(Gmelin, 1790) in the Critically Endangered European Mink Mustela Lutreola

Total Page:16

File Type:pdf, Size:1020Kb

(Gmelin, 1790) in the Critically Endangered European Mink Mustela Lutreola Manuscript Click here to download Manuscript PARE-D-18-00689- Revised-version.doc Click here to view linked References 1 Severe parasitism by Versteria mustelae (Gmelin, 1790) in the critically 1 2 3 2 endangered European mink Mustela lutreola (Linnaeus, 1761) in Spain 4 5 3 6 7 4 Christine Fournier-Chambrillon1, Jordi Torres2,3, Jordi Miquel2,3, Adrien André4, Johan Michaux4, Karin 8 9 5 Lemberger5, Gloria Giralda Carrera6, Pascal Fournier1 10 11 6 1 Groupe de Recherche et d’Etude pour la Gestion de l’Environnement, Route de Préchac, 33730 Villandraut, 12 13 7 France (CFC ORCID: 0000-0002-9365-231X). 14 15 8 2 Departament de Biologia, Sanitat i Medi ambient, Universitat de Barcelona, Av. Joan XXIII, sn, 08028 16 17 9 Barcelona, Spain (JT ORCID: 0000-0002-4999-0637; JM ORCID: 0000-0003-1132-3772). 18 19 3 Institut de Recerca de la Biodiversitat, Universitat de Barcelona, Av. Diagonal 645, 08028 Barcelona, Spain 20 10 21 4 22 11 Université de Liège, Laboratoire de génétique de la conservation, GeCoLAB, Chemin de la Vallée 4, 4000 23 24 12 Liège, Belgium 25 5 26 13 Vetdiagnostics, 14 avenue Rockefeller, 69008 Lyon, France 27 6 28 14 Sección de Gestión de la Comarca Pirenaica, Gobierno de Navarra, C/ González Tablas 9, 31005 Pamplona, 29 30 15 Spain 31 32 16 33 34 17 Corresponding author: 35 36 18 Christine FOURNIER-CHAMBRILLON 37 38 19 GREGE, Route de Préchac, 33730 VILLANDRAUT, France 39 40 20 Tel.: + (33) 5 56 25 86 54 41 42 21 Email: [email protected] 43 44 22 45 46 23 Acknowlegments 47 48 24 The necropsies program was funded by the “Departamento de Desarrollo Rural, Medio Ambiente y 49 50 25 Administración Local del Gobierno de Navarra” and the carcasses were collected by the “Sección de Hábitats y 51 52 26 Sección de Guarderío de Gobierno de Navarra, Equipo de Biodiversidad de Gestión Ambiental de Navarra S.A.” 53 54 27 We thank two anonymous reviewers for their very constructive recommendations. 55 56 28 57 58 29 59 60 61 62 63 64 1 65 30 Abstract 1 2 31 The riparian European mink (Mustela lutreola), currently surviving in only three unconnected 3 4 5 32 sites in Europe, is now listed as a critically endangered species in the IUCN Red List of 6 7 33 Threatened species. Habitat loss and degradation, anthropogenic mortality, interaction with the 8 9 10 34 feral American mink (Neovison vison), and infectious diseases are among the main causes of its 11 12 35 decline. In the Spanish Foral Community of Navarra, where the highest density of M. lutreola 13 14 36 in its western population has been detected, different studies and conservation measures are 15 16 17 37 ongoing, including health studies on European mink, and invasive American mink control. We 18 19 38 report here a case of severe parasitism with progressive physiological exhaustion in an aged 20 21 22 39 free-ranging European mink female, which was accidentally captured and subsequently died in 23 24 40 a live-trap targeting American mink. Checking of the small intestine revealed the presence of 25 26 27 41 seventeen entangled Versteria mustelae worms. To our knowledge, this is the first description 28 29 42 of hyperinfestation by tapeworms in this species. 30 31 43 32 33 34 44 Key words: critically endangered, severe parasitism, Mustela lutreola, physiological 35 36 45 exhaustion, Spain, Versteria mustelae. 