Scathophagidae

Total Page：16

File Type：pdf, Size：1020Kb

Cornell University Insect Collection SCATHOPHAGIDAE Determined Species: 61 Emily Satinsky Updated: April 20, 2015 Subfamily Tribe Genus Species Author Zoogeography Delininae Americina adusta (Loew 1863) NEA Scathophaginae Amaurosomini Orthacheta cornuta (Loew 1863) NEA hirtipes Johnson 1927 NEA Cleigastrini Cleigastra apicalis (Meigen 1826) PAL Gonarcticus arcticus (Becker 1907) NEA Megaphthalma pallida (Fallen 1819) NEA/PAL unilineata (Zetterstedt 1838) NEA Cordilurini Bucephalina setipes (Coquillett 1910) NEA Gimnomerini Gimnomera cerea (Coquillett 1908) Hydromyzini Chaetosa punctipes (Meigen 1826) NEA/PAL Hydromyza confluens Loew 1863 NEA Okeniella dasyprocta (Loew 1864) NEA Plethochaeta varicolor Coquillett 1901 Pogonota barbata (Zetterstedt 1838) NEA pallida Malloch 1931 NEA Spaziphora cincta (Loew 1863) NEA hydromyzina (Fallen 1819) PAL Microprosopini Acanthocnema capillata (Loew 1872) NEA Microprosopa flavinervis Malloch 1924 NEA haemorrhoidalis (Meigen 1826) NEA Trichopalpus palpalis (Coquillett 1898) NEA Scathophagini Ceratinostoma ostiorum (Curtis 1832) NEA Scathophaga aldrichi (Malloch 1920) NEA apicalis (Curtis 1835) NEA dasythrix (Becker 1894) NEA furcata (Say 1823) NEA incola (Becker 1900) NEA inquinata (Meigen 1826) PAL intermedia Walker 1849 NEA lutaria (Fabricius 1794) PAL nigrolimbata (Cresson 1918) NEA obscura (Fallen 1819) PAL obscurinervis (Becker 1900) NEA reses (Giglio-Tos 1893) NEO stercoraria (Linnaeus 1758) NEA/PAL suilla (Fabricius 1794) NEA/PAL Stomoxyini Cordilura angustifrons Loew 1863 NEA carbonaria (Walker 1849) NEA confusa Loew 1863 NEA dimidiata (Cresson 1918) NEA emarginata (Malloch 1923) NEA fuscipes Zetterstedt 1838 NEA gagatina Loew 1870 NEA glabra Loew 1870 NEA gracilipes Loew 1870 NEA latifrons Loew 1870 NEA ontario Curran 1929 NEA picticornis Loew 1864 NEA pleuritica Loew 1863 NEA praeusta Loew 1864 NEA pudica Meigen 1826 NEA setosa Loew 1860 NEA variabilis Loew 1876 NEA varipes (Walker 1849) NEA spp. NEA incertae sedis Cordylurella nebulosa (Coquillett 1898) NEA Nanna brunneicosta (Johnson 1927) NEA inermis (Becker 1894) PAL similis (Coquillett 1902) NEA Neorthacheta dissimilis (Malloch 1924) NEA Norellia armipes (Meigen 1826) PAL spinipes (Meigen 1826) PAL .

