRUS INFECTING FORAGE CROPS IN BRAZIL STYLOSANTHES IN BRAZIL Silva, K.N.; Melo, F.L.; Silva, M.S.; Fernandes, C.D.; Silva, K.N.; Mendes, J.; Melo F.L.; Silva, M.S.; Fernandes, Nagata, T.; Resende, R.O. C.D.; Nagata, T.; Resende, R.O. 1. UNIVERSIDADE DE BRASÍLIA 1. UNIVERSIDADE DE BRASÍLIA 2. EMBRAPA RECURSO GENÉTICOS E 2. EMBRAPA RECURSO GENETICOS E BIOTECNOLOGIA BIOTECNOLOGIA 3. EMBRAPA GADO DE CORTE 3. EMBRAPA GADO DE CORTE Panicum sp. and Brachiaria sp. are tropical grasses used Stylosanthes is a genus of leguminous plant used in as pasture for cattle feeding. In recent years, plants association with grasses to cattle feed, due to its higher showing virus-like symptoms have been observed in the main pasture grass growing areas. Plants of Panicum microorganisms. These plants have been used in savanna and Brachiaria showing typical virus mosaic symptoms regions,protein especially contend andduring its the association drought season. with Recently, N-fixing on leaves and growth reduction were collected in Mato mosaic symptoms have been observed in Stylosanthes
Embrapa Beef Cattle. In order to identify and characterize presence of viruses, which is rarely reported in this theGrosso viruses do Sul present State, in Brazil, these in plants, the experimental symptomatic field leaves of plant.fields Using of Mato leaves Grosso with domosaic Sul state,symptoms, suggesting elongated the particles typical Potyviridae family were observed by viral RNA was extracted using RNeasy Mini Kit. The transmission electron microscope. In order to identify RNAwere samples collected were and pooled virus particlesand sequenced were purifiedat Macrogen and INc. (Korea) using Illumina HiSeq 2000 technology. We and viral RNA was extracted using RNeasy Mini Kit obtained approximately 20,299,626 reads, which were followingand characterize the manufacturer’s the viruses, instructions. particles were RNA samples purified trimmed and assembled de novo using CLC Genomics were pooled and sequenced at Macrogen INc. (Korea) Workbench 7.0. The assembled contigs (3,254) were using Illumina HiSeq 2000 technology. About 20 million submitted to Blastx against the RefSeq Viral database reads were obtained, trimmed and assembled de novo and the contigs related to plant viruses were selected. using CLC Genomics Workbench 7.0. The assembled As a result, the complete genome of a new virus isolate contigs (3,254) were submitted to blastx against the from the family Secoviridae Viral RefSeq database and the contigs related to plant presented highest amino acid identities of 75% and viruses were selected. A partial genome (9525 nt) was 84% for its coat protein (CPs) was and identified. polymerase This (Pro- virus assembled and the sequence analysis suggested that Pol), respectively, with Maize chlorotic dwarf virus (MDCV) isolates. According to the Secoviridae species Potyviridae. Comparing the coat protein (CP) sequence demarcation criteria this isolate belongs to the MCDV withthis virus available is indeed CP sequences a novel inspecies/genus GenBank, the in most the closelyfamily species. Furthermore, primers to detect this virus in related was Rose yellow mosaic virus (RYMV), showing the surveyed hosts Panicum sp. and Brachiaria sp. were 51% nucleotide identity. When using the partial genome, designed. In addition, phylogenetic analyses are being we found 52% nucleotide identity with RYMV. According conducted to uncovers evolutionary history of the to the Potyviridae species demarcation based on CP identity, this new virus belongs to the Potyviridae family species. Financial Support: CAPES/CNPq. RT-PCR,and possibly cloning to and a novel Sanger genus. sequencing. Specific Host primers range were and phylogeneticdesign to confirm analysis the are complete being conducted genomic sequence for further by
CNPq. characterization of this virus. Financial Support: CAPES/
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
211 Plant and Invertebrate Virology: PIV
PIV401 - TOSPOVIRUSES GLOBAL SPREAD: THE one is circulating in USA and the other between Europe PHYLODINAMIC AND PHYLOGEOGRAPHY OF and Asia. Financial Support: CNPq. TOMATO SPOTTED WILT VIRUS, TOMATO CHLOROTIC SPOT VIRUS AND IRIS YELLOW SPOT VIRUS PIV404 - URTHER EVIDENCE OF LOCAL EVOLUTION OF WEED-INFECTING BEGOMOVIRUSES IN Almeida, M.M.S.; Ferreira, F.A.; de Oliveira, A.S.; Melo, BRAZIL: MOLECULAR CHARACTERIZATION AND F.L.; Resende, R.O. PRODUCTION OF INFECTIOUS CLONES OF A NEW 1. UNIVERSIDADE DE BRASILIA SPECIES INFECTING SIDA SP. FROM THE STATE OF 2. HARVARD UNIVERSITY PIAUÍ The diversity of the genus tospovirus comprises 11 Macedo, M.A.; Maliano, M.R.; Rojas, M.R.; Souza, J.O.; recognized species with a variable host range and Inoue-Nagata, A.K.; Gilbertson, R.L. geographic distribution, besides the brief reports of new 1. UNIVERSIDADE DE BRASILIA species. Tospoviruses are responsible for considerable 2. UNIVERISITY OF CALIFORNIA-DAVIS crop loses. Decipher the global trends in tospoviruses 3. EMBRAPA VEGETABLES spread is an economic necessity, since it may be permit Begomovirus diseases are caused by numerous species, the formulation of better quarantine methods. Therefore, we performed phylogeography reconstructions of three in the world, and new species have been frequently selected species. Tomato spotted wilt virus (TSWV) is the andleading continuously to significant reported losses in inboth many cultivated important and cropsnon- type member of the genus, Iris yellow spot virus (IYSV) cultivated plants. Begomoviruses are commonly found occurs occasionally in most locations that is reported, in mixed infection, which may lead to the occurrence but has few endemic occurrences all over the world, and of recombination and pseudo-recombination events between their genome components. Plants of genus the early 1990’s and nowadays can be found only in the Sida are common weeds found in agricultural areas americas.Tomato chlorotic To investigate spot virus the global (TCSV) spread was first trends describe of TSWV, in TCSV and IYSV, publicly available (Genbank) genomes with begomoviruses. The objective of this work was to with distinct dates and location of sampling were used. molecularlyin Brazil, and characterize it is not rare a tonew find begomovirus sida plants infectedspecies Viral phylogenies based on the nucleoprotein sequences found infecting Sida sp. collected in the state of Piauí. of isolates were estimated using maximum likelihood Leaf tissue from a symptomatic Sida sp. plant was implemented in Phyml and using Beast. Through Beast applied into an FTA card, the total DNA was extracted, we carried out extensive Bayesian phylogeography PCR analysis was performed with degenerate primers analyses. Five hundred TSWV sequences, around eighty sequences for IYSV and thirty-three for TCSV were used. PCR fragment was sequenced. The total genomic DNA The resulting trees were summarized in the maximum wasfor begomovirus also used to A amplify and B components the full DNA and genome the amplified of both clade credibility (mcc) tree using Treeannotator and the ancestral reconstruction were visualized with Figtree. RCA products were digested with restriction enzymes The supported routes were then compared to the level tocomponents identify restriction by rolling enzymes circle amplificationthat linearize (RCA).these components and full-length clones obtained. Sequence involved countries. Analyses of the phylogenetic trees comparisons and recombination analysis were allowof export/import noting that ofviral an migration important for susceptible all three cropspecies of performed using SDT and RDP programs, respectively. Dimeric clones of DNA-A and DNA-B components were with trade liberation policies of the time. Despite this generated with a partially digested RCA products and similarity,intensified the beginning dynamics in of viral the mid-1980s,trade and the correlating countries transformed into Agrobacterium tumefaciens. Nicotiana involved were distinct to each species. IYSV seems benthamiana plants, agroinoculated with the DNA-A to be much more mobile than the others are. TCSV and DNA-B clones, developed symptoms including disappeared for some years and now reemerged in the stunting and yellow spots and leaf curl. PCR analyses Caribbean and USA. TSWV has two different behaviors;
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant andwith Invertebrate DNA-A Virology: and DNA-B PIV specific primers confirmed the XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
212 Plant and Invertebrate Virology: PIV presence of both components. The complete sequence ELISA and RT-PCR of the 3’ end portion of the genome. of DNA-A was determined to be 2694 nucleotides, with The complete genome showed 99% identity with some a genome organization typical of New World bipartite of the CPMMV isolates from soybean in Brazil and also begomoviruses. The full-length sequence of DNA-A had with the complete genome of CPMMV obtained from the highest identities of 85% to Sida mosaic Alagoas virus, a begomovirus previously reported in Sida sp. plants in Brazil. The DNA-B component was 2622 nucleotides v6.06.whiteflies This in work Florida. helps The to sequences elucidate alsothe etiologyclustered of with the and encoded two open reading frames (BV1 and BC1). It viruseach other causing in the disease filogenetic in the analyses newly developed performed common in mega had 79% sequence identity with the DNA-B component bean cultivar with resistance to BGMV by rnai and goes of Okra mottle virus. In a recombination analysis, no further in the investigation of CPMMV distribution and potential impact in Brazil. Financial Support: CNPq. DNA-A component of this isolate. Thus, a novel bipartite begomovirussignificant recombination species was event found was infecting detected a fromSida thesp. PIV416 - HOMOLOGY MODELING OF TOSPOVIRUS NUCLEOPROTEIN: STRUCTURE AND FUNCTION begomovirus evolution will be discussed. Financial Lima, R.N.; Faheem, M.; Barbosa, J.A.R.G.; Melo, F.L.; Support:plant in Brazil,UNIVERSITY and the OF implications BRASÍLIA, ofUNIVERSITY this finding OF in Resende, R.O. DAVIS, EMBRAPA VEGETABLES UNIVERSIDADE DE BRASÍLIA PIV408 - DETECTION AND WHOLE GENOME The rapid progress in the understanding of protein folding SEQUENCING OF CPMMV IN COMMON BEAN RESISTANT TO BGMV FROM PARANÁ STATE have provided reliable tools to modeling and predict three mechanisms and the advances in the bioinformatics field Milanesi, D.F.; Zanardo, L.G.; Faria, J.C.; Carvalho, C.M. dimensional structures of plant virus proteins. recently, the nucleoprotein (np) crystal structures of related rna 1. UNIVERSIDADE FEDERAL DE VIÇOSA 2. EMBRAPA ARROZ E FEIJÃO elucidated and despite having different sizes and distinct Cowpea mild mottle virus (CPMMV) is a Carlavirus from np-foldingvirus families structures, (arena/orthomyxo/bunyaviridae) these proteins share common were the family Betaflexiviridae which has a linear single features and architectural principles when forming np- stranded positive sense rna genome of approximately np multimers and np–rna complexes. therefore, due 8,200 nt and infects a wide range of cultivated plants to their genetic relationship, the la crosse virus (lacv- from the Fabaceae family. It is transmitted by the orthobunyavirus) crystal structure in complex with ssrna Bemisia tabaci (pdb id 4bhh) was selected as template for a homology for the release of a new common bean (Phaseolus modeling approach to predict a three dimensional vulgariswhitefly) cultivar resistant. During to bean the golden field tests mosaic required virus model for the np of the tospovirus groundnut ringspot by rna interference, some plants with mild mosaic and virus (grsv). the grsv np monomer was predicted to distortion in the leaves were tested for the presence of possess thirteen helical segments and two small beta- CPMMV by ELISA. These plants were collected in the sheets organized in a globular core domain (33-223 aa) cities of Cambará and Londrina, Paraná state. In order containing a deep positively charged groove with the two terminal chains forming a n-terminus arm (1-32 aa) the genome of these isolates with the CPMMV isolates and a c-terminus arm (224-258 aa). both n- and c-arms fromto confirm soybean the which etiology we had of theobtained disease a couple and compareof years extend outwards from the globular core domain and they previously, the positive samples from ELISA were used interact with the globular core domain of neighboring for rna extraction and RT-PCR with primers previously monomers to mediate the multimerization, supporting used for sequencing of CPMMV in soybean. One of the samples was used for the sequencing of the whole the central rna-binding groove and the key residues for genome of the virus, using also the race protocol for the thisthe “head-to-tail”interaction are model. mainly the located rna is primarilyin this groove. bound rna at is strongly bent at each np–np interface and is largely solvent-inaccessible in the tetramer structure. the amplification of the 5’ end of the genome. Another four samplesOctober 2015 were Volume confirmed 20 – Supplement as infected 1 - Abstracts/Posters by CPMMV - Plant with and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
213 Plant and Invertebrate Virology: PIV dimensions of the groove allow accommodation of ssrna related to the MNPV phenotype we constructed three and further analysis showed that the majority of residue- recombinant baculoviruses: AcMNPV-134-del (ac134 nucleotide interactions occur with the ribose and the disrupted), AcMNPV-134-HA (ac134 repaired with HA tag) and AcMNPV-wt (wild type). We transfected the ssrna interaction. importantly, most of the key residues recombinant DNA of those constructs into insect cells arephosphate highly conserved moiety, suggesting among all a tospoviruses. non-sequence-specific multiple and infective BVs were produced. We have shown by TEM copies of the np form oligomers that interact with the that the disruption of ac134 does not change the multiple viral rnas to build ribonucleoprotein complexes (rnps) capsid occlusion, thus, this gene is not responsible that are proposed to be transported via plasmodesmata for the MNPV phenotype. Then, we determined by and are functional templates for rna replication and immuno confocal microscopy that ac134 was located transcription. thus, the proposed model may shed light in the cytoplasm of the infected cells with increase on the mechanisms of rnp shaping and could allow and decrease of signal at 48 and 72 hpi. These results potential targets for tospovirus control strategies. corroborateof fluorescence the signalidea that at 6this and gene 12 hpi,is not peak related at 24 to hpi,the Financialthe identification Support: ofCAPES, essential CNPq, amino FAPDF. acid residues as MNPV phenotype, since the ac134 were the responsible for the multiple encapsidation phenotype of ODVS, it PIV421 - INVESTIGATING THE IMPACT OF supposed to be in the nucleus. Moreover, we inoculated AUTOGRAPHA CALIFORNICA MULTIPLE the recombinant viruses by injecting BV into Spodoptera NUCLEOPOLYHEDOVIRUS AC134 GENE ON MULTIPLE frugiperda larvae. The injections enabled infection and NUCLEOCAPSID FORMATION kill all larvae, showing that the ac134 is not essential Andrade, M.S.; Ardisson-Araújo, D.M.P.; Ribeiro, B.M.; for virus replication. After these analyses, we are now Melo, F.L. evaluating the impact of this deletion on viral DNA UNIVERSIDADE DE BRASÍLIA replication, BV, OB and some viral proteins production and time to kill the insect host. Financial Support: CNPq, Baculoviruses are an interesting group of large dsDNA FAP-DF, CAPES. viruses that have two distinct virions during the infection cycle. Occlusion bodies (OB) that are ingested PIV424 - GENETIC STRUCTURE OF BRAZILIAN by the host carry the occlusion derived virus (ODV), that POPULATIONS OF THE BEGOMOVIRUSES TOMATO is responsible for the horizontal transmission. After the MOTTLE LEAF CURL VIRUS INFECTING TOMATO (SOLANUM LYCOPERSICUM) AND SIDA MOTTLE and is responsible for the host cell-to-cell transmission. ALAGOAS VIRUS IN SIDA SPP first round of replication, a budded virus (BV) is produced Curiously, the ODV of some species present only one Lima, G.S.A.; Ferro, M.M.; Ramos-Sobrinho, R.R.; Silva, nucleocapsid per virion (SNPV), whereas others have J.T.; Assunção, I.P. several nucleocapsid per virion (MNPV). The genetic UNIVERSIDADE FEDERAL DE ALAGOAS does not seems to be correlated with larger phylogenetic Tomato (Solanum lycopersicon) is an important crop groups.basis of However, this phenotype some hasclosely not related been identified baculoviruses, and it in tropical and subtropical regions. Begomoviruses such as BmNPV, BomaNPV and AcMNPV, have discordant are among the most damaging pathogens infecting phenotypes and may help to identify candidates genes. this crop, being considered limiting factor in tomato Therefore, we compared the genome of these viruses and found a unique gene (ac134) that was present in BomaNPV and in the majority of MNPVS (including hostsfields. playing Begomoviruses a crucial are epidemiological whitefly-transmitted, role, acting single- as AcMNPV) and was absent in BmNPV, suggesting that the begomovirusstranded DNA reservoirs. plant viruses, Recently, with wild/non-cultivatedit has been shown presence of this gene could be related to the appearance that Brazilian begomoviruses infecting tomatoes are of multiple nucleocapsid virions. This gene was the biogeographically segregated, with different viral species being prevalent in different tomato-growing areas. The BomaNPV genomes. To analyze whether this gene was present study aimed to determine the diversity and most significant difference among the BmNPV and the October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
214 Plant and Invertebrate Virology: PIV genetic structure of begomovirus populations infecting PIV436 - BEGOMOVIRUS DIVERSITY IN THE VECTOR tomato and Sida Bemisia tabaci AND HOST PLANTS northeastern Brazil. Foliar samples of tomato and Sida Costa, L.C.; Fontenele, R.S.; Lamas, N.S.; Sanches, spp. in different tomato fields in M.M.; Campos, M.A.; Ribeiro, S.G. states in northeastern Brazil in 2014. Total DNA was extractedspp. near tomatoand used fields as were a template collected forin three rolling-circle different 1. UNIVERSIDADE FEDERAL DE CAMPINA GRANDE 2. EMBRAPA RECURSOS GENÉTICOS E were cloned and sequenced commercially by primer BIOTECNOLOGIA walking.amplification To properlyof begomovirus assign genomes.taxonomy These to the genomes novel isolates, full-length genome pairwise comparisons with Begomoviruses (family Geminiviridae) are transmitted previously reported begomoviruses was used. Multiple Bemisia tabaci and cause serious diseases sequence alignments were prepared for the full-length in many economically important crops worldwide. They by the whitefly DNA-A, and for the CP and Rep coding sequences can also infect weeds and wild plants. Their genomes of each viral species. Phylogeny, genetic variability, are either monopartite or bipartite composed of single recombination and selection pressure analyses were stranded DNA molecules known as DNA-A and DNA-B. performed. A total of 30 clones of DNA-A genomic Begomovirus diversity in the host plant has been widely component was obtained. Pairwise comparisons studied; however, the information about the diversity indicated the presence of only two begomovirus species: found in the vector Bemisia tabaci is scarce. In this study Tomato mottle leaf curl virus (ToMoLCV) from tomato samples; and Sida mottle Alagoas virus (SiMoAV) in we collected whiteflies in plants from Distrito Federal Sida spp. plants. Bayesian phylogenetic trees showed and Paraíba. Total DNA was extracted from the whitefly that ToMoLCV and SiMoAlV isolates were structured Phi-29 DNA polymerase. samples and viral DNA was amplified by rolling circle RCAamplification products (RCA)as template. using PCR products were cloned Fst(ToMoLCV) = 0.51 and Fst(SiMoAlV) = according to geographical region, which was confirmed andBegomovirus sequenced. presence Overlapping was primers confirmed based by in PCR the usingvirus geneticby high variability, Fst values with [ the Rep gene of ToMoLCV being partial sequence were designed to amplify the complete the0.75]. most ToMoLCV variable. and Recombination SiMoAlV populations events were showed detected high only among ToMoLCV isolates, with recombination the plant samples where the vector was collected. The DNA-A viral genome from both the whitefly samples and breakpoints occurring in the Common Region and the data that was indicated by the partial sequences. The complete DNA-A was cloned and sequenced, confirming the major selective force acting on CP and Rep in both Rep. Negative or purifying selection was identified as the plants from Distrito Federal (Bidens pilosa, Crepis complete DNA-A found in the whiteflies collected from that ToMoLCV is the main begomovirus infecting tomato japonica, Jatropha podarica and Solanum melongena) plantsToMoLCV in northeastern and SiMoAlV. Brazil, The present and showed study confirmedthat Sida presented 98% identity with Bean golden mosaic virus spp. seems do not contribute to ToMoLCV outbreaks in tomato. Financial Support: CAPES, CNPq and FAPEAL. plant samples. Sida micrantha mosaic virus (SiMMV) (BGMV), however, this virus was not Emilia identified sonchifolia in the
was identified in whiteflies collected in from Distrito Federal but the virus was also not identified cottonin the plant (Gossypium sample. hirsutum Two begomoviruses) in Paraíba. Thiswere result identified was by the partial sequences of the whiteflies collected from presence of Corchorus mottle virus (CoMoV) and Sida yellowconfirmed blotch by thevirus DNA-A (SiYBV). sequencing However, which the cotton showed plants the were not available for comparison. The begomoviruses
found in the whiteflies were not recovered from the plants October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant and Invertebrate Virology: PIV where the whiteflies were collected, demonstrating XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
215 Plant and Invertebrate Virology: PIV that they were probably present in other hosts in the 1 was more frequent and was observed in 80% of tested area and highlighting the importance of studying the genotypes. In contrast, PvEV-2 was detected in 40% of diversity of plant viruses present in the vectors as a the tested beans and in double-infection with PvEV- surveillance method of the diversity of plant viruses in 1. Infection only with PvEV-2 was not observed. Only a given area that may possibly forecast the emergence of 20% of the bean genotypes were endornavirus-free. new virus diseases. Financial Support: Embrapa, CNPq, Further work will include molecular characterization FAP-DF, Rede Estrece, Rede Centro Oeste de Pesquisa em and phylogenetic analysis of these viruses. Financial Biodiversidade Viral, INCTIPP. Support: EMBRAPA, CNPq, FAP-DF, Rede Estrece, Rede Centro Oeste de Pesquisa em Biodiversidade Viral, PIV437 DETECTION OF TWO ENDORNAVIRUS IN INCTIPP COMMON BEAN GENOTYPES IN BRAZIL Alves-Freitas, D.M.T.; Ribeiro, G.C.; Matos, V.O.R.L.; PIV443 - GROUNDNUT RINGSPOT VIRUS (GRSV) Melo, L.C.; Faria, J.C.; Ribeiro, S.G. INFECTING WATERMELON (Citrullus lanatus) IN CENTRAL BRAZIL 1. EMBRAPA RECURSOS GENÉTICOS E BIOTECNOLOGIA Lima, M.F.; Michereff-Filho, M.; Lima, E.F.B. 2. UNIVERSIDADE DE BRASÍLIA, CAMPUS 1. EMBRAPA HORTALIÇAS UNIVERSITÁRIO DARCY RIBEIRO 2. UNIVERSIDADE FEDERAL DO PIAUÍ 3. EMBRAPA ARROZ E FEIJÃO Viral diseases are among the main cause of yield losses in Common bean (Phaseolus vulgaris) is an important cucurbit species around the world. In Brazil, at least ten source of proteins and is a major grain legume consumed virus species had already been reported infecting these worldwide. Brazil is the third largest producer of beans, crops. During 2013 and 2015, watermelon (Citrullus with different cultivars planted and consumed in the lanatus) plants exhibiting mosaic and leaf distortion symptoms, with incidence varying from 20% to 40%, the productivity and quality of this crop. However, country. Viral pathogens play a significant role in reducing some viruses do not cause apparent damage and may region of Brazil, one of the most important watermelon producerswere observed in the in fieldscountry. of the Samples state of were Goiás, collected at the Central from (Endornaviridae) are persistent viruses that infect symptomatic plants and submitted to serological and play a beneficial role in the plants. Endornaviruses important crops such as pepper, rice, broad bean, and molecular tests. Simultaneously, 235 thrips specimens beans. However, these viruses are poorly studied and have not yet been reported in Brazil. In this study, we investigated the occurrence of two endornaviruses, obtainedwere collected from for those identification plants were on leaves tested and for in flowersPapaya Phaseolus vulgaris endornavirus-1 (PvEV-1) and ringspotof watermelon virus - type plants watermelon in many (PRSV-W), fields. Leaf Watermelon extracts Phaseolus vulgaris endornavirus-2 (PvEV-2) in bean mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus (CMV) and, Zucchini lethal germplasm bank including Brazilian cultivars (25) and chlorosis virus (ZLCV) by NCM-ELISA, using polyclonal genotypes. Forty five bean genotypes from Embrapa`s breeding lines (17) and three accessions of ‘Black Turtle antibodies raised against the coat protein of each virus. Soup’ were selected. The seeds were germinated, and Samples were also subjected to total RNA extraction and used as template for complementary DNA (cDNA) leaves using the STE-phenol protocol. Duplex RT-PCR was synthesis by reverse transcription (RT) with primer J13 total nucleic acids were extracted® from the first true conducted using a SuperScript III One-Step RT-PCR Kit that contains a conserved region present in all tospovirus (Invitrogen) with primers to detect both endornaviruses RNA termini, followed by conventional PCR using the were evaluated in 1.5% agarose gel electrophoresis. region from the 3’ end portion of the S RNA and the simultaneously. The sizes of virus-specific PCR product Based on electrophoresis results, PvEV-1 and PvEV-2 proteinprimer setN-coding BR60/BR65 gene and, that amplify targets fragments the non-translated of at least were present in high frequency, and 80% of the tested genotypes contained at least one of these viruses. PvEV- Tomato spotted three tospovirus species (453 bp). In addition, specific October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Plant andprimers Invertebrate for Virology: ZLCV PIV (ZLCV-P1/ZLCV-P2), XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
216 Plant and Invertebrate Virology: PIV wilt virus Groundnut ringspot virus the S RNA, of 350 bp. Leaf extracts prepared in 0.01 M were used (TSWV in RT-PCR - TSWV722/TSWV23) reactions. Serological and tests results phosphateZLCV-P2 primer buffer set,at pH which 7.0 were amplifies also rub a fragment inoculated of indicated that symptomatic (GRSV - GRSVNv/GRSVNvc) plants were positive detection mostly onto leaves of indicator host plants Datura stramonium, for ZLCV and just a few plants showed to be infected with Nicotiana benthamiana and, Cucurbita pepo cv. Caserta, previously dusted with carborundum. Serological of the symptomatic watermelon plants tested positive analysis revealed that all three and four gherkin and potyviruses (PRSV-W; ZYMV). More than 80% (32/40) melon plants, respectively, were infected with ZLCV. Samples also tested positive for ZLCV by RT-PCR with DNAfor tospovirus fragments degenerateof 453 bp and primers 494 bp, (BR60/BR65) respectively. andNo samplesGRSV specific were positive primers for (GRSVNv/GRSVNvc) ZLCV or TSWV. Frankliniella amplifying Typical ZLCV systemic symptoms were observed in D. schultzei (99%) was the most frequent thrips species stramonium,primers ZLCV-P1/ZLCV-P2, C. pepo and, N. producing benthamina a 350 plants, bp amplicon. 10-12 F. zucchini was days after inoculation. ZLCV infection in the inoculated resultsfound inindicate watermelon the importance fields, while of monitoring no viruses in identified among the thrips specimens collected. These plants was confirmed by serological tests. Cloning and epidemiological studies of GRSV in this crop. Financial ofsequencing ZLCV to cucurbit of DNA crops.fragments Considering are underway that the to virus confirm is a Support:watermelon EMBRAPA. crop in the field and the need of generating threatZLCV identification. to watermelon These and pumpkin data indicate production the importance in Brazil, further survey is needed to determine the frequency of PIV444 - MELON AND GHERKIN: TWO NEW NATURAL ZLCV infecting melon and gherkin crops as well as its HOSTS OF ZUCCHINI LETHAL CHLOROSIS VIRUS (ZLCV) EMBRAPA. Lima, M.F.; Souza, T.; Oliveira, V.R. geographical distribution in the field. Financial Support: 1. EMBRAPA HORTALIÇAS 2. UNIVERSIDADE DE BRASÍLIA Zucchini lethal chlorosis virus (ZLCV) belongs to the Tospovirus genus, in the family Bunyaviridae and is transmitted by thrips, in a circulative propagative manner. ZLCV is the solely tospovirus species that is reported on cucurbits in Brazil, causing yield losses, and 2014, three gherkin (Cucumis anguria L.) and four melonespecially (Cucumis in watermelon melo L.) and plants pumpkin showing fields. virus-like In 2012 symptoms were observed in greenhouse cropping system, in the Federal District. Serological tests were performed with leaf extracts obtained from symptomatic melon and gherkin plants for Papaya ringspot virus - type watermelon (PRSV-W), Watermelon mosaic virus (WMV) and, Zucchini yellow mosaic virus (ZYMV), genus Potyvirus in the family Potyviridae, Cucumber mosaic virus (CMV), genus Cucumovirus in the family Bromoviridae and, Zucchini lethal chlorosis virus (ZLCV), genus Tospovirus in the family Bunyaviridae, using polyclonal antibodies, by NCM-ELISA. In addition, total RNA was extracted from leaves collected from gherkin and melon plants and testedOctober 2015 for ZLCV, Volume by 20 two-steps– Supplement RT-PCR, 1 - Abstracts/Posters using ZLCV-P1/ - Plant and Invertebrate Virology: PIV VETERINARY VIROLOGY - VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
218 Veterinary Virology: VV
VV26 - PATHOGENIC AND IMMUNOLOGYCAL STUDY OF EQUINE HERPESVIRUS 1 INFECTION (EHV-1). NEW INSIGHTS IN PROPHYLACTIC STRATEGIES their placentas and uteri showed a significant increase of TNF and IFNγ mRNA and protein expression, thus Scrochi, M.R.; Bravi, M.E.; Fuentealba, N.A.; Sguazza, increase of IL13 and IL10 was also found, possibly indicating a strong Th1 profile. In addition, a moderate G.H.; Nishida, F.; Cid de la Paz, V.; Gimeno, E.J.; as a homeostatic immune response to the infection. Portiansky, E.L.; Barbeito, C.G.; Muglia, C.I.; Zanuzzi, Experiment 3). We evaluated the protective effect of a C.N.; Galosi, C.G. the B subunit of cholera toxin (CBT) in intranasally 1. VIROLOGY-FACULTY OF VETERINARY immunizedpurified recombinant and challenged glycoprotein mice. (gD) Secretorycombined withIgA SCIENCES-NATIONAL UNIVERSITY OF LA production was measured in upper airways lavages and PLATA plasma, and by immunohistochemistry in lungs. IgA was 2. NATIONAL SCIENTIFIC AND TECHNICAL detected in the lungs of immunized mice. The use of gD RESEARCH COUNCIL 3. ARGENTINEAN AGENCY FOR THE PROMOTION and CBT prevented the arrival of the virus to the lungs. OF SCIENCE AND TECHNOLOGY These results provide new data to better understand the 4. SCIENTIFIC RESEARCH COMMISSION OF abortion pathogeny of EHV-1 infection, and to validate BUENOS AIRES PROVINCE the new immunization strategy proposed. This project is funded by Argentine Agency for the Promotion of Science EHV-1 causes respiratory and nervous signs, abortion and neonatal disease. In this study we performed in vitro Research Commission of the Province of Buenos Aires and National Technology University (FONCyT, of PICTLa Plata. 2011-1123), Scrochi MR, Scientific Bravi the pathogenic mechanism of the abortion, and to ME and Fuentealba NA equal contribution. evaluateand in vivo an (BALB/c immunogen mice) capable assays of in inducing order to understandan immune response to prevent infection. In all the experiments the VV29 - MOLECULAR DETECTION OF BOVINE Argentinean AR8 strain was used. Experiment 1). We IMMUNODEFICIENCY VIRUS IN TISSUES OF A determined whether EHV-1 exerts a modulatory effect BUFFALO WITH LYMPHOMA FROM AMAZON REGION, of the apoptosis during its replication cycle over: a) BRAZIL infected, b) non-infected and c) induced to apoptosis with De Oliveira, C.H.S.; Oliveira, F.G.; Resende, C.F.; Kassar, sorbitol heterologous (MDBK) and homologous (ED) cell T.C.; Rodrigues, A.P.S.; Reis, J.K.P.; Leite, R.C.; Barbosa, lines. Apoptosis was studied at different post-infection J.D. (pi) times using ethidium bromide and acridine orange 1. UNIVERSIDADE FEDERAL DE GOIÁS 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS electronstaining microscopy (fluorescent (TEM). microscopy), In both infected Annexin cell Vlines FITC/ the 3. UNIVERSIDADE FEDERAL DO PARÁ propidium iodide (flow cytometry-FC-) and transmission The Bovine immunodeficiency virus (BIV) was isolated to (b); viral infection and apoptotic ultrastructural apoptosis was significantly lower than (c), but similar leukocytosis in the United States. BIV belongs to 1 interferes with the apoptosis of the infected cell lines, Retroviridaefor the first timefamily in and 1969 genus from Lentivirus, a cow with although persistent not achanges strategy were that confirmed may ensure by virus TEM. replication. We conclude Experiment that EHV- 2). We analyzed the local immune response in the uteri lymphadenopathy, lymphocytosis and encephalitis. Anti- and placentas of intranasally infected females by day 13 BIVassociated antibodies with ahave specific been syndrome detected in in cattle, buffaloes may causefrom of pregnancy (n=3) and the corresponding control mice Pakistan and Cambodia, but was not associated with (n=3). The viral isolation (VI) was carried out in lungs, illness in these animals. For 12 years, we have studied the uteri, placentas and fetuses taken at day 3 pi. In uteri and occurrence of lymphoma in buffalo from Amazon region, Pará state, Brazil. The disease is similar to Enzootic by real-time RT-PCR, and the expression of their proteins Bovine Leucosis caused by Bovine leukemia virus (BLV) placentas mRNA of TNF, IFNγ and IL10 were quantified in cattle. Sick buffaloes presents lymphadenopathy and The infected mice showed positive VI in their lungs, and progressive weight loss. At the necropsy in many tissues was measured by ELISA (IFNγ and IL13) or FC (TNF). October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
219 Veterinary Virology: VV and organs collected were observed B-cell multicentric were reported. There are no studies regarding BEV lymphoma by histopathology and immunohistochemistry seroprevalence in Brazil. The aim of this study was to analysis. The aim of this study was investigate the molecular presence of BIV, BLV and Bovine herpesvirus antibodies from 182 bulls from of eighteen farms, 6 (BoHV-6) in lymphoma samples, lymph node, kidney, locatedinsurvey the seroprevalenceCenter-West, Southeast of BEV specific and neutralizingSouthwest liver, spleen, salivary gland and testis from a sick male regions of Rio Grande do Sul. State, Brazil. The serum- buffalo. DNA was extracted from tissue samples by neutralization (SN) technique was applied as follows: commercial kits and submitted to PCRs developed in serum samples were diluted from 1:5 to 1:1.640 and house. BIV was tested by seminested PCR for pol gene, assayed against with 100 – 200 TCID50 BLV by qPCR for LTR gene and BoHV-6 by seminested BEV-2 strains. From the samples analyzed, nearly all PCR for pol. All samples were negative for BLV and BoHV- /mL of a prototype 6, but lymphoma samples, lymph nodes and kidney were positive for BIV. BoHV-6 is a gammaherpesvirus, recently neutralizing99.4 % (181/182) antibodies were ranged positive from for 1:10 the titre presence in 2.2% of discovered from lymphoma samples in cattle, but yet BEV-specific antibodies. The titer and prevalence of not associated with any disease and have been widely These results points that BEV is circulating among detected in healthy cattle. Previously, we detected BoHV- theof the bovine animals population (4/182) toexamined, >1:640 incausing 25.8% subclinical (47/182). 6 in healthy buffaloes from Brazil (2.23%), but the virus or undiagnosed infections. Financial Support: CNPq, was not detected in this study associated with lymphoma. FAPERGS, FEEVALE, CAPES. BLV seems not occur naturally in buffaloes, we evaluated 315 blood samples from buffaloes from Brazil by PCR, VV76 - VIRUCIDAL ACTIVITY TESTING OF AN ELISA and AGID and all tested negative. The molecular OXIDIZING DISINFECTANT AGAINST FOOT AND detection of BIV in buffalo lymphoma samples have MOUTH DISEASE VIRUS Guinzburg, M.; Dos Santos, M.N.; Piacentini, D.; from the lymphoma was sequenced and showed 99% Dentello Lustoza, M.; Smitsaart, E.; Cardillo, S.B. never been reported before. The amplified fragment similarity with the reference strain BIV R-29. In a study BIOGENESIS BAGO S.A. about the BIV R-29 pathogenesis, a calf developed T-cell Disinfectants play an essential role in the prevention lymphoma after experimental inoculation with this strain and control of infectious diseases. Biox Biogénesis Bagó and other animals developed persistent lymphocytosis is a multi-component, biodegradable, broad-spectrum and lymphadenopathy. The BIV detection in lymphoma oxidizing biocide suitable for environmental and and other tissue samples, points to the possibility that surface disinfection. According to their susceptibility this virus can be associated with B-cell lymphoma in buffalo. Other studies are needed to validate or deny their size and presence of envelope. Being small and this hypothesis. Keywords: lymphoma, BIV, buffalo, BLV, to disinfectants, viruses can be classified depending on BoHV-6, Brazil. Financial Support: INCT-Pecuária, CNPq, CAPES, FAPEMIG and FAPEG. (FMDV)non-enveloped, belongs picornavirusesto Picornaviridae are family, considered Aphthovirus “very VV50 - HIGH PREVALENCE OF BOVINE ENTEROVIRUS genus,resistant” and to is disinfectants. the causative Foot-and-Mouthagent of highly infectious Disease virus Foot ANTIBODIES IN BULLS FROM RIO GRANDE DO SUL and Mouth Disease (FMD) in cloven-hoofed animals, with STATE, BRAZIL Demoliner, M.; Soliman, M.C.; Eisen, A.K.A.; Stauder, a significant global socio-economic impact. The “disease G.Z.; Henzel, A.; Spilki, F.R. trade of animals and products and the loss of this status canfree” leadstatus to allows severe countries economic to engagelosses. inDuring international a FMD UNIVERSIDADE FEEVALE outbreak, environmental contamination with secretions Bovine enterovirus (BEV), a member of Picornaviridae and excretions containing virus are considered one family, is endemic in bovine herds. The infection usually of the major concerns related to viral spread. The aim runs asymptomatic; however, clinical signs including enteric and respiratory disorders as well as abortions Biogénesis Bagó disinfectant against FMDV, following of this study was to evaluate virucidal efficacy of Biox October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
220 Veterinary Virology: VV test criteria and methods described in the European or RT-PCR, for the three viral agents: circovirus (Beak and Standard (EN 14675:2006). The disinfectant was Feather Disease Virus), polyomavirus and bornavirus diluted in hard water (300 ppm CaCO3 (Proventricular Dilatation Disease), regardless of the concentration of 0.2%, containing either high or low presented clinical signs. We found positives 22 birds, 4 level soiling (high-level soiling: bovine, albuminpH 7.0) atsolution a final with concomitant infection with more than one virus, and yeast extract mix; low-level soiling: bovine albumin in a total of 26 positive samples. From these samples, solution). Suspensions of FMDV O1 Campos strain were 17 from Amazona aestiva were positive for bornavirus exposed to disinfectant solution for 2, 5, 10 or 30 minutes. (3 with concomitant circovirus infection), 4 samples Residual infectivity after exposure to the disinfectant for circovirus (3 presented concomitant infection to was determined by viral titration in BHK21 cells. The bornavírus) and 1 for polyomavirus. From Amazona virucide was considered effective if the virus titer was amazonica, 1 sample was positive for bornavirus and 2 reduced by at least 104 (4 logs) after the exposure to the samples from Ara ararauna were positive for circovirus, disinfectant. Results showed that, after an exposure of 1 presented concomitant with polyomavirus. Although 2 minutes, there was a reduction in the virus titer of at we used birds with clinical signs consistent with the least 105 4 (4 logs) for the clinical signs, thus, the number of positive birds found (5 logs) for the conditions “hard water” and wasaforementioned alarming. It’s diseases, possibility they that were the mostly birds have non-specific become show“hard that,water even + low-level in the presence soiling” ofand interfering of 10 substances, infected after coming in captivity, however, one cannot thecondition disinfectant “hard watertested + is high able level to inactivate soiling”. These FMDV results after rule out the hypothesis that the virus could be spread in a 2-minute exposure in a suspension assay. Thus, it the wild. Other studies are needed to prove this theory. complies with European Standards requirements for It’s also necessary to reinforce the legislation on the FMDV and could be a useful tool suitable for disinfection detection of pathogens in order to protect the Brazilian of animal facilities and animal transport vehicles, even in fauna. Keywords: Virus, Bird, Parrot, Wildlife, illegal the presence of high loads of organic material. trade. Financial Support: CAPES.