37 38 39 46 40 41 47 Introduction 42 43 44 48 The European mink, Mustela lutreola (Linnaeus, 1761), a small semiaquatic mustelid, has 45 46 49 suffered a dramatic decline over the last 150 years and is now listed as critically endangered 47 48 49 50 (Maran et al. 2016). Remaining populations are currently distributed in well-separated nuclei, 50 51 51 in Northern Spain and Southwestern France, in Romania, in Ukraine and in Russia. These 52 53 52 populations are still declining due to several factors, including anthropic pressure (e.g. habitat 54 55 56 53 loss and degradation, vehicle collisions, accidental trapping, dog predation, hunting), 57 58 54 interspecific competition with the alien invasive American mink (Neovison vison), and 59 60 61 62 63 64 2 65 55 infectious diseases. In recent years numerous studies on ecology, health status, and 1 2 56 conservation genetics have been conducted on the western population of European mink to 3 4 5 57 better understand the causes of its decline and to propose conservation measures (Michaux et 6 7 58 al. 2005; Fournier et al. 2008; Philippa et al. 2008; Fournier-Chambrillon et al. in press). 8 9 10 59 Several parasitological surveys have allowed a thorough characterization of the helminth fauna 11 12 60 of the species, which showed that cestodes rarely infected this riparian mustelid, and if at all, 13 14 61 only in low numbers (Shimalov et al. 1993; Sidorovich and Bychkova 1993; Torres et al. 2003, 15 16 17 62 2008). The case reported here provides novel information about the potentially fatal impact of 18 19 63 tapeworms on European mink, specifically of severe infestation by Versteria mustelae (Gmelin, 20 21 22 64 1790). The genus Versteria was recently proposed by Nakao et al. (2013), being V. mustelae 23 24 65 the type species, which has several synonyms: Taenia mustelae, Fimbriotaenia mustelae and 25 26 27 66 Taenia tenuicollis. 28 29 67 30 31 68 Materials and methods 32 33 34 69 The highest density of M. lutreola in its western population was detected in 2004 in the 35 36 70 Spanish Foral Community of Navarra, where a health survey was initiated by the government 37 38 39 71 (Ceña et al. 2005; Fournier-Chambrillon et al. in press). Recent data of American mink in 40 41 72 Navarra led the government to control its invasion using mink rafts (Reynolds et al. 2004). 42 43 44 73 One free-ranging European mink female accidentally captured on November 2016 on the 45 46 74 river Ega, was found dead in a live-trap targeting the invasive species. It was kept frozen until 47 48 49 75 necropsy performed shortly thereafter. Biometric and biological parameters were recorded, 50 51 76 age class estimated through dental wear and calculus, and reproductive status determined by 52 53 77 external examination and uteri analysis (Fournier-Chambrillon et al. 2010). A range of 54 55 56 78 samples was taken for genetic, virological, bacteriological and histological studies, following 57 58 79 the usual protocol established for necropsies. 59 60 61 62 63 64 3 65 80 This female revealed numerous macroscopically visible intestinal tapeworms and 1 2 81 nasolacrimal sinuses parasitism by metastrongylid nematodes. These parasites were removed 3 4 5 82 and transferred to vials containing 70% ethanol. The stomach, intestine and lungs were 6 7 83 additionally checked under a stereoscopic microscope. All helminths found were processed 8 9 10 84 according to classical helminthological methods, identified on the basis of previous 11 12 85 descriptions, and counted. Some little hooks compatible with those of V. mustelae were 13 14 86 observed on the tapeworms, although intact scolices could not be found. Therefore, a molecular 15 16 17 87 identification was performed following the protocol described in Torres et al. (2016) with these 18 19 88 modifications: the primers used were the ones designed by Bowles et al. (1992) (Forward 5'- 20 21 22 89 TTTTTTGGGCATCCTGAGGTTTAT-3'; Reverse: 5'- 23 24 90 TAAAGAAAGAACATAATGAAAATG -3’), with an annealing temperature of 50°C. The 25 26 27 91 resulting sequence has been deposited in GenBank under the accession number MH431789; 28 29 92 and compared to previously published GenBank sequences. 