Copy Link

Recommended publications

20 4 423 430 Ozerov (Spaziphora) for Inet.Pmd
Russian Entomol. J. 21(1): 423430 © RUSSIAN ENTOMOLOGICAL JOURNAL, 2012 A review of the World species of the genus Spaziphora Rondani, 1856 (Diptera: Scathophagidae) Îáçîð âèäîâ ðîäà Spaziphora Rondani, 1856 (Diptera: Scathophagidae) ìèðîâîé ôàóíû A.L. Ozerov À.Ë. Îçåðîâ Zoological Museum, Moscow Lomonosov State University, Bolshaya Nikitskaya 6, Moscow 125009, Russia. E-mail: [email protected] Çîîëîãè÷åñêèé ìóçåé, Ìîñêîâñêèé ãîñóäàðñòâåííûé óíèâåðñèòåò èì. Ì.Â. Ëîìîíîñîâà, Áîëüøàÿ Íèêèòñêàÿ óë., 6, Ìîñêâà 125009, Ðîññèÿ. KEY WORDS: Diptera, Scathophagidae, Spaziphora, new species. ÊËÞ×ÅÂÛÅ ÑËÎÂÀ: Diptera, Scathophagidae, Spaziphora, íîâûé âèä. ABSTRACT. Flies of the genus Spaziphora Ron- While determining materials of Scathophagidae from dani, which includes three species in the World, are Chukotka, collected by P.S.Tomkovich in 2011 I dis- reviewed. One of them, new to science, Spaziphora co-vered one more undescribed species of Spaziphora. tomkovichi, is described and the other species are rede- Genus diagnosis, a description of a new species and scribed. Genus diagnosis, keys for determination of redescriptions of the other species, key for determina- species and data on distribution are summarized. tion of species are given below. Terminology follows McAlpine [1981] and Cumming et ÐÅÇÞÌÅ. Ðåâèçîâàíû äâóêðûëûå ðîäà Spazi- al. [2009]. The following abbreviations are used for deposi- phora Rondani, êîòîðûé âêëþ÷àåò òðè âèäà â ìèðî- tories of the studied specimens: CNC Canadian National âîé ôàóíå. Ïðèâåäåíî îïèñàíèå Spaziphora tomko- Collection of Insects, Ottawa, Canada; MCZ Museum of vichi, íîâîãî äëÿ íàóêè âèäà è ïåðåîïèñàíèå îñ- Comparative Zoology, Harvard University, Cambridge, Mas- sachusetts, USA; MNHN Muséum National dHistoire òàëüíûõ âèäîâ ðîäà. Äàíû äèàãíîç ðîäà è êëþ÷ äëÿ Naturelle, Paris, France; MZLU Lund University, Lund, îïðåäåëåíèÿ âèäîâ Spaziphora, à òàêæå ñóììèðîâà- Sweden; NMW Naturhistorisches Museum, Wien, Aus- íû äàííûå ïî ðàñïðîñòðàíåíèþ âèäîâ.
[Show full text]
Next-Generation Barcoding of Bulked Arthropod Samples
We’re getting there: a first look at (cheap!) next-generation barcoding of bulked arthropod samples Matt Bowser1 Eighth annual meeting of the Alaska Entomological Society January 24, 2015 Fairbanks, Alaska 1USFWS Kenai National Wildlife Refuge, [email protected] Outline • Background: working through the taxonomic impediment • Conventional (morphological) workflow • Classical DNA barcoding workflow • Next-gen DNA barcoding workflow • A trial of NGS methods on bulked samples • Methods • Results • Discussion Conventional Workflow Classical DNA Barcoding Workflow TACCTTATACTTCTTATTTGGAGCTTGAGCTGGAATAGT AGGAACTTCTTTAAGTATCTTAATTCGAGCCGAATTAGG ACATCCAGGAGCCTTAATTGGAGATGACCAAATTTATAA CGTAATTGTAACTGCCCATGCTTTTGTCATAATTTTTTT TATAGTTATACCTATTATAATTGGTGGATTTGGAAATTG ATTGGTACCCTTAATATTAGGAGCTCCAGATATAGCATT TCCTCGAATAAATAATATAAGCTTCTGAATACTTCCCCC TTCTCTTACGCTACTATTAATGAGCAGTATAGTTGAAAA TGGGGCTGGTACAGGTTGAACTGTATACCCTCCCCTATC TTCCACTATTGCACATGGGGGAGCTTCAGTTGATTTAGC AATTTTTAGTTTACATCTAGCTGGAATTTCATCTATTTT AGGAGCTGTAAATTTTATTACTACAGTAATTAATATACG TTCTAACGGAATTACTTTTGATCGAATACCCCTATTTGT TTGATCGGTAGTAATTACAGCTCTTTTATTACTATTGTC TTTACCTGTATTGGCTGGAGCAATTACAATATTACTTAC AGACCGAAATTTAAATACTTCTTTTTTTGACCCCGCTGG AGGAGGAGATCCAATTTTATACCAACATTTATTT Next-Gen DNA Barcoding Workflow Methods: field 3 samples, all from Headquarters Lake, Soldotna • 2 sweep net (one 100 m2 circular plot split in half), 16.Sept.2013 KNWR:Ento:10656, KNWR:Ento:10657 • 1 malaise (leftovers), 27-28.June.2011 KNWR:Ento:7114 Methods: lab • Vial contents recorded (quick, coarse identifications).