VV77 - A SURVEY OF BORNAVIRUS, CIRCOVIRUS AND VV87 - WEST NILE VIRUS SURVEY IN ANTARCTIC POLIOMAVÍRUS IN PSITTACINES FROM ILLEGAL REGION BETWEEN 2010 - 2012 TRADE Ometto, T.; Seixas, M.M.M.; Araujo, J.; Kruger, L.; Philadelpho, N.A.; Allegretti, L.; Carranza, C.; Hurtado, R.; Thomazelli, L.M.; Petry, M.V.; Durigon, Guimarães, M.B.; Ferreira, A.J.P. E.L. UNIVERSIDADE DE SÃO PAULO 1. BSL3 - INSTITUTO DE CIÊNCIAS BIOMÉDICAS Brazil has an important biodiversity, the second biggest II DA UNIVERSIDADE DE SÃO PAULO 2. LABORATÓRIO DE ORNITOLOGIA DA number of bird species in the world, being, for that UNVERSIDADE DO VALE DO RIO DOS SINOS reason, constant target of illegal wildlife trade. The The West Nile Virus (WNV) became known in 1937 in through other countries and different states, facilitating Uganda, Africa, and appeared in the American continent thewildlife spread trafficking of infectious routes are agents, often unknownfurther aggravating and may go only in 1999. Since then, evidence of circulation was the problem of the Brazilian fauna. The literature on obtained in a growing number of countries and the main viruses in psittacines in Brazil is very scarce, so studies sources of spread are the migratory birds. Approximately are needed to identify the presence of viral agents, 61 species of seabirds migrate between Oceania, South epidemiology and the impact of the country. In this study, Africa, South America and Antarctica. The Antarctic fecal samples from 53 parrots were tested. All birds avifauna consists of 40 different species of seabirds, of presented At least one clinical signs compatible with which 19 reproduced within the continent, while the rest one or more viruses, such as apathy, anorexia, sudden reproduced in oceanic islands of the sub-Antarctic region. The aims of this study are to analyze the presence of WNV gastrointestinal signs. All samples were tested using PCR in samples of seabirds of Elephant Island, Antarctic. The death, feathers alteration, neurological signs and / or October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
221 Veterinary Virology: VV study site was chosen for sampling, as the island is the VV103 - PREVALENCE, CLEARANCE AND NUCLEOTIDE point of nesting colonies of seabirds, seals and elephant DIVERSITY OF THE EQUINE HEPACIVIRUS (NPHV) IN seals breeding during the austral summer. From 2010 to BRAZIL 2012, 493 seabirds from different species were captured Figueiredo, A.S.; Lampe, E.; Espírito-Santo, M.P.; using dip net. Orotracheal and cloacal sterile swabs were Mello, F.C.A.; Almeida, F.Q.; Lemos, E.R.S.; Godoi, collected from each bird and placed in sterile cryotubes T.L.O.S.; Dimache, L.A.G.; Santos, D.R.L.; Villar, L.M. 1. OSWALDO CRUZ FOUNDATION 2. LABORATORY OF VIRAL HEPATITIS/ storedcontaining at freezer 500μL -70°C of transport until processing. media. All The samples extraction were OSWALDO CRUZ FOUNDATION wasimmediately done using transferred Magmax to protocol liquid nitrogen and the indetection the field wasand 3. VETERINARY INSTITUTE/FEDERAL RURAL done using one-step Real Time RT-PCR reaction. We UNIVERSITY OF RIO DE JANEIRO analyzed 493 samples collected from seabird species 4. LABORATORY OF HANTAVIRUSES Catharacta lonngbergi (Skua), Daption capense (Cape AND RICKETTSIOSES/OSWALDO CRUZ petrel), Pygoscelis antarcticus (Chinstrap penguin) and FOUNDATION Pygoscelis Papua (Gentoo penguin). All samples tested 5. ANIMAL SCIENCE INSTITUTE/FEDERAL by real-time RT-PCR were negative to the presence of RURAL UNIVERSITY OF RIO DE JANEIRO the WNV. In recent times the contact between humans Nonprimate hepacivirus (NPHV), recently described in and animals in Antarctica has increased due to the horses, is the virus most genetically related to hepatitis research bases and increased tourism. This endangers C virus (HCV) and presents with hepatotropism and the integrity of Antarctic environment, increasing the persistent infection. Although detected worldwide possibility of new species input, contamination by (Americas, Europe and Asia), only limited data on the pollutants, and disease in native species. The possibility distribution and genomic variability of NPHV in Latin America are available. The aim of this study was to since the creation of the Antarctic Treaty in 1959. Lack investigate the presence and genetic diversity of equine of exoticknowledge diseases about in Antarctic biological fauna and and genetic flora isdiversity, known NPHV in Brazil. Two hundred two equines from three especially of microbial communities, emphasizes that Brazilian states - Mato Grosso do Sul (MS), Rio de Janeiro prevention, and monitoring should be considered in (RJ) and Espírito Santo (ES) - were screened by RT- planning any activity in Antarctica. The continent has nested PCR for partial 5’NC and NS5B genome regions and subsequently sequenced. Phylogenetic analysis was its characteristics and natural phenomena may clarify performed with Bayesian inference (MCMC) statistical issuesincontestable of regional scientific and global importance, importance. so It knowledge is important of framework in BEAST package. A high prevalence of to monitoring wildlife in Antarctica, especially knowing equine NPHV was observed: 13.4% positive. Horses that West Nile virus spreads through the planet. Financial involved in rural activity had a prevalence of 10.4%. The Support: FAPESP, CNPq. reproduction programs in a veterinary college, had 15.2%.cohort exposedSixty three to percent intense of human these contactanimals forwere clinical/ under two years old. Screening for NPHV one year later in this cohort resulted in two horses positive, suggesting 89.5% clearance of circulating virus. Similarly to HCV in which 5’UTR is the most conserved genome region, the Brazilian NPHV’s 5’UTR partial region presented a low nucleotide distance of 1.4%. On the other hand, analysis of the NS5B partial region revealed the greatest nucleotide diversity described to date for the NPHVs, up to 25.6%. This distance value is comparable to the
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinaryupper Virology: limit VV of diversity for HCV subtype classification. XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
222 Veterinary Virology: VV
Phylogenetic analysis based on 5’NC and NS5B partial disease in Brazil, with high mortality rate (~40%) in regions including previously published isolates grouped humans. Hantavirus may be transmitted to humans via sequences into two clusters (posterior probabilities, inhalations of aerosols from urine or feces of infected pp=1), with a distance of 24.2% for NS5B. Cluster A rodents, through saliva or direct contact with skin comprised sequences from Southeast Brazil, the USA lesions or bites. Cases of HPS have been reported in and one sequence each from Hungary and Scotland. several Brazilian regions, including Minas Gerais State, Cluster B comprised sequences from Midwest Brazil, with high incidence. Outbreaks involving different the USA and Japan. In conclusion, equine NPHV was Hantavirus genotypes have often been related with highly prevalent in Brazil. High spontaneous viral rodents of Sigmodontinae subfamily, that are commonly clearance was observed. The two phylogenetic lineages associated to agricultural and peridomestic rural formed by the 5’NC and NS5B regions together with a environments. This work aimed to show evidences high nucleotide distance suggest that the equine NPHV of Hantavirus circulation in among small mammals from metropolitan region of Belo Horizonte, Minas two subtypes. Whether HCV has an animal origin is one Gerais State. During 2011-2012 it were captured 138 ofsequences the issues exhibited to be elucidated sufficient withdiversity further to formcomparative at least animals in the wild area of Sabara city, a metropolitan analysis employing equine NPHV complete genomes region of Belo Horizonte, Minas Gerais. Sera samples were tested by IgG-ELISA using the N recombinant Carlos Chagas Filho de Amparo à Pesquisa do Estado protein of Araraquara virus (ARAV) as antigen. Rodents and infection follow-up. Financial Support: “Fundação captured belonged to genera Guerlinguetus sp. (0.57%), Cerradomys sp. (6.25%), Akodon sp. (0.57%), Necromys do Rio de Janeiro” (FAPERJ, grant E-26/111.082/2014), sp. (22.7%) and Oligoryzomys sp. (2.3%). Marsupials “Conselho Nacional de Desenvolvimento Científico e captured belonged to genera Gracilinanus sp. (5.7%) Tecnológico” (CNPq) and “Fundação Oswaldo Cruz” and Didelphis sp. (61.4%) and lagomorphs Sylvilagus for(FIOCRUZ). DNA sequencing. Authors thank “Plataforma Genômica - sp. (0.57%). IgG antibodies were found in 3 (2.17%) sequenciamento de DNA” – PDTIS/FIOCRUZ (RPT01A) animals, two of them are Didelphis albiventris and one VV105 - SEROLOGICAL EVIDENCE OF HANTAVIRUS Necromys lasiurus. The seroprevalence is supported by CIRCULATION AMONG SMALL MAMMALS FROM data from the literature. Moreover, the Necromys lasiurus METROPOLITAN REGION OF BELO HORIZONTE, is the reservoir for ARAV. ARAV is the causative agent MINAS GERAIS, BRAZIL for HPS in the savanna areas of the central plateau and Oliveira, J.S.; Costa, G.B.; Amaral, C.D.; Miranda, J.B.; southeastern Brazil, which includes the Minas Gerais Figueiredo, P.O.; Marques, F.A.; Silva, A.T.S.; Borges, I.A.; Nunes, F.V.; Figueiredo, L.T.M.; Abrahão, J.S.; Hantavirus circulation in rodents and marsupials in the Kroon, E.G.; Paglia, A.P.; Eiras, A.E.; Trindade, G.S. metropolitanState. This is theregion first of report Belo Horizonte, of serological making evidence it a risk of 1. LABORATÓRIO DE VÍRUS, DEPARTAMENTO of transmission to humans. Keywords: Small mammals, DE MICROBIOLOGIA, INSTITUTO DE hantaviruses, emerging infectious diseases, serology. CIÊNCIAS BIOLÓGICAS, UNIVERSIDADE Financial Support: CAPES, CNPq e FAPEMIG. FEDERAL DE MINAS GERAIS 2. DEPARTAMENTO DE BIOLOGIA GERAL, INSTITUTO DE CIÊNCIAS BIOLÓGICAS, UNIVERSIDADE FEDERAL DE MINAS GERAIS 3. CENTRO DE PESQUISA EM VIROLOGIA, FACULDADE DE MEDICINA DE RIBEIRÃO PRETO, USP Hantaviruses are important zoonotic pathogens responsible for Hantavirus Cardiopulmonary Syndrome (HPS), considered one of most important emerging
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
223 Veterinary Virology: VV
VV111 - CLINICAL FINDINGS AND MOLECULAR VV113 - SWINE INFLUENZA VIRUS AND ASSOCIATION DETECTION OF ENTEROVIRUS GROUP G CAUSING WITH THE PORCINE RESPIRATORY DISEASE DISEASE IN SWINE, MINAS GERAIS, BRAZIL COMPLEX IN PIG FARMS IN SOUTHERN BRAZIL Soliman, M.C.; Demoliner, M.; Henzel, A.; de Barcellos, Paim, W.P.; Schmidt, C.; Cibulski, S.P.; Varela, A.P.M.; D.E.S.N.; da Cruz, R.A.S.; Driemeier, D.; Spilki, F.R. Scheffer, C.M.; Teixeira, T.F.; Santos, H.F.; Almeida, L.L.; Franco, A.C.; Roehe, P.M. 1. UNIVERSIDADE FEEVALE 2. UNIVERSIDADE FEDERAL DO RIO GRANDE 1. FEPAGRO SAÚDE ANIMAL - INSTITUTO DO SUL DE PESQUISAS VETERINÁRIAS DESIDÉRIO Porcine Enteroviruses G (PEV-G) belong to the FINAMOR 2. UNIVERSIDADE FEDERAL DO RIO GRANDE Picornaviridae family and eleven serotypes were DO SUL reported (PEV-G1 to G11). PEV-G are formed by small, non-enveloped particles and the viral genome is made by Respiratory diseases in pigs are a major health concern a single stranded RNA molecule. Infection is commonly in swine production. One of the agents of porcine asymptomatic, however clinical signs can be observed respiratory disease that are particularly relevant is including cutaneous lesions and diarrhea. Brazil is the world’s fourth largest producer and exporter of swine disease in pigs but also due to its zoonotic potential. meat. A dysentery outbreak has affected about 3% of influenza virus, not only due to its capacity to cause swine herd with 660 sows located in a farm from Minas A virus (swIAV) infections, data on the occurrence of Gerais, Brazil. The clinical signs were characterized by Despite the putative endemic status of swine influenza severe diarrhea and development of blisters in snout of this study was to detect and subtype swIAVs from six and feet. Moreover, the disease increased 15% mortality outbreaksswine influenza of porcine outbreaks respiratory are scarce disease in complex Brazil. The (PRDC) aim in Southern Brazil. Nasal swabs were collected from 66 animals from birth to three week-old were affected. The piglets with signs of respiratory disease in six herds. necropsyof piglets, and mainly histopathology in the first analysis week of after piglets birth, showed but Lung tissue samples were collected from six necropsied digestive erosions, hydropic degeneration of tongue animals. Virus detection was performed by PCR screening and esophagus epithelium, shortening of the small intestine villi and necrosis in large intestine enterocytes. Timeand confirmed Reverse Transcriptase by virus isolation PCR (rRT-PCR) and hemagglutination to detect the were submitted for viral detection. These samples were A(H1N1)pdm09;(HA). Influenza A other subtyping swIAV wassubtypes performed were determined by a Real- submittedSamples of to diarrheal RNA extraction stools, vesicle through fluids a commercial and tissues by multiplex RT-PCR. In lung tissues, the major bacterial kit. After, cDNA was synthetized through transcriptase and viral pathogens associated with PRDC (Pasteurella reverse reaction (RT) and polymerase chain reaction multocida, Mycoplasma hyopneumoniae, Actinobacillus (PCR) was performed usimng pan-enterovirus generic pleuropneumoniae, Haemophilus parasuis and PCV2) primers targeting 5` untranslated region (5`UTR) were investigated. In some affected pigs, clinico-
5’-ACACGGACACCCAAAGTAG-3´)and amplicons were pathological evaluation was conducted. Influenza A further(ENT-F1 sequenced. 5′-CCTCCGGCCCCTGAATG-3′ A diarrheal stool sample and resulted ENT-R2 thewas sixdetected herds. by Subtype screening A(H1N1)pdm09 PCR in 46/66 swabwas detectedsamples and from 5/6 lungs. Virus was recovered from pigs of region had 100% sequence identity with PEV-G type 1. Althoughpositive for previous enterovirus studies and have the reported partial 5’UTR the occurrence amplified tissues, further agents involved in PRDC were detected in 4/6 herds and H1N2 in the other 2/6 herds. In lung of PEV-G in Brazil, it is remarkable that in the present in all cases; Pasteurella multocida case report the virus was associated to clinical and Mycoplasma hyopneumoniae was identified in pathological signs. Keywords: PEV-G type 1; RT-PCR; Actinobacillus pleuropneumoniae Haemophilus 5/6 samples and in 3/6. vesicle, diarrhea, enterovirus. Financial Support: CNPq, parasuis (1/6), CAPES, FEEVALE Universidade, FAPERGS, UFRGS. summary, this study evidenced that subtypes A(H1N1) pdm09 and (1/6) H1N2 and were, PCV2 at (1/6)time of were sampling, also detected. circulating In
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
224 Veterinary Virology: VV in pigs in Southern Brazil and were involved in the PRDC Most coatis are female (59,3%) while most dogs are male (51,2%). Coatis were grouped in infants (40,7%), young need for continued surveillance and swIAVs subtyping (11,2%) and adults (48,1%). Dogs age range of 4 months tooutbreaks better understand reported here. the evolutionaryThese findings mechanisms emphasize that the to 10 years. In general, uncharacterized lesions were increase swIAV diversity in order to safeguard both, observed in 23 animals (10,8%). It’s important to note human and animal health. Financial Support: CNPq, that 18 dogs (14,6%) are in contact with coatis in wild CAPES, FINEP. environment. It was found 13 seropositive coatis (14,4%) and 24 seropositive dogs (19,5%), with antibodies titers VV115 - ASSESSING RISKS FOR ORTHOPOXVIRUS EMERGENCE IN URBAN AREAS: SEROLOGICAL Poxviruses are ubiquitous among mammals and have a EVIDENCE AMONG COATIS (NASUA NASUA LINNAEUS, wideranging spectrum of 100 of to hosts. 800 neutralizing This situation units/ml can allow (UN/ml). other 1766) AND DOGS SHARING WILD AND URBAN BORDER FROM MINAS GERAIS, BRAZIL the occurrence of VACV in Brazil is, until now, restricted Costa, G.B.; Almeida, L.R.; Santos, A.G.R.C.; de Oliveira, tomammal’s rural environments, species to act some as viral data amplifiers. indicate that Although VACV J.S.; Saraiva-Silva, A.T.; Miranda, J.B.; Marques, F.A.; strains circulate in rodents in Brazilian forests. Indeed, Ferreira, P.C.P.; Abrahão, J.S.; Kroon, E.G.; Pereira, P.L.L.; Soares, D.F.M.; Trindade, G.S. highlight the risk of viral spread to urban environments our findings raise questions about VACV emergence and UNIVERSIDADE FEDERAL DE MINAS GERAIS and its importance to epidemiological chain. Keywords: Orthopoxvirus, Vaccinia virus, urban environment, The genus (OPV), family, Orthopoxvirus Poxviridae serology, epidemiology. Financial Support: CAPES, CNPq, comprises zoonotic species, such as Monkeypoxvirus FAPEMIG. (MPXV), Cowpox virus (CPXV), Vaccinia virus (VACV), as well as Variola virus, the causative agent of smallpox. VV120 - INVESTIGATION OF THE RABIES VIRUS Once smallpox was declared eradicated in 1980, global INFECTION IN VAMPIRE BATS (Desmodus rotundus) mass vaccination was interrupted and this, among IN FIVE CITIES OF THE RIO GRANDE DO SUL STATE, other facts, allowed zoonotic OPV to emerge. Several BRAZIL outbreaks of human and animal infections have been Dallemole, D.R.; Ellwanger, J.H.; Rosa, J.A.; Ferreira, reported, such as MPXV, endemic in Africa, and CPXV in J.C.; Erhardt, U.; Riça, L.B.; Rieger, A. Europe. In Brazil VACV is present in rural areas, causing a zoonotic disease named Bovine Vaccinia (BV), affecting 1. UNIVERSIDADE DE SANTA CRUZ DO SUL mainly dairy cattle and humans. Although studies have 2. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL shown evidence of VACV circulation among buffaloes, 3. INSTITUTO DE PESQUISAS VETERINÁRIAS monkeys, horses, dogs, pigs, rodents and cats, there DESIDÉRIO FINAMOR - FUNDAÇÃO is not a consensus about the role of these animals in ESTADUAL DE PESQUISA AGROPECUÁRIA VACV transmission chain or which animal is the virus 4. NÚCLEO DE CONTROLE DA RAIVA natural reservoir. Recent data have shown serologic HERBÍVORA - SECRETARIA DA evidence of OPV in Procyondis from Mexico. Taking into AGRICULTURA, PECUÁRIA E AGRONEGÓCIO account the zoonotic aspects and host range of OPV, we Rabies is a disease caused by a Lyssavirus that affects the hypothesized the participation of dogs and wild coatis central nervous system of mammals. Bats are important in VACV epidemiological chain in Brazil and the risks rabies virus hosts and transmitters, especially the of spreading to urban areas. In this study, we tested vampire bats Desmodus rotundus. In the Rio Grande do serum samples from 90 coatis captured in a wild region Sul State (RS, Brazil), the cases of herbivorous rabies bording urban environment, and from 123 urban dogs, are associated with the presence of vampire bats near in Belo Horizonte, Minas Gerais, Brazil. Epidemiological the places where disease outbreaks occurred. The aim information such as sex, age and clinical observations of this study was to investigate the occurrence of the were also analyzed. To detect neutralizing antibodies rabies virus in D. rotundus anti-OPV a plaque reduction neutralizing test was chosen.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV bats captured in five cities XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
225 Veterinary Virology: VV of RS: Arroio do Tigre, Bagé, Cachoeira do Sul, Candiota VV130 - HIGH DETECTION FREQUENCY OF TORQUE and Hulha Negra (where occurred cases of rabies in the TENO SUS VIRUS 1, 2 AND PORCINE CIRCOVIRUS 2 IN last two years). Twenty-two bats were captured and sent LIVERS OF SWINE AT SLAUGHTERING AGE to the IPVDF (reference in rabies diagnostic in RS) for Teixeira, T.F.; Cibulski, S.P.; dos Santos, H.F.; Lima, the collection of the brain samples and to perform the D.A.; Finkler, F.; Cerva, C.; Wendlant, A.; Almeida, L.L.; Roehe, P.M. After, a portion of each brain sample was sent to the Laboratorydirect fluorescent of Biotechnology antibody test (FAT)and Geneticsfor viral detection. (UNISC) 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL where the RNA extraction was performed, followed 2. INSTITUTO DE PESQUISAS VETERINÁRIAS by a reverse transcription step. The cDNA obtained DESIDÉRIO FINAMOR time Polymerase Chain Reaction (real-time PCR) to Swine anelloviruses (Torque teno sus virus 1 or detectionfrom this stepof the was virus submitted (primers: to JW12 amplification and N165-146) by real- TTSuV1; Torque teno sus virus 2 or TTSuV2) infections and 18S rRNA (reaction control, primers: VETINHF2 and have been reported in pig herds worldwide. Currently, VETINHR1). One sample (bovine origin) positive for the anelloviruses bear no association with disease though rabies virus by FAT was used as positive control (PC). The its role as co-factors in several syndromes, including porcine circovirus associated diseases (PCVAD), have with Human Papilloma Virus (HPV) and the sensibility been investigated. Here, a study was performed in testprimers was specificityconducted testin a was serial performed dilution (initial with a sample search for porcine anelloviruses and porcine circovirus 2 (PCV2) in pork liver destined for human consumption. testwith functionality. 50ng/µL of cDNA).The sample All samples with HPV (including did not amplify,the PC) healthy pigs at slaughtering age, originated from distinct One hundred sixty five specimens were collected from showed amplification of the 18S rRNA, demonstratingLyssavirus the. swine farming regions throughout the state of Rio Grande The virus detection by real-time PCR was possible in do Sul, Brazil. The DNA was extracted from 10 mg of showing that the primers were specific for The FAT assays, as well as the real-time PCR reactions, chloroform protocol. An SYBR Green-based quantitative total liver tissues, following a standard sodium iodide/ weresamples negative with for a minimum the rabies concentrationvirus in the 22 ofsamples. 0,19ng/µL. This PCR (qPCR) was designed to detect and quantify TTSuV1, study showed that negative results for rabies in vampire TTSuV2 and PCV2 genomes. Genomes of TTSuV1 and bats can occur in places with outbreaks of herbivore TTSuV2 were detected in all samples examined. The rabies. It is possible that these results can be associated mean viral load (MVL) for TTSuV1 was 1.63 x 103 with the virus neutralizing capacity by antirabies antibodies that can be found in bats. Moreover, the viral was 1.78 x 104 copies/100 ng of total liver DNA, whereas TTSuV2 MVL distribution in host’s tissues cannot be homogeneous, copies/100 ng of total liver DNA. The and it can hamper the detection of the virus. This study MVLs (p < 0.001). Regarding PCV2, viral genomes were TTSuV2 MVLs were significantly higher than TTSuV1 also demonstrated the possibility of using the real-time detected in 61.8% of the specimens, though with MVLs PCR for detection of the rabies virus with sensibility and 4 speed to obtain results. Keywords: Desmodus rotundus, was detected between TTSuV1 and TTSuv2 MVLs and ≤6 x 10 copies/100 ng of total liver DNA. No correlation Lyssavirus, rabies, real-time PCR, viral ecology. Financial PCV2 MVLs. In addition, it is clear that anellovirus and Support: Course of Biological Sciences (UNISC), PCV2 genomes will eventually be consumed by humans. Laboratory of Biotechnology and Genetics (UNISC), and SCS Biotecnologia (Santa Cruz do Sul, Brazil). represent any risk for human consumption remains to beThe determined. significance Financial of this findingSupport: and CNPq whether and FINEP. this will
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
226 Veterinary Virology: VV
VV148 - GENETIC CHARACTERIZATION OF INFLUENZA A VIRUS ISOLATED FROM COMMERCIAL SWINE HERDS IN SOUTHERN AND SOUTHEASTERN (99%)NA gene with sequences, pH1N1. The were NA analyzedgene sequences five of of eight H3N2 H1N1 and BRAZIL, 2014 H1N2samples isolates and all have five not sequences yet been showedanalyzed. high These similarity results Costa, E.A.; Machado, A.M.V.; Vannucci, F.; Guedes, M.I.M.C.; Dias, A.S.; Lobato, Z.I.P. human viruses, H1N2 and H3N2 subtypes in Brazilian commercialconfirm the circulationswine herds of pH1N1,with the H1N1 occurrence derived from of 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. CENTRO DE PESQUISAS RENÉ RACHOU, report of isolation and partial genetic characterization FUNDAÇÃO OSWALDO CRUZ reassortment among their gene segments. This is the first 3. LABORATÓRIO MICROVET, VIÇOSA, MINAS with pH1N1 reassortment detected during outbreaks of GERAIS acuteof a novel respiratory human-like disease H1N1 in Brazilianand H1N2 commercial influenza A swine virus population, causing major economic losses. In Brazil, virus, swine. Financial Support: CAPES, CNPq, FAPEMIG. previousSwine influenza studies A virushave infectiondetected isthe endemic circulation in swine of herds. Keywords: Brazil, H1δ, H1 pandemic, Influenza A H1N1, H3N2, pandemic H1N1 (pH1N1), which was VV152 - CHICKEN PARVOVIRUS IN CLOACAL SWABS FROM MALABSORPTION SYNDROME-AFFECTED H1N2 swine subtypes. Reassortments between swine AND HEALTHY BROILERS andfirst human identified subtypes in 2009 have in been humans reported. and In swine, 2014, and 10 Finkler, F.; Lima, D.A.; Cerva, C.; Domingues, G.; samples of nasal swab or lung tissue from pigs showing Cibulski, S.P.; Teixeira, T.F.; dos Santos, H.F.; Almeida, signs of respiratory disease of different ages and raised L.L.; Roehe, P.M.; Franco, A.C. in commercial herds from Minas Gerais, São Paulo, UNIVERSIDADE FEDERAL DO RIO GRANDE DO Paraná and Rio Grande do Sul states were analyzed. SUL INSTITUTO DE PESQUISAS VETERINÁRIAS A virus by RT-PCR and the positive samples were DESIDÉRIO FINAMOR submittedThe samples to wereRT-PCR screened subtyping for the and M virusgene ofisolation influenza in MDCK cells. Of the 10 positive samples, eight were H1N1, It has been proposed that chicken parvovirus (ChPV) one H3N2 and one H1N2. Viral RNA was extracted from might be associated to the occurrence of malabsorption the cell culture supernatants and genome sequences syndrome (MAS) in broilers. However, the role for were generated by RT-PCR targeting the hemagglutinin this virus in such syndrome is unclear, since it may be (HA), neuraminidase (NA) and matrix (M) genes. Based detected in both diseased and healthy chickens. Here, on the sequences analyzes of the M gene, all isolates an experiment was performed to determine whether showed a high identity (98-100%) with pH1N1. The ChPV genome loads in cloacae might be related to the sequences of the HA gene of seven H1N1 clustered with occurrence of MAS. Cloacal swabs from 68 broilers with pH1N1. Surprisingly, the HA gene of one H1N1 isolate MAS and 59 from healthy animals were collected from different poultry farms. A SYBR Green-based quantitative which circulated in New York in 2003, with high identity PCR was developed to detect and quantify ChPV genomes. (97-99%).clustered with Since human 2009, influenza all Brazilian A viruses H1N1 (H1swine cluster isolates δ), Genomes of ChPV were detected in all samples, regardless had all HA derived from pH1N1. Another unexpected of their health status. However, viral genome loads in of 5 result was the clustering of the HA gene of H1N2 isolated with pH1N1. Previous studies showed that the HA gene MAS-affected3 broilers were significantly higher (1x10 from Brazilian swine H1N2 isolates had high degree of (1.3x10 indicategenome copies/100suggest an ngassociation of DNA) than between in healthy higher animals ChPV genome copies/100 ng of DNA). These findings gene sequence from two H3N2 isolates showed high genome loads in cloacae of broilers and the occurrence identity with human isolates (H1δ). The analysis of HA of MAS. Financial Support: CAPES, CNPq and FINEP. viruses from Hong Kong and New York from 1996, in accordanceidentity (97%) with and other clustered reports with from human Brazil. influenzaAmong the A October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
227 Veterinary Virology: VV
VV156 - CHARACTERIZATION OF THE FECAL VIROME VV157 - EVIDENCE OF ORTHOPOXVIRUS IN CHICKENS WITH MALABSORPTION SYNDROME CIRCULATION AMONG SMALL MAMMALS OF SABARÁ, USING NEXT GENERATION SEQUENCING BRAZIL Lima, D.A.; Finkler, F.; Cibuski, S.P.; Teixeira, T.F.; Miranda, J.B.; Borges, I.A.; Vieira, F.N.; Marques, F.A.; Santos, H.F.; Cerva, C.; Varela, A.P.M.; Domingues, G.; Costa, G.B.; de Oliveira, J.S.; Ferreira, P.C.P.; Bonjardim, Almeida, L.L.; Roehe, P.M. C.A.; Abrahão, J.S.; Kroon, E.G.; Paglia, A.P.; Eiras, A.E.; Trindade, G. de S. 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. INSTITUTO DE PESQUISAS VETERINÁRIAS The importance of Orthopoxvirus (OPV) for human DESIDÉRIO FINAMOR health is highlighted by the rate of deaths that one of Malabsorption syndrome (MAS) is responsible for its members, Variola virus, has caused worldwide. For major economic losses in the commercial broiler that reason a vaccination campaign has been developed industry. Different enteric viruses have been studied by the WHO using Vaccinia virus, another OPV, as the and implicated in this syndrome. However, the role vaccinal agent. Even though Variola virus was declared of such viruses in MAS remains poorly understood. eradicated, other members of the OPV genus are arising Recent advances have allowed insights into the whole as important zoonotic agents, naming Monkeypox virus viral community in the intestine, thus providing an (MPXV) in Africa, Cowpox virus (CPXV) in Europe and opportunity to search for combined agents that may Vaccinia virus (VACV) in Brazil and India. In Brazil, VACV play a role in a particular syndrome. In this study, a causes exanthematic disease mainly in milking cattle metagenomic sequencing approach was employed and humans that are in close contact with these animals. in attempting to identify viral communities in MAS- Evidences of virus circulation have also been detected affected chickens. Samples were collected from two in monkeys, horses, dogs, cats, pigs and rodents, being high density poultry farming regions in the state of Rio the last ones implicated as important links between the Grande do Sul, Brazil. Samples were pooled, diluted 1:10 natural and human habitats. Taking into account that little is known about the natural reservoirs of VACV to ultracentrifugation to concentrate viral population. and that MPXV and CPXV have rodents as reservoirs, in PBS, clarified by centrifugation, filtered and submitted Viral nucleic acids were extracted from intestines of the aim of the present work was to access the presence 20 MAS-affected chickens. After extraction, enriched of OPVs in rodents from a target area in Sabará, Brazil. and sequenced using the Illumina Miseq System. A Small mammals were trapped using size selective cages, total of 1,030,898 reads were assembled into 10,714 organs and blood samples were collected for further contigs using the Spades 3.5 and compared to GenBank lab processing. Sera were used for PRNT assays and qPCR essays targeting the OPV conserved gene C11R. The Geneious software was used for open reading frame PRNT was performed in BSC-40 cells using VACV- nucleotide and protein databases using blastn/blastx. predictions and genome annotations. About 3,000 of the WR and positivity was given by a reduction of 50% or contigs were associated to viral genomes. Contigs which more of plaques in comparison with virus control. For showed identity to viruses of animal origin (i.e. excluding qPCR experiments, diluted sera was used as template sequences of phages) could be assigned to families Adenoviridae, Caliciviridae, Circoviridae, Parvoviridae, duplicate or in more than one test and suspect when Picobirnaviridae, Picornaviridae and Reoviridae. These and sample was considered positive when amplified in partial results demonstrate a large diversity within a seroprevalence of 10% and the same percentage of the viral population detected in MAS-affected broilers. DNAamplified detection. in one Besides replicate. that, Preliminary 6,25% of samples results showwere Further studies shall be performed to better evaluate the considered suspected in molecular essay. Positivity was role for such viral communities in the development of found amongst Didelphis albiventris, Necromys lasiurus, MAS. Financial Support: CAPES, CNPq and FINEP. Oligoryzomys sp., Necromys and Cerradomys subflavus,
that OPVs are circulating in the study area. These are October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinarybeing Virology: the VV first two the most prevalent. Our results show XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
228 Veterinary Virology: VV
VV163 - INVESTIGATION OF INFLUENZA A, WEST the participation of rodents and marsupials, respectively, NILE AND NEWCASTLE DISEASE VIRUSES IN BIRDS inimportant the VACV findings transmission which reinforcechain. The and area put studiedin evidence is a FROM THE PANTANAL WETLANDS OF MATO GROSSO, natural habitat surrounded by human occupation and BRAZIL virus presence is relevant as it could spread to domestic Ometto, T.; Pinto, B.L.; Araujo, J.; Thomazelli, L.M.; animals and humans. Further analyses are necessary Seixas, M.M.; Barbosa, C.M.; Ramos, D.G.S.; Melo, to characterize the virus detected. Financial Support: A.L.T.; Pinho, J.B.; Durigon, E.L.; Aguiar, D.M. CAPES, CNPq, FAPEMIG, PRPq UFMG, PPG-Microbiologia UFMG. 1. UNIVERSIDADE DE SÃO PAULO 2. UNIVERSIDADE FEDERAL DE MATO GROSSO VV159 - GYROVIRUS 4 (GYV4) DETECTED IN FECES FROM BRAZILIAN COMMERCIAL BROILERS Lima, D.A.; Finkler, F.; Cibuski, S.P.; Teixeira, T.F.; birds.The Pantanal It is known is the that world’s birds canlargest act as flooded natural biome reservoirs with Santos, H.F.; Cerva, C.; Varela, A.P.M.; Domingues, G.; ofa seasonal Influenza flood A, West pulse Nile that (WNV) attracts and a Newcastlegreat diversity Disease of Almeida, L.L.; Roehe, P.M. (NDV) viruses, although their occurrence in birds from 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL out in the municipality of Poconé, one of the biggest the Pantanal was not verified yet. The study was carried 2. INSTITUTO DE PESQUISAS VETERINÁRIAS Pantanal area of Brazil. The birds were captured using DESIDÉRIO FINAMOR Gyrovirus 4 (GyV4) was initially detected in feces of encompassingmist nets during a total flood, area ebb of and100m dry per seasonal collection cycles point. of diarrheic children. Later on, the virus was detected in the Pantanal and effort involved 1200 mist net/hours chicken meat destined to human consumption. These taken from the cloaca and orotracheal mucosa using sterileBirds wereswabs. identified The samples and were samples stored of in secretions transportation were food uptake. To date, little is known about GyV4 infections media following the protocol described in the WHO infindings chickens. suggest Here that a study humans was mayperformed acquire in the attempting virus by to identify gyroviruses in chicken feces. Samples (n=20) were collected from different poultry farms in the state inmanual liquid on nitrogen Animal Influenzauntil the Diagnosis moment andof analysis. Surveillance. The of Rio Grande do Sul, Brazil. The feces were diluted in samplesThe cryotubes from wereeach identifiedindividual andbird immediately were pooled frozen and the genetic material extracted using a semi-automated viral population. Viral nucleic acids were extracted, MagMAXTM enrichedPBS, filtered and andsubmitted ultracentrifuged to next generation to concentrate sequencing the tested by qRT-PCR targeting the matrix gene of Influenza in the Illumina MiSeq System. A total of 541,988 reads A virus, envelope Express-96 gene Pathogenof WNV and RNA/DNA matrix kitgene (5X) of wereNDV. were obtained. The reads were assembled into contigs with aid of the program SPAdes 3.5. One circular contig qRT-PCR for any of the three viruses were then subjected contained 43,548 reads was assembled which displayed toThe direct samples double-stranded that showed ansequencing amplification in an curve ABI PRISM in the a high genomic similarity (99%) with GyV4. The genome 3100 Genetic Analyzer and the resulting sequences were comprises 2,035 nucleotides arranged in two open aligned with other corresponding sequences available reading frames (VP1 and VP2) separated by an intergenic in GenBank. A total of 76 birds belonging to 10 orders and 20 families were captured. The most representative order was Passeriformes (10 families), followed by onregion the detection of 519 nucleotides. of GyV4 in chicken Apart feces. from Further being the studies first the other nine orders, which included Columbiformes, willGyV4 be sequence conducted reported in the future in Brazil, to investigate this is the thefirst biology report Psittaciformes, Charadriiformes and Anseriformes. The and the possible pathogenic potential of this agent to its most representative family was Thamnophilidae, with 13 hosts. Financial Support: CAPES, CNPq and FINEP. individuals (17.1%), followed by the family Tyrannidae with 11 individuals (14.5%) and the family Furnariidae with eight individuals(10.5%). All birds were considered October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
229 Veterinary Virology: VV healthy and tested negative for the three viruses. We can (~135 copies), intestines (~296 copies) and bursa of Fabricius (~358 copies). Thus, ChPV DNA was broadly from the samples in this region of the Pantanal during distributed in the samples examined here. Tissues theconclude period that of this Influenza, study. In WNV short, and this NDV study were highlights absent obtained from MAS-affected broilers contained higher the need for more detailed research involving ongoing viral loads than those of healthy chickens. These results monitoring of the birds in the Pantanal, in order to suggest that high ChPV loads may be associated with the expand the sampling design in each seasonal period to development of MAS. Keywords: Poultry, Parvoviridae, encompass a wider variety of avian species, which are runting-stunting syndrome (RSS), quantitative PCR. considered potential reservoirs of infectious diseases. Financial Support: CAPES, CNPq and FINEP.
