Intravital Imaging in a Zebrafish Model Elucidates Interactions Between Mucosal Immunity and Pathogenic Fungi Linda S

The University of Maine DigitalCommons@UMaine

Electronic Theses and Dissertations Fogler Library

Summer 8-23-2019 Intravital Imaging in a Zebrafish Model Elucidates Interactions Between Mucosal Immunity and Pathogenic Fungi Linda S. Archambault University of Maine, [email protected]

Follow this and additional works at: https://digitalcommons.library.umaine.edu/etd Part of the Animal Experimentation and Research Commons, Immunity Commons, Immunology of Infectious Disease Commons, Immunopathology Commons, and the Pathogenic Microbiology Commons

Recommended Citation Archambault, Linda S., "Intravital Imaging in a Zebrafish Model Elucidates Interactions Between Mucosal Immunity and Pathogenic Fungi" (2019). Electronic Theses and Dissertations. 3066. https://digitalcommons.library.umaine.edu/etd/3066

This Open-Access Thesis is brought to you for free and open access by DigitalCommons@UMaine. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of DigitalCommons@UMaine. For more information, please contact [email protected]. INTRAVITAL IMAGING IN A ZEBRAFISH MODEL ELUCIDATES

INTERACTIONS BETWEEN MUCOSAL IMMUNITY

AND PATHOGENIC FUNGI

Linda S. Archambault

B.S. Bates College, 1982

M.A. Boston University, 1986

A DISSERTATION

Submitted in Partial Fulfillment of the

Requirements for the Degree of

Doctor of Philosophy

(in Biochemistry)

The Graduate School

The University of Maine

August 2019

Advisory Committee: Robert T. Wheeler, Associate Professor of Microbiology, Advisor

Clarissa Henry, Associate Professor of Biological Sciences

Julie Gosse, Associate Professor of Biochemistry

Paul Millard, Associate Professor of Chemical and Biomedical Engineering

Reeta Rao, Associate Professor of Biology and Biotechnology, Worcester Polytechnic

Institute, Worcester, Massachusetts.

INTRAVITAL IMAGING IN A ZEBRAFISH MODEL ELUCIDATES

INTERACTIONS BETWEEN MUCOSAL IMMUNITY

AND PATHOGENIC FUNGI

By Linda S. Archambault

Dissertation Advisor: Dr. Robert T. Wheeler

An Abstract of the Dissertation Presented in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy (in Biochemistry) August 2019

Candida yeasts are common commensals that can cause mucosal disease and life- threatening systemic infections. While many of the components required for defense against

Candida albicans infection are well established, questions remain about how various host cells at mucosal sites assess threats and coordinate defenses to prevent normally commensal organisms from becoming pathogenic. Using two Candida species, C. albicans and C. parapsilosis, which differ in their abilities to damage epithelial tissues, we used traditional methods (pathogen CFU, host survival, and host cytokine expression) combined with high- resolution intravital imaging of transparent zebrafish larvae to illuminate host-pathogen interactions at the cellular level in the complex environment of a mucosal infection. In zebrafish,

C. albicans grows as both yeast and epithelium-damaging filaments, activates the NF-kB pathway, evokes proinflammatory cytokines, and causes the recruitment of phagocytic immune cells. On the other hand, C. parapsilosis remains in yeast morphology and elicits the recruitment of phagocytes without inducing inflammation. High-resolution mapping of phagocyte-Candida interactions at the infection site revealed that neutrophils and macrophages attack both Candida species, regardless of the cytokine environment. Time-lapse monitoring of single-cell gene expression in transgenic reporter zebrafish revealed a partitioning of the immune response during C. albicans infection: the transcription factor NF-kB is activated largely in cells of the

swimbladder epithelium, while the proinflammatory cytokine tumor necrosis factor alpha (TNF-a) is expressed in motile cells, mainly macrophages. Our results point to different host strategies for combatting pathogenic Candida species and separate signaling roles for host cell types.

DEDICATION

I dedicate this dissertation to my husband, Thomas Archambault, who has been my steadfast supporter through this endeavor and every endeavor I have undertaken since we met.

There is no one who has more unselfishly wished for my happiness and success and no one more suited to travel the path with me as I have pursued them.

iii ACKNOWLEDGEMENTS

My collaborators on this project include University of Maine graduate, Dominika Trzilova, and researchers from University of Minnesota, Dr. Cheryl Gale and Sara Gonia. I would like to thank the Tobin, Huttenlocher, Bagnat, Rawls and Lieschke laboratories for sharing fish lines and am grateful for the exceptional fish husbandry provided by Mark Nilan at the UMaine

Zebrafish Facility. I thank members of the Wheeler Lab and Drs. Henry and Rao for their contributions along the way and comments on the paper manuscript. I especially thank Dr. Remi

Gratacap for his excellent training in confocal microscopy and the use of the zebrafish model.