30 31 93 32 33 34 94 Results and Discussion 35 36 95 Necropsy revealed a cachectic relatively old female of 402 g in state of physiological 37 38 39 96 exhaustion and without any traumatic lesion. No sign of recent lactation was observed, and 40 41 97 absence of placental scars could not be interpreted because of rapid disappearance at this time 42 43 44 98 of year due to tissue regeneration. Internal exam revealed congestion of all abdominal organs, 45 46 99 and a pale almost translucent hepatic parenchyma. The other major macroscopic lesion was a 47 48 49 100 mass of entangled tapeworms in the small intestine (Fig. 1). After incision, thickening of the 50 51 101 gastrointestinal wall was observed, with presence of greenish to black mucus in the stomach, 52 53 102 black rectal content suggesting digested blood, and diffuse congestion of the gastrointestinal 54 55 56 103 mucosa. Opening of the skull revealed mild brain congestion and the presence of numerous 57 58 104 metastrongylid nematodes in the nasolacrimal sinuses with ventral osseous deformation and 59 60 61 62 63 64 4 65 105 right dorsal cranial perforation. Helminthological study concretely revealed the presence of 17 1 2 106 tapeworms (V. mustelae) and 10 Molineus patens in the small intestine as well as 18 3 4 5 107 Skrjabingylus nasicola in the nasolacrimal sinuses. Mitochondrial COI gene sequence obtained 6 7 108 from the tapeworms presented a 99 % homology with the previously published GenBank V. 8 9 10 109 mustelae sequence (AJ544880.1). Only one out of the 381 bases differed between the two 11 12 110 sequences (Fig. 2). In contrast, our sequence matched the Taenia martis sequence with a lower 13 14 111 identity score of 85%. In addition, both species are easily distinguished by the size of their 15 16 17 112 hooks, which in T.
Recommended publications
  • Myodes Glareolus) In
    1 Long-term spatiotemporal stability and dynamic changes in 2 helminth infracommunities of bank voles (Myodes glareolus) in 3 NE Poland 4 5 MACIEJ GRZYBEK1,5, ANNA BAJER2, MAŁGORZATA BEDNARSKA2, MOHAMMED AL- 6 SARRAF2, JOLANTA BEHNKE-BOROWCZYK3, PHILIP D. HARRIS4, STEPHEN J. PRICE1, 7 GABRIELLE S. BROWN1, SARAH-JANE OSBORNE1,¶, EDWARD SIŃSKI2 and JERZY M. 8 BEHNKE1* 9 10 1School of Life Sciences, University of Nottingham, University Park, Nottingham NG7 2RD, UK 11 2Department of Parasitology, Institute of Zoology, Faculty of Biology, University of Warsaw,1 12 Miecznikowa Street, 02-096, Warsaw, Poland 13 3 Department of Forest Phytopathology, Faculty of Forestry, Poznań University of Life Sciences, 14 71C Wojska Polskiego Street, 60-625, Poznan, Poland 15 4National Centre for Biosystematics, Natural History Museum, University of Oslo, N-0562 Oslo 5, 16 Norway 17 5Department of Parasitology and Invasive Diseases, Faculty of Veterinary Medicine, University of 18 Life Sciences in Lublin, 12 Akademicka Street, 20-950, Lublin, Poland 19 20 Running head : Helminth communities in bank voles in NE Poland 21 *Correspondence author: School of Life Sciences, University of Nottingham, University Park, Nottingham, UK, NG7 22 2RD. Telephone: +44 115 951 3208. Fax: +44 115 951 3251. E-mail: [email protected] 23 ¶ Current address: Department of Plant Biology and Crop Science, Rothamsted Research, Harpenden, 24 Herts, AL5 2JQ, UK 25 1 26 SUMMARY 27 Parasites are considered to be an important selective force in host evolution but ecological studies 28 of host-parasite systems are usually short-term providing only snap-shots of what may be dynamic 29 systems.