VV175 IDENTIFICATION OF CANINE KOBUVIRUS FinancialVV171 - Support: CHICKEN CAPES, PARVOVIRUS INAU/MCT, CNPq, IN TISSUES FAPESP. OF RNA IN FECAL SAMPLES FROM DOMESTIC DOGS IN HEALTHY AND MAS-AFFECTED BROILER BRAZIL Finkler, F.; Lima, D.A.; Cerva, C.; Domingues, G.; Ribeiro, J.; Silva, A.P.; Moraes, N.R.; Diniz; J.A.; Teixeira, T.F.; Santos, H.F.; Cibulski, S.P.; Almeida, L.L.; Campanha, J.E.T.; Lorenzetti, E.; Silva, R.O.S.; D’Elia, Roehe, P.M.; Franco, A.C. M.L.; Almeida, L.R.; Alfieri, A.A.; Alfieri, A.F. 1. UNIVERSIDADE FEDERAL DO RIO GRANDE 1. UNIVERSIDADE ESTADUAL DE LONDRINA DO SUL 2. UNIVERSIDADE FEDERAL DE MINAS GERAIS 2. INSTITUTO DE PESQUISAS VETERINÁRIAS The genus Kobuvirus belongs to the Picornaviridae DESIDÉRIO FINAMOR family and the virions are non-enveloped, with Associations between chicken parvovirus (ChPV) icosahedral symmetry and a diameter of 27-30 nm. infections and the occurrence of malabsorption syndrome (MAS) in birds have been proposed, though the subject samples of dogs with acute gastroenteritis in 2011 in the USACanine and kobuvirus since then (CKoV) studies was have first detected detected the in presencethe fecal to detect and quantify ChPV in MAS-affected as well of CKoV in Italy, Korea, and UK. However, in Brazil there asis stillin healthyundefined. commercial In this study, broilers. a search Samples was performedof tissues are no reports on the presence of CKoV in fecal samples (liver, thymus, spleen, gut, bursa of Fabricius) and sera from domestic dogs. Twenty-one fecal samples the were collected from 50 MAS-affected broilers, 39 days- dogs with 4 months to 13 years old from the states of old, as well as from and 9 healthy animals at the same Paraná (n=11) and Minas Gerais (n=10), Brazil were age. DNA was extracted from samples and submitted to analyzed. Fecal suspensions were prepared at 10-20% quantitative PCR targeting a segment of the ChPV NS gene. Birds were considered infected when at least one min. The nucleic acid extraction was performed with of its tissues contained viral genomes. The virus was 500(w/v) µL in ofPBS fecal buffer suspensions. and centrifuged All fecal at 3,000samples x g werefor 5 detected in 100% of the broilers, regardless of its disease submitted to RT-PCR assay to detect the RdRp gene of status. The virus was most often detected in the bursa a product with 216 bp. The RT-PCR products were analyzedthe CKoV by using electrophoresis the primers in UNIV-F/Ra 2% agarose that gel amplifies in TBE MAS-affectedof Fabricius (59/59), broilers, spleen the intestines (57/59), showed intestine the (55/59), highest buffer, stained with ethidium bromide, and visualized liver (14/59), thymus (2/59) and serum (10/34). Among under UV light. Two RT-PCR products, of which one was followed by bursa of Fabricius (~1,134 copies), spleen from Paraná and other from Minas Gerais state were (~276ChPV genomecopies), thymus loads (~5,500(~12 copies) copies/300ng and liver DNA),(~33 copies). The average viral genome load in serum was Analyser and submitted for nucleotide (nt) sequence analysis.purified, quantified,Six out of 21 sequenced (29%) fecal in an samples ABI3500 evaluated Genetic thymus from healthy animals. Livers of healthy animals were positive for CKoV RdRp gene. Four positive fecal 1.134 copies/mL. No viral DNA was found in sera and samples were from Paraná and two from Minas Gerais state.The nt phylogenetic analysis of the RdRp region of showed significantly lower concentrations of viral DNA (~10October copies/300ng 2015 Volume 20 DNA) – Supplement in comparison 1 - Abstracts/Posters to their spleens - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
230 Veterinary Virology: VV
CKoV showed that the two Brazilian strains (BRA01 and and Geminivirus genus were detected. In addition BRA02) clustered in the same branch with other CKoV to these genomes, most of the viral sequences were strains and fox kobuvirus described in other countries bacteriophages belonging to Microviridae family and worldwide. The Brazilian CKoV BRA01 and BRA02 other viruses with circular single-stranded DNA virus strains exhibited 94.9% of nt identity each other and 92.5% to 94.9% of nt identity with strains detected in and TTSuVs, genomes recognized in previous studies as dogs and fox available in GenBank. This study reveals the participants(ssDNA) unclassified. in PCVAD Therefore, development, addition the presentof PCV2, studyPPVs presence of CKoV RNA in fecal samples from domestic found in the pig sera other viral genomes not related dogs from Brazil and suggests that epidemiological and with these diseases. Keywords: Metagenomic, Next- molecular studies should be performed to characterize Generation Sequencing, Porcine Circovirus Associated the CKoV strains circulating in all Brazilian geographical Desease, Single-Stranded DNA Viruses, Swine Sera. regions. Keywords: Dogs, fecal samples, RT-PCR, CKoV. Financial Support: FINEP, EMBRAPA, FEPAGRO. Financial Support: FINEP, CAPES, CNPq, and Fundação VV182 - DEVELOPMENT OF ENZYME-LINKED IMMUNOSORBENT ASSAYS (ELISAS) FOR DETECTION Araucária/PR.VV176 - SINGLE-STRANDED DNA VIRUSES FOUND IN OF ANTIBODIES TO BOHV-1, BOHV-5 AND BUHV-1 SWINE SERA WITH CIRCOVIROSIS SIGNS THROUGH Scheffer, C.M.; Varela, A.P.M.; Schmidt, C.; Paim, METAGENOMICS ANALYSIS W.P.; Cibulski, S.P.; Teixeira, T.F.; Santos, H.F.; Lima, Cerva, C.; Cibulski, S.P.; Teixeira, T.F.; Lima, D.A.; D.A.; Tochetto, C.; Loiko, M.; Cerva, C.; Petzhold, S.A.; Finkler, F.; Varela, A.P.M.; Mayer, F.Q.; Loiko, M.R.; Roehe, P.M. Roehe, P.M. 1. UNIVERSIDADE FEDERAL DO RIO GRANDE 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL DO SUL 2. INSTITUTO DE PESQUISAS VETERINÁRIAS 2. FUNDAÇÃO ESTADUAL DE PESQUISA DESIDÉRIO FINAMOR AGROPECUÁRIA The aim of this study was to develop ELISA-based assays The porcine circovirus type 2 (PCV2) is a serious to detect antibodies induced by all subtypes of bovine herpesvirus type 1 (BoHV-1), type 5 (BoHV-5) and buffalo herpesvirus 1 (BuHV-1) presently recognized. theproblem main to agent the swine of diseases industry that and are can collectively lead to significant known Antigens from three subtypes of BoHV-1 (1.1, 1.2a, 1.2b), negative impacts on profitability of production. PCV2 is three BoHV-5 (a, b, c) and the single (type 1) BuHV-1 which participate several factors, including practices were prepared by multiplication in MDBK cells following management,as “porcine circovirus co-infections, associated host disease”genetic (PCVAD),and viral in usual protocols. The antigens were tested individually. genotype. However, despite the presence of PCV2 be To validate the assays, 404 bovine sera were previously crucial to the emergence of these clinical condition, the screened in serum neutralization (SN) tests to each of involvement of other infectious agents remains unknown. In this context, we carried out a study to identify other samples were shown to contain neutralizing antibodies viral genomes circulating in the pigs serum with PCVAD. tothe at sevenleast one viruses. of the Inseven such viruses assays, tested. 151/404 Subsequently, (37.4%) Therefore, through next-generation sequencing and serum samples were analyzed using a commercial ELISA metagenomics analysis, were analyzed 32 pig serum samples that had signs consistent with PCVAD, coming samples were positive. In the ELISAs the sensitivity of from the Rio Grande do Sul farms. The analysis results thekit (IBRgB).test varied In accordingthe commercial to the antigenELISA, 165/404 used; cumulative (40.8%) showed viral sequences of PCV2, Torque Teno Sus Virus (TTSuV) types 1 and 2, Porcine Parvovirus (PPV) type 1, one of the antigens. When the ELISAs with each viral 2, 3, 4, 5 and 6; Porcine-circo-like virus and circular virus antigenresults reveal were 178/440considered (44.0%) individually, sera positive the maximumto at least associated with the feces of pigs (PigSCV and PoSCV). sensitivity was attained with antigen prepared with Also genomes belonging to Cyclovirus, Gemycircularvirus
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - VeterinaryBoHV-5c Virology: VV 154/404 (38.1%). The ELISAs prepared with XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
231 Veterinary Virology: VV other antigens revealed variable sensitivity (73.6% to 80.9%). Maximum sensitivity was achieved by adding the positive results obtained with six of the antigen foundtree, two in beefRVA strainscattle herds, showed but the the G6P[5] commercial genotype. vaccine The preparations (BoHV-1.2a, BoHV-1.2b, BoHV-5a, BoHV- withG6P[5] this genotype genotype combinationwas only introduced is the more in the commonlylast years.
a beef cattle herd regularly vaccinated with a RVA strain sample5b, BoHV-5c, used in BuHV-1). manufacturing. These findings The ELISA show sensitivity that the composedThis is the withfirst thereport same of G neonatal and P genotypes diarrhea combination outbreak in cansensitivity be enhanced of the ELISAwhen iscombinations influenced byof viralherpesvirus antigen antigens are used. An ELISA with combined antigens will be evaluated in the near future. Keywords: bovine of RVA strain identified in the field outbreak. Keywords: herpesvirus, bubaline herpesvirus, viral subtypes, RVA, calves, G6P[5] genotype. Financial Support: FINEP, serological test. Financial Support: CAPES, FINEP, CNPq. CAPES,VV184 CNPq, - BOVINE and Fundação GROUP Araucária/PR. A ROTAVIRUS G10P[11] GENOTYPE CIRCULATING IN A DAIRY CATTLE HERD VV183 - GROUP A ROTAVIRUS G6P[5] GENOTYPE IN REGULARLY VACCINATED WITH G6P[5] GENOTYPE A NEONATAL DIARRHEA OUTBREAK IN A BRAZILIAN Medeiros, T.N.S.; Ribeiro, J.; Oliveira, M.V.; Diniz, J.A.; BEEF CATTLE HERD Ferreira, D.H.P.; Pannunzio, C.A.; Alfieri, A.F.; Alfieri, Medeiros, T.N.S.; Lorenzetti, E.; Paixão, S.F.; Massi, A.A. R.P.; Pannunzio, C.A.; Ferreira, D.H.P.; Alfieri, A.F.; UNIVERSIDADE ESTADUAL DE LONDRINA Alfieri, A.A. Bovine group A rotavirus (RVA) is one of the most UNIVERSIDADE ESTADUAL DE LONDRINA important agent of neonatal diarrhea in calves through Neonatal diarrhea is one of the main important diseases the world. The rotavirus belongs to the Reoviridae of calves worldwide and the rotavirus is the most family, genus and is composed by a triple-layered common causative agent. The frequent combinations protein capsid. The VP7 and VP4 proteins of RVA are of G (VP7) and P (VP4) genotypes of bovine group A located in the outer layer capsid, induce neutralizing are commercial vaccines to reduce the economic losses in genotypes G and P, respectively. The most common ofrotavirus neonatal (RVA) diarrhea are G6P[1], in dairy G6P[5], and beef and cattleG10P[11]. herds. There The combinationantibodies and of determineG (VP7) and the P binary (VP4) viralgenotypes classification of RVA aim of this study was to detect the cause of a neonatal diarrhea outbreak in a beef cattle herd in Mato Grosso do Sul state, Brazil. The cows were vaccinated with Gstrains (VP7) isolated and P (VP4) from calvesgenotypes are of G6P[1], three G6P[5],RVA strains and G10P[11]. The present study aim to determine the collected twelve diarrheic fecal samples from Nellore calvescommercial (up tovaccine 30 days contained old) during G6P[5] December,genotype. It2013. was genotype.identified inThe diarrheic VP7 and fecal VP4 samples genes ofcollected RVA strains from dairywere All diarrheic fecal samples were submitted to RNA cattle herd regularly vaccinated against RVA G6P[5] amplicons with 990 bp (VP7) and 863 bp (VP4) length amplified by RT-PCR using consensus primers. The methodsextraction and using were a combination evaluated of phenol/chloroform/by silver stained- and sequenced in ABI3500 Genetic Analyzer sequencer polyacrylamideisoamyl alcohol gel and electrophoresis silica/guanidinium (PAGE). isothiocyanate Three PAGE- usingwere the purified same andprimers quantified used in usingthe RT-PCR commercial assay. The kits positive fecal samples were submitted to RT-PCR assay nucleotide sequence analysis was performed using using primers to amplify G (VP7) and P (VP4) genes Phred, CAP3, Bioedit and MEGA v6 softwares. The of RVA. Two positive products for RVA in RT-PCR were three RVA strains included in the analysis exhibited sequenced in ABI3500 Genetic Analyzer sequencer. The phylogenetic analysis was performed using MEGA v6 and P genotype combination from the commercial vaccine. the G10P[11] genotype, that belongs a different G and of the diarrheic fecal samples analyzed by PAGE and in P genotypes of RVA strains that cause neonatal diarrhea allBioEdit samples software. submitted The RVAto RT-PCR was detected assay. In in phylogenetic75% (9/12) inThe vaccinated continuous and monitoring non-vaccinated and identification cattle herds of provide G and
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
232 Veterinary Virology: VV information related to the circulation and diversity of Only (1.0%) of the primers were in this range, 1 (0.5%) RVA strains in cattle and it is important for animal and presented higher Tm and 194 (98.5%) presented public health. This constant monitoring of the G and low Tm. For the GC content, the primers presented an P genotypes circulating in different Brazilian regions average of 44.13 (Min-Max:18.8-60, SD:7.28). 15 (7.6%) will favor the comprehension of the causes of neonatal presented lower GC, none was above and 182 (92.4%) diarrhea in regularly vaccinated cattle herds. Financial were within the expected values (40-60%). The analyzed primers presented an average of 3.8 (Min-Max:2-10) PR. Keywords: RVA, dairy, diarrhea, genotypes, self-dimer and 4.07 (Min-Max:2-18) of hetero-dimer. rotaviruses.support: FINEP, Financial CAPES, Support: CNPq, and FINEP, Fundação CAPES, Araucária/ CNPq, and Conclusion: There is a great diversity of primers being used for the RNA detection of CDV. These primers present distinct characteristics. Many of them present FundaçãoVV189 - IN Araucária/PR. SILICO ANALYZIS OF PRIMERS USED FOR Tm below the recommended value and some present RNA IDENTIFICATION OF THE CANINE DISTEPER formation of a great number of hetero-dimer ligation. VIRUS BY RT-PCR Therefore, the validation of the molecular assays is Rosadas, C.; Sjostedt, P.P.; Rodrigues, C.N. essential before their implementation in the laboratorial UNIVERSIDADE FEDERAL DO RIO DE JANEIRO routine. The standardization of these tests is essential UNIVERSIDADE ESTÁCIO DE SÁ for reproducible and accurate results. Financial Support: ESTÁCIO DE SÁ. Canine distemper is a highly contagious disease with high lethality in dogs. The agent belongs to Morbillivirus VV200 - EPIDEMIOLOGICAL SURVEY OF CANINE gender, Paramyxoviridae family and can infect other CIRCOVIRUS INFECTION IN BRAZIL mammals. For the diagnosis of the infection, molecular Araujo Jr., J.P.; Portela, L.M.F.; Cruz, T.F. testes, such as the reverse transcription followed by polymerase chain reaction (RT-PCR), can be used. The UNIVERSIDADE ESTADUAL PAULISTA Circoviruses (family Circoviridae) are non-enveloped, icosahedral viruses with single-stranded circular thetest primeridentifies annealing, viral RNA so, in the different primer samples.design is Theyessential are genome DNA that infect birds and mammals. More forhighly test specifics accuracy. and PCR sensible. is an The in specificityhouse technique is related and to recently, a canine circovirus was detected in samples from dogs with vasculitis and hemorrhagic diarrhea in the test result. Objectives: Identify the primers used for the USA, Italy and Brazil, but not much is known about different primers are currently used. This can influence its epidemiology and worldwide distribution. Thus, the (CDV), beside of making an in silico analysis of them. objective of this study was to detect canine circovirus Methods:the identification A research of RNA in PubMed of the canine Database distemper was realized virus several states of Brazil by quantitative PCR (qPCR). DNAin blood was and/or extracted stool from samples whole collected blood from(n=321) dogs and in Thewith variables the terms were: “CDV” number and of “RT-PCR”.nucleotides, The GC content, primers stool (n=29) samples collected from dogs in the period meltingidentified temperature were analyzed (Tm), with self-dimer the program and OligoAnalyzer. hetero-dimer from November 2007 to June 2015. The dogs were one formation. Results: The PubMed research resulted in months-old to 16 years-old. The number of samples per 111 articles, 47 presented primers for RT-PCR for CDV. State was: Alagoas (n=3), Espírito Santo (n=2), Paraná 197 primers were obtained (99 forward, 98 reverse). (n=46), Rio de Janeiro (n=49), São Paulo (n=239), and The primers presented, in average, 20 nucleotides (Min- Max:12-90, SD:29.18). According to the software, the for canine circovirus were analyzed qualitatively. Five ideal number of nucleotides for a primer varies 18-30. dogsno specified were positive (n=11). for The canine results circovirus. determined These by qPCRdogs Then, 185 (93.9%) were correct, 11 (5.6%) below the recommended and 1 (0.5%) presented a high number of nucleotides. The Tm average was 51.14 (Min-Max: were from Rio de Janeiro (1/5), Paraná (3/5) and São 27.7-59, SD: 5.6). The recommended Tm is 60-64OC. Paulo (1/5) States. The dogs were five to seven months- old and samples were collected in 2012 (3/5) and 2014 October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary(2/5). Virology: To VV confirm the presence of canine circovirus, XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
233 Veterinary Virology: VV
VV217 - DETECTION OF CANINE PARVOVIRUS VIRUS BY PCR one DNA extracted of stool sample was amplified by digestion. Fragments larger than 2000 bp were observed Rodrigues, E.D.L.; Cruz, A.V.; Jesus, I.S.; Brito, T.C.; rolling-circle amplification (RCA) followed by restriction suggesting canine circovirus genome (2,063 kb). The Moura, T.P.C.; França, B.L.C.; Negrão, A.M.G.; Casseb, Cap protein region was sequenced using Illumina Miseq A.R.; Teixeira, M.R.N.; Silva, S.P. platform and sequence was 98.2% identical to published (accession JQ821392). The results of this study suggest 1. UNIVERSIDADE FEDERAL RURAL DA AMAZÔNIA that canine circovirus has a lower prevalence (0.6% and 2. INSTITUTO EVANDRO CHAGAS 10.3% for whole blood and stool samples, respectively) in Brazil, but the detection of canine circovirus in Canine parvovirus is one of the most important different states suggest widespread distribution and viral infections of young dogs. Clinically, the disease circulation since 2012. Financial Support: FUNDIBIO (IC is manifested by fever, vomiting, hemorrhagic gastroenteritis, fast dehydration and high mortality. The etiologic agent of canine parvovirus is a DNA virus, 011/2015),VV207 - HIGH FAPESP BVDV (14/13532-3). POSITIVITY AMONG BRAZILIAN non-enveloped, belonging to Parvoviridae family, genre HERD: MOLECULAR DETECTION AN PHYLOGENY Parvovirus, called canine parvovirus (CPV). There are Figueiredo, P.O.; Alves, P.A.; Oliveira, D.B.; Guedes, two types of parvovirus in dogs: the CPV type 1 without M.I.M.C.; Bonjardim, C.A.; Ferreira, P.C.P.; Abrahão, J.S.; Kroon, E.G.; Trindade, G.S. CPV-2, which has three subtypes - CPV2a, CPV2b and CPV2c.clinical The significance CPV2b is defined the most in gastroenteritis,prevalent in the and canine the UNIVERSIDADE FEDERAL DE MINAS GERAIS population. The CPV has a worldwide distribution. The The viral infections of Bovine diarrhea virus (BVDV) faeces of infected animals present great amount of viral are present in cattle populations worldwide, resulting particles using as a gateway to mouth. The objective this in huge economic losses due to a high prevalence combined with negative effects on reproduction and Parvovirus. Methods: 4 stool samples from dogs were health condition of the affected herds. However, studies collectedstudy was between to confirm 4 and the6 months clinical of age diagnosis treated ofat HOVET Canine on the prevalence of BVDV in Brazil are still scarce and the few available are mostly serologic retrospective gastroenteritis without immunoprophylaxis history, this studies. Thus, the objective of this study was to perform material/ UFRA, was who sent had to clinical the Technology symptoms Innovation of hemorrhagic Center a molecular prospection by qPCR, conventional PCR and (CIT) of the Evandro Chagas Institute (IEC), which was sequencing for the detection and characterization of the held extraction of viral ssDNA by Trizol method + kit most frequent genotypes and subgenotype circulating of Qiagen (QIAmp Viral RNA Mini Kit, Cat. No. 52906). in several states of Brazil . Samples were obtained from states of Minas Gerais, Bahia, Espírito Santo and Goiás from 2012 to 2014. We analyzed 240 samples from responsibleConfirmation for of the the formation presence of of the CPV viral was capsid, performed using crusts, sera and PBMCs, where 77 were positive (32%). aby sensePCR using primer a pair (5’-GCCATTTACTCCAGCAGC-3 of primers specific to VP2 protein,‘) and Minas Gerais state showed 49%, Goiás with 27%, Bahia antisense primer (5’ -AGTAAGTGTACTGGCACAG-3 ‘) and Espírito Santo had 19% of positive samples. Four samples were sequencing and characterized as BVDV- reaction was performed in reading agarose gel of 1a, subgenotype also recently detected in southern 2%,which using amplifies as the a developer region of 216SYBR® base Safe, pairs. along The with PCR Brazil. These data showed the high positivity of infected molecular weight of 1000 base pairs, serving as a animals and the active circulation of the virus in the standard for identifying the size of the generated bands. The visualization was made in a transilumidor coupled to a fotodocumentador. Results: All samples Brazilian herd. Financial Support: CNPq, PRPq/UFMG. clinical diagnosis of canine parvovirus. Conclusions: Thewere PCR positive is used for as CPV an effective using PCR, method confirmed for diagnosing that the October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
234 Veterinary Virology: VV
keratinocytes. Total DNA extracted from fresh tissue sensitive for detection of CPV in dog faeces compared toviral other etiology diagnostic of numerous tests like diseases, haemagglutination more specific test,and tissue from the other four outbreaks was submitted ELISA and virus isolation. What increases the accuracy tofragments polymerase obtained chain from reaction one outbreak(PCR) for and Swinepox paraffinized virus of the diagnosis given that the symptoms are not (SWPV) and Vaccinia virus (VACV), that is the differential pathognomonic which can be confused with other viral diseases. Keywords: Canine parvovirus; Dogs; material from one outbreak. Nucleotide sequencing and Hemorrhagic Gastroenteritis; PCR. phylogeneticdiagnosis. DNA analysis of SWPV of the was PCR identified amplicons by demonstrated PCR in fresh 100% homology with sequences from SWPV, grouping VV219 - SWINEPOX IN PIGS IN NORTHEASTERN together with a Brazilian isolate (Holambra, SP) and BRAZIL with a standard SWPV (strain 17077-99). All tissues Monteiro, F.L.; Olinda, R.G.; Maria, L.A.; Cargnelutti, were PCR negative for VACV. Thus, this article reports J.F.; Gois, R.C.S.; Batista, J.S.; Dantas, A.F.M.; Monteiro, the circulation of swine poxvirus in backyard pigs in F.L.; Weiblen, R.; Flores, E.F.; Riet-Correa, F. Northeastern Brazil, indicating the need of including 1. UNIVERSIDADE FEDERAL DE SANTA MARIA SWPV in the differential diagnosis of dermatitis in 2. UNIVERSIDADE FEDERAL DE CAMPINA pigs. Financial Support: CNPq – Conselho Nacional de GRANDE 3. UNIVERSIDADE FEDERAL RURAL DO SEMI- ARIDO DesenvolvimentoVV221 - INVESTIGATION Científico e OF Tecnológico. THE OCCURENCE OF RESPIRATORY VIRUSES IN NONHUMAN PRIMATES Swinepox is a vesiculo-pustular disease of young and OF THE NEW WORLD adult pigs caused by Swinepox virus (family Poxviridae, Bedran, R.L.; Silva, A.M.; Silva, G.A.; Lima, S.T.; Silva, genus Suipoxvirus). Affected animals present progressive A.K.; Medeiros, R.; Santos, M.C.; Mello, W.A. and frequently generalized lesions in the skin starting by punctiformes hemorrhages. Pigs are the only host 1. EVANDRO CHAGAS INSTITUTE species of SWPV in nature and virus transmission is 2. INSTITUTIONAL SCHOLARSHIP PROGRAM usually associated with poor hygienic conditions and FOR SCIENTIFIC INITIATION 3. NATIONAL PRIMATE CENTER which act as mechanic vectors for virus transmission. 4. NUCLEUS OF TROPICAL MEDICINE, the presence of insects, mainly lice and domestic flies FEDERAL UNIVERSITY OF PARÁ swinepox in backyard pigs in Northeastern Brazil (2008, Nonhuman primates (NHP) have a close phylogenetic 2013This articleand 2014). describes The cases five affected outbreaks piglets suspected and adult of relationship with humans, which can be translated by pigs in domestic pig herds of poor hygienic-sanitary common pathogens to humans and NHP, in this context, they stand out as viral diseases. In this scenario, they infestations. The morbidity ranged from 33.3 to 100% highlight the infections by respiratory viruses, as amongconditions, affected most herds,of which with presenting mortality severe reaching fly and up lice to demonstrated in investigations conducted in different 60%. The affected animals developed progressively regions of the world, in which these agents are often detected among NHP. It is aimed to investigate the that eventually erupted evolving to scabby and erosive occurrence of respiratory viruses in New World NHP lesions.coalescent Affected graywish/whitewish piglets presented papules apathy, and anorexia blisters and fever. The disease resolved within 15 to 25 days. Histological examination of lesions revealed proliferative nasopharyngealliving in the Centro aspirate Nacional from August de Primatas 2014 to (CENP/ June and ulcerative dermatitis with ballooning degeneration 2015,Ananindeua/Pará). the species Allouata Samples sp., Cuxiu were sp., collectedAotus sp . and by Saimiri sp., of different ages and gender, symptomatic of lymphocytes, plasma cells, neutrophils, eosinophils and asymptomatic, evaluated by the veterinary medical andof epithelial some macrophages cells, perivascular in the inflammatory dermis. Intranuclear infiltrates staff of CENP. The viral nucleic acid was extracted from eosinophilic inclusions were consistently observed in clinical specimens using the QIAamp® Viral RNA Mini Kit
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
235 Veterinary Virology: VV
(Qiagen) according to the manufacturer’s instructions. acute infection nor reactivated latent infection upon The extracted nucleic acid was subjected to rRT-PCR dexamethasone (Dx) administration at day 42 post- (real time Reverse Transcriptase - Polimerase Chain inoculation (pi). In the immunogenicity test, beef calves Reaction (8 to 10 months-old) were vaccinated once IM (group I, n=8) or subcutaneously (group II, n=9) with live BoHV- ) specific oligonucleicos probes and primers 7.3 virus (VRS), human metapneumovírus (hMPV), human TCID50 for Influenza Virus A and B, human respiratory syncytial 7.3 adenovirus (hAdV), humans coronavirus 229E, HKU1, inactivated virus (10 TCID50 NL63, OC43; and human rinovírus (HRV). In this study, hydroxide1gEΔ (10 (group/animal) III, n=13) or twiceor Montanide (30 days apart)(group with IV, 40 samples were analyzed, 21 were male and 19 female n=14). All calves vaccinated with/animal) live virus plus developed aluminum individuals. Among the individuals investigated, only VN titers of 2 to 8 (group I, GMT: 2; group II, GMT: 1.65) three had symptoms of respiratory infection at the time at 42 days pv. Animals of groups III and IV developed VN of collection. When subjected to the detection of the titers of 2 to 16 (GMT: 2.45) and 2 to 128 (GMT: 3.9), viral genome, the samples were negative for all viroses. According the current study, it can be infered that the remained negative in the gE ELISA. In a vaccination- negativity found in the study population can be explained challengerespectively. experiment, All calves vaccinatedgroups ofwith three-months-old the BoHV-1gEΔ 7.3 by the time that the samples were colected, out of most calves vaccinated with live virus (10 TCID50 viral circulation period in that region, since studies have n=6) or non-vaccinated (n=4) were challenged IN with 7.5 /animal, shown to be frequent detection of respiratory viruses a highly virulent BoHV-1 strain (10 TCID50 in NHP who have had close contact with humans. The day 47 pv. Vaccinated animals developed only mild and transient nasal signs comparing with severe/animal) and long at bureaucratic obstacles, even facing the lack of positivity, lasting rhinitis, conjunctivitis and fever developed by itdifficulty is believed in that collecting the genetic samples similarity was primarilybetween humans due to control calves. Virus shedding by vaccinated animals and NHP besides the close intection between animals and animals keepers in preservation centers, surveillance These results demonstrate that the recombinant BoHV- of respiratory viruses circulating on these population was also significantly reduced compared to controls. deserve to be encouraged. Keywords: Respiratory inactivated adjuvanted vaccine formulation), reduces Infections, New Word Nonhuman Primates, Respitores the1gE∆ virus is safe, shedding immunogenic and the clinicalfor calves signs (both after in challenge a live or and induces a serological response differentiable from that induced by wildtype virus. Thus, the recombinant Viruses.VV241 Financial - SAFETY Support: AND CNPq/IEC/MS/SVS. IMMUNOGENICITY OF A GLYCOPROTEIN E GENE-DELETED BOVINE strain. Financial Support: CNPq. HERPESVIRUS 1 CANDIDATE VACCINE STRAIN BoHV-1gEΔ may represent a suitable candidate vaccine Martins, M.; Weiss, M.; Anziliero, D.; Weiblen, R.; VV245 - SEROLOGICAL COMPARATIVE PROFILE Flores, E.F. FROM VACCINATED AND UNVACCINATED PIGLETS IN A PCV2 INFECTED PIG HERD 1. UNIVERSIDADE FEDERAL DE SANTA MARIA 2. UNIVERSIDADE DO OESTE DE SANTA Fritzen, J.T.T.; Feronato, C.; Saporiti, V.; Pereira Junior, CATARINA M.; Oliveira, M.V.; Favero, L.M.; Silva, C.A.; Alfieri, A.F.; 3. FACULDADE MERIDIONAL Alfieri, A.A. The present article describes an investigation on the UNIVERSIDADE ESTADUAL DE LONDRINA safety and immunogenicity of a glycoprotein E (gE)- Porcine circovirus type-2 (PCV2)-induced disease is an important health challenge in swine industry. Around the world PCV2 associated diseases are commonly deleted bovine herpesvirus 1 (BoHV-1gE∆) candidate old seronegative calves inoculated intramuscularly controlled by vaccination. The aim of this study was to (IM)vaccine with strain. approximately In the safety 10-100 test, fivetimes three the months- usual 8.5 vaccine dose (10 TCID50 and unvaccinated (UnVac) piglets in a PCV2 infected pig healthy, did not shed virus in nasal secretions during herdevaluate situated the serologicalin São Paulo profile state. fromThe farm vaccinated was a 1-site (Vac) ) of live BoHV-1gEΔ remained October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
236 Veterinary Virology: VV herd with 2,000 sows with good health management. VV249 - HIGH FREQUENCY OF EQUINE GAMMAHERPESVIRUS INFECTION IN ASYMPTOMATIC in July, 2013 were vaccinated at 21 days of age against EQUINE IN BRAZIL Three quarters (823/1097) of piglets that were born PCV2. The remaining 274 piglets composed an UnVac Dall Agnol, A.M.; Beuttemmüller, E.A.; Pilz, D.; group. Blood samples collections were performed in 260 Oliveira, M.V.; Headley, S.A.; Alfieri, A.F.; Alfieri, A.A. of Vac and in 90 of UnVac group piglets, at days 1 (before colostrum intake), 7, 21, 42, and 65, corresponding to UNIVERSIDADE ESTADUAL DE LONDRINA
30 pigs from Vac and UnVac groups, respectively, were in horses worldwide. The infection usually occurs during bloodpiglet agesampled in days. at During90, 115, grower-to-finish and 145 days. All stage, the 90serum and theEquine early gammaherpesvirus stages of life, followed 2 and by 5 (EHV-2/5)periodic reactivation are spread samples were tested by ELISA (Biochek, Inc.) for PCV2 of the latent infection over the horse’s lifetime. Despite antibody detection. Additionally, blood samples from 115 equine gammaherpesvirus can be detected in clinically and 145-day-old pigs were tested by qPCR for PCV2 viral healthy horses, EHV-2 might be involved with occurrence load. At day 1 did not have PCV2 antibodies detected. of immunesuppression and has been associated with No differences were detected for PCV2 antibody titers respiratory disease outbreaks. Similarly, EHV-5 also in day 7, likely due to colostrum intake. After 3 weeks presents tropism towards the respiratory tract and old the antibody titers were higher in Vac group than in was related to the occurrence of equine multinodular the UnVac group. At 145 days, antibody titers of UnVac the presence of EHV-2 and -5 in horses from Brazil. For to the Vac group. In order to evaluate a possible PCV2 thispulmonary purpose, fibrosis. 26 nasal The swabs aim were of this collected study from was horses detect challengeanimals significantlyin the pig herd increased as cause and of the became increasing similar in without clinical signs of respiratory distress from two PCV2 antibodies in pigs of this age group, blood samples breed farms, and sent for diagnosis. The nucleic acid of 115 and 145 days were tested for PCV2 viral load. Animals at 115 days of age were negative for PCV2 DNA in qPCR assay, and at 145 days they had higher viral load purification from the samples was performed by using (p<0.001) in UnVac group than in Vac group. The high moleculara combination diagnostic of phenol/chloroform/isoamyl for the presence of equine gamma alcohol viral load detection in the 145-day-old pigs was causing (EHV-2,and silica/guanidinium -5), and alpha (EHV-1, isothiocyanate -4) herpesviruses methods. was The for decreasing of PCV2 antibodies at 115 days allowing performed using nested PCR assays targeting the EHV later occurrence of PCV2 infection. PCV2 was circulating gB gene. From one breed farm 18 nasal swabs were within the herd since the beginning of the grower-to- tested, where 5 resulted positive for EHV-2 and 10 for EHV-5, with one sample showing a mix infection for both of the animals in the same environment after nursery viruses. From the second farm, 8 samples were collected, finish stage. This information is based on maintenance where 7 had positive results for EHV-2, 6 for EHV- 5, the detection of elevated antibody titers and the virus and 6 resulted positive for both viruses. From the total presenceuntil slaughter. in blood All samples these findingsof animals are at supported 145 days byof of 26 tested nasal swabs, 46.1% (12) were positive for age. In conclusion, PCV2 vaccination of a partial pig herd EHV-2, 61.5% (16) were positive for EHV-5, and 26.9% was able to protect non-vaccinated animals against the (7) presented mix infections. All samples were negative virus infection up to 115 days of age and this vaccination protocol should be considered. Keywords: immunology, gammaherpesviruses in horses from Brazil. These results PCV2, pigs, vaccination. Financial Support: FINEP, CAPES, suggestedfor EHV-1 andthat -4. these This viruses was the are first probably detection endemic of equine in Brazil, similarly as previous reports from Europe, USA and Australia. Keywords: Equines, Gammaherpesvirus, CNPq, and Fundação Araucária/PR. Equine herpesvirus -2, Equine herpesvirus -5, Brazil. Financial Support: FINEP, CAPES, CNPq, and Fundação
Araucária/PR.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
237 Veterinary Virology: VV
VV253 - MAGUARI VIRUS WIDESPREAD IN EQUINES of the present study was to assess the exposure of OF PANTANAL, BRAZIL bunyaviruses in sheep sampled in 2009 and 2010 in Pauvolid-Corrêa, A.; Juliano, R.; Nogueira, R.; Komar, Pantanal, state of Mato Grosso do Sul. A total of 236 N. sheep serum samples collected from nine ranches were tested by plaque reduction neutralization test (PRNT) 1. CENTERS FOR DISEASE CONTROL AND for six Brazilian bunyaviruses, including Oropouche, PREVENTION Marituba, Murutucu, Apeu, Itaqui and Maguari (MAGV) 2. EMPRESA BRASILEIRA DE PESQUISA viruses. Neutralizing antibodies were detected for all AGROPECUÁRIA PANTANAL bunyaviruses, except for Itaqui virus. From 236 sheep 3. FUNDAÇÃO OSWALDO CRUZ tested, 80 (33.9%) had homotypic reactions for MAGV, The Pantanal, located in West-Central Brazil, is a reported in the Pantanal in the 1990´s in horses, and itsrepresenting serological all evidence nine ranches in sheep sampled. from allMAGV nine was ranches first floodplain in South America characterized by high including arboviruses. In recent years, serologic sampled suggests that sheep have been exposed to biodiversity among its flora, fauna and microorganisms, MAGV in the Pantanal. Financial Support: CIÊNCIA SEM FRONTEIRAS, CDC, CNPq. evidence of at least five disease-causing arboviruses, samplesincluding collected flaviviruses from and 372 alphaviruses, equines among was detected 15 ranches for VV270 - GENOTYPING BRAZILIAN CANINE ofthe the first Pantanal time in in the 2009 region. and 2010In the were present tested work, by plaqueserum DISTEMPER VIRUS STRAINS ISOLATED FROM reduction neutralization test (PRNT) for antibodies DOMESTIC DOGS BASED ON THE FSP REGION AND against six Brazilian bunyaviruses, including Oropouche, THE HEMAGGLUTININ GENE Marituba, Murutucu, Apeu, Itaqui and Maguari (MAGV) Silva, D.J.F.; Carvalho, C.P.T.; Barreto, E.S.; Tozzato, viruses. Neutralizing antibodies were detected for all C.; Malossi, C.; Drummond, B.P.; Araujo Jr., J.P.A.; bunyaviruses, except for Itaqui virus. From 372 equines Bronzoni, R.V.M. tested, 299 (80.4%) had homotypic reactions for MAGV, 1. UNIVERSIDADE FEDERAL DE MATO GROSSO 2. UNIVERSIDADE ESTADUAL PAULISTA reported in equines from Pantanal in the 1990´s and its 3. UNIVERSIDADE FEDERAL DE JUIZ DE FORA highrepresenting prevalence all in ranchesequines of sampled. 15 ranches MAGV reported was here first suggests MAGV has been continuously transmitted and The canine distemper virus (CDV, Paramyxoviridae, is widespread in the region. Financial Support: CIÊNCIA Morbillivirus) is a multi-host pathogen causative of SEM FRONTEIRAS, CDC, CNPq. canine distemper, a serious systemic disease with high incidence in unvaccinated puppies. Although there are VV254 - EVIDENCE OF MAGUARI VIRUS IN SHEEP available vaccines, the control of canine distemper virus FROM PANTANAL, BRAZIL has been shown to be complex since sporadic outbreaks Pauvolid-Corrêa, A.; Juliano, R.; Nogueira, R.; Komar, occur even in vaccinated dogs. In recent years, it has N. been observed an expansion of the disposed host range, which can be related to the changes in cytopathogenicity 1. CENTERS FOR DISEASE CONTROL AND PREVENTION associated with antigenic variability, which occurs on 2. EMPRESA BRASILEIRA DE PESQUISA and tropism of the field strains. Such changes have been AGROPECUÁRIA PANTANAL virus envelope glycoproteins. Sequence analysis of 3. FUNDAÇÃO OSWALDO CRUZ hemagglutinin (H) gene as well as the signal peptide region of fusion protein (Fsp) gene has been extensively The exposure of sheep to arboviruses in Brazil is poorly understood. However, a recent study conducted in genotypes. In South America it has been demonstrated the Pantanal, located in the West-Central region of the theemployed circulation to the of classification four genotypes. of CDV Based strains on in the eleven analysis CDV country, detected neutralizing antibodies for three of both the Fsp region (405 bp), and a partial region of H alphaviruses in these animals. The main objective gene (734 bp), we assessed the phylogenetic relation of
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
238 Veterinary Virology: VV
12 Brazilian CDV strains circulating in domestic dogs in data were de novo assembled on BaseSpace Cloud Sinop (Mato Grosso State), Sorocaba (São Paulo State), by the SPAdes Genome Assembler (version 3.0) and Bandeirantes (Paraná State) and Vitória (Espírito Santo analyzed by Geneious software (version 7.1.7). The State). For this analysis, we used MEGA 6 software to build phylogenetic trees for the complete Fsp region and of 8 single-stranded RNA segments: polymerase basic 2 partial region from H gene sequences of representative (PB2),viral genome polymerase of the basic H1N2 1 (PB1),influenza acid A polymerasesample, consists (PA), strain plus those detected in this study. Phylogenetic hemagglutinin (HA), nucleoprotein (NP), neuraminidase analysis of Fsp region showed that these CDV strains (NA), matrix (M), and nonstructural protein (NS). are related to those within the intercontinental lineage Phylogenetic analyses reveal that the HA and NA genes phylogenetic trees constructed on Fsp region and partial cluster and N2), whereas the internal genes (PB1, PB2, Hof gene, Europe-1/South-America-1. the analysed strains are Considering distantly associated both of the to PA,clustered NP, M withand NSinfluenza) clustered viruses with of the human A (H1N1) lineage pdm09. (H1-δ These results highlight the importance of continued with previous studies carried out in South America and supportAmerica-1/Vaccine the conclusion lineage. that the Our Fsp results region are is consistenta suitable recombine with viruses from different hosts, including region to study the evolution of this pathogen. Keywords: pigs;surveillance such events of influenza may give A viruses, rise to since reassortants the virus with can South America, Phylogenetic Analysis, Paramyxoviridae.