Thank-you to Dr. Muse Davis for giving me the opportunity to co-author a review article.

Linda Archambault is a Janet Waldron Fellow at University of Maine. Her advisor, Dr.

Robert Wheeler, is a Burroughs Wellcome Fund Investigator in the Pathogenesis of Infectious

Disease. This work was funded by NIH grants R15AI094406 and R15AI133415 and USDA

Hatch Grant ME0-H-1-00517-48413.

TABLE OF CONTENTS

DEDICATION ...... iii

ACKNOWLEDGEMENTS ...... iv

LIST OF TABLES ...... ix

LIST OF FIGURES ...... x

CHAPTERS

1. INTRODUCTION AND BACKGROUND ...... 1

1.1. Host-pathogen Interactions ...... 1

1.1.1. Human microbiota ...... 1

1.1.2. Commensalism vs. disease ...... 2

1.1.3. Detecting and responding to disease ...... 2

1.2. Host Defenses ...... 2

1.2.1. Barriers ...... 3

1.2.2. Innate immunity ...... 3

1.2.3. Adaptive immunity ...... 3

1.3. Fungal Pathogens ...... 4

1.3.1. Environmental fungi ...... 4

1.3.2. Commensal fungi ...... 5

1.3.3. Candida disease states ...... 6

1.3.3.1. Chronic mucocutaneous candidiasis ...... 6

1.3.3.2. Oropharyngeal candidiasis ...... 6

1.3.3.3. Vulvovaginal candidiasis ...... 7

1.3.3.4. Dermal candidiasis ...... 7

1.3.4. Candida albicans ...... 7

1.3.5. Non-albicans Candida species ...... 8

1.3.6 Candida parapsilosis ...... 9

1.4. Virulence Factors ...... 10

1.4.1. Immune evasion ...... 10

1.4.2. Dissemination ...... 11

1.4.3. Morphogenesis ...... 12

1.4.4. Adhesion ...... 13

1.4.5. Invasion ...... 13

1.4.6. Damage ...... 14

1.4.7. Biofilm formation ...... 15

1.5. Host Mucosal Immune Defenses ...... 16

1.5.1. Mucosal adaptive immunity ...... 16

1.5.2. Mucosal innate immunity ...... 18

1.5.2.1. Host receptors to recognize Candida ...... 19

1.5.2.2. Signaling pathways ...... 20

1.5.2.3. Epithelial cells ...... 21

1.5.2.4. Neutrophils ...... 22

1.5.2.5. Macrophages ...... 23

1.5.2.6. Cooperation and crosstalk in mucosal tissue ...... 25

1.6. Models of Candida Infection ...... 26

1.6.1. In vitro models ...... 26

1.6.1.1. Epithelial cell models ...... 27

1.6.1.2. Models of phagocyte-Candida interactions ...... 27

1.6.2. In vivo models ...... 28

1.6.2.1. Mouse and rat models ...... 28

1.6.2.2. Invertebrate models ...... 29

1.7. Zebrafish Models of Fungal Infection ...... 29

1.7.1. The zebrafish toolkit ...... 30

1.7.2. Phagocyte interactions with fungal pathogens ...... 30

1.7.3. Sites of infection ...... 32

1.7.3.1. Yolk ...... 32

1.7.3.2. Hindbrain ventricle ...... 33

1.7.3.3. Swimbladder ...... 34

1.7.3.4. Egg ...... 35

1.7.3.5. Peritoneal cavity ...... 36

1.7.4. Conclusion ...... 36

1.8. Chapter Summary ...... 36

2. INTRAVITAL IMAGING REVEALS DIVERGENT CYTOKINE AND CELLULAR IMMUNE

RESPONSES TO CANDIDA ALBICANS AND CANDIDA PARAPSILOSIS ...... 38

2.1. Introduction ...... 38

2.2. Results ...... 40

2.2.1 C. albicans causes lethal infection but C. parapsilosis does not ...... 40

2.2.2 Zebrafish infected with C. albicans produce higher levels of

inflammatory cytokines than C. parapsilosis-infected fish ...... 41

2.2.3 The local inflammatory signaling pattern mirrors whole-fish

cytokine levels ...... 43

2.2.4 Signaling patterns differ in macrophages and epithelial tissue ...... 46

2.2.5 Neutrophils are recruited to infection and attack both C. albicans

and C. parapsilosis...... 50

vii

2.2.6 Macrophages are recruited to infections of both Candida species ...... 52

2.2.7 Functional neutrophils are required for protection from C. albicans

but not C. parapsilosis infection ...... 54

2.3. Discussion ...... 57

2.4. Materials and Methods ...... 61

2.4.1 Candida strains and growth conditions ...... 61

2.4.2 Animal care and maintenance...... 62

2.4.3 Zebrafish infections...... 63

2.4.4 Fluorescence microscopy...... 64

2.4.5 Dissected swimbladders...... 64

2.4.6 Quantitative real-time PCR ...... 64

2.4.7 Image analysis ...... 65

2.4.8 Statistical analysis ...... 66

2.4.9 Ethics statement ...... 66

3. CANDIDA PARAPSILOSIS PROTECTS ZEBRAFISH FROM INFECTION