    [Show full text]
  • Love S Taeniid Tapeworms Incl T Ovis
    Taeniid tapeworms incl T.ovis (‘sheep ‘measles’) – some notes SL, DPI Armidale May 2016 Following is my interpretive summary of various, especially Jenkins et al, 2014 (J1).These are somewhat disorganised notes, not a polished treatise! Information mostly from JI unless stated otherwise. J1 : “Data collected through the Australian National Sheep Health Monitoring Program (NSHMP) (AHA, 2011 ) reported metacestodes of T. ovis to be widespread and common in sheep slaughtered in mainland Australia 1, but less common in Tasmania. Sheep infected with metacestodes of T. hydatigena are also found commonly in slaughtered sheep from all sheep rearing areas of mainland Australia but less commonly in Tasmania (Animal Health Australia, unpublished data)” ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ [SL:] Prevalence of sheep measles and of adult T ovis in AU. In 2014-2015, ~ 15000 lines of sheep (incl. lambs) which amounted to ~ 3 million sheep incl. lambs were inspected as part of NSHMP. This was in 18 abattoirs, across various states. Approx two thirds of the lines were direct lines (direct consignments to the abattoir). However, two of the biggest mutton processors in NSW (Dubbo, Goulburn) are not part of NSHMP. In 2015, approx. 31 million sheep were slaughtered in AU (~ 8.5M sheep, 22.2 M lambs). Total AU sheep pop is ~ 70M (Source: MLA). So, the sheep inspected under NSHMP is about 10% of all those slaughtered and two major mutton processors are not involved. Question then: how representative are the NSHMP results of the AU sheep population? Indicative only? J1, citing NSHMP data, say sheep measles (metacestodes of T ovis) are widespread and common in sheep slaughtered in AU, especially in mainland AU.
    [Show full text]
  • Endoparasites of American Marten (Martes Americana): Review of the Literature and Parasite Survey of Reintroduced American Marten in Michigan
    International Journal for Parasitology: Parasites and Wildlife 5 (2016) 240e248 Contents lists available at ScienceDirect International Journal for Parasitology: Parasites and Wildlife journal homepage: www.elsevier.com/locate/ijppaw Endoparasites of American marten (Martes americana): Review of the literature and parasite survey of reintroduced American marten in Michigan * Maria C. Spriggs a, b, , Lisa L. Kaloustian c, Richard W. Gerhold d a Mesker Park Zoo & Botanic Garden, Evansville, IN, USA b Department of Forestry, Wildlife and Fisheries, University of Tennessee, Knoxville, TN, USA c Diagnostic Center for Population and Animal Health, Michigan State University, Lansing, MI, USA d Department of Biomedical and Diagnostic Sciences, College of Veterinary Medicine, University of Tennessee, Knoxville, TN, USA article info abstract Article history: The American marten (Martes americana) was reintroduced to both the Upper (UP) and northern Lower Received 1 April 2016 Peninsula (NLP) of Michigan during the 20th century. This is the first report of endoparasites of American Received in revised form marten from the NLP. Faeces from live-trapped American marten were examined for the presence of 2 July 2016 parasitic ova, and blood samples were obtained for haematocrit evaluation. The most prevalent parasites Accepted 9 July 2016 were Capillaria and Alaria species. Helminth parasites reported in American marten for the first time include Eucoleus boehmi, hookworm, and Hymenolepis and Strongyloides species. This is the first report of Keywords: shedding of Sarcocystis species sporocysts in an American marten and identification of 2 coccidian American marten Endoparasite parasites, Cystoisospora and Eimeria species. The pathologic and zoonotic potential of each parasite Faecal examination species is discussed, and previous reports of endoparasites of the American marten in North America are Michigan reviewed.