[Show full text]
The Annals of Scottish Natural History
RETURN TO LIBRARY OF MARINE BIOLOGICAL LABORATORY WOODS HOLE, MASS. LOANED BY AMERICAN MUSEUM OF NATURAL HISTORY t The Annals OF Scottish Natural History A QUARTERLY MAGAZINE \V1TH WHICH IS INCORPORATED CIjc Naturalist EDITED BY ]. A. HARV IE-BROWN, F.R.S.E., F.Z.S. MEMBER OF THE BRITISH ORNITHOLOGISTS' UNION JAMES W. H. TRAIL, M.A., M.D., F.R.S., F.L.S. PROFESSOR OF BOTANY IN THE UNIVERSITY OF ABERDEEN AND WILLIAM EAGLE CLARKE, F.L.S., MEM. BRIT. ORN. UNION NATURAL HISTORY DEPARTMENT, Ml'SEUM OF SCIENCE AND ART, EDINBURGH IQOO EDINBURGH DAVID DOUGLAS, CASTLE STREET LONDON: R. H. PORTER, 7 PRINCES ST., CAVENDISH SQUARE The Annals of Scottish Natural History NO. 33] 1900 [JANUARY A FEW NOTES ON THE WORKING OF THE WILD BIRDS PROTECTION ACT (1894) By WILLIAM BERRY, B.A., LL.B. THE Wild Birds Protection Act of 1894 has now been in operation within one district of Fifeshire for three complete seasons. Even after such a short period as this, though great results cannot yet be looked for, some distinct effect and are to be seen and it be improvement already ; may interesting, ' such as they are, to have them recorded in the Annals.' The district referred to lies in the north-east of the ' ' and is as the Tentsmuir about a third county, known ; of it has been under the writer's pretty constant supervision since the autumn of I 890. For some time before that this moor, which is naturally very attractive to many species of wild birds, had not been sufficiently watched or protected, and in the absence of this had become a happy hunting- ground for egg-gatherers, who regularly searched it for eggs, and gathered every egg they could find.
[Show full text]
(Diptera: Scathophagidae) of Russia Обзор Видов Рода Trichopalpus
Russian Entomol. J. 28(4): 470–484 © RUSSIAN ENTOMOLOGICAL JOURNAL, 2019 A review of the genus Trichopalpus Rondani, 1856 (Diptera: Scathophagidae) of Russia Îáçîð âèäîâ ðîäà Trichopalpus Rondani, 1856 (Diptera: Scathophagidae) ôàóíû Ðîññèè A.L. Ozerov À.Ë. Îçåðîâ Zoological Museum, Lomonosov Moscow State University, Bol’shaya Nikitskaya 2, Moscow 125009, Russia. E-mail: [email protected] Зоологический музей, Московский государственный университет им. М.В. Ломоносова, Большая Никитская ул., 2, Москва 125009, Россия. KEY WORDS: Diptera, Scathophagidae, Trichopalpus, Russia, review, new synonyms, new combination, key. КЛЮЧЕВЫЕ СЛОВА: Diptera, Scathophagidae, Trichopalpus, Россия, обзор, новые синонимы, новая комбинация, определительная таблица. ABSTRACT. Flies of the genus Trichopalpus Ron- punctipes Meigen, 1826. Becker [1894] as well as dani, 1856 of Russia, which includes 6 species, are Rondani considered these both species in the genus reviewed. Generic and species descriptions and keys Trichopalpus. Coquillett [1898] described the genus for determination of species are given, and data on Chaetosa, transferred punctipes to this genus and desi- distributions are summarized. Two new synonyms are gnated this species as type-species of Chaetosa. In the proposed: Chaetosa Coquillett, 1898 and Huckettia same work, he described another genus, Opsiomyia, Vockeroth, 1995 with Trichopalpus Rondani, 1856. with the North American species O. palpalis Coquil- Microprosopa lacteipennis Ringdahl, 1920 is trans- lett, 1898. Curran [1927] described the species nigriba- ferred to the genus Trichopalpus. sis Curran, 1927 in the genus Trichopalpus. Ringdahl [1936] described the species pilirostris Ringdahl, 1936 РЕЗЮМЕ. Дан обзор двукрылых рода Tricho- in the genus Chaetosa. He also described the subgenus palpus Rondani, 1856 фауны России, включающего Paramicroprosopa with the species subarctica Ring- 6 видов.