VV271 - GENOME SEQUENCE OF A HUMAN-LIKE CAPES,significant FINEP. pathogenic potential. Keywords: Swine H1N2 INFLUENZA A VIRUS IN BRAZILIAN PIGS influenza, reassortant, H1N2. Financial Support: CNPq, Tochetto, C.; Schmidt, C.; Paim, W.P.; Cibulski, S.P.; VV284 - VIABILITY OF Vaccinia virus IN ARTISAN Varela, A.P.M.; Scheffer, C.M.; Teixeira, T.F.; Santos, CHEESES OF THE FARMS WITH AND WITHOUT H.F.; Almeida, L.L.; Franco, A.C.; Roehe, P.M. OUTBREAKS OF BOVINE VACCINIA IN SOME REGIONS OF MINAS GERAIS STATE 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL Rehfeld, I.S.; Matos, A.C.D.; Guedes, M.I.M.C.; Sales, 2. INSTITUTO DE PESQUISAS VETERINÁRIAS G.A.; De Castro, R.D.; Costa, A.G.; Fraiha, A.L.S.; De DESIDÉRIO FINAMOR Souza, M.R.; Lobato, Z.I.P. UNIVERSIDADE FEDERAL DE MINAS GERAIS pathogens with high impact on public and animal health. The artisan cheeses are produced with raw milk and Influenza A viruses are important human and animal their production is a tradicional activity in Brazil, H3N2 subtypes remain endemic in swine populations mainly in Minas Gerais (MG) State. In 2006, production Swine influenza A viruses (swIAVs) of H1N1, H1N2, and worldwide. In case of a mixed infection by two viral of artisan cheeses became an immaterial heritage of strains within a cell, the exchange of gene segments the country. However, the use of raw milk to produce may lead to the generation of a new reassortant virus. these cheeses poses a potential risk of contamination Although swIAV infections have already been detected with infectious agents present on milk. Previous studies in swine in Brazil, in most cases these viruses have not showed that Vaccinia virus (VACV), the agent of bovine had their full genomes sequenced. Here, the complete vaccinia (BV), is eliminated on milk of affected cows genome sequences of a swIAV isolate was performed. and the virus could be detected on milk for at least 25 The viruses were recovered from lung tissues of piglets days after lesions healing. Other study showed that in an outbreak of respiratory disease occurred in a farm VACV viable particles could be detected in cheeses made in the state of Rio Grande do Sul, Brazil. Viral RNA was with milk experimentally contaminated until 60 days of extracted from lung tissues using TRIzol reagent. Whole- maturation. As BV is a neglected zoonotic disease with genome sequences were generated by RT-PCR using the PathAmpTM the objective of this study was to detect VACV in samples ofsignificant artisan impactcheeses on commercialized dairy livestock inand MG, public originated health, FluA Reagents. Amplicons were purified by sequencing in the MiSeq sequencing platform. The from properties with and without cases of BV. Twenty with Agencourt AMPure XP – PCR Purification, followed October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
239 Veterinary Virology: VV properties located in three artisan cheeses producing were inoculated onto CRFK cell monolayers grown in 25 regions of MG were visited. Fifty-nine cheeses were cm2 cell culture bottle and submitted to three passages collected and analyzed, where, 10 were originated from properties with and 49 from properties without BV outbreaks. From each cheese, samples from different CPEof five and days were each submitted while theto genome cells were extraction, monitored reverse for areas were taken, and then were grated, mixed and transcriptioncytophatic effect with (CPE). random A total primer of 9/19 (Invitrogen cultures showed®) and macerated in saline solution (1g of cheese per 9 mL of PBS). The viral DNA in cheese samples was detected by was a 924 bp fragment of the ORF2 region, that encodes PCR assay using the Orthopoxvirus (OPXV) growth factor thePCR. RNA The targetpolymerase sequence RNA for dependent FCV RT-PCR (RdRp). amplification These gene (vgf) as the target. PCR-positive samples were products were subjected to a second reaction (Nested- inoculated in VERO cells and chorioallantoic membrane of embryonated eggs for virus isolation, which was cultures. All these PCR amplicons were sequenced and nucleotidePCR) and a(nt) 467 similarity bp amplicon with sequences was obtained deposited in 8/19 in (IPMA) and quantitative PCR, respectively. Viral DNA was the GenBank database was assessed using the BLAST detectedconfirmed in 43 by of immunoperoxidase the 59 samples. Of these, in monolayer 11, at different assay maturation times, had infectious viral particles, been characterization of FCV in specimens from cats in Rio four originated from properties without BV outbreaks detool. Janeiro. This is These the first results report reinforce of isolation the need and formolecular further studies relating to the molecular characterization of contaminated with VACV viable viral particles. Further these viruses and the monitoring of FCV in cats with studieshistory. Theare necessaryfindings show to determine that artisan the cheeses possible could public be clinical signs of conjunctivitis. Financial Support: FAPERJ, health risks associated with the consumption of these PROPPI - UFF, CNPq. cheeses. Keywords: Vaccinia virus, artisan cheeses, bovine vaccinia, viable viral particles. Financial Support: VV293 - ENCEPHALITIS CAUSED BY VIRUS COCAL CNPq, FAPEMIG, CAPES. INDUCES PROINFLAMMATORY RESPONSE IN ADULTS MICE BALB/C VV285 - ISOLATION AND MOLECULAR Freitas, P.S.L.; Ferreira, N.C.; Rodrigues, A.P.D.; Diniz CHARACTERIZATION OF FELINE CALICIVIRUS (FCV) Junior, J.A.P. FROM KITTENS WITH CONJUNCTIVITIS IN RIO DE INSTITUTO EVANDRO CHAGAS JANEIRO Costa, E.M.; Pereira, J.J.; Marinho, R.S.S.; Pinto, A.M.V.; The viruses are the major causative agents of infections Castro, T.X. of the nervous system. The immune response to viral infections involves an initial phase with production of UNIVERSIDADE FEDERAL FLUMINENSE Feline calicivirus (FCV) belongs to the Vesivirus genus and natural killer cells and macrophages. Late phase started the Caliciviridae family. Clinical disease caused by FCV is theinflammatory activation ofmediators cellular immune by resident response, cells and with activity CD4 and of typically characterized by oral ulcerations, conjunctivitis CD8 lymphocytes recruiting. The Cocal rhabdovirus is the and mild respiratory signs. In this study, conjunctival one responsible for vesicular stomatitis in livestock. In swabs were collected from 19 unvaccinated kittens (up newborn mice causes acute infection followed by death to one year) with clinical signs of conjunctivitis from 3 one day post-inoculation, however, little is known about different shelters in Rio de Janeiro city between April the encephalitis caused by this virus in adult animals. 2013 to May 2014. Swabs were kept in microtubes with Therefore, the aim of this study was to investigate the MEM medium (0.5 ml) and stored at – 20°C until use in immune response during Cocal virus infection in albino experiments. The feline kidney cell line CRFK (Crandell- mice adult after intranasal inoculation. It was evaluating Rees feline kidney) was used for virus isolation. Cells were kept in Eagle’s minimal essential medium (MEM) resident cells from Central Nervous system, and how viral containing penicillin, streptomycin, amphotericin B, antigenthe cytokines spreading profile occurs and in nitric the cerebral oxide production parenchyma. of and 10% fetal calf serum. The supernatants (0.15 ml) Thus, immunohistochemistry were performed for
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
240 Veterinary Virology: VV detection of viral antigens and enzyme immunoassay (PAGE) to determine the electropherotypes rotavirus, test for cytokines and nitric oxide production. The followed by polymerase chain reaction preceded by results showed 7 days after inoculation, about 90% of the animals die. The spread of viral antigen occurred genes VP4, VP6 and VP7. Results: Four hundred eighty- along the infection, peaking on the sixth day, coinciding eightreverse fecal transcription pool samples (RT-PCR)were tested, for of amplificationthese, about 3% of
immunochromatography, all samples were negative for with the production of pro-inflammatory cytokines RVA.(13/488) The werepositive positive specimens for RVA by by ELISA ELISA. were Regarding subjected the IFN-γ, TNF-α and MCP-1. There was no significant to RT-PCR for VP4 and VP7 Cocalproduction virus ofinfection anti-inflammatory in adult mice cytokines disseminated (IL-4, inIL-10 the for both. Because of this negativity, samples were tested centraland TGF-β), nervous and nitricsystem oxide. in a Therefore,short period we suggestof time thatand for VP6 genes, with no amplification
samples gene, showed obtaining electrophoretic positivity forpattern 46% suggestive(6/13) of the of nothe increase immune in response production profile of generatednitric oxide. in theKeywords: host is RVA.specimens. Conclusion: Concerning The result the PAGE,indicates 38% a (5/13)circulation of the of Viralpredominantly infection, Cocal pro-inflammatory, virus, immune although response. there Financial was rotavirus of group A among captive non human primates Support: Cordenação de Aperfeiçoamento de Pessoal de in CENP, Pará, Brazil. Due to the lack of data about thefrom prevalence CENP, representing of rotavirus the firstamong report these of RVAanimals, infection the Nível superior (CAPES), Instituto Evandro Chagas (IEC/ development of studies to monitor the circulation of SVS/MS).VV296 - DETECTION OF ROTAVIRUS IN NEOTROPICAL such viruses is required as well as characterization and PRIMATES FROM CENTRO NACIONAL DE PRIMATAS, determination of species and most common genotypes PARÁ, BRAZIL circulating in this population, in order to prevent Silva, J.R.; Lobo, P.S.; Muniz, J.A.P.C.; Marinho, A.N.R.; episodes of acute diarrhea in these captive animals Mascarenhas, J.D.P. from CENP. Keywords: Rotavirus, non human primates, 1. INSTITUTO EVANDRO CHAGAS ELISA, RT-PCR. Financial Support: Conselho Nacional 2. CENTRO NACIONAL DE PRIMATAS Coordenação de Aperfeiçoamento de Pessoal de Nível Acute diarrhea is one of the most causes of morbidity Superiorde Desenvolvimento (CAPES), Instituto Científico Evandro e Tecnológico Chagas (IEC). (CNPq), and mortality among human and animals, including non human primates (NHP). However, little is known about VV298 - IDENTIFICATION AND CLASSIFICATION OF the prevalence of viral agents, such as rotavirus (RV), ROTAVIRUS IN BUFFALOES OF ILHA DO MARAJÓ AND causing acute gastroenteritis in NHP, demonstrating the MARABÁ, PARÁ, BRAZIL importance of this research in order to have a better Fecury, P.C.M.S.; Barros, B.C.V.; Cherpinski, H.F.M.; understanding about the circulation of RV in captive NHP, Rocha, D.C.C.; Kanai, Y.K.; Mascarenhas, J.D.A.P.; obtained from Centro Nacional de Primatas (CENP), Pará, Marinho, A.N.R. Brazil. Objective: Study rotavirus frequence in captive non human primates with or without diarrhea obtained 1. INSTITUTO EVANDRO CHAGAS from CENP. Material and Methods: Fecal pool samples 2. FACULDADE METROPOLITANA DA AMAZÔNIA were collected from NHP species of Callithrix genre born in capitivity at CENP, twice a month, in a period of August Rotaviruses (RV) are one of the main causes of 2014 to December 2014. The screening of fecal specimens gastroenteritis in humans and animals worldwide. was performed by immunochromatography and enzyme eight groups or species designates of A to H. Infections group A (RVA). The fecal suspensions were prepared in causedRepresent by aRV wide of therange A ofgroup hosts are and widely are classified distributed, into bufferimmunoassay Tris-Ca++ (ELISA), 0,01M bothpH 7,2, specific then the to extraction rotavirus of mainly in children and young animals. These virus viral nucleic acid was performed. The positive samples belongs to the Reoviridae family, genus Rotavirus; and were subjected to polyacrylamide gel electrophoresis has a segmented nature with a genome that contains 11
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
241 Veterinary Virology: VV segments of double-stranded RNA (dsRNA). Objective circulation of H1N1pdm and reassortant H1N2 and H3N2 (s): Standardize a methodology of quantitative Real viruses containing HA and NA genes of human-origin Time PCR (qPCR) to assessing the presence or absence of rotavirus A-H in fecal samples collected from different derived from H1N1pdm. Passive monitoring of FLUAV in breeding herds of buffaloes diarrheal occurred of Marajó pigsseasonal continued influenza from virus 2013 and to the 2015 internal and resultedgene segments in the Island and Marabá district, Pará state, Brazil. Material isolation of thirty-six viruses from nasal swab and lung and Methods: Stool samples were obtained from samples tissue samples collected from clinically affected pigs from Virology Section, at Evandro Chagas Institute collected farms in the southern region of Brazil. Sequencing of HA from different breeding from State of Pará. Stool samples and NA gene segments were performed by ABI 3130xl and the phylogenetic relationships of each analyzed nucleic acid extraction and after were subjected to gene were inferred with the Neighbor Joining method in qPCR,were suspendedto detect the in bufferrotavirus Tris/Calcium, groups. Results: followed Forty by MEGA 6.0. The sequence analysis revealed seven H1N2, seven positive samples (51.64%) were detected belongs to the groups A, B and C of RV. Of these, were observed additionalfour H1N1pdm eleven and N1 five and H3N2 seven FLUAVs. N2 sequences. Eighteen virusesOn the H1had phylogeny, only the NA the gene seven segment H1N2 viruses identified, isolated resulting in pigs in ofamplifications B group. Furthermore, in 48.35% were (44/91) observed to RV concomitant of A group; in 2013 and 2014 were grouped with other Brazilian 2.19% (2/91) to RV of C group; and 1.09% (1/91) to RV H1N2 virus detected previously. The Brazilian H1N2 suggesting the existence of mixed infection. Conclusion: viruses were separated into two subclades supported Theamplifications recent literature for the shows groups the A existence and B in of1.09% RV of (1/91),several groups (A, B and C) in domestic mammals, bovines and H3N2 viruses isolated in 2014 and 2015 were grouped buffaloes. The present study corroborates with the data withby a other 100% four bootstrap. Brazilian On H3N2 the viruses H3 phylogeny, detected the in pigs five existent on literature and show a necessity of a further in 2011 with a 99% bootstrap support. The analysis research of the diarrheal cases occurred different of the NA gene segment of H1N2 and H3N2 viruses breeding to determine the frequency and distribution of revealed the formation of two subclades, one clade with RV of several groups between the existent herds’ on the a 97% bootstrap support comprising two H1N2 viruses region. Financial Support: Fundação Amazônia Paraense detected in pigs and in wild boars in 2011 and a second de Amparo à Pesquisa (FAPESPA); Instituto Evandro clade with 81% bootstrap support comprising H1N2 Chagas (IEC); Coordenação de Aperfeiçoamento de and H3N2 viruses detected in pigs from 2011 to 2015. Pessoal de Nível Superior (CAPES). Within the second N2 clade, the H1N2 viruses clustered separately from the H3N2 viruses (99% and 100% VV301 - CONTINUOUS CIRCULATION OF HUMAN- bootstrap support, respectively). The H1N2 and H3N2 ORIGIN SEASONAL INFLUENZA A VIRUSES IN SWINE FLUAVs detected in pigs in Brazil are distinct from other IN BRAZIL human-origin H1N2 and H3N2 viruses detected in swine Schaefer, R.; Gava, D.; Haach, V.; Cantão, M.E.; Ciacci- Zanella, J.R. in other countries. These findings show the very dynamic 1. EMPRESA BRASILEIRA DE PESQUISA the importance of human-to-swine transmission in the epidemiology of influenza virus in pigs and highlight AGROPECUÁRIA 2. UNIVERSIDADE DO OESTE DE SANTA Financial Support: EMBRAPA (02.11.01.006.00). CATARINA generation of influenza virus diversity in swine in Brazil. In the last years, following the introduction of pandemic in 2009, genetically diverse FLUAVs of subtypes H1N1, H1N2H1N1 (H1N1pdm)and H3N2 influenzahave been A virusdetected (FLUAV) in swine in swine in Brazil. The eight gene sequence analysis of 16 FLUAVs isolated from pigs between 2009 and 2012 revealed the
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
242 Veterinary Virology: VV
VV303 - DIARRHEA OUTBREAK BY BOVINE VV308 - BLUETONGUE VIRUS OUTBREAK IN RIO CORONAVIRUS INFECTION IN A DAIRY CALF REARING GRANDE DO SUL: FIRST REPORT OF BTV CO- UNIT INFECTION ASSOCIATED WITH CLINICAL SIGNS IN Balbo, L.C.; Ribeiro, J.; Lorenzetti, E.; Pannuzio, C.A.; SHEEP IN BRAZIL Freitas, L.A.; Massi, R.P.; Pereira, F.L.; Alfieri, A.A.; Guedes, M.I.M.C.; Rosa, J.C.C.; Guimarães, L.L.B.; Alfieri, A.F. Matos, A.C.D.; Costa, E.A.; Leal, C.A.G.; Figueiredo, H.C.P.; Nomikou, K.; Mertens, P.P.C.; Driemeier, D.; UNIVERSIDADE ESTADUAL DE LONDRINA Lobato, Z.I.P. Neonatal diarrhea is a main health problem in dairy calves worldwide. Management practices such as 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS rearing units where calves from different herds and 2. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL origins are managed together can increase the risk of 3. THE PIRBRIGHT INSTITUTE neonatal diarrhea. The aim of this study was to report the occurrence of a diarrhea outbreak in a dairy calf Bluetongue (BT) is a vector borne viral disease of rearing unit located in western of the Paraná state, in domestic and wild ruminants caused by Bluetongue southern Brazil. The diarrhea outbreak unresponsive to virus (BTV), an Orbivirus from the Reoviridae family. BTV broad-spectrum antibiotic therapy involved calves with is transmitted by Culicoides biting midges. BT is an OIE 5 to 90 days old in a period of 25 to 30 days. The calves were from 40 small dairy herds (family agriculture). to its economic losses in livestock industries, as well as notifiable disease with current global importance due None of herds had immunoprophylactic program for restrictions on animal trade and products from infected neonatal diarrhea control as cow vaccination at the end of gestation. Thirty-three diarrheic fecal samples were been known since 1978 and there are many serological or endemic regions/countries. BTV infection in Brazil has collected and submitted to diagnostic. The presence of surveys showing that BTV is widespread in the country RNA of group A, B, and C rotavirus, bovine coronavirus with different seroprevalence levels, but there is only (BCoV), and bovine viral diarrhea virus was evaluated limited understanding of the direct impact on economy. by molecular techniques (RT-PCR or SN-PCR). For the Cryptosporidium sp and Eimeria sp in the country (24.6%), with low BTV seroprevalence levels,Rio Grande with do less Sul (RS)than state 1% hasof theseropositive largest sheep animals. flock identification of the Ofoocysts all the was enteropathogens performed the Ziehl-Nelseen evaluated in modified the present and of BT outbreaks. Until now, only two outbreaks have Therefore, this region is considered at significant risk studyGordon positive and Whitlock results modifiedwas only techniques,obtained for respectively. BCoV. The been reported in sheep on RS, and in both cases, BTV of 33 diarrheic fecal samples evaluated with positive sheep farms located at Cachoeira do Sul and Teutonia serotype 12 was identified. In April 2014, outbreaks in rateBCoV of single 28.6, 66.7,infection and 58.8%was identified for diarrheic in 18 fecal (54.5%) samples out counties, RS state, were reported. The major clinical collected from calves with up 30, 60, and 90 days old, signs observed were dyspnea with nasal discharge and respectively. The BCoV occurrence in diarrheic fecal laminitis with high mortality rate. The main macroscopic samples both in single and mainly in mixed infections lesions observed at necropsy were increased lung size is frequently detected in diarrheic calves but in lower with edema, anterior-ventral pulmonary consolidation, rates than reported in this outbreak. The high rates of muscular necrosis in esophagus and in the ventral BCoV single infection notably in calves with 60 and 90 portion of the serratus muscle, and necrohemorrhagic days old characterize the importance of this virus in the lesions in the heart. RNA extracted from blood, kidney, enteric infections and in episodes of diarrhea in suckling lung, liver, heart, spleen, lymph nodes samples was calves. Keywords: dairy calves, enteric infection, enteric tested by real time RT-PCR targeting the segment 10 of viruses, BCoV. Financial Support: FINEP, CNPq, CAPES, BTV’s genome. The PCR positive tissue samples were used to infect insect cells monolayers for virus isolation. For BTV typing, RNA extracted from insect cells was used and Fundação Araucária/PR. October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV as a template in a RT-PCR assay using specific primers XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
243 Veterinary Virology: VV targeting the VP2 protein coded by segment 2 of 26 BTV evidence that PiCV is circulating in southern Brazil serotypes, followed by sequencing analysis. Vero cells pigeons population, which is unprecedented at our monolayers were infected to verify the cytopathic effect. knowledge. Future investigations in other areas and in a Triple BTV co-infection with serotypes 1, 4 and 17 was higher number of samples must be performed to better understand the virus epidemiology and sequencing of sheep. Furthermore, BTV- 4 and 17 were detected in samplesidentified from in two Cachoeira positive do tissue Sul. Currently, samples the from full Teutonia genome genetic characteristics. Financial Support: CAPES, FINEP. analyses of the serotypes are in progress in order to better entire genome of identified virus must elucidate their understand the segments reassortment events among VV311 - DIAGNOSIS OF EQUINE INFECTIOUS ANEMIA the serotypes and the epidemiology of the disease. This IN HORSES FROM THE MARAJÓ ISLAND THROUGH AGID AND PGP45 ELISA TEST clinical signs in sheep in Brazil. Keywords: Bluetongue Oliviera, F.G.; Freitas, N.F.Q.R.; Barbosa, J.D.; Reis, virus,is the co-infections, first report of outbreak, BTV co-infection ovine, serotypes. associated Financial with J.K.P.; Leite, R.C.; Perdigão, H.H.; Bomjardin, H.A.; Support: CAPES, CNPq, FAPEMIG. Oliveira, F.G.; Naves, J.H.F.F.; Salvarani, F.M.; Oliveira, C.M.C. VV310 - PIGEON CIRCOVIRUS (PICV) IN FREE-LIVING 1. ESCOLA DE VETERINÁRIA UFMG PIGEONS (Columbia livia) FROM SOUTHERN BRAZIL 2. FACULDADE DE MEDICINA VETERINÁRIA - Loiko, M.R.; Varela, A.P.M.; Morel, A.P.; Santos, H.F.; UFPA Tochetto, C.; Lima, D.A.; Cibulski, S.P.; Mayer, F.Q.; The equine infectious anemia (EIA) is a disease caused Roehe, P.M. by the equine infectious anemia virus (EIAV), which has 1. UNIVERSIDADE FEDERAL DO RIO GRANDE a worldwide distribution and infects equine persistently. DO SUL 2. HAYABUSA - FALCOARIA E CONSULTORIA of EIA is the agar gel immunodiffusion (AGID), which AMBIENTAL usesThe official as an testantigen for the the diagnosis, p26 protein prevention of the viral and controlcapsid. Pigeon circovirus (PiCV), also known as columbid Antibodies to gp45, the viral transmembrane protein, circovirus (CoCV), belongs to Circoviridae family, genus responsible for the interaction of the virus with the Circovirus. The PiCV is an immunosuppressive agent host cell, are detected earlier in the circulation, when reported in several countries, which causes a young compared to antibodies against p26. The objective of pigeon disease syndrome in pigeons. In the present study, this study was to estimate the occurrence of the EIA in a research was conducted to examine the occurrence horses from properties located in the municipalities of of PiCV infections in free-living pigeons from southern Cachoeira do Arari, Salvaterra, Santa Cruz do Arari and Brazil. Thus, serum samples were collected from 60 Soure, in the Marajó Island, state of Pará, using agar gel apparently healthy pigeons (Columbia livia) from immunodiffusion and ELISA (using as antigen a pgp45 different Brazilian municipalities: 40 from Cachoeirinha, peptide named pgp45 ELISA) tests. Samples of blood Rio Grande do Sul (RS), 10 from metropolitan region of sera from 294 horses of the breeds puruca, marajoara Porto Alegre, RS, and 10 from Cambará, Paraná (PR). Sera and their half-breeds, aged from six months on, from were pooled at 6 pools with 10 samples each, according to properties located in the Marajó Island were collected by the region, and submitted to nucleic acid extraction using jugular vacuum venipuncture, for serological evaluation PureLink® Genomic DNA Mini Kit (Life Technologies), in both AGID and pgp45 ELISA. The occurrence rates following manufacturer’s instructions. Genomes of PiCV of equine infectious anemia in the studied horses were were detected with a nested-PCR targeting the rep gene of circoviruses with previously described degenerate positiveof 46.26% by (136/294)rgp45 ELISA in theand AGIDnegative test by and AGID 48.98% test Viral DNA was detected in 2 out of the 6 pools (33 % - indicate(144/294) that in the pgp45 test ELISA.is more The sensitive, samples allowing that were the twoprimers. pools The of Cachoeirinha amplicons were - RS). purified The sequencing and sequenced. analysis in the control of the EIA in the Marajó Island. Keywords: diagnosis of truly positive animals, being more efficient confirmedOctober 2015 theVolume PiCV 20 – detection. Supplement These1 - Abstracts/Posters findings provide - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
244 Veterinary Virology: VV
EIA, agar gel immunodiffusion, pgp45 ELISA. Financial transmission. Financial Support: FAPERJ, CNPq, PROPPI- Support: CNPq, UFPA, FAPEMIG and INCT-pecuária. UFF and IOC.