    [Show full text]
  • Journal of American Science, 2011;7(12)
    Journal of American Science, 2011;7(12) http://www.americanscience.org Comparative ultrastructural study of the spermatozoa of Cotugnia polycantha (Cestoda, Cyclophyllidea, Davaineidae), the intestinal parasites of pigeons (Columba livia domestica) and doves (Streptopelia senegalensis) from Egypt Sabry, E. Ahmed and Shimaa, Abd-El-Moaty Department of Zoology, Faculty of Science, Zagazig University, Egypt [email protected] Abstract: The present study compares ultrastructure of the spermatozoa of Cotugnia polycantha recovered from the intestine of the two different host, Columba livia domestica and Streptopelia senegalensis from Egypt. The spermatozoa of C. polycantha of the two different host are filiform, tapered at the anterior extremity and lack mitochondria. The anterior extremity has an apical cone of electron dense material and two helicoidal thick cord crested-like body. The axoneme possesses the 9+"1" pattern of microtubules and contains the peri-axonemal sheath. The cortical microtubules are spiraled along the whole length of the spermatozoon. The spermatozoon of C. polycantha of C. livia consists of five regions (I-V), while the other consists of four regions (I-IV). The cytoplasm contains numerous and large electron dense granules only in the region V in case of C. polycantha of C. livia but, these granules are also found in the regions I, II and IV in the spermatozoon of C. polycantha of S. senegalensis. The nucleus is a fine compact cord and envelops the central axoneme once or twice, interposes itself between the cortical microtubules in case of C. polycantha of C. livia which is different in that of C. polycantha of S. senegalensis in which the nucleus is coiled in a helix around the axoneme.
    [Show full text]
  • Universlty of Manltoba
    THE HELMINTHOFAUNA OF SMALL BODENTS IN SOUTHEBN I{ANTIOBA A Thesis Presented, to the Faculty of Grad.uate Süud-les and. Research Universlty of Manltoba fn Partlal F\r1fl1lnent of the Bequlremenüs for the Ðegree Master of Sclence ffi urutvrRs/ryìs ,..# by 0i- tulANlTOBA Brian Blchard. Jaeobsenu ¿'. ¡{+i'r,rr ,-*d 11. $Errlì.ÄçL Eleven species of helminths (seven of cestod.es and. four of nematodes) were found in a total of 1081 specimens of five species of rodents from southern Manitoba. Six new host records were established. Focal distributions of cestodes were attributed, to their lif e cycles; a.nd foci of nematodes to the relative abundance of moisture in the habitats studied. Infections of Angrp r¡acrocephala and Capillaria hepatica varied seasonally. No statistic- aI evidence was found of positive or negative correlative occurrence between members of parasite pairs. CapilLeria hepatica was the only rodent parasiie found that is a potential human patnogen. Çuterebra sp. (Cuterebridae¡ Diptera) was found in 5.5% of rodents examined. 1L1 . ACKNOl^ILEDGMENTS I would. l1ke to express my sincere gratitud.e to Dr. G. Lubinsky, Associate professor of Zoology, - unlverslty of Manltoba for his assistance and. encourage; ¡nent in this stud.y. I am al_so ind_ebted to Dr. H. E. hlel-ch, Head., Ðepartment of ZooLogy, University of Manitoba, for his val-uable counsel. Thanks are d.ue to Dr. C. tüatts, Departnent of ãoology, University of Manltoba, Ðr. S. fverson of the ÏthiteshelL Nuclear Reaetor at Pinawa, Manitoba and. Dr. M. Levin of the Departnent of Botany, Unlversity of Manltoba. iv.