[Show full text]
Calyptratae: Diptera)
BUILDING THE TREE OF LIFE: RECONSTRUCTING THE EVOLUTION OF A RECENT AND MEGADIVERSE BRANCH (CALYPTRATAE: DIPTERA) SUJATHA NARAYANAN KUTTY (B.Tech) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE 2008 The great tragedy of Science - the slaying of a beautiful hypothesis by an ugly fact. - Thomas H. Huxley ii ACKNOWLEDGEMENTS We don't accomplish anything in this world alone... and whatever happens is the result of the whole tapestry of one's life and all the weavings of individual threads from one to another that creates something - Sandra Day O'Connor. The completion of this project would have been impossible without help from so many different quarters and the few lines of gratitude and acknowledgements written out in this section would do no justice to the actual amount of support and encouragement that I have received and that has contributed to making this study a successful endeavor. I am indebted to Prof. Meier for motivating me to embark on my PhD (at a very confusing point for me) and giving me a chance to explore a field that was quite novel to me. I express my sincere gratitude to him for all the guidance, timely advice, pep talks, and support through all the stages of this project and for always being patient while dealing with my ignorance. He has also been very understanding during all my non- academic distractions in the last two years. Thanks Prof.- your motivation and inspiration in the five years of my graduate study has given me the confidence to push the boundaries of my own capabilities.
[Show full text]
Diptera) in Central Europe, with New Faunistics Data on Some Species
©Biologiezentrum Linz, Austria; download unter www.zobodat.at Linzer biol. Beitr. 50/2 1635-1655 17.12.2018 Annotated checklist of the family Scathophagidae (Diptera) in Central Europe, with new faunistics data on some species František ŠIFNER A b s t r a c t : Check-list of the family Scathophagidae has been compiled for the following Central European countries, and the following species numbers are given: Austria 69 species, Czech Republic 89 species, Germany 59 species, Hungary 40 species, Poland 67 species, Slovakia 64 species and Switzerland 46 species. Until 2017, 118 species in 42 genera are known from the Central Europe, i.e. approximately 70% of species known from Europe. Scathophaga analis (MEIGEN, 1826) is confirmed as valid species and one new synonymy is established, Scathophaga bohemiae ŠIFNER, 2000 syn. nov. = Scathophaga analis. New faunistic data from the Central Europe and from some other European countries are added, including the following new records: Mirekiana anthrax (SCHINER, 1864) from Montenegro, Cordilura umbrosa (LOEW, 1873) from Turkey, Norellisoma nervosum (MEIGEN, 1826) from Italy, and Scathophaga inquinata (MEIGEN, 1826) from Albania. K e y w o r d s : Diptera, Scathophagidae, taxonomy, faunistics, number of species, Centrale Europe, Palaearctic Region. Introduction Notes to the geological evolution and a geographic characteristics of Central Europe The whole Europe, and the Central Europe especially, passed a complicated geological and climatic changes in the course of evolution. In the first place the Mesozoic and Tertiary mountain-building processes, the Miocene marine transgression period and the continental Quaternaly glaciations during which the Scandinavia developed glacial cover extending into the Central Europe up to Sudeten and Carpathians.