BY CANDIDA ALBICANS ...... 67

3.1. Introduction ...... 67

3.2. Results and Discussion ...... 68

3.3. Materials and Methods ...... 71

4. CONCLUSIONS AND FUTURE DIRECTIONS ...... 73

4.1. Host Responses to C. parapsilosis and C. albicans ...... 73

4.2. C. parapsilosis-Host Interactions ...... 75

4.3. Conclusions ...... 76

REFERENCES ...... 77

BIOGRAPHY OF THE AUTHOR ...... 103

viii

LIST OF TABLES

Table 2.1. Candida strains ...... 62

Table 2.2. Zebrafish lines ...... 63

Table 2.3. qPCR primer information ...... 65

LIST OF FIGURES

Figure 2.1. C. albicans is more virulent than C. parapsilosis in the zebrafish

swimbladder infection model ...... 42

Figure 2.2. C. albicans elicits higher levels of cytokine expression than

C. parapsilosis ...... 43

Figure 2.3. Transcription Factor NF-kB is activated during C. albicans but not

C. parapsilosis infection ...... 44

Figure 2.4. Pro-inflammatory cytokine TNFα is expressed during C. albicans

but not C. parapsilosis infection ...... 45

Figure 2.5. Patterns of NF-kB activation and TNFα expression differ ...... 47

Figure 2.6. Tissue partitioning of NF-kB activation and TNFα expression ...... 49

Figure 2.7. Neutrophils respond to infections of both Candida species ...... 51

Figure 2.8. Both C. albicans and C. parapsilosis elicit macrophage recruitment ...... 53

Figure 2.9. Neutrophil defects impact immunity to C. albicans but not

C. parapsilosis infection ...... 56

Figure 3.1. Candida parapsilosis cell-free culture fraction protects zebrafish

from infection by Candida albicans ...... 69

CHAPTER 1

1.INTRODUCTION AND BACKGROUND

1.1 Host-Pathogen Interactions

We live in a microbe-rich world. Our skin and mucosal surfaces are constantly in contact with micro-organisms: those present in the environmental and those that make their home on us

– commensal microbes. Our mucosal tissues, in cooperation with our immune system, must tolerate beneficial microbes while also protecting us from disease-causing organisms. In this chapter, I will discuss important aspects of this delicate balancing act.

1.1.1 Human microbiota

We are surrounded by microbes. The number of microbe species is estimated to be between several million and a trillion (1–4). Estimates of microbial abundance suggest there are over 1,000 bacterial phyla, one to five million fungal species worldwide and up to 120,000 species of microfungi in the U.S. alone (5). Microbes have colonized every habitat imaginable, including humans. We play host to a microbiome that encompasses three kingdoms and matches us in cell numbers (6). The species that make up our microbiome vary from person to person and in different environments in the body (5). The content of our microbiome fluctuates, depending on our age, state of health, our diet, and other factors. Commensal organisms help us; they provide digestive enzymes, synthesize essential nutrients, and prevent our being colonized by more harmful organisms. Our microbiome contributes to the development of immunity, influences our digestion, cancer risk and even mental health (7–9). The mycobiota

(fungal microbiome) has been an overlooked part of the mucosal microbiome but that is being rectified (10). Given their numbers, diversity and influence, it’s vitally important that we understand our interactions with commensal organisms.

1.1.2 Commensalism vs. disease

By definition, a commensal organism does its host no harm. Microbes that damage their hosts are designated as pathogens. However, it’s important to understand that a particular microbe cannot always be categorized definitively as a commensal or a pathogen (11). A microbe can reside commensally until a change in host biology allows disease to occur.

Additionally, the damage inherent in disease can result from an overzealous host immune response as well as from microbial action. Thus, disease needs to be understood in the context of the interactions between host and microbe.