    [Show full text]
  • (Gmelin, 1790) in the Critically Endangered European Mink Mustela Lutreola (Linnaeus, 1761) in Spain
    Parasitology Research https://doi.org/10.1007/s00436-018-6043-z SHORT COMMUNICATION Severe parasitism by Versteria mustelae (Gmelin, 1790) in the critically endangered European mink Mustela lutreola (Linnaeus, 1761) in Spain Christine Fournier-Chambrillon1 & Jordi Torres2,3 & Jordi Miquel2,3 & Adrien André4 & Johan Michaux4 & Karin Lemberger5 & Gloria Giralda Carrera6 & Pascal Fournier1 Received: 25 June 2018 /Accepted: 3 August 2018 # Springer-Verlag GmbH Germany, part of Springer Nature 2018 Abstract The riparian European mink (Mustela lutreola), currently surviving in only three unconnected sites in Europe, is now listed as a critically endangered species in the IUCN Red List of Threatened Species. Habitat loss and degradation, anthropogenic mortality, interaction with the feral American mink (Neovison vison), and infectious diseases are among the main causes of its decline. In the Spanish Foral Community of Navarra, where the highest density of M. lutreola in its western population has been detected, different studies and conservation measures are ongoing, including health studies on European mink, and invasive American mink control. We report here a case of severe parasitism with progressive physiological exhaustion in an aged free-ranging European mink female, which was accidentally captured and subsequently died in a live-trap targeting American mink. Checking of the small intestine revealed the presence of 17 entangled Versteria mustelae worms. To our knowledge, this is the first description of hyperinfestation by tapeworms in
    [Show full text]
  • 4. Discussion
    4. Discussion Chez les digènes objets de notre étude (Scaphiostomum palaearcticum, Notocotylus neyrai, Fasciola gigantica et F. hepatica) la spermiogenèse suit le modèle général décrit chez tous les trématodes déjà étudiés (Burton, 1972 ; Rees, 1979 ; Erwin & Halton, 1983 ; Hendow & James, 1988 ; Cifrián et al., 1993 ; Miquel et al., 2000a). Elle commence par la formation d’une zone de différentiation à la base de la spermatide. Cette zone présente deux centrioles séparés par un corps intercentriolaire et surmonté chacun par une racine striée. Chaque centriole donne naissance à un flagelle généralement disposé perpendiculairement à l’expansion cytoplasmique médiane. Ensuite, les deux flagelles subissent une rotation pour devenir parallèles à l’expansion cytoplasmique médiane, puis fusionnent avec cette dernière, marquant ainsi la fin de la spermiogenèse. Ce processus de fusion, nommé fusion proximo- distale (« proximodistal fusion ») a été décrite pour la première fois par Justine (1991a). Absente chez les Turbellariés, elle est l’événement majeur de la spermiogenèse des Plathelminthes parasites ou Cercomeridea. Elle a pour principale conséquence la présence de microtubules dorsaux et ventraux dans la région principale (région nucléaire) du spermatozoïde. Considérée comme une synapomorphie caractéristique des Cercomeridea, mais pas des Neodermata (= Udonellidea + Cercomeridea) par Justine (1991a), elle a donc un grand intérêt phylogénétique. La fusion proximo-distale, ainsi que la rotation flagellaire (« flagellar rotation ») qui la précéde ont été décrites comme un processus asynchrone chez divers digènes dont un Dicrocoelidae, Dicrocoelium dendriticum (Cifrián et al., 1993), un Lecithodendriidae, Postorchigenes gymnesicus (Gracenea et al., 1997), un Opecoelidae, Opecoeloides furcatus (Miquel et al., 2000a), un Haploporidae, Saccocoelioides godoyi (Baptista-Farias et al., 2001), un Brachylaimidae, Scaphiostomum palaearcticum (Ndiaye et al., 2002), un Notocotylidae, Notocotylus neyrai (Ndiaye et al., 2003d) et deux Fasciolidae Fasciola gigantica et F.