VV313 - DETECTION AND MOLECULAR VV317 - IMMUNOGENICITY OF ORF VIRUS CHARACTERIZATION OF CALICIVIRUSES (VESIVIRUS RECOMBINANT EXPRESSING THE RABIES VIRUS AND NOROVIRUS) IN AN OUTBREAK OF ACUTE GLYCOPROTEIN IN CATTLE, HORSES AND SWINE DIARRHEA IN KITTENS FROM BRAZIL Martins, M.; Cargnelutti, J.F. ; Anziliero, D.; Frandoloso, Castro, T.X.; Garcia, R.C.N.C.; Fumian, T.M.; Costa, E.M.; R.; Joshi, L.R.; Diel, D.G.; Flores, E.G.; Weiblen, R. Bottino, F.O.; Leite, J.P.G. 1. UNIVERSIDADE FEDERAL DE SANTA MARIA 1. UNIVERSIDADE FEDERAL FLUMINENSE 2. FACULDADE MERIDIONAL 2. FUNDAÇÃO OSWALDO CRUZ 3. UNIVERSIDADE DE PASSO FUNDO 4. SOUTH DAKOTA STATE UNIVERSITY Feline caliciviruses (FCVs) have occasionally been described in cats in association with enteric disease, The parapoxvirus ORF virus (ORFV) presents several but an etiological role for these viruses in acute unique properties that make the virus an excellent gastroenteritis is still unclear. In this study, molecular candidate for vaccine delivery in livestock species. To characterization of FCV and feline norovirus (FNoV) was assess the suitability of ORFV as a multi-species vaccine undertaken using real-time PCR (RT-PCR) and sequence delivery vector, we constructed ORFV recombinants analysis of the ORF1 region in fecal specimens from 29 expressing the rabies virus (RABV) glycoprotein G diarrheic cats from an outbreak of gastroenteritis in (gG), and evaluated their immunogenicity in target Rio de Janeiro city. Initially, samples were screened by animal species. Expression of gG by recombinants RT-PCR with primers targeting a 300 nt fragment of the in RNA-dependent RNA polymerase (RdRp). Additionally, vitro and replication characteristics of the recombinant samples were screened for the presence of feline virusesORFV-RabVgG-1 were assessed and ORFV-RabVgG-2 in cell cultures derived was confirmed from target parvovirus (FPV), feline coronavirus (FeCoV), and group animal species. The immunogenicity of ORFV-RabVgG-1 A rotavirus (RV-A), either by PCR or RT-PCR. FCV RNA was and ORFV-RabVgG-2 recombinant viruses was assessed detected in 8 samples (27.6%) and all amplicons were in cattle horses and swine. Animals from each target submitted to sequence analysis. Seven FCV sequences species were divided in two groups and immunized shared 60.9%-80.2% nt identity with sequences from intramuscularly with two doses (21 days apart) of ORFV- 7.9 the Vesivirus RabVgG-1 or ORFV-RabVgG-2 containing 10 TCID50 91.3% nt identity with FeNoV. All samples were also dose. Serum was collected at days 0 (vaccination day), genus and one (RJ1018/10) displayed 21 (second dose) and 42 (21 days after revaccination)/ targeting a 550 nt fragment of the 3`end of the FNoV and tested for RABV neutralizing antibodies by rapid screened by one step RT-PCR with especific primers animals developed VN antibodies to RABV by day 21 samplesRdRp encoding were tested region. using Only the sample RNA RJ1018/10UltraSenseTM tested one- post-revaccination.fluorescent focus inhibition Heifers test immunized (RFFIT). All with immunized ORFV- steppositive. quantitative For NoV RT-PCR detection system and and quantification, primers and the probe 29 RabVgG-1developed titers of 80 to 1280 (GMT = 211) targeted a highly conserved 550 nt region of the open and heifers immunized with ORFV-RabVgG-2 developed reading frame (ORF1-ORF2). GIV RNA was detected titers of 320 to 2560 (GMT = 735). The three horses immunized with ORFV-RabVgG-1 developed titers of 20 to 5.98 x 105 genome copies per gram of stool sample. to 40 (GMT = 25), the other three immunized with ORFV- only in sample RJ1018/10 at a Ct of 31.8, corresponding RabVgG-2 developed titers of 80 to 160 (GMT = 100). in South America and the zoonotic potential of these virusesThis is is the highlighted first description by their ofsimilarity enteric to FCV human and FNoVGIV.1 were of 80 to 640 (GMT = 160), whereas pigs immunized NoVs. Further studies on domestic animals to identify withIn five ORFV-RabVgG-2 pigs immunized developed with ORFV-RabVgG-1 VN titers of the 640 titers to for the presence of FeNoV should be conducted in order 1280 (GMT = 905). We are currently investigating the to investigate the role of these viruses in interspecies impact of vaccination with the recombinants in cellular
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
245 Veterinary Virology: VV responses to RABV glycoprotein and the duration of the warts in Sergipe. PCR using primers FAP59 and FAP64 VN response. These results demonstrate the suitability has proven to be an effective method to diagnose these of ORFV as a vaccine delivery vector in cattle, horses and viruses in cutaneous tissues from dogs. CPV can cause swine. Financial Support: CNPq. single or multiple oral lesions in dogs, so it can affect the quality of life and well-being of the animal. This study VV320 - PRESENCE OF CANINE PAPILLOMAVIRUS has shown the presence of CPV in Sergipe state for the (CPV) IN ORAL WARTS FROM SERGIPE, NORTHEAST BRAZIL used as a basis for the development of better strategies Batista, M.V.A.; Reis, J.D.R.; Figueirêdo, R.P. infirst treating time, and the that disease. is import Financial because Support: the diagnosis CNPq, CAPEScan be UNIVERSIDADE FEDERAL DE SERGIPE Papillomaviruses are members of the family andVV333 FAPITEC/SE. - FECAL SHEDDING OF PORCINE Papilomaviridae. Their hosts are vertebrates like BOCAPARVOVIRUS FROM ASYMPTOMATIC PIGS AT mammals, reptiles and birds. These viruses are known DIFFERENT AGES to infect epithelial cells with tropism for skin and Alcântara, B.K.; Leme, R.A.; Possati, F.; Molinari, mucous membrane inducing benign neoplasms that may B.L.D.; Lorenzetti, E.; Crespo, S.E.I.; Pereira, F.L.; Bon, progress to cancer. Canine papillomavirus (CPV) have V.R.; Alfieri, A.A.; Alfieri, A.F. been associated to lesions including exophytic cutaneous and oral warts, endophytic warts and pigmented UNIVERSIDADE ESTADUAL DE LONDRINA plaques. Although there is only a few information about Members of Parvoviridae family are small, non- CPV worldwide, molecular analyses allowed to identify enveloped, and present linear single-stranded DNA these virus and to discover novel types. In Brazil, the genome. According to International Committee on Taxonomy of Viruses, the genus Bocaparvovirus contains papillomavirus was in 2014, which the authors have the species Carnivore, Pinniped, Primate and Ungulate foundfirst and CPV-1. single Because molecular different characterization types are associated of canine bocaparvovirus to different pathological properties, it is important to species of Ungulate bocaparvovirus, of which four characterize the isolates that are circulating in Brazil (Ungulate bocaparvovirus. Currently there2 to are5) group five segregated multiple so we could develop better diagnosis and treatment subspecies of porcine bocaviruses (PBoV). To date, there methods. Therefore, the aim of this study was assess the is no information regarding PBoV infection in Brazilian presence of CPV in dogs from Sergipe state, Northeastern pig herds. The aim of this study was to investigate Brazil. Samples were surgically removed from relapse PBoV presence in animals at different categories of pig production cycle in Brazil. A total of 117 fecal samples from young female mix breed dog. The samples was from asymptomatic suckling piglets (1 to 3 weeks-old, maintainedoral exophytic at -20oC warts until clinically used for classified molecular as papillomadiagnosis. n=17), weaned piglets (4 to 8 weeks-old, n DNA was extracted using the Wizard Genomic DNA pigs (9 to 24 weeks-old, n=21), and breeders (n=39) of =40), finisher using primers forward FAP59 and reverse FAP64, which were evaluated. PCR assay was performed using primers isPurification well known kit to (Promega) target conserved and PCR regions assay in was the doneL1 open by thatfive pigtargeted herds thelocated partial in ParanáNS1 region state, of Southern PBoV genome, Brazil, reading frame. PCR cycling conditions included 10 min of initial denaturation at 94ºC followed by 40 cycles of 117 (41%) fecal samples were positive for PBoV DNA. 1 min at 94°C, 1 min at 50°C and 1 min at 72ºC and a PBoVwith modification was more frequentlyon reverse detectedprimer. Forty-eight in weaned of pigs the were analyzed by electrophoresis in 1.5% agarose gel andfinal visualizedextension stepunder at 72ºCUV light. for 10 As min. a result, All PCR all productssamples (65%, 26/40), followed by animals at finisher category were tested positive for the presence of CPV. With this (52.4%, 11/21). For suckling piglets and breeders, PBoV analysis, it was possible to develop a molecular assay was detected in 17.6% (3/17) and 20.5% (8/39) of the Canine papillomavirus that induces oral samples, respectively. Phylogenetic analysis confirmed amplicon specificity. The present study represents inOctober order 2015 to findVolume 20 – Supplement 1 - Abstracts/Posters - Veterinarythe Virology: first VV survey conducted for PBoV detection among XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
246 Veterinary Virology: VV different production categories in pig herds of Brazil. The applied in order to develop better prevention treatment results indicated that PBoV infection has widespread in methods. In this context, the objective of this study was all pig-producing categories. Suckling piglets presented to assess the diversity of BPV types infecting cattle in lower percentage of PBoV detection than animals from the state of Sergipe. In order to do this, lesions were other categories. However, the presence of PBoV in collected from cattle in different regions of Sergipe young piglets revealed that these animals had early state. Histopathological analysis were carried out to contact with the virus, which raises questions regarding characterize BPV lesions. Next, DNA was extracted from the routes of PBoV transmission. PBoV infection was higher in recently weaned pigs, likely due to the decrease in the titres of maternal antibodies in addition the samples. A fragment of L1 gene was amplified using to the mixing of young piglets of different litters. After polymerase chain reaction with the primers FAP59/64. this period, infection with this virus became endemic in sequenced.The amplified Local product sequence was alignments analyzed were in agarose carried out gel withelectrophoresis. BLAST to identify All positive the BPV samples types. were We werepurified able and to All animals included in this study were asymptomatic detect BPV DNA in all samples tested, which shows that atolder the animals,moment as of seen fecal in collection the results and, from therefore, finisher PBoV pigs. BPV is widespread over the state of Sergipe. Sequencing infection was not associated with disease occurrence. analysis showed that different types of BPV were Further studies are necessary to investigate whether circulating in Sergipe, which shows that there is a great the virus presence is related to PBoV-induced diseases in Brazil. Financial Support: FINEP, CAPES, CNPq, and report of the occurrence of BPV in cutaneous lesions in Sergipegenetic diversitystate. The of knowledge BPV in this of region.the distribution This is the of BPVfirst types is essential to serve as the basis for diagnostic and FundaçãoVV334 - MOLECULAR Araucária/PR. DETECTION AND GENOTYPING treatment methods development. Although this study OF BOVINE PAPILLOMAVIRUS IN SERGIPE STATE, contributes to increase the understanding about the NORTHEASTERN BRAZIL diversity of these viruses in Brazil, further studies are Batista, M.V.A.; Figueirêdo, R.P.; Oliveira, L.B.; needed in order to shed light on the correlation between Campos, A.C.; Azevedo, E.O. these viruses and risk factors. Financial Support: CNPq, UNIVERSIDADE FEDERAL DE SERGIPE Bovine papillomavirus (BPV) is a potentially oncogenic CAPESVV335 and - FAPITEC/SE. GENETIC DIVERSITY OF PORCINE virus group, which mainly affects individuals from CIRCOVIRUS TYPE 2 CAUSING CLINICAL DISEASE IN the species Bos taurus. In contrast to other types of BRAZILIAN PIG HERDS CONCOMITANT WITH PCV2 VACCINATION have shown that BPV were found in other ruminants, Schaefer, R.; Gava, D.; Haach, V.; Serrão, V.H.B.; Cantão, papillomavirus, BPV is not species-specific. Studies such as giraffes, bison, buffalo, and equines. BPV still M.E.; Ciacci-Zanella, J.R. causes great concern to livestock producers, especially the dairy ones, since it affects the growth of papillomas 1. EMPRESA BRASILEIRA DE PESQUISA in teats, which affects the production of milk, and could AGROPECUÁRIA 2. UNIVERSIDADE DO OESTE DE SANTA progress to cancer. Today, 13 BPV types are known, CATARINA which belongs to three different genera. As long as some 3. UNIVERSIDADE DE SÃO CARLOS BPV types are associated to cancer and others are not, it is very important to understand which types of BPV Porcine Circovirus type 2 (PCV2) belongs to the are circulating in Brazil. However, information about the Circoviridae family and four distinct genotypes have been diversity of BPV in Sergipe state, Northeastern Brazil, described; PCV2a and PCV2b, which have been detected is still unknown. Sergipe has a dairy region with a big local economic relevance and large number of cows. Denmark; and PCV2d, isolated initially in China in 2010 worldwide; PCV2c, identified from archived samples in Therefore, the knowledge about BPV types in this and in U.S in 2012, which carries an ORF2 elongation area has a great economic importance, and could be by one amino acid. Postweaning Multisystemic Wasting
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
247 Veterinary Virology: VV
Syndrome, the most common clinical manifestation of VV337 - IDENTIFICATION OF CANINE PARVOVIRUS 2B IN A CRAB-EATING FOX Cerdocyon thous (LINNAEUS, in 1996 in Canada and in 2000 in Brazil. PCVD has 1766) WILDLIFE IN BRAZIL Porcine Circovirus Diseases (PCVD), was first described caused economic losses with high mortality rate in Lorenzetti, E.; Spera, C.G.; Marques, G.C.; Freitas, L.A.; Brazilian pig farms until the introduction of a PCV2 Martins, M.B.; Diniz, J.A.; Teixeira, C.R.; Alfieri, A.A.; vaccine in 2008. However, since 2012, PCVD has been Alfieri, A.F. reported in nursery pigs from vaccinated pig herds. Aiming to diagnose and characterize PCV2 infection 1. UNIVERSIDADE ESTADUAL DE LONDRINA 2. UNIVERSIDADE ESTADUAL PAULISTA JULIO in PCV2 vaccinated pig herds, lymph node, kidney and DE MESQUITA FILHO lung tissue samples from 12 clinically affected pigs from seven farms were submitted to histopathology (H&E), Canine parvovirus (CPV) belongs to Parvoviridae family nested-PCR and immunohistochemistry (IHC) test. DNA and is the causal agent of one of the most dangerous sequencing was performed by the Sanger method. The infectious disease in young dogs and it is responsible obtained sequences were analyzed and assembled with for large numbers of animal deaths worldwide. The CPV of the whole genome and the ORF2 gene (capsid protein) has a linear ssDNA genome that codifies two structural werePhred/Phrap/Consed performed by Neighbor-Joining softwares. Phylogenetic method in analyses MEGA proteins (VP1/VP2) and two non-structural proteins 6 software. PCv2 infection was demonstrated in all panleukopenia virus (FPV) which is adapted to the canine(NS1/NS2). host by The wild CPV2 carnivores emerged such as aas variant mink and of felinefoxes Sequence analysis revealed one PCV2a, nine PCV2b, and spread rapidly. A few years later, CPV2a emerged andsamples two byPCV2d. H&E andThese confirmed results byshow IHC theand detectionnested-PCR. of and replaced completely the CPV2. After a new type distinct PCV2 genotypes causing clinical disease in PCV2 called CPV2b emerged and co-circulated with CPV2a. vaccinated pigs. Moreover, only PCV2a and PCV2b have In 2000, the CPV2c was discovered and is co-circulating with CPV2a and CPV2b. The Crab-eating Fox (Cerdocyon mainly detected until 2003, and in 2004 a new genotype, thous) is present in all Brazilian biomes and in some PCV2b,been identified emerged in Brazilianworldwide. herds Multiple until now. factors PCV2a wasare countries of South America. The viral disease constitutes 56% of the pathogens that threaten populations of maternal derived antibody, the presence of co-infecting wild carnivores worldwide. The aim of this study was agents,involved level in vaccine and frequency efficacy, including of challenge, the interference management by to detect the causal agent of diarrhea in a Crab-eating practices, and also the presence of isolates that are more Fox. The Medical and Research Center for Wild Animals virulent due to antigenically silent mutations. Molecular (CEMPAS) of the Universidade Estadual Paulista (UNESP) modelling studies applied to the capsid protein of these - Botucatu, received a Crab-eating Fox with 21 days old isolates are ongoing. These studies aim to elucidate with diarrhea. The animal died and organ fragments (CNS, gut, kidney, heart, lung, tonsil, liver, and spleen) were collected. The viral DNA extraction was performed recognitionpossible modifications that was observed in the viralin the protein apparent conformation vaccination failure.which could Financial have Support: caused an EMBRAPA inefficient (02.11.01.006.00). antibody binding acidusing methods. a combination The DNA extracted of phenol/chloroform/isoamyl was submitted to PCR alcohol and silica/guanidinium isothiocyanate nucleic 4585) of the VP2 gene. The PCR product was sequenced inassay ABI3500 that amplifies Genetic Analyzera fragment sequencer with 583 using bp (ntthe 4003- same primers used in the PCR assay. Nucleotide and amino acid sequence alignment (Clustal W) and the phylogenetic tree were performed in MEGA software. The sequence identity matrix was performed in BioEdit software. Just the heart out of eight organ fragments evaluated was positive to CPV2 in PCR assay. In the sequence October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
248 Veterinary Virology: VV analysis the positive sample exhibited a high (99.6%) (n n n n=14), nucleotide identity with the CPV2b prototype CPV-39 n n n strain. In the phylogenetic tree the sample clustered (n=61), G9P[23] (n =25), G9P[7] ( n=21), G5P[13] ( n=7), with CPV2b strains and in the amino acid analysis the G9P[13] (n =12), G5P[6] ( n=11), G9P[6] ( =10),n G3P[13] sample revealed the presence of the codon GAT (D (n=8), G5P[7] n ( =8), G3P[6]n ( =7), G5P[23]n=1), ( and amino acid - Asp) at position 426 of the viral protein VP2 G1P[7] ( =2),n=1). G3P[23] In some (porcine=2), G4P[13] RVA strains ( =2), only G1P[6] the G that characterize the subtype 2b. This report relates the =1), G4P[7] ( =1), G4P[23] ( =1), G11P[23]n ( n=5), circulation of CPV2b in Crab-eating Fox wildlife in Brazil G26P[13]n ( n n (orn P genotype wasn detected: GXP[6] (n=7),=1). G9P[X]Common ( and Financial support: FINEP, CAPES, CNPq, and Fundação uncommonG5P[X] ( =3), G and GXP[23] P genotypes ( =3), of G3P[X]RVA detected ( =2), in GXP[7]piglets and it is the first description of CPV2b in this species. =1), GXP[13] ( =1), and G26P[X] ( Crab-eating Fox, wildlife. Financial Support: Financial in this study showing the great diversity of genotypes Araucária/PR. Keywords: CPV2b, Cerdocyon thous, circulatingwere identified in Brazilian in the pig porcine herds RVA during strains the period analyzed of PR. support: FINEP, CAPES, CNPq, and Fundação Araucária/ the most detected in the strains analyzed and the G and P VV339 - PORCINE GROUP A ROTAVIRUS STRAINS 2005 to 2014. The G4P[6] genotype combination was CIRCULATING IN PIG HERDS IN BRAZIL FROM 2005 TO 2014 genotypes moreprovide detected information were G9related and P[6], to the respectively. circulation Lorenzetti, E.; Massi, R.P.; Medeiros, T.N.S.; Oliveira, andThe diversitycontinuous of RVAmonitoring in piglets. and This identification is important of forG and both P M.V.; Ribeiro, J.; Leme, R.A.; Possatti, F.; Molinari, animal and public health because piglets are regarded as B.L.D.; Moraes, N.R.; Bon, V.R.; Alfieri, A.F.; Alfieri, A.A. important reservoirs of diversity for human and animal UNIVERSIDADE ESTADUAL DE LONDRINA RVA strains. Keywords: piglet, diarrhea, RVA, genotype. Financial Support: FINEP, CAPES, CNPq, and Fundação Group A rotavirus (RVA) infection cause neonatal diarrhea in many animal species worldwide. The genotypes G3, Araucária/PR.VV348 - CO-INFECTION OF PARROT-BREASTED- piglets. In addition, other G and P genotypes, such as G1, PURPLE (AMAZONA VINACEA) BY COV AND AMPV-1 G4, G5, G11, P[6], and P[7] are commonly identified in Ferreira, H.L.; Scagion, G.P.; Martini, M.C.; Barnabé, A.C.S.; Caserta, L.C.; Arns,C.W. G2, G6, G8, G9, G10, G12, G26, P[1], P[2], P[3], P[4], P[5], ofP[8], this P[9], study P[11], was P[13], to identify P[19], theP[22], G and P[23], P genotypesP[26], P[27], of 1. FZEA-USP 218P[32], RVA-positive and P[34] havefecal beensamples identified in PAGE in from pigs. BrazilianThe aim 2. IB-UNICAMP 3. MASSACHUSETTS INSTITUTE OF pig herds. All diarrheic fecal samples from suckling TECHNOLOGY piglets collected during 2005 to 2014 were submitted to PAGE technique and one RVA-positive fecal sample Wild birds act as reservoir for several viruses and in PAGE from each pig herd evaluated was selected to thus posing continuous threats to both livestock and realize the RT-PCR assay using rotavirus VP7 (G type) human beings.Viruses belonging to three main virus and VP4 (VP8* - P type) primers. The RT-PCR amplicons families are often found in wild birds: Orthomyxoviridae, of the 218 fecal samples were sequenced in ABI3500 Paramyxoviridae and Coronaviridae, that also infect Genetic Analyzer Sequencer using the same primers human and other livestock species. The present study used in the RT-PCR and the nucleotide sequences were aimed to investigate co-infection by avian viruses in wild analyzed using the BLASTn and RotaC v2.0 software. bird samples. To do so, 303 cloacal and orophayngeal (OP) The sequence analysis of 218 Brazilian wild-type swabs from 33 bird species were collected in different porcine RVA strains revealed the presence of seven G regions of Sao Paulo State. Samples were screened by genotypes (G1, G3, G4, G5, G9, G11, and G26) and four P using a PanCoV PCR selective assay targeting a 440 bp of RNA-dependent RNA polymerase (RdRp) gene of Coronaviruses. Among those samples, 100 cloacal genotypes (P[6], P[7], P[13], and P[23]). The following GOctober and P2015 genotype Volume 20combinations – Supplement 1 were - Abstracts/Posters detected: G4P[6] - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
249 Veterinary Virology: VV and OP swabs were also tested by a PanParamyxo RT- autogenous subunit product containing H3 cluster 4, PCR targeting 121bp of avian paramyxoviruses. As previous reported by our group (Duraes-Carvalho et in the selected farms. Samples were collected every- al, 2015), CoV was detected in nineteen samples of 11 other-weekH1-δ and H1-γ between viruses March-May was used andto vaccinate July-August all dams2013 different bird species. Those CoV samples were cluster for a total of eight collections. One hundred and thirty with isolates belonging to the BeltaCoV and DeltaCoV genus. Whilst, avian paramyxoviruses were detected in piglets by litter, for a total of 4320 piglets’ samples, and two samples. Phylogenetic analysis based on fusion (F) fromfive serum 330 breedingsamples werefemales collected corresponding from 12-17 with day-old the gene revealed that these viruses clustered with vaccinal litters. All samples were evaluated for nucleoprotein strains of NDV belonging to the genotype II. Interestingly, (NP) antibody by ELISA (MultiS-Screen Ab Test, Idexx) CoV and NDV were both detected in a sample from and for antibodies against autogenous vaccine antigens Parrot-breasted-purple (Amazona vinacea). The by hemagglutination inhibition (HI) test. NP antibodies were detected in 82.4% of sampled dams and F4 had investigated. Determination of alternation in immune the lowest percentage of positive samples over the responsesbiological significanceagainst multiple of co-infection pathogens should would be helpfurther to samplings. Similarly, 89.7% of piglets had NP antibodies underpin the nature and breadth of immune responses. and the percentage of NP MDA-positive piglets varied between and within litters, suggesting incomplete passive transfer is common. A total of 98.8%, 90.7% and Financial Support: FAPESP Grant numbers 2011/09019- 97.4% of dams and 86%, 84.4% and 83.7% of piglets 0VV353 and 2011/50919-5. - DETECTION OF INFLUENZA A VIRUS MATERNALLY DERIVED ANTIBODIES IN SUCKLING respectively. F2 had the lowest percentage of positive PIGS FROM DAMS ADMINISTERED INFLUENZA were positive for H3 cluster 4, H1δ and H1γ antibodies, VACCINES IN COMMERCIAL SWINE FARMS Dias, A.S.; Gauger, P.C.; Vincent, A.L.; Kitikoon, P.; collection,piglets in the suggesting first sampling virus andcirculation piglets fromand thisinfection farm Baker, R.B.; Zhang, J. mayshowed have signs occurred. of influenza Incomplete infection passive at transfer this sampling of IAV 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS antibodies was apparent within and between litters of 2. IOWA STATE UNIVERSITY piglets. The variability in MDA in suckling piglets may 3. NATIONAL ANIMAL DISEASE CENTER/ UNITED STATES DEPARTMENT OF breeding herds suggesting this population of pigs may AGRICULTURE occur in spite of the use of influenza vaccination in breeding herds. Financial Support: FAPEMIG, CNPq. be a source of endemic influenza virus circulating in A virus (IAV) provides passively acquired antibody VV356 - DEVELOPMENT OF A LUCIFERASE- Vaccination of breeding females against Influenza through colostrum ingested by neonatal pigs at birth. EXPRESSING PPRV Cano, L.; Comerlato, J.; Minet, C.; Campos, F.S.; clinical disease can vary depending on the quantity and Tochetto, C.; Roehe, P.M.; Franco, A.C.; Albina, E.; qualityHowever, of thepassively piglet’s acquired resistance antibody. to influenza The objectives infection orof Almeida, R.S. this study were to determine the presence of antibodies 1. UNIVERSIDADE FEDERAL DO RIO GRANDE vaccination in breeding females and to determine the DO SUL presenceagainst IAVof IAV in maternally dams from derived farms antibodies using influenza (MDA) 2. CENTRE DE COOPÉRATION in suckling piglets. Four farms (F1 to F4) from the same INTERNATIONALE EN RECHERCHE production system in the Midwest United States were AGRONOMIQUE POUR LE DÉVELOPPEMENT selected for the study. Dams were previously vaccinated Peste des petits ruminants virus (PPRV), the recent launch animal virus to be eradicated, is a paramixovirus which belongs to genus Morbillivirus. PPRV is a H3N2with aviruses. licensed One commercial week prior influenza to sample vaccine, collection, which an negative ssRNA virus that causes the peste des petits contained δ -2 H1N1, γ- H1N1, C1- H3N2 and C4- October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
250 Veterinary Virology: VV ruminants, an acute disease of goats and sheep that VV358 - DISTINCT MORBILLIVIRUS-RELATED IN results in high mortality of the infected herds. The live DIFFERENT BAT SPECIES FROM SOUTHERN BRAZIL attenuated vaccines available to date provide lifelong Corrêa, R.A.; Lima, F.E.S.; Cibulski, S.P.; Teixeira, T.F.; immunity, however, are unable to allow differentiation Varela, A.P.M.; Scheffer, C.M.; Santos, H.F.; Witt, A.A.; between naturally infected and vaccinated animals. Roehe, P.M.; Franco, A.C. Recently the reverse genetics methodology has been intensively applied to create PPRV recombinants 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL and better confront the eradication challenges. This 2. UNIVERSIDADE FEDERAL DE CIÊNCIAS DA study aims to develop a luciferase-expressing PPRV, SAÚDE DE PORTO ALEGRE which will be used as a tool in the validation of a PPRV 3. INSTITUTO DE PESQUISAS VETERINÁRIAS mouse model also in development in our laboratory. DESIDÉRIO FINAMOR 4. CENTRO ESTADUAL DE VIGILÂNCIA EM will be very useful for future PPRV studies. Based on SAÚDE DO RIO GRANDE DO SUL The couple luciferase-expressing PPRV/mouse model Bats (order Chiroptera) may be reservoirs of many emerging zoonotic viruses. Pertinent examples include overlappingthe PPRV Nigeria sections. 75/1 The vaccine luciferase strain, gene the was entire inserted viral Hendra and Nipah viruses, members of the family betweengenome wasthe phosphoprotein amplified by RT-PCR and matrix and cloned protein in genes, three Paramyxoviridae, genus Henipavirus. Apart from these, a number of other paramyxoviruses have been detected in different bat species in Asia, Africa and Europe, constructrespecting containing the viral polymerase the nucleoprotein, “rule of fusionsix”. Then, protein the particularly rubulaviruses. Most of such viruses have and“P-luciferase-M” hemagglutinin segment gene sequences. was introduced The last in cloning a plasmid step been detected in bats, particularly fruit bats. In the was the insertion of the L gene in the remaining PPRV present study, pooled organs (kidneys, spleen, lungs and cloned genome. At the 5’ and 3’ ends of the antigenomic liver) from 120 bats of various species of the families sequence, hammerhead ribozyme and hepatitis delta Vespertillionidae, Molossidae and Phyllostomidae were virus ribozyme sequences were introduced, respectively. sampled and tested for paramyxovirus RNA using a The full-length clone was under the expression control conventional pan-paramyxovirus reverse transcription of the T7 RNA polymerase promoter. Three helper polymerase chain reaction, followed by sequence plasmids containing N, P and L genes were cloned under expression control of CMV promoter. Those plasmids, from Artibeus lituratus, one from Histiotus velatus and necessary to form the ribonucleoprotein complex, were oneanalysis. from InMolossus total, organs molossus from species) five specimens yielded RT-PCR (three previously validated in a minigenome PPRV system products of 496 base pair fragments. These were cloned to do the subsequent PPRV-luciferase rescue. The into TOPO-TA, sequenced and aligned with homologous complete cDNA clone was fully sequenced to search for fragments of reference members of the Paramyxoviridae. undesirable mutation introduced in the process. Five Preliminary results demonstrated that all viral nucleotides alteration were found in the L sequence genomic sequences detected bear a close phylogenetic relationship with members of the genus Morbillivirus. vaccine. Attempts to rescue the PPRV-luciferase are still inwhen progress. compared Financial to the Support: reference CIRAD, sequence, AIRD, Nigeria FINEP. 75/1 paramyxoviruses in this geographic area. Since such sequencesThese findings recovered indicate were thedetected presence in bat of specimens bat-born living in synantropic areas, further studies are needed to evaluate the zoonotic potential of such agents. Financial Support: FINEP, CAPES, CNPq.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
251 Veterinary Virology: VV
VV364 - A GENETICALLY DIVERSE CYCLOVIRUS identity and >70% amino acid identity in the capsid DETECTED IN Tadarida brasiliensis BATS BY NEXT (Cap) protein to the same species. In the present study, GENERATION SEQUENCING we report the detection of ssDNA genomes from tissue Finoketti, F.; Lima, F.E.S.; Cibulski, S.P.; Bello, A.G.D.; samples from bat specimens using the using high- Roehe, P.M.; d´Azevedo, P.A. throughput sequencing approaches bringing to light the genetic diversity of cycloviruses that can be found in 1. UNIVERSIDADE FEDERAL DO RIO GRANDE bats. Financial Support: FINEP, CAPES e CNPq. DO SUL 2. UNIVERSIDADE FEDERAL DE CIÊNCIAS DA VV373 - OCCURRENCE AND MOLECULAR SAÚDE DE PORTO ALEGRE CHARACTERIZATION OF PICOBIRNAVIRUS ISOLATED 3. INSTITUTO DE PESQUISAS VETERINÁRIAS FROM CALVES IN BRAZIL DESIDÉRIO FINAMOR Macedo, R.; Kunz, A.F.; Gallego, J.C.; Mello, J.L.; Viruses of the Circoviridae family are known to infect a Possatti, F.; Otonel, R.A.A.; Alfieri, A.A.; Takiuchi, E. wide range of vertebrates. The virions consist of naked 1. UNIVERSIDADE ESTADUAL DE LONDRINA nucleocapsids of about 20 nm in diameter, with a circular 2. UNIVERSIDADE FEDERAL DO PARANÁ single stranded DNA (ssDNA) genome of approximately Picobirnavirus (PBV) belongs to the family and genome organization in these ssDNA allowed Picobirnaviridae. PBV are a group of emerging non- authors2.0 kb. The to propose distinct the nucleotide/amino creation of a new acid genus composition within the enveloped viruses, with a bisegmented double-stranded Circoviridae, which was named Cyclovirus. Bats (order RNA genome that can infect a wide range of hosts. Chiroptera) are recognized as sources of viruses that can The large RNA segment (or segment 1) encodes the potentially cause disease in humans and animals. In this capsid protein while the small segment (or segment study, viral DNA recovered from organs of 12 healthy 2) encodes the viral RdRp. According to the migration Brazilian free-tailed bats (Tadarida brasiliensis) was sequenced using the Illumina MiSeq system. A total of electrophoresis and silver staining (PAGE-SS), the PBV profile of the two dsRNA segments in polyacrylamide gel 740,198 reads were generated. Reads were assembled into contigs using SPAdes and compared to sequences can be classified into two patterns: small or large genome in the GenBank nucleotide and protein databases using (GI) and II (GII) due the genetic variability of segment 2. Theprofile. aim PBV of this has study been was classified to report into the two frequency genogroups: of PBV I into 2,199 contigs and analyzed using BLAST with the infection and to perform the molecular characterization NationalBLASTn/BLASTx. Center for These Biotechnology sequences Information were assembled (NCBI) of a bovine PBV strain detected in fecal sample from a databases. Twenty one contigs were related to Cyvlovirus. naturally infected calf. From May 2012 to January 2014 were collected 289 fecal samples from calves between sequence displays the archetypal ambisense genome organizationOne full circular containing genome two of major 1744 open was reading identified. frames The Paraná State, South of Brazil. Nucleic acid extraction was 5 and 60 days of age, from five dairy cattle herds in (ORFs) inversely arranged, responsible for encoding the replicase (Rep) and capsid (Cap) proteins, and are performed using a combination of phenol/chloroform/ separated by a 3’ intergenic region (IGR) between the methods. The dsRNA of PBV were analyzed by PAGE- isoamyl alcohol and silica/guanidinium isothiocyanate stop codons and a 5’ IGR between the start codons. All SS and all positive samples were submitted on RT-PCR. sequences present in their 5’ IGR (intergenic region) of The RT-PCR was carried out using the primers PicoB25 the rep ORF the cyclovirus-conserved nonanucleotide and PicoB43 that amplify a 201 bp fragment of the RdRp motif (5’-TAATACTAT-3’) in their loop region. The gene of GI PBV. From the 289 stool samples analyzed predicted CAP protein sequences shows an amino acid identity of less than 70% and the predicted REP protein by PAGE-SS the PBV was detected in 8.3 % (24/289), of sequence displays amino acid identity of less than 60%. 24 positive samples, 5 (20.8%) of them showed a small which 75% (18/24) had diarrheic consistency. Of the Circovirus considers circoviruses sharing >75% genome-wide nucleotide The classification for the genus electrophoretic profile and 19 (79.2%) samples had October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinarylarge Virology: profile. VV From the 24 positives samples by PAGE-SS, XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
252 Veterinary Virology: VV
when p <0.05. Of the 175 DNA samples subjected to real analysis15 (62.5%) of nucleotide were successfully identity amplifiedmatrix revealed (201 bp) that using the DNA targeting gB gene fragment, 41 (23.56%) were GI specific primers targeting the RdRp gene of PBV. The positive,time PCR considering reaction for that amplification 32 (34.40%) of GHVFwere genomicpositive nucleotide identity (81%) with PBV detected in turkey for feline retrovirus. All comparisons accomplished, bovine PBV identified in this study, showed the highest sequence of a bovine PBV strain in the American difference in infection GHVF and feline retroviruses. (MD-2010 / HM803965). This is the first nucleotide showed p <0.05, indicating the statistically significant the ratio of chances, which shows that animals infected Picobirnavirus,continent and Phylogeny, the first detectionRT-PCR. Financial of small Support: genome byThis retroviruses result was haveconfirmed 3.1 times by the more calculation likely to haveperformed GHVF CAPESprofile andof PBV Fundação in bovine Araucária. hosts. Keywords: Bovine, PAGE, than the negative animals. The domestical cats infected for feline retrovirus can be more susceptible to infection VV374 - RETROSPECTIVE STUDY OF FELINE GHV due to immunosuppression as observed in human GAMMAHERPESVIRUS PREVALENCE gamaherpesvirus (HHV-4 and HHV-8) in individuals Kurissio, J.K.; Rodrigues, M.V.; Taniwaki, S.A.; Brandi, infected with the AIDS virus. Thus, based on the analysis A.; Zanutto, M.S.; Araujo jr., J.P. and results presents was observed the prevalence and 1. UNIVERSIDADE ESTADUAL PAULISTA presence of GHVF in the evaluated samples and it main 2. UNIVERSIDADE DE SAO PAULO occurrence in co-infected animals by felines retrovirus. Herpesviruses are enveloped viruses, double stranded DNA linear, divided into three distinct subfamilies: FinancialVV375 - GENETIC Support: CAPES/FUNDIBIO.VARIABILITY OF THE VP3 CODING alpha, beta and gamaherpesvirus. The gamaherpesvirus SEQUENCE OF AVIAN GYROVIRUS TYPE 2 are lymphotropic, most of which establishes latency Finoketti, F.; dos Santos, H.F.; Varela, A.P.M.; Campos, in B lymphocytes, mainly in immunosuppressed F.S.; Roehe, P.M.; Franco, A.C. individuals and the infection can lead to development of cancers and lymphoproliferative disorders. In cats, 1. UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL States as disease associated to retrovirus. In Brazil, 2. INSTITUTO DE PESQUISAS VETERINÁRIAS DESIDÉRIO FINAMOR therethe gamaherpesvirus is no report of wascases first or agent’sidentified presence in the Unitedin the feline population to date. The aim of this work is to Chicken anemia virus (CAV) and avian gyrovirus type 2 estimate the prevalence and the correlation between (AGV-2) are members of the family Circoviridae, genus feline gamaherpesvírus (GHVF) and the main feline Gyrovirus. Gyroviruses are small nonenveloped DNA viruses of about 2.3kb that codes for three proteins: VP1, leukemia virus) infections. For this retrospective study VP2, and VP3. AGV-2 has only ~40% identity to CAV. wereretroviruses used 175 (feline DNA samples immunodeficiency extracted from virus whole and blood feline Remarkably, one of the CAV proteins, Apoptin (or VP3), of domestic cats in the period 2008-2014, referred to can induce selective apoptosis in human malignant cell the Molecular Diagnostic Laboratory, Department of lines and has been studied as an alternative in cancer Microbiology and Immunology, Institute of Biosciences treatment. The AGV-2 VP3 is a 124 amino acid protein of Botucatu, UNESP. To this purpose were selected 93 that shares 32.2% amino acid identity to CAV Apoptin. samples positive and 82 negative for feline retrovirus by Apoptin has important functional domains: leucine-rich PCR for proviral DNA detection. For the statistical analysis domain (LRS), a bipartite-type nuclear localization signal (NLS1 and NLS2), a nuclear export signal (NES) and test and the odds ratio were performed to evaluate the several potential phosphorylation sites. These domains correlationused the 95% between significance infection level, by retroviruses where the chi-squareand GHVF. activity. The aim of this study was to analyze the genetic variabilityare essential of forthe itsVP3 efficient from nuclearAGV-2 positive localization samples and It was considered statistically significant difference collected from different species of birds and try to identify