Although the organisms of our microbiota are usually good guests, many do cause disease. The switch from commensalism to pathogenicity is connected to changes in the makeup of our microbiome and to changes in host immune function. Our challenge as hosts is to respond appropriately to the organisms of our microbiome, tolerating them as commensals but mounting a defense against them when they threaten us as pathogens.

1.1.3 Detecting and responding to disease

Traditionally, we have understood the role of our immune system to be the recognition and response to threats in the form of “foreign” microbes. In the case of disease-causing organisms not usually found on or in our bodies, recognition, leading to attack and elimination of the microbe, is a good protection strategy. However, in the case of our microbiome, beneficial organisms must be tolerated, our immune system must be prevented from excess activity that could damage our own tissues, and commensal microbes must be kept from growing uncontrolled (12). This demands a complex balancing act, and yet, in healthy humans, this balance is achieved by our barrier tissues and our immune system. The following section will explore their roles in detail.

1.2 Host Defenses

Although I am not a violent person, I sometimes find it useful to think of host defenses at mucosal tissues using a military analogy. While epithelial tissue acts as a wall to keep out

intruders (pathogens), the cells of these barriers also act as look-outs, sounding the alarm when the wall comes under attack. Receiving these messages are the soldiers (immune cells) that respond to defend the barriers from attack by pathogens. This section will summarize the roles of these barriers and their defenders.

1.2.1 Barriers

The epithelial tissues form the barrier wall between the interior of our bodies and the external environment. Our skin’s outermost layer is a keratinized stratified epithelium that forms a tough, waterproof barrier to invasion. Although we think of our respiratory, digestive and reproductive tracts as internal, they must remain open to the external environment in order to facilitate gas exchange, nutrient intake, elimination and reproduction (13). These tissues are lined with mucosal epithelium and mucus serves a protective function. In the fight against invading microbes, epithelial cells were once thought to serve only as barriers, but it’s now known that they play key signaling roles in initiating and coordinating immune responses.

1.2.2 Innate immunity

If the cells of the skin and mucosal tissues can be thought of as the watchers on the wall, their calls for help are received by the soldiers, the cells of the innate immune system.

Innate immune cells include mast cells, natural killer cells, eosinophils, basophils, and the phagocytic cells: neutrophils, macrophages and dendritic cells. These cells detect the presence of pathogen associated molecular patterns (PAMPs) using germ line encoded pattern recognition receptors (PRRs). Innate immune cells do not have memory in the classical sense.

Their roles include phagocytosis and killing of pathogens, signaling to amplify immune responses and recruit more phagocytes, and presentation of antigens to the cells of the adaptive immune system.

1.2.3 Adaptive immunity

The adaptive immune system is capable of memory and of specific recognition of pathogens. Adaptive cells involved in protection at barrier tissues include T cells, B cells, and

dendritic cells. The combined efforts of the innate and adaptive immune systems work to keep pathogens in check. Human pathogens have evolved in tandem with our immune system so have many strategies to counter its efforts.

1.3 Fungal Pathogens

When defending against attack, it is important for the army to know the enemy. The enemy in question is a fungal pathogen of the genus Candida. This section will introduce fungal pathogens and describe the pathogenic Candida species and the illnesses they cause.

Of the approximately five million fungal species on earth, only 0.01% are able to cause disease in humans (14). Because the human immune system and fungal commensals have co- evolved, commensal fungi generally do not infect people unless there is an underlying problem with the immune system. Fungal disease is on the rise, mainly due to medical advances that save lives but have led to increasing populations of immunocompromised patients.

To be a pathogen of a human host, fungi need to be able to do 4 things: grow at human body temperatures, get past external barriers, lyse human tissue to gain nutrients, and resist immune defenses (14). Fungi from only 4 of the many fungal lineages are able to infect humans, even when we are immunocompromised. They are the Zygomycota, Entomophthorales,

Ascomycota and Basidiomycota. For the purposes of this literature review, I will split the pathogenic fungi into two categories, those that are generally found outside the human body but can enter and sometimes cause disease (environmental fungi), and those whose natural environment is the human body (commensal or parasitic fungi). This group includes the Candida species, the subjects of this dissertation, and I will describe their characteristics and the diseases they cause in detail.

1.3.1 Environmental fungi

Fungi are important recyclers, degrading dead plant and animal tissue to obtain nutrition.

Some fungi can cause disease in immunocompromised patients even though their normal

environment is not the human body. Two examples illustrate the variety of infection mechanisms fungi employ.

Aspergillus fumigatus (Ascomycota) is a ubiquitous, soil-dwelling saprophyte whose spores enter the air and are breathed into the lungs by the thousands. In healthy humans

Aspergillus is managed by resident immune cells and no disease symptoms arise. However, in immunocompromised hosts, the spores germinate and grow in filamentous form, invade lung tissue, grow into and along blood vessels, block blood flow, and cause necrotizing pneumonia.