    [Show full text]
  • Wildlife-Transmitted Taenia and Versteria Cysticercosis and Coenurosis in Humans and Other Primates
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2019 Wildlife-transmitted Taenia and Versteria cysticercosis and coenurosis in humans and other primates Deplazes, Peter ; Eichenberger, Ramon M ; Grimm, Felix Abstract: Wild mustelids and canids are definitive hosts of Taenia and Versteria spp. while rodents actas natural intermediate hosts. Rarely, larval stages of these parasites can cause serious zoonoses. In Europe, four cases of Taenia martis cysticercosis have been diagnosed in immunocompetent women, and two cases in zoo primates since 2013. In North America, a zoonotic genotype related but distinct from Versteria mustelae has been identified in 2014, which had caused a fatal infection in an orangutan and liver- disseminated cysticercoses in two severely immune deficient human patients in 2018, respectively. Addi- tionally, we could attribute a historic human case from the USA to this Versteria sp. by reanalysing a published nucleotide sequence. In the last decades, sporadic zoonotic infections by cysticerci of the canid tapeworm Taenia crassiceps have been described (4 in North America, 8 in Europe). Besides, 3 ocular cases from North America and one neural infection from Europe, all in immunocompetent patients, 6 cutaneous infections were described in severely immunocompromised European patients. Correspond- ingly, besides oral infections with taeniid eggs, accidental subcutaneous oncosphere establishment after egg-contamination of open wounds was suggested, especially in cases with a history of cutaneous injuries at the infection site. Taenia multiceps is mainly transmitted in a domestic cycle. Only five human co- enurosis cases are published since 2000. In contrast, T.
    [Show full text]
  • Helminths of Microtinae in Western Montana
    University of Montana ScholarWorks at University of Montana Graduate Student Theses, Dissertations, & Professional Papers Graduate School 1966 Helminths of Microtinae in western Montana John Michael Kinsella The University of Montana Follow this and additional works at: https://scholarworks.umt.edu/etd Let us know how access to this document benefits ou.y Recommended Citation Kinsella, John Michael, "Helminths of Microtinae in western Montana" (1966). Graduate Student Theses, Dissertations, & Professional Papers. 6581. https://scholarworks.umt.edu/etd/6581 This Thesis is brought to you for free and open access by the Graduate School at ScholarWorks at University of Montana. It has been accepted for inclusion in Graduate Student Theses, Dissertations, & Professional Papers by an authorized administrator of ScholarWorks at University of Montana. For more information, please contact [email protected]. HELMINTHS OF MICROTINAE IN WESTERN MONTANA by JOHN M. KINSELLA A.B* Bellarmine College, 1963 Presented in partial fulfillment of the requirements for the degree of Master of Arts UNIVERSITY OF MONTANA 1966 Approved by: Chairman, Board of Examiners Dean,/uraduate School MAY 1 : Date Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. UMI Number: EP37382 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will Indicate the deletion. UMT DUtsartaeion PuMiaNng UMI EP37382 Published by ProQuest LLC (2013). Copyright in the Dissertation held by the Author.
    [Show full text]
  • PARASITES of ALASKAN VERTEBRATES Host-Parasite Index
    PARASITES OF ALASKAN VERTEBRATES Host-Parasite Index Between DEPARTMENT OF THE ARMY and THE UNIVERSITY OF OKLAHOMA RESEARCH INSTITUTE NORMAN, OKLAHOMA November 1, 1965 PRINCIPAL INVESTIGATOR; Cluff E. Hopla Professor of Zoology Parasites of Alaskan Vertebrates by William L. Jellison, Ph.D., Research Scientist University of Oklahoma Research Institute Norman, Oklahoma (Home address: Hamilton, Montana) and Kenneth A. Neiland, Leader Disease and Parasite Studies Alaska Department of Fish and Game Anchorage, Alaska I I I I This host-parasite index has demanded much by way of time I and patience on the part of the authors. While not as complete as ariy of us desire, it does cover most of the pertinent literature I and brings together, under one cover, a surprising amount of information obtained in one area, which from the ecological view­ I point, is one of the most interesting in the Nearctic Region. I In a task such as this, good secretarial help is invaluable; I therefore, I take this opportunity to acknowledge the assistance of Mrs. Joyce Markman and Mrs. Gilda Olive. I Support in part by Federal Aid to Wildlife Restoration I Projects W-6-R and W-15-R is gratefully acknowledged. I Cluff E. Hopla Project Director I I II I I :, I I I i J I I I I TABLE OF CONTENTS I Page Introduction iii I Acknowledgements iv Host-Parasite List for Mammals 1 Insectivora 1 I Chiroptera 2 Carnivora 2 Pinnipedia 12 I Primates 16 Rodentia (Other than microtine rodents) 18 Microtine rodents (Voles, lemmings, muskrats) 21 Lagomorpha 29 I Artiodactyla 30 Cetacea