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
253 Veterinary Virology: VV
species. The increase in aquaculture activities around the health status of the bird. Feather shafts collected the globe has created new possibilities for transmission froma correlation 9 healthy between and 6 diseasedthe molecular birds profile(displaying of VP3 loss with of of aquatic viruses, which remain limiting factors for weight and anemia) were submitted to DNA extraction aquaculture production. Among the hundreds of known primers used in the PCR assay were designed to amplify stands out as a great cause for international concern due aand 523 polymerase base pairs chain (bp) fragment,reaction (PCR). targeting The theAGV-2 whole specific VP3 toviruses its socio-economic of fish, the spring importance viraemia for of international carp virus (SVCV) trade. gene. Next, PCR products were sequenced and the genetic SVCV causes an acute, systemic, contagious disease that relationship between each isolate was determined by affects primarily the common carp (Cyprinus carpio) nucleotide and amino acid alignment. Additionally each functional domain was in silico induces severe mortality (30-70%) to both young analysis of the VP3 gene sequence resulted in three along with several other fish and shrimp species, and clusters, named N1, SM and T, according verified. to Phylogenetic a previous reported in Asia, Europe, Russia, North and South America.and adult Understanding fish world-wide. SVCV Until transmission now, SVCV is hasessential been 12.0 % between amino acid sequences were detected for prevention of spreading, especially in Brazil, where betweenclassification these of groups. AGV-2 Samples samples. more Differences similar to of the 8.9 N1 to aquaculture is growing. SVCV, a rhabdovirus of the genus group showed an insertion of one amino acid in NLS2 Vesiculovirus, is an enveloped, negative polarity, single- region. In addition, from all samples examined, only two stranded RNA virus of approximately 11kb. In the present of them, from diseased animals, contained a predicted study a nested RT-PCR assay for SVCV was standardized NES domain. The VP3 sequences of such samples did not using two primer pairs targeting a conserved sequence cluster with N1, SM or T. This study has shown genetic within the glycoprotein (G) gene, generating amplicons of 470bp (1st round) and 170bp (2nd round). A synthetic birds: all samples belonging to group N1 originated fromvariation diseased in the birds, AGV-2 while VP3 geneall the amplified samples from belonging different to was used as the endogenous control. The detection limit 489bp gene was used as positive control and fish actin correlation between the VP3 genotype and the healthy dilutions of the positive control was 8.62 x 10-2 copies. statusgroup Tof originatedthese birds, from more healthy AGV-2 animals. positive Tosamples confirm will a Theof the assay assay was determined applied to by 150 fish tissuetissue samplesspiking with from serial 146 be further analyzed. Financial Support: FINEP, CAPES e ® and reverse CNPq. lambaridifferent (fish,Astyanax after bimaculatusextraction with) and Trizol 1 tilapia (Tilapia VV376 - DEVELOPMENT AND APPLICATION OF A RT- rendallitranscription.), were Twopositive samples for the from G gene 2 differentof SVCV, and fish, the 1 PCR ASSAY FOR DETECTION OF SPRING VIREMIA OF PCR product sequenced by the Sanger method indicated CARP VIRUS IN FRESHWATER FISH FROM BRAZIL them as being part of genogroup Ia, a subgroup of SVC Arruda E.P.; Luna, L.K. de S.; Navarro J.; Oliveira A.S.; viruses that were isolated in England, China, the United Michelin E.; Maganha S.R.L.; Alencar A.; Queiroz States and Canada. To the best of our knowledge, this is S.R.A.; Sousa E.L.M. 1. FACULDADE DE ZOOTECNIA E ENGENHARIA the first time SVCV has been detected by way of RT-PCR DE ALIMENTOS - UNIVERSIDADE DE SÃO 3). PAULO in Brazil. Financial Support: FAPESP (Proc. 2012/08846- 2. FACULDADE DE MEDICINA DE RIBEIRÃO PRETO - USP 3. AQUIVET SAÚDE AQUÁTICA
Freshwater fish compose the largest portion of the world ofaquaculture technology production, and continued and warm expansion water fish of farmingcultivated is increasing, due to financial investment, improvement October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
254 Veterinary Virology: VV
VV378 - SEROLOGICAL RESEARCH FOR ARBOVIRUS of wild animals. Financial Support: Insituto Evandro IN WILD ANIMALS RESIDENTS IN AREAS OF PROJECTS MINNING EXPLORATION, PARA STATE, BRAZIL Chagas/SVS.VV382 - ROTAVIRUS DETECTION IN FELINE IN THE Silva, F.A.; Moraes, J.R.S.; Chagas, L.L.; Ferreira, METROPOLITAN REGION OF BELÉM , PARA , BRAZIL M.S.; Chiang, J.O.; Vasconcelos, P.C.; Martins, L.C.; Guerreiro, S.R. Barros, B.C.V.; Fecury, P.C.M.S.; Alves, C.M.; Rocha, D.C.C.; Kanai, Y.K.; Marinho, A.N.R.; Mascarenhas, INSTITUTO EVANDRO CHAGAS J.D.P. The Amazon forest has a wide range of blood-sucking INSTITUTO EVANDRO CHAGAS arthropods and wild vertebrates who live a favorable ecological environment for its perpetuation, favoring Infection caused by rotavirus (RV) is a major cause the maintenance of arboviruses. In Para state there are of gastroenteritis in humans and young animals several projects that develop mining stocks, which have worldwide. RV belongs to the family Reoviridae, genus been causing environmental changes, so it is necessary Rotavirus, with genome consisting of 11 double- to conduct a ecosystem study of the region with into eight groups or species A- H. In general, in felines emphasis on the diversity of circulating arboviruses stranded RNA segments (dsRNA). They are classified in the area. The focus of the study was to the detect the infections caused by rotavirus, in particular group arboviruses antibodies in wild animals serum captured A are well described in the literature. Objective(s): To detect the occurrence of rotavirus, by serological and Pará, Brazil. Two expeditions were conducted to capture molecular techniques to evaluate the presence of RV in in the influence areas of mining projects in the state of fecal specimens collected of diarrheal wandering felines. to the cities of Canaan dos Carajás, Curionópolis and Material and Methods: Two hundred twenty-four fecal wild animals in March / 2014 and October / 2015, specimens were selected of felines coming from shelters by hemagglutination inhibition (HI). 154 samples of in the metropolitan region of Belém, Pará, Brazil. The wildParauapebas animal serum / PA. were Antibody teted detection for 19 types was of performed arbovirus samples were resuspended in Tris- Ca ++ buffer 0.01M belonging to the following genus: Alphavirus (Eastern pH 7.2, followed by immunochromatography reaction, equine encephalitis virus, Western equine encephalitis ELISA, and qPCR, to detect RV groups. Results: A total virus, Mayaro virus and Mucambo virus); Flavivirus of 224 fecal samples were studied for group A: 21.87 (Yellow Fever virus, Ilheus virus, St. Louis encephalitis virus, Rocio virus , Cacipacoré virus and Bussuquara .% Conclusion: (49/224) were Literature positive data by immunochromatography,describe the occurrence virus); Orthobunyavirus (Guaroa Virus, Maguari virus, 3.57 % (8/224) by ELISA and 5.35% (12/224) by qPCR Tacaiuma virus, Caraparu virus, Oropouche virus, Catu of RV group A in domestic animals, especially feline. virus, Belém virus and Utinga virus) and Phlebovirus This study corroborates the data about the occurrence (Icoaraci virus). From the 154 tested serum by IH, 25 of RV group A in the population studied and points to (16.2%) had antibodies to some of the 19 different types the need for more research about rotavirus on felines of arboviruses tested and 129 (83.8%) had no antibodies because these animals present as a potential reservoir of the tested arboviruses. Of the 25 positive serums, 12 of rotaviruses in big cities facilitating the transmission showed monotypic response to virus: EEEV (1); ILHV zoonotic for the population. Keywords: Rotavírus, feline, (4); SLEV (1); CACV (2); ICOV (1) and OROV (3); the qPCR, ensaio imunoenzimático. Financial Support: Coordenação de Aperfeiçoamento de Pessoal de Nível genus. Antibodies titles detected ranged from 1:20 to Superior (CAPES), Fundação de Amparo à Pesquisa do 1:other 640. 13 Conclusion: samples had The simultaneous presence of reaction hemagglutination- to flavivirus Estado do Pará (FAPESPA), Instituto Evandro Chagas inhibiting antibodies to some of arboviruses tested (IEC). indicates the circulation of these viruses in the study had a higher prevalence of antibodies to several species area, especially viruses of the genus flavivirus, which October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
255 Veterinary Virology: VV
VV385 - BLUETONGUE VIRUS: ISOLATION OF MULTIPLE SEROTYPES IN A SHEEP FLOCK FROM RIO serotypes that might be circulating in the country. DE JANEIRO, BRAZIL Keywords:flock and draws Bluetongue attention virus, to theserotypes, diversity outbreak, of bluetongue ovine, Matos, A.C.D.; Rosa, J.C.C.; Nomikou, K.; Balaro, M.F.A.; co-infections. Financial Support: BRAZIL: CAPES, CNPq, Guedes, M.I.M.C.; Costa, E.A.; Leal, C.A.G.; Figueiredo, FAPEMIG; UK: WELLCOME TRUST, DEFRA. H.C.P.; Mertens, P.P.C.; Lobato, Z.I.P. VV386 - EVIDENCE OF REASSORTMENT EVENTS IN 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS NEW BLUETONGUE VIRUS SEROTYPES CIRCULATING 2. THE PIRBRIGHT INSTITUTE IN BRAZIL, 2014 3. UNIVERSIDADE FEDERAL FLUMINENSE Matos, A.C.D.; Nomikou, K.; Rosa, J.C.C.; Guedes, Bluetongue virus (BTV) is the aetiological agent of M.I.M.C.; Costa, E.A.; Leal, C.A.G.; Figueiredo, H.C.P.; bluetongue (BT), an economically important vector Mertens, P.P.C.; Lobato, Z.I.P. borne disease of ruminants. BTV is transmitted primarily 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS by biting midges ( .). It infects domesticated Culicoides spp 2. THE PIRBRIGHT INSTITUTE and wild ruminants, frequently causing severe haemorrhagic disease and fatalities in sheep and white Bluetongue virus (BTV) is an arbovirus belonging to the tailed deer, while most cattle remain asymptomatic. BTV family Reoviridae, within the genus Orbivirus. Its genome is a double-stranded segmented RNA virus belonging consists of ten linear double-stranded RNA segments to the family Reoviridae, within the genus Orbivirus. that encode structural and non-structural proteins. BTV genome is composed of ten linear dsRNA segments Segment 2 (Seg-2) encodes VP2, a structural protein, packaged within a triple layered icosahedral protein- responsible for serotype determination. BTV is the capsid and code for seven structural and four non- aetiological agent of bluetongue (BT), an haemorrhagic structural proteins. Until now, 27 BTV serotypes have disease that affects ruminants. Clinical disease is more been described worldwide. In Brazil, serological surveys often observed in sheep and some deer species, whereas demonstrated that the virus is widespread and endemic cattle and goats are typically asymptomatic or present in the country, although, only BTV serotypes 4 and 12 have subclinical disease. Bovine has an important role in the been isolated. Nonetheless, reports of clinical disease epidemiology of the virus due to the prolonged viraemia are rare event. In January 2013, an outbreak of BTV-4 observed in the species, which may be detected for more than two months. A preliminary study was performed at (RJ) state, associated with clinical signs and even deaths. Towas better reported understand affecting the a sheepepidemiology flock in Rioof the de disease Janeiro Minas Gerais state in order to study the BTV epidemiology the UFMG/Veterinary School Farm, in Pedro Leopoldo, in that region, blood samples were collected during and serotypes distribution in Brazil. Previous serological two summer periods (2014 and 2015), from animals studies in this farm demonstrated a high percentage of presenting mild clinical signs as depression, mouth positivity for Orbivirus, although clinical signs have never been observed in the herd. To identify the BTV serotypes RT-PCR targeting the segment 10 of the BTV genome, that circulate in the area, blood samples from 27 healthy andlesions positive and fever. samples BTV were was detectedinoculated with in insectgroup cellspecific line heifers, aged from 12 up to 18 months were collected. for virus isolation. After virus isolation, the serotype was determined by typing RT-PCR targeting the segment PCR targeting BTV segment 10 (Seg-10). The positive The samples were tested for identification of BTV by RT- 2. At least three different serotypes were isolated and samples were inoculated in insect cell lines, following inoculation in mammalian cells until appearance of 2014, BTV-10 and BTV-18 were isolated from an ewe cytopathic effect (CPE). Serotype was determined using bloodidentified sample, circulating and in February in the affected 2015, BTV-1 flock. was In isolated January from a lamb blood sample. The detection of at least four sequencing. Additionally, full-length genome sequences ofRT-PCR Seg-2 assayand Seg-10 targeting were Seg-2, performed confirmed and submitted by genome to ofdifferent BTV-1, BTV BTV-10 serotypes and BTV-18in a single in sheepBrazil, flock infecting enhances one from two out of the 27 blood samples tested. Serotypes the risk of viral reassortments. This is the first isolation phylogenetic analyses. BTV was identified and isolated October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
256 Veterinary Virology: VV
and reverse were designed to amplify the region of interest, inserting sites for restriction enzymes BamHI ofBTV-18 the isolates and BTV-24 and demonstrated were identified that inthey the belong isolates. to and HindIII aPhylogenetic western topotype analyses ofof Seg-2BTV-18 confirmed and BTV-24. the serotype Seg-10 analysis from both isolates showed 98.2% to 98.7% and ligated ,to respectively. expression Thevector fragments pQE30. Thiswere vector amplified was nucleotide similarities with Seg-10 of BTV-12 isolated transformedusing high fidelity into enzyme,E. coli strain cut with M15 restriction. Positive enzymescolonies were grown in appropriate medium, plasmids were
BTVin 2002 serotypes in Brazil circulating (BRA2002/01). in Brazil; 2. Collectively, co-circulation these of PCR. Cloning in a prokaryotic system allows obtaining differentresults demonstrate: serotypes in 1.the the same identification herd at the of same two time new aextracted recombinant and cloninggp51 (rgp51). was confirmed The perspective by BLV of gp51- this work is to characterize the protein produced and use Seg-10 suggest that reassortment events happened it in serological test for BLV infection. Keywords: BLV, betweenand 3. the the similarities detected strains identified and the in BTV12 the full-length previously of recombinant protein, serological test. Financial Support: detected in the country. Keywords: Bluetongue virus, INCT-Pecuária, CNPq, CAPES and FAPEMIG. serotypes, bovine, co-infections, epidemiology, Brazil. Financial Support: - BRAZIL: CAPES, CNPq, FAPEMIG; VV392 - MOLECULAR DETECTION OF AVIAN UK: WELLCOME TRUST, DEFRA. GYROVIRUS TYPE 2 IN BROILER CHICKEN IN SOUTHERN BRAZIL VV391 - PRODUCTION OF RECOMBINANT ENVELOPE Yamakawa, F.H.S.; Silva, A.D.; Duarte, C.R.A.; Nunes, GLYCOPROTEIN GP51 OF BOVINE LEUKEMIA VIRUS I.A.C.; Alves, R.S.; Ferraz, S.M.; Vaz, E.K.; Forell, F.; Kassar, T.C.; Oliveira, F.G.; Resende, C.F.; Mata, C.P.S.M.; Esteves, P.A.; Costa, U.M. Gonçalves, S.A.; Castro, R.S.; Leite, R.C. 1. UNIVERSIDADE DO ESTADO DE SANTA 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS CATARINA 2. UNIVERSIDADE FEDERAL RURAL DE 2. EMPRESA BRASILEIRA DE PESQUISA PERNAMBUCO AGROPECUÁRIA SUINOS E AVES 3. CNPQ Bovine leukemia virus (BLV) is a member of the Retroviridae family, genus Deltaretrovirus and the Avian Gyrovirus type 2 (AGV2) was recently described as causative agent of enzootic bovine leucosis (EBL), which a new virus present in poultry. Member of Circoviridae causes persistent lymphocytosis and lymphosarcoma family, belongs to the same genus as the chicken anemia in cattle. The economic importance of BLV infection is virus, an agent known to lead great losses in commercial due to several factors, including losses in exportation, poultry industry by immune depletion result from treatment of secondary infection, and reduction in dairy infection. Although there are few reports about the production. The BLV is commonly diagnosed through be widespread in brazil, and has similar characteristics in serum or milk samples, or by molecular diagnostic to topresence those seen of AGV2 in cav, in once flocks they of belongbroilers, to theit is same believed genus. to identifydifferent themethods proviral by theDNA. detection The infected of specific cattle antibodies develop It is the possible that the resemblance between them a humoral immune response against viral proteins, makes AGV2 a possible cause of losses in the industry. particularly to gp51 (envelope protein), and the This work reports the molecular detection of AGV2 by diagnostic tests for BLV have important applications such polymerase chain reaction technique in commercial poultry housed in different farms in the state of Rio of areas free of disease, and prevalence studies. The Grande do Sul. To carry out this study, 90 chickens were aimas research, of this work epidemiological is to produce surveillance, a recombinant certification gp51 necropsied at ages 1 to 42 days, randomly chosen. For (rgp51) protein to use in diagnosis tests. Proviral DNA each individual chicken, was performed collection of was extracted from three positive animals for BLV. For biological material from lymphoid organ thymus, which in is believed to be one of the sites of viral replication. DNA silico of protein gp51was performed. Primers forward extraction was performed using a commercial kit. For amplification of the fragment of interest, analysis October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
257 Veterinary Virology: VV
BoHV-5) and boostered 26 days later. Animals were region encoding part of nonstructural viral protein VP2, clinically monitored for 200 days after vaccination. viral detection were used a primer pair that amplifies a Neutralizing antibodies to BoHV-5 were evaluated by by electrophoresis in 1% agarose gel. The AGV2 was serum neutralization. No clinical signs were observed in detectedvisualization in 26of the(28.89%) amplified of productsthe 90 thymus was performed samples vaccinated cattle throughout the duration of the study. analyzed. Based on the results obtained at this work, Neutralizing antibodies were detected in all vaccinated AGV2 is present and appears to be widespread in broiler chicken in Rio Grande do Sul state. We believe that the concluded that the live-attenuated vaccine prepared with results demonstrated in this work can contribute to a animals 200 days after the first dose of vaccine. It is better understanding of the presence of AGV2, and that of inducing neutralizing antibodies in vaccinated cattle will add related knowledge, since there understanding of whenthe BoHV-5 administered gI/gE/US9- intramuscularly. recombinant isFinancial safe and Support: capable the epidemiology, pathogenesis and sources of infection FINEP.
FAPESC. VV397 - PORCINE PARVOVIRUS 2 IN SERA OF of the virus are still scarce. Financial Support: CAPES/ HEALTHY DOMESTIC PIG (SUS SCROFA) IN BRAZIL VV394 - A RECOMBINANT, LIVE-ATTENUATED DETECTED BY VIRAL METAGENOMIC ANALYSIS BOVINE HERPESVIRUS TYPE 5 (BOHV-5) VACCINE Campos, F.S.; Kluge, M.; Franco, A.C.; Giongo, A.; INDUCES NEUTRALIZING ANTIBODY RESPONSES IN Valdez, F.P.; Eizirik, E.; Saddi, T.M.; Brito, W.M.E.D.; CATTLE Roehe, P.M. Silva, A.G.; Araújo, I.L.; Campos, F.S.; Bach, S.; Leite, 1. UNIVERSIDADE FEDERAL DO RIO GRANDE F.P.L.; Franco, A.C.; Roehe, P.M. DO SUL 1. LABORATORY OF VIROLOGY, DEPARTMENT 2. PONTIFÍCIA UNIVERSIDADE CATÓLICA OF MICROBIOLOGY, IMMUNOLOGY AND 3. UNIVERSIDADE FEDERAL DE GOIÁS PARASITOLOGY, INSTITUTE OF BASIC The complete genome sequence of porcine parvovirus HEALTH SCIENCES, FEDERAL UNIVERSITY 2 (PPV-2), a member of the Parvoviridae family, was OF RIO GRANDE DO SUL 2. LABORATÓRIO DE BACTERIOLOGIA, samples of domestic pigs (Sus scrofa). Sera were collected CENTRO DE DESENVOLVIMENTO fromidentified ten clinically through normal metagenomic sows in analysisfarms in inthe serum state TECNOLÓGICO (CDTEC) – NÚCLEO DE of Goiás, Brazil. The sera were pooled, centrifuged and BIOTECNOLOGIA, UNIVERSIDADE FEDERAL DE PELOTAS a random PCR. The products were sequenced in an Ion Bovine herpesvirus type 5 (BoHV-5) is the causative Torrentviral particles platform. were A purified, total of extracted261.836 andraw amplifiedreads were in agent of bovine herpetic encephalitis. In countries generated with an average length of 164 base pairs. Reads where BoHV-5 is prevalent, attempts to vaccinate cattle were trimmed using Geneious software and 126.661 to prevent clinical signs from BoHV-5-induced disease selected reads were submitted to BlastX searches. From have relied essentially on vaccination with bovine those, 18.862 were used for contig assembly, annotation herpesvirus type 1 (BoHV-1) vaccines. However, such and taxonomic compositions. Virome mapping of the practice has been shown not to confer full protection to contigs revealed that 95% of all matches clustered with BoHV-5 challenge. In the present study, a live attenuated members of the Parvoviridae. A 5,426 nucleotide-long vaccine prepared with a recombinant BoHV-5 from which contig corresponded to the complete PPV-2 genome. the genes coding for glycoprotein I (gI), glycoprotein E Due to the high degree of coverage of such sequence (gE) and membrane protein US9 were deleted (BoHV- was deposited in GenBank and soon selected as the 5.3 was prepared with a virus suspension containing 10 reference(named BR/GO/ion_09_PPV-2/2011) PPV-2 sequence (NC_025965.1). the Phylogenetic full genome TCID5 gI/gE/US9-) was evaluated in cattle. The vaccine 50 analyses suggest that the genome of Brazilian PPV-2 intramuscularly to ten cows (serologically negative for strain is closely related (98% of identity) to other PPV /mL. Two mL of the vaccine were administered October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
258 Veterinary Virology: VV strain isolated United States, but more distantly related VV407 - DETECTION OF AVIAN GYROVIRUS TYPE 2 IN to Chinese strains (80 to 84% of identity). Financial FEATHER SHAFTS SAMPLES OF COTURNIX COTURNIX Support: CAPES, CNPq, FAPESRGS, FINEP. Corrêa, R.A.; Finoketti, F.; Santos, H.F.; Varela, A.P.M.; Campos, F.S.; Roehe, P.M.; Franco, A.C. VV398 - BOVINE HERPESVIRUS 1 STRAIN COOPER HAS UNDERGONE SPONTANEOUS DELETION OF THE 1. UNIVERSIDADE FEDERAL DO RIO GRANDE US1.67/US2 GENOMIC REGION DO SUL Campos, F.S.; Paim, W.P.; Silva, A.G.; Santos, R.N.; 2. INSTITUTO DE PESQUISAS VETERINÁRIAS Firpo, R.M.; Scheffer, C.M.; Finoketti, F.; Franco, A.C.; DESIDÉRIO FINAMOR Roehe, P.M. Avian gyrovirus type 2 (AGV-2) and Chicken anemia virus (CAV) are members of the family Circoviridae, UNIVERSIDADE FEDERAL DO RIO GRANDE DO genus Gyrovirus. Such viruses are non-enveloped, SUL icosahedral shaped viruses with diameters between 16 Bovine herpesvirus 1 (BoHV-1) is an alphaherpesvirus and 26 nm and contain small, circular, single-stranded with a ~135 kb DNA genome, comprising a unique DNA genomes. In addition to AGV-2, the both CAV and long (UL; ~ 103 kb) and a unique short (US, ~ 32 kb) AGV-2 are wide spread in domestic chickens, however segment. The US segment has a unique region of 10 kb CAV is the etiologic agent of an important disease in chickens, while AGV-2 has been detected both in healthy BoHV-1 genes (e.g. gC, gE, gI and gG) are nonessential and diseased individuals. . The aim of this study was to flanked by two inverted repeats of 11 kb each. Some and may be deleted from the viral genome with no identify AGV-2 in samples from Coturnix coturnix. Feather prejudice for viral multiplication. Here, a spontaneous shafts collected from 4 healthy and 2 diseased animals were submitted to DNA extraction and polymerase chain strain Cooper is reported. The isolate was multiplied, reaction (PCR) targetting a 523 base pairs (bp) fragment deletion identified in the “classical” BoHV-1 vaccine of the AGV-2 VP3 gene. PCR products were sequenced usual methods. Sequencing of the whole viral genome and nucleotide sequences were analyzed. Three purified by ultracentrifugation and DNA extracted by was performed the NSG in Miseq platform. A total of samples were VP3 positive (2 from healthy and 1 from 645,622 raw reads were generated with an average diseased birds) and phylogenetic analysis showed that length of 139 base pairs (bp). Reads were trimmed using the obtained sequences clustered with AGV-2 positive the Geneious software. After mapping the viral genome samples detected from chickens which displayed brain revealed 99.1% identity to the reference strain Cooper, except for the lack of a 892 bp segment corresponding DNA can be detected from Coturnix coturnix samples. to the US1.67/US2 gene. The virus is believe to have Alesions. possible Our pathogenic results show, role for of theAGV-2 first for time, this that species AGV-2 is undergone spontaneous deletion during in vitro passage. at the moment being investigated. Financial Support: FINEP, CAPES, CNPq. future analysis of the in vitro growth properties of a mutantPrimers will will be be compared designed with to confirm wild type the virus. deletion Financial and Support: CAPES, CNPq, FAPESRGS, FINEP.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
259 Veterinary Virology: VV
VV411 - UNGULATE COPIPARVOVIRUS 1 (BOVINE is mainly associated to milk cattle and humans that have PARVOVIRUS 2): CHARACTERIZATION OF A NEW close contact with these animals. Even though these GENOTYPE AND ASSOCIATED VIREMIA IN DIFFERENT infections are well characterized, information about BOVINE AGE GROUPS virus transmission chain is lacking. Previous studies Cano, L.; Cibulski, S.P.; Fumako, T.T.; dos Santos, H.F.; have also shown evidences of VACV circulation in horses, de Sales, F.E.L.; Scheffer, C.M.; Varela, A.P.M.; de Lima, cats, dogs, pigs, monkeys and rodents. Taking into D.A.; Schmidt, C.; Silveira, F.; de Almeida, L.L.; Roehe, account that small rodents are often present in farms P.M. were outbreaks of disease have been detected and that they are the natural hosts for Cowpox virus (CPXV) and 1. UNIVERSIDADE FEDERAL DO RIO GRANDE probably for Monkeypox virus (MPXV), virus belonging to DO SUL the same genus as VACV, it has been proposed that they 2. INSTITUTO DE PESQUISAS VETERINÁRIAS could play an important role at its transmission chain. DESIDÉRIO FINAMOR These animals could be the link between the natural 3. FACULTAD DE MEDICINA, UNIVERSIDAD DE LA REPÚBLICA and human inhabited places since they are known to circulate among these habitats. To better understand A novel BPV2 genotype comprising 5,394 nt was the role played by these animals, an ELISA essay was developed for detection of antibodies IgG anti-OPV. The healthy cattle at different age groups farmed in the state test was used for determination of seroprevalence in ofidentified Rio Grande by next do Sul, generation Brazil. The sequencing genome fromorganization sera of of new BPV2 genotype retains the two ORFs typical of urban rodents (MBB), animals from an rural area members of the Parvovirinae with overall nucleotide surroundedsera collections by humanfrom spots occupation with tree (IHS) different and profiles:samples sequence identities less than 87% in comparison to from habitats fragmented between forest, meadow and other members of the subfamily. Phylogenetic analysis peridomicile (PRONEM). The essay was performed in revealed similar clustering with two previously NuncTM 96-well plates coated with inactivated particles described bovine BPV2 within the genus Copiparvovirus. of VAC-WR. Three negative controls were utilized per the distribution of BPV2 infection in cattle at different ageNo significantgroups. This differences is the second (p<0.05) full genome were sequence detected inof plate, serum from Balb/c mice infected with VACV- BPV2 reported to date and may contribute to a better negativeGP1 was controls used as and positive standard control deviation and A/G times protein three. as understanding of the biology of copiparvoviruses and its Samplesconjugate. were The considered cutoff was indeterminate defined by the when somatory their OD of interactions with the host. values were 10% higher or above cutoff. Besides that, VV412 - DETERMINATION OF ANTI-ORTHOPOXVIRUS blank controls (without test sera) were used as controls SEROPREVALENCE AMONG RODENTS OF DIFFERENT HABITATS OF MINAS GERAIS WITH A NEWLY positivity of 12%, 13,6% and 9% for IHS, PRONEM and for non-specific reactivity. Preliminary results show a DEVELOPED IGG ELISA ESSAY MBB, respectively, and the percentages of indeterminate were 6,8%, 11,2% and 20% for these same collections. Miranda, J.B.; Borges, I.A.; Luiz, A.P.M.F.; Marques, F.A.; These results evidence that the developed ELISA is Vieira, F.N.; Müller, U.B.; Ferreira, P.C.P.; Bonjardim, C.A.; Abrahão, J.S.; Kroon, E.G.; Howard, J.C.; Paglia, test is fast and requires small amounts of sample. A.P.; Eiras, A.E.; Trindade, G. de S. Furthermore,efficient, which circulation is an important of VACV advantage, (the OPV sinceknown this to 1. UNIVERSIDADE FEDERAL DE MINAS GERAIS circulate in Brazil) in small rodents is reinforced and the 2. UNIVERSITY OF COLOGNE presence of the virus in urban environments is detected. 3. INSTITUTO GULBENKIAN DE CIÊNCIA Financial Support: CAPES, CNPq, FAPEMIG, PRPq UFMG, In Brazil, since the years 2000, many outbreaks of an PPG-Microbiologia UFMG. exanthematic disease caused by Vaccinia virus (VACV) have been reported in rural environments. The disease
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
260 Veterinary Virology: VV
VV419 - MOLECULAR DETECTION AND VV426 - COMPARISON OF SEROLOGICAL TESTS FOR PHYLOGENETIC ANALYSIS OF THE N GENE OF CANINE DIAGNOSIS OF FELINE IMMUNODEFICIENCY AND DISTEMPER VIRUS IN DOGSFROM PORTO ALEGRE, FELINE LEUKAEMIA VIRUS RS Gonçalves, S.A.; Bueno, R.N.; Teixeira, B.M.; Praes, Teixeira, B.M.; Campos, F.S.; Firpo, R.M.; Finoketti, F.; E.C.; Heleno, N.V.R.; Naves, J.H.F.F.; Martins, C.P.S.; Silva, A.G.; Torres, F.D.; Franco, A.C.; Roehe, P.M. Kassar, T.C.; Resende, C.F.; Oliveira, F.G.; Leite, R.C.; Reis, J.K.P. INSTITUTO DAS CIÊNCIAS BÁSICAS DA SAÚDE DA UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL UNIVERSIDADE FEDERAL DE MINAS GERAIS Canine distemper virus (CDV) is a Morbillivirus that causes a multisystemic disease of dogs and other carnivores with leukemia virus (FeLV) are among the most prevalent respiratory, gastrointestinal, neurological and cutaneous viralFeline agents immunodeficiency in feline clinic. However, virus (FIV) the frequency and feline of involvement. The virus has a single stranded RNA these infections is not well known due to variability genome with about 15.9 kb, comprising six genes that of tests performances in addition to the fact that the code for eight viral proteins. The N gene has been used laboratory diagnosis is not mandatory. In order to detect as a molecular epidemiological marker for comparing FIV antibodies and FeLV antigen in sera of domestic different CDV strains. The aim of the present study was cats, two rapid immunoassay tests were used. The SNAP to compare segments of the N gene recovered from urine and blood collected from dogs in Porto Alegre, RS. gold standard and a non-commercial test named here In total, 41 urine samples and 19 whole blood samples asFIV/FeLV test A, that Combo® is in a validation test (IDEXX, process USA), for considered use in Brazil. as were collected from clinically suspected animals and submitted to RNA extraction, reverse transcription and N The SNAP detected 6.94% (5/72) of FIV and 16.66% gene. Fourteen urine samples and eight blood samples Although(12/72) of two FeLV tests while used in intest this A workthe results are based for FIV on andthe gavePCR amplification,rise to the expected targeting amplicon. a 335 Sixteenbp fragment of these of thewere sameFeLV weremethod 0 % (immunochromatography)(0/72) and 18.05% (13/72) they respectively. showed cloned and sequenced by the Sanger method. Nucleotide sequences were compared to those of vaccinal and wild type strains available at Genbank. Genomic comparisons golddifferences standart concerning Snap were the0% sensitivityand 100% respectively and specificity. for revealed that endemic CDV strains share 96.25–100% FIVThe andsensitivity 75% and and 93.3% specificity for FeLV. of testLaboratorial A compared diagnosis to the similarity; when compared to classical vaccine strains Onderstepoort and Lederle, similarity ranged between the possibility of false-negative or false-positive should 94.98-to 96.55%. However, phylogenetically, recovered beare considered essential to dueconfirm to variation the infection in accuracy by FIV and of currently FeLV but sequences clustered apart from vaccine strains. Fifteen available tests. Keywords: FIV, FeLV, Virus, Serological out of the sixteen sequences clustered along with Diagnosis. Financial Support: CAPES, CNPq, FAPEMIG, Uruguayan and North American strains, whereas the INCT Pecuária, Programa de Pós – Graduação em Ciência remainder sequence clustered with sequences of viruses Animal da Escola de Veterinária da UFMG. of Chinese and Taiwanese origin. In conclusion, we found that at least two different pathogenic CDV strains VV429 - FIRST DETECTION OF BETACORONAVIRUS are currently circulating in domestic dog population LINEAGE “A” IN WILD RODENTS FROM AN ATLANTIC from Porto Alegre, and those are similar to worldwide FOREST REMNANT IN BRAZIL circulating strains. Keywords: CDV, nucleocapsid gene, Góes, L.G.B.; Campos, A.C.A.; Góes, M.B.; Gomes, F.R.; phylogenetic analysis. Financial Support: FINEP. Neto, A.P.C.; Durigon, E.L. 1. UNIVERSIDADE DE SÃO PAULO 2. UNIVERSIDADE ESTADUAL PAULISTA Rodents are recognized as a major zoonotic source of human infectious diseases, hosting parasites, bacteria’s
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
261 Veterinary Virology: VV and virus pathogens including Arena- and Hantaviruses. VV434 - NO EVIDENCE OF INFLUENZA A-LIKE VIRUS Despite the great rodent species richness, representing IN BATS FROM BRAZILIAN’S AMAZON AND ATLANTIC 40% of all mammalian species, and the diversity of FOREST BIOMES coronavirus (CoV) in mammals, until recently only Campos, A.C.A.; Góes, L.G.B.; Ceara, C.C.; Ambar, G.; one coronavirus genotype was described in this order. Souza, M.C.P.; Crispin, L.A.C.; Oliveira, D.B.L.; Queiroz, CoV are enveloped, positive single stranded RNA virus L.H.; Neto, A.P.C.; Durigon, E.L. usually associated with respiratory, enteric, hepatic and neurological diseases of varying severity in animals 1. DEPARTAMENTO DE MICROBIOLOGIA, INSTITUTO DE CIÊNCIAS BIOMÉDICAS (ICB), UNIVERSIDADE DE SÃÃO PAULO Alphacoronavirus Betacoronavirus (USP), SÃO PAULO, SP, BRAZIL areincluding found humans.exclusively Classified in mammals, into four and distinct Gamma genera: - and (α-CoV) and (β-CoV) 2. FACULDADE DE MEDICINA VETERINÁRIA Deltacoronavirus are detected mainly in avian species. DE ARAÇATUBA, UNIVERSIDADE ESTADUAL The genus β-CoV is composed by four different virus PAULISTA (UNESP), ARAÇATUBA, SÃO clades, β-CoV A-D. Bat species harbor the great diversity PAULO, SP, BRAZIL β-CoV, and are considerate the reservoirs 3. DEPARTAMENTO DE ZOOLOGIA, INSTITUTO of CoV ancestors of this two genera. However beside DE BIOCIÊNCIAS (IB), UNIVERSIDADE theof α-CoV genetic and diversity of CoV in bats, no Betacoronavirus ESTADUAL PAULISTA (UNESP), RIO CLARO, β-CoV A), composed by murine, bovine and SP, BRAZIL 4. UNIVERSIDADE DE SANTO AMARO (UNISA), bats,lineage and “A” the ( origin of this lineage is yet not completely SÃO PAULO, SP, BRAZIL human coronavirus OC43 and HKU1, were identified in understood. New β-CoV “A” genotypes were recently The vast majority of emerging infectious diseases (EID) present wild zoonotic origin and are consequence of Betacoronavirus 1 species. In this work we analyzed of pathogen cross-species transmission. Bats are identified in China rodents, suggesting the murine origin the circulation of CoV in wild rodents from Atlantic Forest recognized as one of the most important reservoir of EID renmant, Brazil. Rodents were captured with Sherman viruses like Rabies virus, Ebola, Nipah virus, Coronavirus and pitfalls traps in the Morro Grande Reserve, Cotia-SP. Oral swabs were screened by Pancoronavirus conserved A virus where detected in bats from Guatemala and Peru, nested PCR assay. A total of 73 individuals were analyzed SARS and MERS. Recently, new members of the influenza including Akodon montensis (52), Euryoryzomys russatus (16), Oligoryzomys nigripes (3) and Thaptomys nigrita amplifying the host variety of Influenza virus A group. (2) species. CoV RNA was detected in one sample The new virus where classified as H17N10 and H18N11. obtained from A. montensis. The phylogenetic analysis The history of epidemic flu episodes including the “swine show the detection of a β-CoV A, presenting higher flu” emergence in 2009 demonstrate the potential of genetic similarity with Betacoronavirus1 species (89.5% spreadreassortant in to of human Influenza population. virus genotypes Brazil holds of distinct about hosts 15% of nt identity with HCoV-OC43 and Bovine coronavirus) ofwith the the species generation of bats of worldwide, new flu virus harboring capable speciesto infect from and than with others rodent coronavirus (nt identity of diverse ecological characteristics, anatomy and lifestyle 85.3% with Rat sialodacryadenitis CoV, 85% with MHV). indicating a high genetic potential of viruses. Despite the large number of bat species in Brazil, and the previously thisAs far species. as we knowCoronavirus this is thedetected first report represent of detection a possible of coronavirus from wild rodents of America and the first in new CoV genotype. Our results demonstrate the potential diversitydetection inof batsinfluenza from ABrazil in bats have from been Central conducted. and South The aimAmerica, of this as study far as is we analyze know theno studiesoccurrence about of Influenza know or reinforce the possible origin of Betacoronavirus 1 of new coronavirus identification in wild rodents and species from murine CoV ancestor. Financial Support: species and ecological areas of Brazil. We analyzed 268 bats,new Influenzaincluding virus 188 Aoral genotypes swabs sampled in bats from in bats different from Amazon Forest and 80 lung tissues from bats of Atlantic FAPESP 2013/11006-0; FAPESP 2008/57687-0; CNPq 130300/2012-8.October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
262 Veterinary Virology: VV
Forest biome. Samples were screened by PCR assay targeting the PB1 gene using primers developed by CII – Columbia University (New York-NY). The Total Nucleic Acid (TNA) was extracted by automatic method and cDNA synthesis was performed with High Capacity kit. Twelve samples present a suspicious PCR fragment after sequenced by Sanger method in 3130xl equipment. No electrophoresis analysis. The samples were purified and inInfluenza bats in Brazil virus and sequence our preliminary was detected results in batindicate samples the screened. This is the first report of influenza surveillance analyzed. Nonetheless samples previously analyzed and fromabsence different of circulation bat species of influenza and habitats virus will in batsbe screened species using a distinct PCR assays, also capable to detected the absence of this virus in Brazilian’s bats. Financial broad spectrum of Influenza genotypes, to confirm
Support: FAPESP: 2014/15090-8.