[Show full text]
Manual of the Families and Genera of North American Diptera
iviobcow,, Idaho. tvl • Compliments of S. W. WilliSTON. State University, Lawrence, Kansas, U.S.A. Please acknowledge receipt. \e^ ^ MANUAL FAMILIES AND GENERA ]^roRTH American Diptera/ SFXOND EDITION REWRITTEN AND ENLARGED SAMUEL W^' WILLISTON, M.D., Ph.D. (Yale) PROFESSOR OF PALEONTOLOGY AND ANATOMY UNIVERSITY OF KANSAS AUG 2 1961 NEW HAVEN JAMES T. HATHAWAY 297 CROWN ST. NEAR YALE COLLEGE 18 96 Entered according to Act of Congress, in the year 1896, Bv JAMES T. HATHAWAY, In the office of the Librarian of Congress, at Washington. PREFACE Eight years ago the author of the present work published a small volume in which he attempted to tabulate the families and more important genera of the diptera of the United States. From the use that has been made of that work by etitomological students, he has been encouraged to believe that the labor of its preparation was not in vain. The extra- ordinary activity in the investigation of our dipterological fauna within the past few years has, however, largely destroy- ed its usefulness, and it is hoped that this new edition, or rather this new work, will prove as serviceable as has been the former one. In the present work there has been an at- tempt to include all the genera now known from north of South America. While the Central and West Indian faunas are preeminently of the South American type, there are doubt- less many forms occurring in tlie southern states that are at present known only from more southern regions. In the preparation of the work the author has been aided by the examination, so far as he was able, of extensive col- lections from the West Indies and Central America submitted to him for study by Dr.
[Show full text]
Dipterists Forum
BULLETIN OF THE Dipterists Forum Bulletin No. 84 Autumn 2017 Affiliated to the British Entomological and Natural History Society Bulletin No. 84 Autumn 2017 ISSN 1358-5029 Editorial panel Bulletin Editor Darwyn Sumner Assistant Editor Judy Webb Dipterists Forum Officers Chairman Rob Wolton Vice Chairman Howard Bentley Secretary Amanda Morgan Meetings Treasurer Phil Brighton Please use the Booking Form downloadable from our website Membership Sec. John Showers Field Meetings Field Meetings Sec. vacancy Now organised by several different contributors, contact the Secretary. Indoor Meetings Sec. Martin Drake Publicity Officer Erica McAlister Workshops & Indoor Meetings Organiser Conservation Officer vacant Martin Drake [email protected] Ordinary Members Bulletin contributions Stuart Ball, Malcolm Smart, Peter Boardman, Victoria Burton, Please refer to guide notes in this Bulletin for details of how to contribute and send your material to both of the following: Tony Irwin, Martin Harvey, Chris Raper Dipterists Bulletin Editor Unelected Members Darwyn Sumner 122, Link Road, Anstey, Charnwood, Leicestershire LE7 7BX. Dipterists Digest Editor Peter Chandler Tel. 0116 212 5075 [email protected] Secretary Assistant Editor Amanda Morgan Judy Webb Pennyfields, Rectory Road, Middleton, Saxmundham, Suffolk, IP17 3NW 2 Dorchester Court, Blenheim Road, Kidlington, Oxon. OX5 2JT. [email protected] Tel. 01865 377487 [email protected] Treasurer Phil Brighton [email protected] Dipterists Digest contributions Deposits for DF organised field meetings to be sent to the Treasurer Dipterists Digest Editor Conservation Peter Chandler Robert Wolton (interim contact, whilst the post remains vacant) 606B Berryfield Lane, Melksham, Wilts SN12 6EL Tel. 01225-708339 Locks Park Farm, Hatherleigh, Oakhampton, Devon EX20 3LZ [email protected] Tel.
