Manuscript Click here to download Manuscript PARE-D-18-00689- Revised-version.doc Click here to view linked References 1 Severe parasitism by Versteria mustelae (Gmelin, 1790) in the critically 1 2 3 2 endangered European mink Mustela lutreola (Linnaeus, 1761) in Spain 4 5 3 6 7 4 Christine Fournier-Chambrillon1, Jordi Torres2,3, Jordi Miquel2,3, Adrien André4, Johan Michaux4, Karin 8 9 5 Lemberger5, Gloria Giralda Carrera6, Pascal Fournier1 10 11 6 1 Groupe de Recherche et d’Etude pour la Gestion de l’Environnement, Route de Préchac, 33730 Villandraut, 12 13 7 France (CFC ORCID: 0000-0002-9365-231X). 14 15 8 2 Departament de Biologia, Sanitat i Medi ambient, Universitat de Barcelona, Av. Joan XXIII, sn, 08028 16 17 9 Barcelona, Spain (JT ORCID: 0000-0002-4999-0637; JM ORCID: 0000-0003-1132-3772). 18 19 3 Institut de Recerca de la Biodiversitat, Universitat de Barcelona, Av. Diagonal 645, 08028 Barcelona, Spain 20 10 21 4 22 11 Université de Liège, Laboratoire de génétique de la conservation, GeCoLAB, Chemin de la Vallée 4, 4000 23 24 12 Liège, Belgium 25 5 26 13 Vetdiagnostics, 14 avenue Rockefeller, 69008 Lyon, France 27 6 28 14 Sección de Gestión de la Comarca Pirenaica, Gobierno de Navarra, C/ González Tablas 9, 31005 Pamplona, 29 30 15 Spain 31 32 16 33 34 17 Corresponding author: 35 36 18 Christine FOURNIER-CHAMBRILLON 37 38 19 GREGE, Route de Préchac, 33730 VILLANDRAUT, France 39 40 20 Tel.: + (33) 5 56 25 86 54 41 42 21 Email: [email protected] 43 44 22 45 46 23 Acknowlegments 47 48 24 The necropsies program was funded by the “Departamento de Desarrollo Rural, Medio Ambiente y 49 50 25 Administración Local del Gobierno de Navarra” and the carcasses were collected by the “Sección de Hábitats y 51 52 26 Sección de Guarderío de Gobierno de Navarra, Equipo de Biodiversidad de Gestión Ambiental de Navarra S.A.” 53 54 27 We thank two anonymous reviewers for their very constructive recommendations. 55 56 28 57 58 29 59 60 61 62 63 64 1 65 30 Abstract 1 2 31 The riparian European mink (Mustela lutreola), currently surviving in only three unconnected 3 4 5 32 sites in Europe, is now listed as a critically endangered species in the IUCN Red List of 6 7 33 Threatened species. Habitat loss and degradation, anthropogenic mortality, interaction with the 8 9 10 34 feral American mink (Neovison vison), and infectious diseases are among the main causes of its 11 12 35 decline. In the Spanish Foral Community of Navarra, where the highest density of M. lutreola 13 14 36 in its western population has been detected, different studies and conservation measures are 15 16 17 37 ongoing, including health studies on European mink, and invasive American mink control. We 18 19 38 report here a case of severe parasitism with progressive physiological exhaustion in an aged 20 21 22 39 free-ranging European mink female, which was accidentally captured and subsequently died in 23 24 40 a live-trap targeting American mink. Checking of the small intestine revealed the presence of 25 26 27 41 seventeen entangled Versteria mustelae worms. To our knowledge, this is the first description 28 29 42 of hyperinfestation by tapeworms in this species. 30 31 43 32 33 34 44 Key words: critically endangered, severe parasitism, Mustela lutreola, physiological 35 36 45 exhaustion, Spain, Versteria mustelae. 37 38 39 46 40 41 47 Introduction 42 43 44 48 The European mink, Mustela lutreola (Linnaeus, 1761), a small semiaquatic mustelid, has 45 46 49 suffered a dramatic decline over the last 150 years and is now listed as critically endangered 47 48 49 50 (Maran et al. 2016). Remaining populations are currently distributed in well-separated nuclei, 50 51 51 in Northern Spain and Southwestern France, in Romania, in Ukraine and in Russia. These 52 53 52 populations are still declining due to several factors, including anthropic pressure (e.g. habitat 54 55 56 53 loss and degradation, vehicle collisions, accidental trapping, dog predation, hunting), 57 58 54 interspecific competition with the alien invasive American mink (Neovison vison), and 59 60 61 62 63 64 2 65 55 infectious diseases. In recent years numerous studies on ecology, health status, and 1 2 56 conservation genetics have been conducted on the western population of European mink to 3 4 5 57 better understand the causes of its decline and to propose conservation measures (Michaux et 6 7 58 al. 2005; Fournier et al. 2008; Philippa et al. 2008; Fournier-Chambrillon et al. in press). 