October 2015 Volume 20 – Supplement 1 - Abstracts/Posters - Veterinary Virology: VV INDEX XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
264 Index
A Almeida, T.N.V. 147, 155 Araujo Jr., J.P.A. 237 Abjaude, W. 9, 14, 33, 51 Al Rwahnih, M. 187 Araújo Junior, J.P. 145 Abjaude, W. da S. 9, 14, 33 Alvan, V.M. 140 Araújo, L.A. 110 Abraão L.M.L. 133, 142 Alves, A.S. 122 Araujo, L.M. 129 Abraão, L.M.L. 176 Alves, C.M. 103, 254 Araújo, L.M. 136, 183 Abrahao, J. 97 Alves, E.P.B. 137 Araújo, M.S.S. 181 Abrahão, J. 8, 14, 32 Alves-Freitas, D.M.T. 215 Araujo, M.W.L. 145 Abrahao, J.S. 7, 10, 14, 30, 36 Alves, G.B. 198 Araújo, P.A.S. 117, 118 Abrahão, J.S. 6, 10, 12, 13, 15, 18, 21, 40, Alves, J.C. dos S. 91 Araujo, S.C. 129 50, 51, 57, 68, 87, 89, 100, 123, 130, Alves, J.C.S. 97, 99, 122 Araújo, S.C. 136 146, 192, 222, 224, 227, 233, 259 Alves, L.F.G.S. 66 Araújo, V.E.M. 123 Abrão, L.M.L. 163 Alves, M.S. 198, 200 Ardisson-Araújo, D.M.P. 12, 17, 71, 213 Abreu, M.N. 111, 154 Alves, P.A. 49, 107, 233 Ardisson-Araújo, M.P.D. 203 Acosta, K. 205 Alves, R.S. 256 Argenta, D.F. 109, 115 Acosta, P.O.A. 139, 151 Alves, S.D. 137 argnelutti, J.F. 234 Acrani, G.O. 9, 14, 34 Alves, T.M.A. 76 Arns, C.W. 79 Affonso, V.R. 140 Amaral, C.D. 49, 89, 107, 222 Arns,C.W. 248 Afonso, A.M.S. 129 Amaral, J.G. 198 Arruda, E. 9, 10, 12, 14, 17, 35, 38, 69, 72, Aguiar, D.M. 228 Ambar, G. 7, 13, 29, 261 73, 76, 172 Aguiar, R.S. 9, 12, 14, 17, 35, 172 Ambrósio, L.L.D. 107 Arruda E.P. 253 Aguiar, R.W.S. 198 Amendola-Pires, M.M. 132 Arrúda, F.S. 117, 118 Aguirre, A. 195 Amui, G.C. 208 Arruda, G.L. 196 Akinaga, M.M. 59, 65 Andrade, A.A.S. 64 Arruda, L.B. 55 Albarnaz, J.D. 51, 57 Andrade, A.C.P. 57 Ashimine, R. 184 Albina, E. 78, 249 Andrade, A.C.S.P. 50, 68 Assis, A.S.F. 85 Albino, S.M. 77, 88, 89, 104 Andrade, B.Y.G. 70 Assis, F.L. 7, 8, 14, 30, 32, 51, 57, 100, 173 Albrecht, R.A. 10, 14, 39 Andrade,E.H.P. 123 Assis, M.T.A. 75 Albuquerque, N.R.M. 8, 14, 32, 104, 105 Andrade, I.P.C.B.G. 80 Assunção, I.P. 213 Alcaide, C. 7, 13, 24 Andrade, K.R. 7, 30, 51 Assunção-Miranda, I. 9, 14, 36, 80, 81 Alcântara, B.K. 7, 13, 27, 245 Andrade, M. de S. 12, 19 Astray, R.M. 181, 182, 185 Aleixo, A.A. 108 Andrade, M.S. 195, 213 Azevedo, E.O. 246 Alencar A. 253 Andrade, S. 196 Azevedo, E.P. 150 Alexandre-Moreira, M.S. 79, 80 Andrade, S.T.Q. 135 Azevedo, K.M.L. 138, 147 Alfenas-Zerbini, P. 206, 207 Andriguetti, N.B. 96, 98, 100, 101, 103 Azevedo, R.S.S. 172 Alfieri, A.A. 7, 13, 15, 27, 28, 229, 231, Angerami, R.N. 6, 13, 21 Azevedo, S.M.M.M. 130 235, 236, 245, 247, 248, 251 Anselmo-Lima, W.T. 10, 14, 38 B Alfieri, A.F. 7, 13, 15, 27, 28, 229, 231, Antonelli, L.R.V. 181 Bach, S. 257 235, 236, 242, 245, 247, 248 Antunes, D. 67 Badial, R.M. 140 Allegretti, L. 220 Anziliero, D. 7, 13, 14, 26, 235, 244 Badotti, F. 192 Almeida, A.J. 120, 128, 132 Aquino, V.H. 9, 14, 35 Badr, K.R. 69 Almeida, C.P.S. 145, 149 Aranda, M.A. 7, 13, 24 Baggio, M.P.D. 71 Almeida, D.S. 145, 149 Aranha, D.C.P. 84, 94, 95, 102 Baimukanova, G. 10, 14, 38 Almeida, F.Q. 221 Aranha,J.P. 110 Bajrai, L. 7, 30 Almeida, G.M. 51, 57 Arantes, A.M. 111, 154, 161 Baker, R.B. 7, 13, 28, 249 Almeida G.M.F. 130 Arantes, T.S. 6, 8, 13, 14, 21, 32, 100 Balaro, M.F.A. 255 Almeida, L.L. 197, 223, 225, 226, 227, 228, Araujo, D. 80, 81 Balbo, L.C. 242 229, 238 Araújo, E.C. 168 Bandeira, R. da S. 91 Almeida, L.R. 15, 224, 229 Araújo, E.D. 158, 163 Bandeira, R.S. 137, 144, 168 Almeida, L.T. 47, 49 Araújo, G.C. 169 Báo, S.N. 10, 12, 15, 17, 44, 153 Almeida, M.M.S. 211 Araújo, I.L. 257 Barardi, C.R.M. 8, 14, 31, 90, 94, 99 Almeida, N.K.O. 147 Araujo, J. 220, 228 Baraúna, R.A. 137 Almeida, R.R.P. 148 Araujo jr., J.P. 252 Barbagelata, L.S. 10, 15, 42, 141, 143, 162, Almeida, R.S. 78, 249 Araujo Jr., J.P. 232 167, 172 Almeida, S.E.M. 96, 98, 100, 101, 103 Araújo Jr., J.P. 12, 19 Barbeito, C.G. 218
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
265 Index
Barbosa, A.N. 124, 148 Bianchi E. 98 Bueno, B.L. 52 Barbosa, A.V. 188 Bio, L.V. 10, 14, 38, 75 Bueno, L.L. 10, 12, 15, 18, 43 Barbosa, C.M. 228 Biselli-Périco, J.M. 7, 13, 22 Bueno, R.N. 260 Barbosa, E.C. 76 Bispo, N.J. 130 Bydlowski, S.P. 141, 142 Barbosa, F.H. 124, 148 Bittar, C. 9, 14, 35, 66 C Barbosa, J.A.R.G. 212 Bittar, C.O. 53 Cabello, P.H. 10, 15, 42, 133 Barbosa, J.D. 10, 15, 40, 57, 218, 243 Blackburn, K. 57 Cabezas, S.C. 140 Barbosa, K.M.V. 151 Blawid, R. 70, 72, 188, 191 Cabral, M.C. 93 Barbosa, L.R. 198 Boas, L.S.V. 113 Caceres, S. 195 Barbosa, M.R.F. 95 Boccardo, E. 9, 14, 33 Cadar, D. 170 Barbosa, N.S. 69 Boff, L. 54, 55 Caetano, B.C. 122, 134 Barbosa, S.F.C. 149 Bolpetti, A. 118 Caetano, C.C.S. 47, 49 Barbosa-Stancioli, E.F. 12, 18 Bomjardin, H.A. 243 Caetano, K.A.A. 110 Barbosa, T.F. 56, 127, 129 Bonafé, C.F.S. 79 Caffarena, E.R. 67 Barboza, A.P.M. 12, 18 Bonanno, V.M. 95 Caiado, B.V.R. 114 Barnabé, A.C.S. 248 Bonfim, C.M. 117 Caires, A.J. 12, 18 Barreto, D.M. 111, 158 Bonfim, M.C.M.S. 103 Calaça, M.M. 188 Barreto, E.S. 237 Bonjardim, C.A. 10, 12, 15, 18, 40, 75, 87, Calegario, R.F. 195 Barros, A.M.R. 190 146, 150, 227, 233, 259 Calixto, R.S. 50, 57, 68, 159, 160 Barros, A.P.O. 206, 207 Bonjardin, C.A. 159, 160 Calmon, M.F. 117, 140 Barros, B.C.V. 103, 240, 254 Bonon, S.H.A. 110, 113, 114, 121 Calzavara-Silva, C.E. 7, 10, 13, 15, 22, 44, Barros, D.R. de 200 Bonvicino, C.R. 53 76 Barros, G.S. 158, 163 Bon, V.R. 245, 248 Cambraia, R.D. 180 Barros, I.C. 155, 159 Borato, P.V.M. 7, 30 Camini, F.C. 47, 49 Barros, J.A. 139, 151 Boratto, P.V.M. 6, 10, 13, 14, 21, 36, 51, Campanha, J.E.T. 15, 229 Barroso, W.S. 137 100 Campi-Azevedo, A.C. 181 Bartholomeu, D.C. 12, 18 Borges, A.A. 79, 80, 125, 136, 175 Campos, A.C. 246 Bassani, V.L. 109, 115 Borges, F.P.S. 111, 154, 155, 161 Campos, A.C.A. 7, 13, 29, 260, 261 Basso, M.F. 203 Borges, I.A. 49, 89, 107, 222, 227, 259 Campos, F.S. 8, 14, 32, 58, 78, 91, 104, Batista, I.C.A. 7, 10, 13, 15, 22, 44 Borges, L.G.A. 10, 14, 39 105, 249, 252, 257, 258, 260 Batista, J.S. 234 Born, P.S. 122 Campos, G.R.F. 9, 14, 35, 53, 66 Batista, M.A. 181 Bortolin, T.A. 8, 14, 31 Campos, M.A. 214 Batista, M.N. 9, 14, 35, 59, 60, 65 Bosco Jr, J. 174 Campos, R. 57 Batista, M.V.A. 111, 158, 163, 164, 245, Botelho, S.R.A. 188 Campos, R.M. 93, 170 246 Bottino, F.O. 244 Canal, C.W. 7, 10, 13, 15, 27, 41 Bedran, R.L. 234 Bové, J.M. 197 Candeias, J.M.G. 118 Belagero, V.M.S. 113, 114 Braga, A.C.S.; 59, 60, 65 Cândida, D.V. 189 Belchior, D.C.V. 208 Branco, F.R.P. 141 Cañedo, A.D. 60 Bellardini, J.F.T. 76 Brandão, C.E.M. 132 Canidiani, T.M. 130 Bello, A.G.D. 251 Brandão, G.C. 65 Cano, L. 249, 259 Benamar, S. 7, 30 Brandi, A. 252 Cantão, M.E. 241, 246 Benega, M.A. 129 Brant, P.M. 191 Cardillo, S. 10, 15, 39 Benites, C.I. 184 Brasil-Costa, I. 155, 159, 171 Cardillo, S.B. 219 Benjamim, C.F. 9, 14, 36 Brasil-Neto, I.P. 80 Cardoso, D.D.P. 69, 111, 147, 154, 155, Bergmann, M.Ribeiro 7, 13, 24 Bravi, M.E. 218 156, 157, 161, 166 Berna, E.C. 140 Brito, D.C.N. 151 Cardoso, J.F. 160 Bernardino, T.C. 181, 185 Brito, T.C. 233 Cardoso,L.M. 180 Berois, M. 8, 14, 30, 84 Brito, W.M.E.D. 257 Cardoso, R.S. 10, 14, 38, 72 Bertran, A.G.M. 209 Bronzoni, A.M.R.V. de M. 145 Cardozo, F.T.G.S. 10, 14, 38, 75, 113 Beuttemmüller, E.A. 236 Bronzoni, R.V.M. 169, 237 Cardozo, V.J.R. 172 Bexiga, N.M. 184 Brown, D. 57, 122 Carenzi, L.R. 10, 14, 38 Bezerra, B.M. 188 Brown, D.T. 82 Cargnelutti, J.F. 7, 13, 14, 26, 244 Bezerra, D.A.M. 131, 137 Brunelli, K.R. 193 Carneiro B.M. 65 Bezerra, H.D. 130 Budaszewski, R.F. 7, 13, 27 Carneiro, B.M. 59, 60, 135
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
266 Index
Carneiro, B.S. 84–105, 102–105 Coelho, L.F.L. 48, 107, 108, 165 Cristina, J. 8, 14, 30, 84 Carneiro, M.A.S. 110 Coelho. L.F.L. 108 Cruz, A.V. 233 Carneiro, R.S. 156 Coimbra, L. 128 Cruz, H.M. 116 Carranza, C. 220 Coimbra, R.S. 130 Cruz, L.E.A.A. 169 Carraro, E. 167 Colariccio, A. 67 Cruz, N.V.G. 164 Carrasco, CH.M. 140 Colina, R. 8, 14, 30, 84 Cruz-Oliveira, C. 81 Carréra, K.A.F. 130 Colombo, T.E. 12, 19, 169 Cruz, T.F. 232 Carvalho, A.N. 72 Colombo, T.L. 145 Cunha, C.C.C. 122 Carvalho, C.A.M. 9, 14, 33, 81 Colson, P. 7, 30, 100 Cunha, M.P. 147, 156 Carvalho, C.M. 200, 212 Comerlato, J. 78, 249 Cunha, M.S. 6, 13, 21 Carvalho, C.P.T. 237 Conteville, L.C. 119 Curti, S.P. 56, 127, 129 Carvalho, J.V. 9, 14, 17, 32 Contreras, P.E. 140 Cury, A.A.F. 145 Carvalho, L.D. 52, 115, 130 Corado, A. de .L.G. 177 D Carvalho, L.R. 135 Corado, A. de L.G. 177 Dabilla, N.A.S. 154, 155, 161 Carvalho, V.L. 160 Corado, A.L.G. 81 Dabrowski, P.W. 55 Casagrande, L. 169 Cordeiro, J.A. 135 da Cruz, R.A.S. 223 Caserta, L.C. 248 Cornelli, R. 92 da Cunha, J. 141 Casseb, A.R. 233 Coroadinha, A.S. 185 da Fonseca, F.G. 10, 12, 15, 18, 43, 51, 162 Castro, C.P.M. 47 Corrêa, A.A. 88 Dall Agnol, A.M. 236 Castro, I.A. 157, 166 Corrêa, M.O. 95, 102 Dallemole, D.R. 224 Castro, R.S. 256 Corrêa-Oliveira, R. 10, 15, 44 Damaso, C. 54, 68, 164 Castro, T.X. 239, 244 Corrêa, R.A. 250, 258 Damaso, C.R. 55 Catenacci, L.S. 118 Correa, T.S. 154, 155, 161 Damon, I.K. 55 Cavalcante, M.S. 148 Cortines, J.R. 12, 18, 87, 150 D`Andrea, P.S. 53 Cavalcante, M.S.B. 129, 136, 183 Cortinhas, J.C.M. 122 D’Andrea, P.S. 174 Cavalcanti, A.M.S. 152, 153 Costa, A.G. 10, 15, 41, 238 Dangelo, L.C.D. 10, 15, 44 Cayulla, Q.D. 140 Costa, A.O. 87 Daniel, M.P.Ardisson-Araújo 7, 13, 24 Ceara, C.C. 7, 13, 29, 261 Costa; A.O. 12, 18 Dantas, A.F.M. 234 Cecilio, S.G. 48 Costa, A.R.F. 149 Daròs, J.A. 189 Cerva, C. 197, 225, 226, 227, 228, 229, 230 Costa, C.A. 145, 149 da Silva, E.M. 9, 14, 32 Chagas, A.A.C. 151 Costa, C.C.S. 125 da Silva, E.Z. 172 Chagas, L.L. 117, 118, 254 Costa, C.S. 58 da Silva, E.Z.M. 12, 17 Chaverri, P. 192 Costa, E.A. 10, 15, 41, 226, 242, 255 Da Silva França, D.D. 110 Chaves, A.L.R. 193 Costa, E.M. 239, 244 da Silva, G.A.V. 177 Chaves, B.A. 7, 13, 22 Costa, F.R. 169 da Silva, G.C.D. 162 Chaves, V.C. 152 Costa, G.B. 7, 10, 13, 14, 23, 36, 89, 146, da Silva-Januário, M.E. 12, 17, 172 Cherpinski, H.F.M. 240 173, 222, 224, 227 da Silva, J.L. 170 Chiang, J.O. 117, 118, 254 Costa, J.D.D. 64 da Silva Junior, H.C. 180 Chiaravalloti-Neto, F. 131 Costa, L.C. 214 da Silva, L.L. 172 Chiavanotti-Neto, F. 145 Costa, L.C.P.N. 135, 149 Dasilva, L.L. 9, 14, 32 Ciacci-Zanella, J.R. 241, 246 Costa, L.D.C. 157, 166 da Silva, L.L.P. 12, 17 Cibulski, S.P. 182, 183, 197, 223, 225, 226, Costa, N. 195 Da Silva, L.L.P. 69 229, 230, 238, 243, 250, 251, 259 Costa, P.S.S. 157, 166 Da Silva, L.N. 110 Cibuski, S.P. 227, 228 Costa, S.C.B. 110, 113, 114, 121 da Silva Monteiro, D.C. 81 Cid de la Paz, V. 218 Costa, U.M. 256 da Silva, M.S. 10, 15, 41 Cilli, E.M. 60 Costenaro, J.G. 58 da Silva, S.P. 160 Cintra, A.C.O. 9, 14, 35 Cota, B.B. 76 D’Athaide, E.S. 148 Clemente, W.T. 6, 13, 21 Couto-Fernandez, J.C. 7, 13, 22, 62 David-Neto, E. 112 Clem, R. 12, 17 Crespo, S.E.I. 245 Dawson, W.O. 197 Coêlho, D.F. 114 Creste, S. 194 d´Azevedo, P.A. 251 Coelho-Dos-Reis, J.G. 181 Criado, M. 69 de Albuquerque, J.P. 93 Coelho dos Reis, J.G.A 180 Criado, M.F. 10, 14, 38 de Almeida, L.L. 259 Coelho, G.R. 56 Crispim, A.P.C. 7, 13, 23 de Araujo, G.C. 12, 19 Coelho, J.L. 145 Crispin, L.A.C. 7, 13, 29, 261 de Azevedo, M.L.B. 180
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
267 Index de Barcellos, D.E.S.N. 223 Dornas, F.P. 7, 10, 12, 14, 18, 30, 36, 51, Fernandes-Silva, C.C. 56 de Camargo, L.M.A.Q. 79 87, 97 Fernando, L.Melo; 7, 13, 24 de Carvalho, J.V. 12, 17, 172 dos Anjos, K. 74 Feronato, C. 235 De Castro, R.D. 238 dos Santos, H.F. 182, 225, 226, 252, 259 Ferrari, C. 113 de Castro, R.O. 12, 17, 172 dos Santos, I.N.P. 12, 19 Ferrari, S.F. 125 de Costa, F. 182 Dos Santos, M.N. 219 Ferraz, A.C. 48, 61 de Filippis, A.M. 119 Driemeier, D. 10, 15, 41, 223, 242 Ferraz, S.M. 256 de Filippis, A.M.B. 10, 15, 42, 133 Drummond, B.P. 237 Ferreira, A.C. 131 de Leite, C.F. 70 Drumond, B.P. 49, 85, 89, 107, 108 Ferreira, A.J.P. 220 D’Elia, M.L. 15, 229 Drumond, P.R.B.P. 145 Ferreira, C.S. 70 de Lima, D.A. 259 Duarte, C.R.A. 256 Ferreira, D. 57 Dellariva, T.C. 110, 121 Duarte, L.P. 123 Ferreira, D.F. 93, 170 Del-Rios, N.H.A. 110 Duarte, M.F. 188 Ferreira, D.H.P. 231 de Meneses, M.D.F. 170 Durigon, E.L. 7, 13, 29, 220, 228, 260, 261 Ferreira, D.L. 141, 144 Demoliner M. 98 E Ferreira, F. 183 Demoliner, M. 96, 219, 223 Eiras, A.E. 222, 227, 259 Ferreira, F.A. 211 Denani, C.B. 9, 14, 33 Eiras, M. 189, 193 Ferreira, G.P. 77, 165 Dentello Lustoza, M. 219 Eisen, A.K.A. 219 Ferreira, H.L. 248 de Oliveira, A.C.P. 174 eixeira, M.M. 145 Ferreira, J.A. 10, 15, 42, 122, 141, 143, de Oliveira, A.C.S. 174 Eizirik, E. 257 162, 167 de Oliveira, A.S. 211 Eléouët, J.F. 63 Ferreira, J.C. 224 De Oliveira, A.S. 7, 13, 25 Elgui de Oliveira, D. 63 Ferreira, J.G.G. 10, 15, 44 de Oliveira, C.H.S. 10, 15, 40 Elliott, R.M. 9, 14, 34 Ferreira, J.M.S. 48, 50, 61, 107, 108 De Oliveira, C.H.S. 218 Ellwanger, J.H. 224 Ferreira, L.S.C. 145, 149 de Oliveira, J.S. 146, 224, 227 Elmahdy, M.E.I. 99 Ferreira, L.S.S. 133, 142, 163, 176 De Oliveira, R.S. 110, 121 Elói-Santos, S.M. 181 Ferreira, M.S. 117, 118, 254 De Paula, V.S. 102, 116 Erhardt, M.M. 7, 13, 14, 26 Ferreira, N.C. 239 Derek, A. 91 Erhardt, U. 224 Ferreira, P.C.P. 7, 10, 13, 15, 23, 40, 57, de Sales, F.E.L. 259 Espinoza, A.M. 10, 15, 39 146, 150, 224, 227, 233, 259 De Santis, B. 10, 15, 42, 133 Espírito-Santo, M.P. 120, 221 Ferreira,P.C.P. 123 de Souza, A.R. 79 Esteves, P.A. 256 Ferreira, P.G. 61 de Souza, C.V. 81 eto, P.S. 135 Ferreira, P.P. 159, 160 de Souza, F.P. 12, 19 F Ferreira, S. 118 de Souza Luna, L.K. 73, 76 Fabres, R.B. 96, 100, 101 Ferro, C.G. 201 De Souza, M.R. 238 Fachini, R.M. 135 Ferro, M.M. 213 de Souza, V.C. 177 Faheem, M. 212 Fett-Neto, A. 182 Deus, D.R. 84, 91, 97, 99 Fajardo, T.V.M. 187, 200 Fiaccadori, F.S. 111, 147, 154, 155, 156, Dhalia, R. 114 Fares R.C.G. 130 157, 161, 166 Dianese, E.C. 189 Faria, J.C. 212, 215 Fiallo-Olive, E. 198, 201, 202 Dias, A.S. 7, 13, 28, 226, 249 Faria. J.C. 189 Fiallo-Olivé, E. 202, 203 Dias, C.M.G. 174 Farias, L.M. 12, 18, 55, 87 Figueiredo, A.S. 128, 221 Dias, J.B.L. 88 Farias, S.L. 176 Figueiredo, C.A. 56, 127, 129 Dias, M.C. 117, 140 Farignoli, M. 89 Figueiredo, C.M. 9, 14, 36, 80 Diel, D.G. 244 Favero, L.M. 7, 13, 27, 235 Figueiredo, H.C.P. 242, 255 Dimache, L.A.G. 221 Fecury, P.C.M.S. 131, 240, 254 Figueiredo, J.E. 61 Diniz, J.A. 7, 13, 27, 231, 247 Feitosa, R.C.S. 136 Figueiredo, L.B. 150, 159, 160 Diniz; J.A. 15, 229 Felippe, L.G. 58 Figueiredo,L.B. 123 Diniz, J.A.P. 129, 136, 183 Feltrin, C. 109, 152 Figueiredo, L.T.M. 73, 76, 89, 136, 222 Diniz Junior, J.A.P. 239 Fernandes, C.D. 210 Figueiredo, P.O. 222, 233 Domingues, G. 197, 226, 227, 228, 229 Fernandes, D.D.C. 117, 118 Figueirêdo, R.P. 245, 246 Domingues, R.A.S. 71 Fernandes, F.R. 188 Filho, M.M. 187 Dominot, A.F.A. 8, 14, 31, 90 Fernandes, G.C. 108 Filizzola, E.M.A. 167 Domitrovic, T. 66 Fernandes, J. 53, 174 Finkler, F. 197, 225, 226, 227, 228, 229, do Nascimento, V.A. 81, 177 Fernandes, J.E.A. 12, 19, 195 230
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
268 Index
Finoketti, F. 105, 251, 252, 258, 260 Galinari, G.C.F. 10, 15, 41 238, 242, 255 Firpo, R.M. 258, 260 Gallego, J.C. 251 Guerra, S.F.S. 131, 137, 170 Fleck, J.D. 89, 199 Galler, R. 180 Guerreiro, A.T. 80 Flores, E.F. 7, 10, 13, 14, 15, 26, 41, 234, Galosi, C.G. 218 Guerreiro, S.R. 254 235 Garcês, T.C.C.S. 77 Guimarães, L.L.B. 242 Flores, E.G. 244 Garcia, A.M.O. 130 Guimarães, M.B. 220 Flores, G.L. 132 Garcia, M. 84 Guimarães, R.A. 110 Fongaro, G. 99 Garcia, M.M.V. 198 Guimarães, V.N. 147 Fonseca, F.G. 10, 15, 18, 43, 51, 70 Garcia, R.C.N.C. 244 Guinzburg, M. 10, 15, 39, 219 Fonseca L.P.S. 133, 176 García-Sastre, A. 10, 14, 39 Guissoni, A.C.P. 69 Fonseca, L.P.S. 142, 163 Garcia, S.C. 95 Gularte J.S. 98 Fonseca, L.X. 174 García-Villalba, J.M. 7, 13, 24 Gularte, J.S. 85, 86, 87, 96, 100, 101, 103 Fonseca, P.L.C. 192 Garza, D.R. 84, 102 Gurgel, R.Q. 158, 163 Fontenele, R.S. 214 Gasparino, E.C. 194 Gurjão, T.C.M. 102 Forell, F. 256 Gauger, P.C. 7, 13, 28, 249 Gusmão, R.H.P. 168 Fortunato, E.C. 184 Gava, D. 241, 246 Guterres, A. 53, 174 Fracalanzza, S.E.L. 93 Gavioli, A.F.G.C. 61 H Fraiha, A.L.S. 238 Geddes, V.E.V. 9, 14, 35 Haach, V. 241, 246 França, B.L.C. 233 Giarola-Silva, S. 181 Hachich, E.M. 95 França, J.P. 52 Giehl, I.C. 77, 88, 89, 104, 199 Hahn, R.C. 8, 14, 31, 92 França, L.P. 52 Gilbertson, R.L. 211 Hallwas, M. 187 Francini, M. 7, 13, 22 Gimeno, E.J. 218 Hansman, S.G. 74 Francisco, F.L.M. 76 Giongo, A. 91, 257 Harakava, R. 67, 189, 193 Francisco, R.B.L. 7, 13, 22 Giordano, M.C.D. 170 Harper, S. 197 Franco, A.C. 8, 14, 32, 58, 78, 91, 104, Girardi, V. 8, 14, 31, 92, 98 Hasselmann, B. 128 105, 197, 223, 226, 229, 238, 249, Girardi,V. 96 Haziot, M.E.J. 174 250, 252, 257, 258, 260 Gobatto, D. 67, 189 Headley, S.A. 236 Franco,G.M. 52 Godinho, M.T. 7, 13, 26, 204, 205, 206 Heck, T.M.S. 86, 87, 92, 96, 98, 100, 101, Franco-Luiz A.P.M. 130 Godoi, T.L.O.S. 221 103 Franco, O.L. 120 Góes, L.G.B. 7, 13, 29, 260, 261 Heldt, F.H. 85, 86, 87, 96, 98, 100, 101, Frandoloso, R. 244 Góes, M.B. 260 103 Freitas, D.O. 159 Goés-Neto, A. 192 Heleno, N.V.R. 260 Freitas, F.B. 134, 159 Goes, T. 79, 80 Henning, J.S.L. 125 Freitas, L.A. 242, 247 Gois, R.C.S. 234 Henzel, A. 85, 86, 87, 92, 101, 219, 223 Freitas, M.N.O. 117, 118 Golin, R.O. 60 Hermosilla, J.J. 140 Freitas, N.F.Q.R. 243 Gomes, A.M. 81 Hernandez, J.M. 119, 127 Freitas, P.E.B. 151 Gomes, A.M.O. 9, 14, 33, 52 Hernandez, R. 82 Freitas, P.S.L. 239 Gomes, A.V.B.T. 48, 107, 108 Hohn, A.R. 9, 14, 33 Freitas, R.C. 159 Gomes, E.R. 167 Howard, J.C. 259 Fritzen, J.T.T. 235 Gomes, F.R. 260 Huang, N. 12, 17 Fuentealba, N.A. 218 Gomez, M.M. 84 Hurtado, R. 220 Fujiwara, R.T. 10, 12, 15, 18, 43 Gómez, M.M. 8, 14, 30 I Fumako, T.T. 259 Gómez, P. 7, 13, 24 ilva, L.P. 154 Fumian, T.M. 85, 244 Gonçalves, M.C. 194 Inoue-Nagata, A.K. 7, 13, 25, 187, 191, Furlan, M. 58 Gonçalves, M.S. 167 192, 199, 211 G Gonçalves, R.B. 9, 14, 33 Ishikawa, E.A. 149 Gabbay, Y.B. 84, 91, 95, 97, 99, 102, 119, Gonçalves, S.A. 256, 260 Ishikawa, E.A.Y. 125 127, 135, 144, 149, 156, 157, 166, Goshe, M. 57 J 168, 171 Gosmann, G. 182, 183 Jamur, M.C. 12, 17, 172 Gadelha, A.N. 52 Goulart, N. 8, 14, 31, 92 Jardim, A.C.G. 9, 14, 35, 53, 58, 66 Gadelha, S.R. 52, 115, 130 Granja, F. 139, 151, 177 Jesus, A.C. 70 Gagliardi, T.B. 10, 14, 38, 73 Grinsztejn, B. 62 Jesus, B.L.S. 10, 14, 38, 72 Gagliardi. T.B. 76 Grotto, R.M.T. 124, 126, 135, 148 Jesus, I.S. 233 Galdo Novo, S. 10, 15, 39 Guedes, M.I.M.C. 10, 15, 41, 226, 233, Jesus L.F. 98 Jesus, L.F. 92, 96, 100, 101 October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
269 Index
Jesus, M.G. 120 Lau, D. 188, 198, 208 Lino, V. de S. 9, 14, 33 Joel da Cunha, J. 142 Leal, C.A.G. 242, 255 Lins, R.D. 114 Johnson, J.E. 66 Leal, E.S. 152, 153 Lira, E.L. 125, 136 Jorge, S.A.C. 181, 182, 185 Leal, F.S. 184 Li, Y. 55 José, L.C.Wolff 7, 13, 24 Leal, V.N.C. 130 Lizasoain, A. 8, 8–15, 14, 14–15, 30, Joshi, L.R. 244 Leão, R. 177 30–45, 84, 84–105 Juárez, M 7, 13, 24 Leite, A.B. 79 Lobato, Z.I.P. 10, 15, 41, 226, 238, 242, Juliano, R. 237 Leite, C.M.A. 50 255 Júnior, E.C. 10, 15, 42, 122 Leite, F.P.L. 257 Lobo, P.S. 170, 240 Junior, E.C.S. 127, 143 Leite, J.P.G. 8, 14, 30, 84, 244 Loiko, M. 230 Júnior, E.C.S. 149, 157 Leite, J.P.V. 55 Loiko, M.R. 230, 243 Junior, E.S.C. 91 Leite, R.A. 155 Loiola, D.S. 10, 15, 44 Júnior, J.F. 130 Leite, R.B. 125 Lopes, B.L. 115 Junior, J.F.J. 169 Leite, R.C. 218, 243, 256, 260 Lopes, C.A. 206 Junior, J.P.A. 169 Leme, R.A. 7, 13, 27, 28, 245, 248 Lopes, I.G. 148 Junior, L.B.D. 142, 163, 176 Lemes, L.G.N.L. 161 Lopes, J.C.C. 12, 19, 145 Junior, W.A.S. 140 Lemos, E.R. 53, 174 Lorenzetti, E. 7, 13, 15, 27, 28, 229, 231, Justino, M. C. A. 170 Lemos, E.R.S. 221 242, 245, 247, 248 Justino, M.C.A. 131, 156, 157, 166 Lemos, M.A.N. 181 Loureiro, E.C.B. 102, 171 K Lemos, P. 208 Lucas, C.O. 55 Kahwage, C.B. 155, 159 Lemos, P.S. 74 Lucena, M.S.S. 119, 127, 156, 166, 168 Kanai, Y.K. 103, 240, 254 Leonardo, R. 174 Luiz, A.P.M.F. 10, 15, 40, 259 Kassar, T.C. 218, 256, 260 Leon, L.L. 110, 114, 121 Luna, L.K. de S. 253 Katz, G. 6, 13, 21 Leuthold, M. 74 Lutaif, A.C.C.B. 113 Khalil, J.B. 97 Lewis-Ximenez, L.L. 120, 128, 132 Luz, I.S. 139 Kitajima, E.W. 193, 195, 196 Leyva, R.M. 205 Luz, R.B. 96, 98, 100, 101 Kitajima, J.P. 196 Lima, A.B.F. 168, 170 M Kitikoon, P. 7, 13, 28, 249 Lima, A.R.V. 79, 125, 175 Macedo, F.L.L. 6, 13, 21 Kluge, M. 91, 257 Lima, A.T.M. 7, 13, 26, 204 Macedo, M.A. 211 Knak, M.B. 58 Lima, C.P.S. 74, 160 Macedo, O. 159 Koester, L.S. 109, 115 Lima, C.S. 53 Macedo, R. 251 Komar, N. 237 Lima, D.A. 197, 225, 226, 227, 228, 229, Machado, A.M.V. 181, 226 Kormelink, R. 7, 13, 25 230, 243 Machado, D. 122 Kratz, J.M. 54, 55 Lima, D.S. 10, 15, 44, 153 Machado, R.R.G. 53 Kroon, E.G. 6, 7, 10, 12, 13, 14, 15, 18, 19, Lima, E.F.B. 215 Machado, R.S. 134 21, 23, 30, 36, 40, 44, 50, 51, 57, 68, Lima, F.E.S. 250, 251 Maeda, A.Y. 6, 13, 21 75, 76, 87, 89, 100, 123, 130, 146, Lima, G.S.A. 213 Magalhães, C.B.L. 48 150, 159, 160, 173, 222, 224, 227, Lima, H.C. 208 Magalhães, C.L.B. 47, 48, 49, 61, 75, 108 233, 259 Lima Jr, W.P. 151 Magalhães, F.P. 12, 18 Kruger, L. 220 Lima Junior, M.M. 139 Magalhães, J. 128 Kunz, A.F. 251 Lima Junior, W.P. 139 Magalhães, J.C. 47, 48, 49, 61, 108 Kupper, D.S. 117 Lima, K.O. 152, 153 Magalhães, L.L. 206 Kurissio, J.K. 118, 252 Lima, K.V.B. 125, 149 Magalhães, P.P. 87 L Lima, L.M.P. 120 Magalhães, T.F.F. 12, 18, 87 Lacerda, H.R. 152, 153 Lima, M. 191 Maganha S.R.L. 253 Lacorte, C. 7, 13, 25, 199 Lima, M.F. 215, 216 Magri, M.E. 99 Ladeira, L.O. 10, 12, 15, 18, 43, 70 Lima, M.R.Q. 10, 15, 42 Magrini, F.E. 8, 14, 31 Ladislau, L. 9, 14, 36 Lima, M.T. 50, 57, 68 Maia, F.G.M. 73, 76 Lage, A.P. 10, 15, 41 Lima, R.N. 12, 17, 212 Mair, C.E. 54 Lago Aladro, E. 10, 15, 39 Lima, S.T. 144, 234 Malaquias, L.C.C. 107, 108 Lamas, N.S. 214 Lima, T.S. 184 Maliano, M.R. 211 Lampe, E. 67, 116, 120, 128, 132, 221 Linhares, A.C. 131, 134, 135, 149, 156, Mallqui, M.H. 140 Landell, M.G.A. 194 159, 166, 170, 171 Malossi, C. 237 La Scola, B. 7, 12, 18, 30 Lino, V. 9, 14, 33, 51 Mamani, Z.E.W. 140