[Show full text]
ABSTRACT BAYLESS, KEITH MOHR. Phylogenomic Studies of Evolutionary Radiations of Diptera
ABSTRACT BAYLESS, KEITH MOHR. Phylogenomic Studies of Evolutionary Radiations of Diptera. (Under the direction of Dr. Brian M. Wiegmann.) Efforts to understand the evolutionary history of flies have been obstructed by the lack of resolution in major radiations. Diptera is a highly diverse branch on the tree of life, but this diversity accrued at an uneven pace. Some of radiations that contributed disproportionately to species diversity occurred contemporaneously, and understanding the relationships of these taxa can illuminate broad scale patterns. Relationships between some subordinate groups of taxa are notoriously difficult to untangle, and genomic data will address these problems at a new scale. This project will focus on two major radiations in Diptera: Tabanus horse flies and relatives, and acalyptrate Schizophora. Tabanus includes over one thousand species. Synthesis focused research on the group is stymied by its species richness, worldwide distribution, inconsistent diagnosis, and scale of undescribed diversity. Furthermore, the genus may be non-monophyletic with respect to more than 10 other lineages of horse flies. A groundwork phylogenetic study of worldwide Tabanus is needed to understand the evolution of this lineage and to make comprehensive taxonomic projects manageable. Data to address this question was collected from two different sources. A dataset including five genes was sequenced from ninety-four species in the Tabanus group, including nearly all genera of Tabanini and at least one species from every biogeographic region. Then a new data source from a next generation sequencing approach, Anchored Hybrid Enrichment exome capture, was used to accumulate a dataset including hundreds of genes for a subset of the taxa.
[Show full text]
Sensitivity Analysis, Molecular Systematics and Natural History Evolution of Scathophagidae (Diptera: Cyclorrhapha: Calyptratae)
Kutty, S N; Bernasconi, M V; Sifner, F; Meier, R (2007). Sensitivity analysis, molecular systematics and natural history evolution of Scathophagidae (Diptera: Cyclorrhapha: Calyptratae). Cladistics, 23(1):64-83. Postprint available at: http://www.zora.uzh.ch University of Zurich Posted at the Zurich Open Repository and Archive, University of Zurich. Zurich Open Repository and Archive http://www.zora.uzh.ch Originally published at: Cladistics 2007, 23(1):64-83. Winterthurerstr. 190 CH-8057 Zurich http://www.zora.uzh.ch Year: 2007 Sensitivity analysis, molecular systematics and natural history evolution of Scathophagidae (Diptera: Cyclorrhapha: Calyptratae) Kutty, S N; Bernasconi, M V; Sifner, F; Meier, R Kutty, S N; Bernasconi, M V; Sifner, F; Meier, R (2007). Sensitivity analysis, molecular systematics and natural history evolution of Scathophagidae (Diptera: Cyclorrhapha: Calyptratae). Cladistics, 23(1):64-83. Postprint available at: http://www.zora.uzh.ch Posted at the Zurich Open Repository and Archive, University of Zurich. http://www.zora.uzh.ch Originally published at: Cladistics 2007, 23(1):64-83. Sensitivity analysis, molecular systematics and natural history evolution of Scathophagidae (Diptera: Cyclorrhapha: Calyptratae) Abstract The 60 000 described species of Cyclorrhapha are characterized by an unusual diversity in larval life-history traits, which range from saprophagy over phytophagy to parasitism and predation. However, the direction of evolutionary change between the different modes remains unclear. Here, we use the Scathophagidae (Diptera) for reconstructing the direction of change in this relatively small family ( 250 spp.) whose larval habits mirror the diversity in natural history found in Cyclorrhapha. We subjected a molecular data set for 63 species (22 genera) and DNA sequences from seven genes (12S, 16S, Cytb, COI, 28S, Ef1-alfa, Pol II) to an extensive sensitivity analysis and compare the performance of three different alignment strategies (manual, Clustal, POY).