8 9 10 59 Several parasitological surveys have allowed a thorough characterization of the helminth fauna 11 12 60 of the species, which showed that cestodes rarely infected this riparian mustelid, and if at all, 13 14 61 only in low numbers (Shimalov et al. 1993; Sidorovich and Bychkova 1993; Torres et al. 2003, 15 16 17 62 2008). The case reported here provides novel information about the potentially fatal impact of 18 19 63 tapeworms on European mink, specifically of severe infestation by Versteria mustelae (Gmelin, 20 21 22 64 1790). The genus Versteria was recently proposed by Nakao et al. (2013), being V. mustelae 23 24 65 the type species, which has several synonyms: Taenia mustelae, Fimbriotaenia mustelae and 25 26 27 66 Taenia tenuicollis. 28 29 67 30 31 68 Materials and methods 32 33 34 69 The highest density of M. lutreola in its western population was detected in 2004 in the 35 36 70 Spanish Foral Community of Navarra, where a health survey was initiated by the government 37 38 39 71 (Ceña et al. 2005; Fournier-Chambrillon et al. in press). Recent data of American mink in 40 41 72 Navarra led the government to control its invasion using mink rafts (Reynolds et al. 2004). 42 43 44 73 One free-ranging European mink female accidentally captured on November 2016 on the 45 46 74 river Ega, was found dead in a live-trap targeting the invasive species. It was kept frozen until 47 48 49 75 necropsy performed shortly thereafter. Biometric and biological parameters were recorded, 50 51 76 age class estimated through dental wear and calculus, and reproductive status determined by 52 53 77 external examination and uteri analysis (Fournier-Chambrillon et al. 2010). A range of 54 55 56 78 samples was taken for genetic, virological, bacteriological and histological studies, following 57 58 79 the usual protocol established for necropsies. 59 60 61 62 63 64 3 65 80 This female revealed numerous macroscopically visible intestinal tapeworms and 1 2 81 nasolacrimal sinuses parasitism by metastrongylid nematodes. These parasites were removed 3 4 5 82 and transferred to vials containing 70% ethanol. The stomach, intestine and lungs were 6 7 83 additionally checked under a stereoscopic microscope. All helminths found were processed 8 9 10 84 according to classical helminthological methods, identified on the basis of previous 11 12 85 descriptions, and counted. Some little hooks compatible with those of V. mustelae were 13 14 86 observed on the tapeworms, although intact scolices could not be found. Therefore, a molecular 15 16 17 87 identification was performed following the protocol described in Torres et al. (2016) with these 18 19 88 modifications: the primers used were the ones designed by Bowles et al. (1992) (Forward 5'- 20 21 22 89 TTTTTTGGGCATCCTGAGGTTTAT-3'; Reverse: 5'- 23 24 90 TAAAGAAAGAACATAATGAAAATG -3’), with an annealing temperature of 50°C. The 25 26 27 91 resulting sequence has been deposited in GenBank under the accession number MH431789; 28 29 92 and compared to previously published GenBank sequences. 30 31 93 32 33 34 94 Results and Discussion 35 36 95 Necropsy revealed a cachectic relatively old female of 402 g in state of physiological 37 38 39 96 exhaustion and without any traumatic lesion. No sign of recent lactation was observed, and 40 41 97 absence of placental scars could not be interpreted because of rapid disappearance at this time 42 43 44 98 of year due to tissue regeneration. Internal exam revealed congestion of all abdominal organs, 45 46 99 and a pale almost translucent hepatic parenchyma. The other major macroscopic lesion was a 47 48 49 100 mass of entangled tapeworms in the small intestine (Fig. 1). After incision, thickening of the 50 51 101 gastrointestinal wall was observed, with presence of greenish to black mucus in the stomach, 52 53 102 black rectal content suggesting digested blood, and diffuse congestion of the gastrointestinal 54 55 56 103 mucosa. Opening of the skull revealed mild brain congestion and the presence of numerous 57 58 104 metastrongylid nematodes in the nasolacrimal sinuses with ventral osseous deformation and 59 60 61 62 63 64 4 65 105 right dorsal cranial perforation. Helminthological study concretely revealed the presence of 17 1 2 106 tapeworms (V. mustelae) and 10 Molineus patens in the small intestine as well as 18 3 4 5 107 Skrjabingylus nasicola in the nasolacrimal sinuses. Mitochondrial COI gene sequence obtained 6 7 108 from the tapeworms presented a 99 % homology with the previously published GenBank V. 8 9 10 109 mustelae sequence (AJ544880.1). Only one out of the 381 bases differed between the two 11 12 110 sequences (Fig. 2). In contrast, our sequence matched the Taenia martis sequence with a lower 13 14 111 identity score of 85%. In addition, both species are easily distinguished by the size of their 15 16 17 112 hooks, which in T.