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
270 Index
Manfro I.D. 98 Medagila, M.L.G. 55 Miura, V.C. 135 Manfro, I.D. 96, 101 Medeiros, C.N.F. 194 Molinari, B.L.D. 7, 13, 27, 28, 245, 248 Manso, E.P. 125 Medeiros, D.B. de A. 160 Mondini, A. 131, 169 Maradei, E. 10, 15, 39 Medeiros, L.M.L. 79 Monteiro, A.H. 137 Marais, L.L.C.S. 102 Medeiros, M.A. 180 Monteiro, D.C. da S. 177 Maria, L.A. 234 Medeiros, R. 10, 15, 42, 141, 143, 162, Monteiro, F.L. 7, 13, 14, 26, 234 Marinho A.N.R. 103 167, 234 Monteiro, J.C. 99, 134, 171 Marinho, A.N.R. 240, 254 Medeiros, T.N.S. 231, 248 Monteiro, J.S.V. 125 Marinho, P.E.S. 7, 13, 23, 123 Meira, G.L.S. 93 Monteiro, T.A.F. 155, 171 Marinho,P.E.S. 123 Meireles, L.T. 155, 159 Montenegro, A. 9, 14, 33, 51 Marinho, R.S.S. 239 Melgaço, F.G. 139 Moraes, J.R.S. 254 Marin, L.J. 52, 115, 130 Mello, F.C.A. 221 Moraes, N.R. 15, 229, 248 Marín, M.A. 119 Mello, J.L. 251 Moraes, T.F.S. 48, 108 Marins, K. 159 Melloni, L.M. 194 Morais, B.M. 195 Marques, B.C.L. 7, 13, 22 Mello, W.A. 10, 15, 42, 133, 142, 143, 144, Morais, F.S. 167 Marques, F.A. 222, 224, 227, 259 162, 163, 167, 172, 176, 234 Morais, L.A. 145, 149 Marques, G.C. 247 MELLO, W.A. 141 Morais, L.L.C. de S. 91 Marques, J.P. 148 Melo, A.L.T. 228 Morais, L.L.C.S. 84, 94, 95, 97, 99, 102 Marques, V.A. 120 Melo, D.M. 79, 80, 175 Morais, S.M.S. 107, 108 Mar, T.B. 198, 203 Melo F.L. 210 Morale, G.M. 9, 14, 33 Mar,T.B. 208 Melo, F.L. 7, 12, 13, 17, 19, 25, 187, 188, Moreira, F.B. 175 Marti, E. 94 191, 195, 199, 210, 211, 212, 213 Moreira, I.N.S. 70 Martinez-Zubiaur, Y. 190 Melo, J.M. 155, 159 Moreira, M.S.A.M. 175 Martini, M.C. 79, 248 Melo, L.C. 215 Morel, A.P. 243 Martins, C.P.S. 260 Melo, M.N. 73 Morgado, da S.F. 203 Martins,C.P.S. 52 Mendes, G.S. 120 Morgado, M.G. 7, 13, 22, 62 Martins, E.C. 197 Mendes, I.R. 198, 203 Mormontoy, Q.C. 140 Martins Filho, O.A. 180 Mendes, J. 210 Mósena, A.C.S. 10, 15, 41 Martins-Filho, O.A. 181 Mendes, T.A.O. 12, 18 Mota, B.D.L. 134 Martins, F.S. 50, 68 Mendes, Y.G. 172 Mota, B.E.F. 57, 173 Martins Júnior, R.B. 10, 14, 38 Mendonça, A. 148 Motta, F.C. 122, 134 Martins, L.C. 117, 118, 160, 172, 254 Mendonça, L.A. 107, 108 Moura, A. 159 Martins, M. 7, 13, 14, 26, 235, 244 Mendonça, L.A. de 107 Moura, C.S.S. 75 Martins, M.A. 181 Mendonça, L.L.R. 69 Mourão, M.M. 181 Martins, M.B. 247 Mendonça, M.C.L. 119 Moura, T.P.C. 233 Martins, P.M. 192 Meneguete, P. 174 Mourglia-Ettlin, G. 182, 183 Martins, R.M.B. 110 Meneses, M. 57 Moussatché, N. 55 Mascarenhas, J.D.A.P. 240 Menezes, E.G. 180 Muglia, C.I. 218 Mascarenhas, J.D.P. 99, 102, 103, 119, 127, Menezes-Filho, S.M. 107 Müller-Coan, B.G. 63 131, 137, 156, 166, 168, 170, 171, Menoni, S.M.F. 113, 114 Muller, D.M. 175 172, 240, 254 Mertens, P.P.C. 242, 255 Müller, U.B. 259 Maselli, L.M.F. 141, 142 Miagostovich, M.P. 8, 14, 30, 84, 85, 139 Muller, V.D.M. 79 Massi, R.P. 7, 13, 28, 231, 242, 248 Michelin E. 253 Muller, V.M. 125, 136 Massolini, V.M. 124, 126, 148 Michereff Filho, M. 7, 13, 25, 199 Muniz, J.A.P.C. 240 Mata, C.P.S.M. 256 Michereff-Filho, M. 215 Murillo, C.A. 140 Matos, A.C.D. 10, 15, 41, 238, 242, 255 Miguel, J.C. 116, 120, 132 Muylaert, R.L. 76 Matos, A.R. 134 Milagres, F.A.P. 116 N Matos, M.A.D. 110 Milanesi, D.F. 200, 212 Nagata, T. 7, 13, 25, 70, 71, 72, 74, 187, Matos, V.O.R.L. 215 Minet, C. 78, 249 198, 199, 210 Mattos, M.S. 68 Miranda, D.P.J. 159, 160 Nakasu, E.Y.T. 7, 13, 25, 191, 192, 199 Mayer, F.Q. 230, 243 Miranda, J.B. 49, 89, 107, 222, 224, 227, Nali, L.H. 112 May, S. 132 259 Nali, L.H.S. 10, 14, 37 Mayta, H.E.M. 140 Misturini, F.D. 109 Nascimento, C.A. 92 Mazaro, C.C.P. 12, 19, 169 Mituti, T. 196 Navarro J. 253
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
271 Index
Navas-Castillo, J. 198, 201, 202, 203 Oliveira, G.P. 50, 57, 68 Peabody, D.S. 52 Naveca, F.G. 81, 139, 151, 177 Oliveira, J.G. 10, 15, 44, 76 Pedrosa, P.B.S. 178 Naves, J.H.F.F. 243, 260 Oliveira,J.G. 123 Pellinzzoni, T.A. 52 Negrão, A.M.G. 233 Oliveira, J.M. 175 Pellizzoni, T.A. 130 Negri, G. 56 Oliveira Jr, R.J. 174 Penalva de Oliveira, A.C. 10, 14, 37 Neris, R.L. 9, 14, 36 Oliveira, J.S. 222 Penha Junior, E.T. 137, 170 Neris, R.L.S. 81 Oliveira, L.B. 246 Penido, B. 108 Neto, A.P.C. 7, 13, 29, 260, 261 Oliveira, L.H.S. 138, 147 Penna Jr, J.M. 174 Neto, D.F.L. 79 Oliveira, L.M. 70 Peralta, R.H.S. 164 Neto, J.P.N. 160 Oliveira, M.I. 56, 127, 129 Perdigão, H.H. 243 Neves, D.P. 77 Oliveira, M. V. 7, 13, 27 Perecin, D. 194 Neves, M. 62 Oliveira, M.V. 231, 235, 236, 248 Peregrino, P.C.P. 75 Neves, M.A.O. 171 Oliveira O.S. 142, 176 Pereira, A.C.T.C. 77, 165 Nickel, O. 200 Oliveira, O.S. 163 Pereira, A.C.T.C.P. 165 nior, E.C.S. 135 Oliveira, R.C. 53, 174 Pereira, A.F. 10, 15, 40 Nishida, F. 218 Oliveira, R.S. 74, 121 Pereira, C.A. 181, 182, 185 Nitsche, A. 55 Oliveira, S.V. 174 Pereira-Carvalho, R.C. 188, 191 Nobre, A.F. 145, 149 Oliveira, T.S. 147 Pereira, C.C.C. 145, 149 Nogueira, A. 208 Oliveira, V.C. 196, 203, 208 Pereira, F.C. 6, 13, 21, 127 Nogueira, J.S. 6, 13, 21 Oliveira, V.R. 216 Pereira, F.L. 242, 245 Nogueira, M.B. 175 Oliver, C. 12, 17, 172 Pereira, H.M.B. 198 Nogueira, M.L. 7, 12, 13, 19, 22, 23, 61, Oliviera, F.G. 243 Pereira, J.J. 239 117, 135, 145, 162, 169 Ometto, T. 220, 228 Pereira, J.L. 7, 13, 25, 199 Nogueira, R. 237 Ore, R.M. 140 Pereira Junior, M. 235 Nogueira, R.L. 117 Orílio, A. 188, 191 Pereira, L.A. 175 Nogueira, R.M. 10, 15, 42, 119, 133 Orsi, M.A. 184 Pereira, O.M.D. 147 Nomikou, K. 242, 255 Ortiz, L.C. 8, 14, 32, 104, 105 Pereira, P.L.L. 224 Nunes, C. 124, 148 Otenio, M.H. 85 Pereira, R.S. 6, 13, 21 Nunes, C.F. 174 Otonel, R.A.A. 7, 13, 28, 251 Peres-da-Silva, A. 67 Nunes, F.V. 222 P Peres, L.R. 128 Nunes, H.M. 151 Pacheco, L.M.M. 125 Perez Beascoechea, C. 10, 15, 39 Nunes, I.A.C. 256 Paesi, S. 8, 14, 31 Peruhype-Magalhães, V. 181 Nunes, M.R.T. 64, 74, 160 Paesi, S.O. 92 Perussi, A.P. 184 O Paganini, E.R. 66 Pescador, C.A. 10, 15, 41 Ogawa, J.K. 63 Paglia, A.P. 49, 107, 222, 227, 259 Petruccio, M.M. 99 Olinda, R.G. 234 Paglia. A.P. 89 Petry, M.V. 220 Olival, G.S. 10, 14, 37, 174 Pagnier, I. 97 Petzhold, S.A. 230 Oliveira, A.C. 9, 10, 14, 33, 37, 52 Paim, I.F. 104 Philadelpho, N.A. 220 Oliveira, A.C.R. 155, 157, 166 Paim, W.P. 223, 230, 238, 258 Piacentini, D. 219 Oliveira, A.L.R. 6, 13, 21 Paiva, T.M. 129 Picarelli, M.A.S.C. 67 Oliveira, A.P. 63 Paixão, C.G.S da 176 Picelli, N. 126 Oliveira, A.P.G. 155, 159 Paixão, C.G.S. da 133, 142, 163 Pierrotti, L.C. 112 Oliveira A.S. 253 Paixão, S.F. 231 Pilotto, J.H. 132 Oliveira, A.S.L. 131 Palma, L.P. 114 Pilotto, M.R. 7, 8, 14, 30, 31 Oliveira, C.H.S. 10, 15, 40, 57 Pannunzio, C.A. 231 Pilz, D. 236 Oliveira, C.M.C. 243 Pannuti, C.S. 10, 14, 38, 112 Pimenta, P.F.P. 7, 13, 22 Oliveira, D.B. 10, 12, 15, 18, 40, 50, 68, 87, Pannuzio, C.A. 242 Pinheiro, B.T. 145 130, 150, 173, 233 Pantoja, K.C. 168 Pinheiro, G.S. 117 Oliveira, D.B.L. 261 Pardini, M.I.M.C 124 Pinheiro, R.S. 110 Oliveira, D.S. 99 Pardini, M.I.M.C. 126, 148 Pinheiro, T.M. 7, 13, 22 Oliveira, E.G. 52 Pati, S. 10, 14, 38 Pinho, J.B. 228 Oliveira, E.S. 10, 15, 44 Patricio, F.R.A. 67 Piñol, B. 205 Oliveira, F.C. 96, 98, 100, 101, 103 Paulino, R.S. 129 Pinto, A.M.V. 239 Oliveira, F.G. 218, 243, 256, 260 Pauvolid-Corrêa, A. 237 Pinto, B.L. 228
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
272 Index
Pinto, C.A. 75 Rêgo, M.O.S. 148 Rodrigues, A.P.D. 183, 239 Pinto, E.V. 160 Rehfeld, I.S. 10, 15, 41, 238 Rodrigues, A.P.S. 148, 218 Pinto G.V.S. 118 Reichert, C.O. 141, 142 Rodrigues, C.N. 232 Pinto, L.A. 184 Reis, A.F.N. 12, 19, 169 Rodrigues, E.A.M. 119, 168 Pinto, L.R. 194 Reischak, D. 184 Rodrigues, E.D.L. 233 Pinto, V.B. 202, 205 Reis, J.D.R. 163, 245 Rodrigues, I.P. 10, 15, 44, 153 Pinto, W.V.M. 94 Reis, J.K.P. 52, 218, 243, 260 Rodrigues, L.K. 193 Pires, M.A. 173 Reis R.M. 159 Rodrigues, M.P. 194 Polaro, A.A. 155 Resende, C.F. 52, 218, 256, 260 Rodrigues, M.V. 252 Pontes, D.F.S. 10, 15, 44, 153 Resende, P.C. 122 Rodrigues, N.F. 108 Portal, T.M 135 Resende, R.O. 7, 13, 25, 188, 191, 196, Rodrigues, N.F.S. 173 Portal, T.M. 149, 156 198, 203, 209, 210, 211, 212 Rodrigues, R.A.L 6, 12, 13, 18, 21, 87 Portela, L.M.F. 232 Resque, H.R. 135, 149, 156 Rodrigues, R.A.L. 6, 12, 13, 21, 87 Portiansky, E.L. 218 Reymão, T.K.A. 156, 166 Rodrigues, R.L. 184 Possati, F. 7, 13, 27, 245 Rezende, A.G. 181 Rodrigues, S.G. 172 Possatti, F. 7, 13, 28, 248, 251 Rezende, B.C. 54 Rodrigues, T.V. 10, 15, 41 Potsch, D.F.V. 132 Rezende, I.M. 49 Rodrigues, V.G. 123 Prado, A.A.O. 108 Rezende, J.A.M. 196 Roehe, P.M. 8, 14, 32, 58, 78, 91, 105, 182, Prado, F.O. 164 Ribeiro-Alves, M. 9, 14, 35 183, 197, 223, 225, 226, 227, 228, Prado, T. 95 Ribeiro, B.M. 7, 12, 13, 17, 19, 25, 71, 196, 229, 230, 238, 243, 249, 250, 251, Praes, E.C. 260 199, 213 252, 257, 258, 259, 260 Prates, L.C. 114 Ribeiro, G.C. 215 Roehe,P.M. 104 Prati, B. 51 Ribeiro, J. 15, 229, 231, 242, 248 Rojas, M.R. 211 Prazeres, B.A.P. 125 Ribeiro, J.F. 145 Roldão, D.F. 84 Pressi, G. 89 Ribeiro, J.G.L. 181 Rollie, J.Clem 7, 13, 24 Provazzi, P.J.S. 135, 140 Ribeiro, M.B. 203 Rollinger, J.M. 54 Puech, C. 78 Ribeiro, M.C.E. 70 Romano, C.M. 10, 14, 37, 38, 72, 75, 112, Puglia, A.L.P. 182 Ribeiro, M.R. 7, 13, 22, 61, 162 113, 174 Punil, L.R. 140 Ribeiro, M.S. 170 Romão, L.F. 150 Purificação Junior, A.F. 114 Ribeiro S. 191 Rontani, R. 174 Q Ribeiro, S.G. 7, 13, 25, 188, 199, 214, 215 Rosadas, C. 232 Queiroz, F.M. 145 Riça, L.B. 224 Rosa e Silva, M.L. 85 Queiroz, L. 7, 13, 29 Ridpath, J.F. 10, 15, 41 Rosa, J.A. 224 Queiroz, L.H. 261 Rieger, A. 224 Rosa, J.C.C. 10, 15, 41, 242, 255 Queiroz, M.V. 206, 207 Riet-Correa, F. 234 Rosa,J.C.C. 123 Queiroz S.R.A. 253 Rigotto, C. 77, 88, 89, 92, 93, 104, 199 Rosa, L.H. 76 Quinan, B.R. 10, 15, 44 Rimério C.A.T. 121 Rosario, C.S. 175 Quinderé Neto, G.A. 156 Rios, M. 130 Rossi, L.M.G. 135 Quiñones, M. 205 Ritzel, R.G.F. 101 Ruskowski L. 98 Quirici, L. 183 Ritzel, R.G.F. 96, 98, 100, 103 Ruskowski, L. 92 R Rivas, E.B. 67 S Raboni, S.M. 175 Robert, C. 7, 30 Sabino, E.C 10, 14, 38, 75 Rachid-de-Lacerda, M.C. 7, 13, 22 Rocco, Y.M. 6, 13, 21 Sabino-Santos Jr, G. 73, 76 Rahal, P. 9, 14, 35, 53, 58, 59, 60, 66, 117, Rocha, D.C. 168 Sabino-Santos Jr., G. 136 135, 140 Rocha, D.C.C. 103, 240, 254 Sacchetto, L. 49, 107 Ramos, D.G.S. 228 Rocha, E.S. de O. 12, 19 Saddi, T.M. 257 Ramos, R. 208 Rocha, E.S.O. 10, 15, 44 Ságio S. 208 Ramos-Sobrinho, R.R. 213 Rocha, I.M. 157 Sakamoto.T. 150 Raoult, D. 97 Rocha, K.C.J. 84 Salas, F.J.S. 194 Ravasi, G. 62 Rocha, M.A.L. 80 Saldaña Gonzales, R. 184 Regasini, L.O. 53, 66 Rocha, P.A.S. 164 Sales, G.A. 238 Regatieri, L.J. 169 Rocha, V.A. 49 Salles, T. 57 Reginatto, F.H. 152 Rocha, V.P. 9, 14, 33 Salustiano, D.M. 152, 153 Rego, C.M. 192 Rodrigues, A. 198 Salvador, F.S. 72
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
273 Index
Salvarani, F.M. 243 Scheffer, C.M. 223, 230, 238, 250, 258, 259 Silva, L.A. 115 Sampaio, S.V. 9, 14, 35 Schenkel, E.P. 54 Silva, L.C. 51 Sampaio, T.L. 10, 15, 44, 153 Schmidt, C. 223, 230, 238, 259 Silva, L.C.F. 6, 10, 13, 14, 21, 36, 100 Sanches, M.M. 188, 190, 214 Schmidt-Chanasit, J. 170 Silva, L.D. 119, 127, 166, 168, 171 Sanches, P.R.S. 60 Schneider, V.E. 8, 14, 31, 92 Silva, L.K.S. 6, 12, 13, 18, 21, 87 Sánchez-Pina, M.A. 7, 13, 24 Schnell, M.J. 7, 13, 27 Silva, L.V. 94 Sande, O.F.L. 204 Schnellrath, L.C. 68 Silva, M.C.M. 171 Santos, A.C.V. 52 Scola, B. 7, 10, 12, 14, 18, 30, 36, 51, 87, Silva, M.F. 194 Santos, A.G.R.C. 224 97, 100 Silva, M.G. 118 Santos, A.S. 99 Scrochi, M.R. 218 Silva, M.J.M. 155, 159 Santos, B.R. 155, 159 Seixas, M.M. 228 Silva, M.L. 10, 14, 38, 72, 181 Santos, B.V.O. 175 Seixas, M.M.M. 220 Silva, M.M. 168 Santos, C.M. 144 Serra, A.C.S. 137 Silva, M.S. 210 Santos, C.S. 6, 13, 21 Serra, I.G.S.S. 158, 163 Silva, N.L. 10, 15, 41 Santos, D.A. 12, 18, 87 Serrão, V.H.B. 246 Silva, P.A. 120 Santos, D.R.L. 221 Sguazza, G.H. 218 Silva, P.E. 127, 129 Santos, D.S. 129, 136, 183 Shimizu, J.F. 9, 14, 35, 58, 66 Silva, R.O.S. 229 Santos, D.S.A. 97 Sichero, L. 118 Silva, S. 58 Santos, D.S.A.S. 84, 91, 94, 99, 102 Sihler, W. 190 Silva, S.P. 233 Santos, E.J.M. 149 Silva, A.D. 256 Silva, T.M.S. 79 Santos, F.M. 126 Silva, A.G. 257, 258, 260 Silveira, A.C. 118 Santos, F.M.B. 191 Silva, A.K. 133, 142, 163, 176, 234 Silveira, E. 122 Santos, F.S. 145, 170 Silva, A.L. de O. 142 Silveira, F. 182, 183, 259 Santos, G.R. 196, 208 Silva, A.M. 9, 14, 33, 143, 167, 234 Silveira, P.F. 65 Santos, H.C.P. 111, 154 Silva, A.P. 15, 120, 229 Silveira, P.P. 12, 17, 172 Santos, H.F. 197, 223, 227, 228, 229, 230, Silva, A.T.S. 222 Silveira, S. 10, 15, 41 238, 243, 250, 258 Silva, B.M. 65, 70, 108 Silvestre, R.V.D. 133, 142, 163, 176 Santos, I.N.P. 169 Silva, C.A. 235 Simabuco, F.M. 63 Santos, J.M. 175 Silva, C.O. 147 Simões, C.M.O. 54, 55, 109, 115, 152 Santos, K.C.O. 129 Silva, C.R.S. 151 Sincero, T.C.M. 109 Santos, L.F.P. 144 Silva, D.B.B. 129 Singh, B.K. 74 Santos, L.L. 107 Silva-de-Jesus, C. 7, 13, 22, 62 Siqueira, J.A.M 135 Santos, L.L.R. 170 Silva, D.F. 10, 14, 37 Siqueira, J.A.M. 144, 149, 157 Santos, L.S. 138, 147 Silva, D.J.F. 237 Siqueira, M.M. 122, 134 Santos, M.C. 10, 15, 42, 141, 143, 162, Silva, F.A. 254 Siqueira, T.R. 108 167, 234 Silva, F.M. 155, 159 Sjostedt, P.P. 232 Santos, M.C.M. 115 Silva, F.P. 199, 207 Smith, V.C. 84, 91, 95, 97, 99, 102 Santos, M.L. 130 Silva, G.A. 234 Smitsaart, E. 219 Santos, M.R.M. 125 Silva, G.F. 124, 126, 135, 148 Soares, C.M.A. 69 Santos, N. C. 110 Silva, H.H.G. 156 Soares, D.F.M. 224 Santos, R.A. 9, 14, 33 Silva, I.C. 145 Soares, H. 185 Santos, R.N. 8, 14, 32, 104, 105, 258 Silva, I.G. 156 Soares, L.S. 99, 119, 122, 127, 131, 137, Santos, V.A.F.F.M. 58 Silva, I.T. 55, 109, 115 168, 170, 171 Santos, V.L. 192 Silva. J. 79 Soares, M. 57 Santos, V.M. 141 Silva, J.C. 204, 205 Soares, M.C.P. 151, 172 Saporiti, V. 235 Silva, J.C.F. 208 Sobrinho, R.R. 204 Saraiva-Silva, A.T. 7, 13, 23, 224 Silva, J.G. 150 Soliman M.C. 98 Sarmento, A.R. 208 Silva, J.L. 9, 14, 33, 52 Soliman, M.C. 92, 96, 100, 101, 219, 223 Sarmento, V.P. 151 Silva, J.M.F. 70, 72 Sonoda, I. 159, 160 Sato, M.I.Z. 95 Silva, J.P. 7, 13, 26, 202, 204 Sosa-Gómez, D.R. 12, 17 Scagion, G.P. 248 Silva, J.R. 178, 240 Sousa, A.C.M. 118 Scalioni, L.P. 116, 120 Silva, J.T. 213 Sousa, D.D. 151 Scerni, R.M. 171 Silva, K.N. 210 Sousa E.L.M. 253 Schaefer, R. 241, 246 Silva, K.R.T. 84, 91 Sousa Junior, E.C. 144
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
274 Index
Sousa Júnior, E.C. 160, 170 Tamashiro, E. 10, 14, 38 Vallinoto, A.C.R. 149 Sousa-Júnior, E.C. 10, 15, 42 Taniwaki, N.N. 56 Vancini, R. 57, 82 Sousa Junior, E.C.S. 141 Taniwaki, S.A. 252 Vannucci, F. 226 Sousa, J.V.B. 77 Tanuri, A. 62 Varela, A.P.M. 223, 227, 228, 230, 238, Sousa, M.S. 125, 145, 149 Taranto, A.G. 61 243, 250, 252, 258, 259 Sousa, N.R. 84, 91, 94, 102 Tassi, A.D. 195 Vasconcelos, J.M. 74 Sousa, P.F. 128 Tavares, F.N. 99, 122, 134, 171 Vasconcelos, P.C. 254 Sousa, R.C.M. 144 Tavares, L.A. 9, 14, 32 Vasconcelos, P.F.C. 117, 118, 172 Sousa, T.T. 155 Tavares, M. 91 Vasconcelos, P.F. da C. 160 Souza, C.A. 188 Tavares, M.L. 191 Vaz, A.B.M. 192 Souza, D.G. 50 Teixeira, B.M. 260 Vaz, E.K. 256 Souza, D.M.S. 90 Teixeira, B.R. 53, 174 Vedovello, D. 7, 12, 13, 19, 22, 145, 162, Souza, D.S.M. 8, 14, 31 Teixeira-Carvalho, A. 181 169 Souza, E.B. de 200 Teixeira, C.R. 247 Veiga, A.G.V. 10, 14, 39 Souza, E.M.A. 10, 15, 42, 141, 144, 162 Teixeira, D.C. 197 Veloso, V. 7, 13, 22 Souza, F.G. 93 Teixeira, D.M. 91, 95, 97, 99, 102, 166 Ventura, A.M. 63 Souza, F.P. 169 Teixeira, E.C. 208 Veras, R.M.A. 79, 80, 175 Souza, H.L. 10, 12, 15, 18, 43 Teixeira, H.F. 109, 115 Vergueiro, M.V.B. 144 Souza, J.O. 7, 13, 25, 199, 211 Teixeira, M.R.N. 233 Vermelho, A.B. 93 Souza, K.M.C. 154, 155, 161, 166 Teixeira, R. 180 Vermudez, J.E.V. 174 Souza, L.G. 165 Teixeira, T.F. 182, 183, 197, 223, 225, 226, Versiania, A.F. 12, 18 Souza, L.R. 126 227, 228, 229, 230, 238, 250 Versiani, A.F. 10, 15, 43, 162 Souza, M. 155, 161 Teles, S.A. 110 Viana, M.N.S.A. 145 Souza, M.B.L.D. 111, 147, 154, 156, 157, Terzian, A.C.B. 61, 145 Viana, R.M.M. 165 166 Thomazelli, L.M. 220, 228 Vianez Júnior, J.L. da S.G. 160 Souza, M.C.P. 7, 13, 29, 261 Tilston-Lunel, N.L. 9, 14, 34 Vianez-Junior, J.Ls.G. 74 Souza, M.L. 190 Tochetto, C. 230, 238, 243, 249 Vianez Junior, J.L.S.G. 64 Souza, R.C.M. 149 Todorov, S.D. 120 Vicente, A.C. 119 Souza, S.A. 79 Tolardo, A.L. 89 Victer, T.N.F. 10, 15, 44, 153 Souza, S.J.M. 79, 175 Torres, A.L.Q. 67 Victoria, M. 8, 14, 30, 84 Souza, T. 216 Torres, F.D. 260 Vidal, L.R.R. 175 Souza, T.A. 187 Tort, L.F.L. 8, 30, 84 Vidigal, P.M.P. 207 Souza, V.C. 151 Totola, A.H. 48 Vieira, A.C.S. 175 Souza, W.M. 89 Tozzato, C. 237 Vieira-Almeida, E.C. 196 Souza, W.T. 155, 159 Trindade, A.T. 7, 13, 26, 204 Vieira, F. 89 Spada, C. 141, 142 Trindade, G. 10, 14, 15, 36, 40, 107, 227, Vieira, F.N. 49, 107, 227, 259 Spera, C.G. 247 259 Vieira, P.H.S. 175 Sperb, L.C. 199 Trindade, G.S. 7, 13, 23, 49, 57, 146, 192, Vieira, R.C. 125 Spilki, F.R. 77, 85, 86, 87, 88, 89, 92, 93, 222, 224, 233 Vieira, T.M. 73 96, 98, 100, 101, 103, 104, 199, 219, Trindade. G.S. 89 Vigorito, A.C. 110 223 Trindade, J.Q. 125 Vilas Boas, L.C.P. 120 Staggemeier, R. 85, 86, 87, 92, 93, 96, 98, Tripathi, S. 10, 14, 39 Vilela, A.P.P. 7, 13, 23, 123 100, 101, 103 Tsutsumi, M.I. 125 Villa, L.L. 118 Staggmeier, R. 92 Turina, M. 209 Villani, F.N.A. 10, 15, 41 Stauder, G.Z. 219 U Villar, K.S. 56 Stephano, M.A. 184 Ullmman, L.S. 145 Villar, L.M. 116, 120, 132, 221 Strecht, L. 53, 174 Urbano, P.R. 72, 112, 113 Villela-Nogueira, C.A. 120 Streck, A.F. 10, 15, 41 Urbano, P.R.P. 10, 14, 37, 174 Vincent, A.L. 7, 13, 28, 249 Suárez-Patiño, S.F. 181 V Virgolino, L.M.S. 95 Suarez, S.F.P. 185 Valdez, F.P. 91, 257 von Messling, V. 7, 13, 27 Suzuki, A. 6, 13, 21 Vale, E.R. 84, 91, 102 W T Valêncio, C.R. 135 Wagner, R. 182 Takiuchi, E. 251 Valera, F.C.P. 10, 14, 38, 117 Walsh, J.A. 193 Tâmara, S.A. 79 Valle, E.R. 94, 102 Wanzeller, A.L.M. 99, 122, 134
October 2015 Volume 20 – Supplement 1 - Index XXVI Brazilian Congress of Virology & X Mercosur Meeting of Virology October, 11 - 14, 2015, Costão do Santinho Resort, Florianópolis, Santa Catarina, Brazil
275 Index
Watanabe, A.S.A. 7, 13, 22 Weber, M.N. 10, 15, 41 Weiblen, R. 7, 10, 13, 14, 15, 26, 41, 234, 235, 244 Weiss, M. 235 Wendlant, A. 225 Witt, A.A. 250 Wulff, N.A. 197 X Xavier, A.G. 192 Xavier, A.S. 206, 207 Xavier, C.A.D. 7, 13, 26, 204, 205 Y Yamakawa, F.H.S. 256 Yamamoto. K. 57 Yendo, A.C. 182 Yuki, V.A. 196 Z Zanardo, L.G. 200, 212 Zanella, L. 119 Zani, C.L. 76 Zanutto, M.S. 252 Zanuzzi, C.N. 218 Zaroni, M.M.H. 184 Zenatti, V.R. 128 Zerbini, F.M. 7, 13, 26, 200, 201, 202, 203, 204, 205, 206, 208 Zerbini, M. 198 Zhang, J. 7, 28, 249 Zibaoui,H.M. 123–178 Zini, N. 145, 162 Zucatelli, R.M. 56 Zugaib, R. 126
October 2015 Volume 20 – Supplement 1 - Index