[Show full text]
Current Management Plan
Portsdown Hill and Portchester Common S.S.S.I. 5 year Higher Level Stewardship Management Plan for Portchester Common 2018 - 2022 Commenced February 2018 Next review Jan 2022 Contents 0.1 Preamble 4 0.2 Summary 4 DESCRIPTION 5 1.1 General information 5 1.1.1 Location 5 1.1.2 Tenure 6 1.1.3 Management Infrastructure 6 1.1.4 Compartments 6 1.2 Environmental Information 6 1.2.1 Physical 6 1.2.1.1 Climate 6 1.2.1.2 Geology 7 1.2.1.3 Soil 7 1.2.2 Biological 7 1.2.2.1 Flora 7 1.2.2.2 Fauna 8 1.2.2.2.1 Invertebrates 8 1.2.2.2.2 Vertebrates 9 1.2.2.3 Communities 9 1.2.3 Cultural 10 1.2.3.1 Archaeology/past land use 10 1.2.3.2 Past Conservation management 11 1.2.4 Environmental relationships which may have implications for management 11 1.2.4.1 General considerations of calcareous grassland Error! Bookmark not defined. 1.2.4.2 Coarse grassland 11 1.2.4.2.1 Grazing - summary of ecological considerations 16 1.2.4.3 Scrub 16 1.2.4.3.1 Hedges 17 1.2.4.5 Species considerations 18 1.3 Bibliography 19 PART 2 EVALUATION AND OBJECTIVES 21 2.1 Evaluation of features 21 2.1.1 Evaluation 21 2.1.1.1 Size 21 2.1.1.2 Diversity 21 2.1.1.3 Potential 21 2.1.1.4 Intrinsic value 22 2.1.3 Summary of Important Features 22 2.1.4 Long-term /Ideal Management Objectives 23 2.2 Factors influencing the achievement of long term management objectives 23 2.2.1 Owners objectives Error! Bookmark not defined.
[Show full text]
1 Appendix 3. Nahanni National Park Taxonomy Report
Appendix 3. Nahanni National Park Taxonomy Report Class Order Family Genus Species Arachnida Araneae Araneidae Araneus Araneus trifolium Hypsosinga Hypsosinga rubens Clubionidae Clubiona Clubiona furcata Dictynidae Dictyna Dictyna arundinacea Gnaphosidae Orodrassus Orodrassus canadensis Linyphiidae Ceraticelus Ceraticelus atriceps Dismodicus Dismodicus decemoculatus Entelecara Entelecara sombra Grammonota Grammonota angusta Hilaira Hilaira canaliculata Hypselistes Hypselistes florens Hypselistes jacksoni Pityohyphantes Pityohyphantes subarcticus Lycosidae Pardosa Pardosa hyperborea Pardosa moesta Pardosa xerampelina Philodromidae Philodromus Philodromus peninsulanus 1 Philodromus rufus vibrans Salticidae Eris Eris militaris Sitticus Sitticus finschi Tetragnathidae Tetragnatha Tetragnatha shoshone Theridiidae Dipoena Dipoena nigra Theridion Theridion differens Thomisidae Coriarachne Coriarachne brunneipes Mesostigmata Ascidae Digamasellidae Melicharidae Parasitidae Phytoseiidae Sejidae Trematuridae Trichouropoda Trombidiformes Anystidae Arrenuridae Arrenurus Calyptostomatidae Erythraeidae Abrolophus Leptus Eupodidae Hydrodromidae Hydrodroma Lebertiidae Lebertia Limnesiidae Limnesia Microtrombidiidae Mideopsidae 2 Mideopsis Oxidae Oxus Oxus nodigerus Pionidae Piona Trombidiidae Unionicolidae Neumania Collembola Entomobryomorpha Entomobryidae Entomobrya Entomobrya gisini Entomobrya marginata Symphypleona Bourletiellidae Deuterosminthurus Heterosminthurus Sminthuridae Insecta Coleoptera Buprestidae Buprestis Buprestis nutalli Cantharidae Dichelotarsus
[Show full text]