    [Show full text]
  • Echinococcus Multilocularis and Other Tapeworms in a Low Endemic Area
    The Role of Rodents in the Transmission of Echinococcus multilocularis and Other Tapeworms in a Low Endemic Area Andrea L. Miller Faculty of Veterinary Medicine and Animal Sciences Department of Biomedical Sciences and Veterinary Public Health Section for Parasitology Uppsala Doctoral Thesis Swedish University of Agricultural Sciences Uppsala 2016 Acta Universitatis Agriculturae Sueciae 2016:125 Cover: “Micro-focus” designed by Behdad Tarbiat for this thesis. Background field and feces photo provided by author. Water vole picture provided by Miloš Anděra. The water vole picture was used in part for Miller et al., 2016 and is used now with permission (Elsevier). Fox picture provided by Pål F. Moa, Nord universitet, (Reirovervåkningsprosjektet – hønsefugl). ISSN 1652-6880 ISBN (print version) 978-91-576-8753-1 ISBN (electronic version) 978-91-576-8754-8 © 2016 Andrea L. Miller, Uppsala Print: SLU Service/Repro, Uppsala 2016 The role of rodents in the transmission of Echinococcus multilocularis and other tapeworms in a low endemic environment Abstract Echinococcus multilocularis is zoonotic tapeworm in the Taeniidae family with a two part lifecycle involving a canid definitive host and a rodent intermediate host. The work of this thesis followed the first identification E. multilocularis in Sweden in 2011 in a red fox (Vulpes vulpes). The main purpose was to describe the importance of the rodents for E. multilocularis transmission in Sweden. Echinococcus multilocularis was identified in both the water vole (Arvicola amphibius) and the field vole (Microtus agrestis), but not the bank vole (Myodes glareolus) or mice (Apodemus spp). As the number of E. multilocularis positive rodents was low (n=9), the examination of other taeniid parasites was used to investigate overall parasite transmission patterns.
    [Show full text]
  • Molecular Identification of Taenia Mustelae Cysts in Subterranean Rodent Plateau Zokors (Eospalax Baileyi)
    Zoological Research 35 (4): 313−318 DOI:10.13918/j.issn.2095-8137.2014.313 Molecular identification of Taenia mustelae cysts in subterranean rodent plateau zokors (Eospalax baileyi) Fang ZHAO1,#, Jun-Ying MA2,#, Hui-Xia CAI2, Jian-Ping SU1, Zhi-Bin HOU3, Tong-Zuo ZHANG1, 1,* Gong-Hua LIN 1. Key Laboratory of Adaptation and Evolution of Plateau Biota, Northwest Institute of Plateau Biology, Chinese Academy of Sciences, Xining 810008, China 2. Qinghai Institute for Endemic Disease Prevention and Control, Xining 811602, China 3. Xining No.2 People’s Hospital of Qinghai Province, Xining 810003, China Abstract: Cestode larvae spend one phase of their two-phase life cycle in the viscera of rodents, but cases of cestodes infecting subterranean rodents have only been rarely observed. To experimentally gain some insight into this phenomenon, we captured approximately 300 plateau zokors (Eospalax baileyi), a typical subterranean rodent inhabiting the Qinghai-Tibet Plateau, and examined their livers for the presence of cysts. Totally, we collected five cysts, and using a mitochondrial gene (cox1) and two nuclear genes (pepck and pold) as genetic markers, we were able to analyze the taxonomy of the cysts. Both the maximum likelihood and Bayesian methods showed that the cysts share a monophyly with Taenia mustelae, while Kimura 2-parameter distances and number of different sites between our sequences and T. mustelae were far less than those found between the examined sequences and other Taeniidae species. These results, alongside supporting paraffin section histology, imply that the cysts found in plateau zokors can be regarded as larvae of T. mustelae, illustrating that zokors are a newly discovered intermediate host record of this parasite.
    [Show full text]