Aspergillus is capable of dissemination through the blood to the brain, eyes and kidneys. It affects patients with mutations in NADPH oxidase (Chronic Granulomatous Disease) and those being treated with iatrogenic immunosuppression (15).

Cryptococcus spp. (Basidiomycota) are environmental saprophytes (organisms that live on dead or decaying matter). The two species that infect humans are C. neoformans and C. gattii. C. gattii is one of the few fungal species that is able to cause disease in apparently immunocompetent hosts. Dried yeast are inhaled, can cause pneumonia and often disseminate.

In healthy hosts Cryptococcus can survive dormant in the lung or other organs for years and then reactivate when immune defenses are suppressed. In immunocompromised patients it often breaches the blood-brain barrier to cause meningoencephalitis, which is fatal if untreated

(14, 16)

1.3.2 Commensal fungi

Candida species (Ascomycota) are the most common human commensal and pathogenic fungi. There are 15 Candida species that cause disease but only five cause 90% of infections: C. albicans, C. glabrata, C. parapsilosis, C. tropicalis, and C. krusei (17). Infection by

Candida takes on two forms; mucosal infection occurs in people with defects in adaptive immunity while disseminated infection is connected with hospital environment and dysfunctional innate immune cells, especially neutrophils.

1.3.3 Candida disease states

Candida species colonize the mucosal surfaces of the human digestive, respiratory, and

(female) reproductive tracts. Their pathogenic potential lies in their ability to shift from harmless colonization to overgrowth on superficial tissues, leading to invasion into deeper tissues, then potentially to dissemination through the blood stream to internal organs (18, 19). Candida species are the 4th most common cause of nosocomial bloodstream infection in the U.S. with a mortality rate of around 50% (20). Candida spp. are responsible for several forms of superficial disease on skin and mucosal surfaces. Because mucosal candidiasis is the focus of this dissertation, these diseases will be discussed in more detail.

1.3.3.1 Chronic mucocutaneous candidiasis

Chronic mucocutaneous candidiasis (CMC) is a “recurrent or persistent infection affecting nails, skin and oral or genital mucosae” (21). CMC occurs in individuals with inherited or acquired T-cell deficiencies, for example: auto-immune deficiency syndrome (AIDS), autosomal dominant Hyper IgE syndrome (HIES), STAT1 gain-of-function mutations, deficiencies in IL-12 receptor b1, IL-12p40, CARD9, RORgT, autoimmune polyendocrinopathy candidiasis-ectodermal dystrophy (APECED), and mutations in interleukin (IL)-17 pathway components such as IL-17 receptor (R)A, IL-17RC, ACT1, and the cytokine IL-17 (Soltész et al.,

2013, Conti and Gaffen, 2015).

1.3.3.2 Oropharyngeal candidiasis

Oropharyngeal candidiasis (OPC) is an infection of the tongue and oral mucosa that manifests as white, curd-like patches (pseudomembranous candidiasis, aka thrush) or reddened patches (erythematous candidiasis) (18, 23–26). Oral lesions cause discomfort and difficulty chewing and swallowing. OPC is often the first manifestation of HIV/AIDs infection and up to

90% of HIV patients will get OPC at some point. OPC is common in infants and young children, before their adaptive immunity develops, and in people using dentures, corticosteroid inhalers, cigarettes, broad-spectrum antibiotics, and immunosuppressive and chemotherapeutic drugs,

those with diabetes and transplant recipients. OPC is one form of candidiasis seen in patients with CMC.

1.3.3.3 Vulvovaginal candidiasis

Vulvovaginal Candidiasis (VVC) is an infection of the genital mucosa in immunocompetent women, usually by C. albicans, although other Candida species have been isolated from affected and asymptomatic individuals (27, 28). Symptoms include severe itching, pain, redness, vaginal discharge and painful intercourse. Predisposing factors include the use of oral contraceptives or broad-spectrum antibiotics, pregnancy, and diabetes. VVC is common enough that 75% or more of women of childbearing age will have at least one episode and around 9% have recurrent infection (RVVC). Treatment with antifungal drugs is generally effective and recurrence is prevented by removing the predisposing factor(s). It’s thought that C. albicans’ ability to switch from the yeast to hyphal morphology is largely responsible for the occurrence of VVC in healthy women with no genetic predisposition for other forms of

Candidiasis (29). Recruitment of neutrophils to the vaginal mucosa does not clear the fungus but instead, exacerbates symptoms (30).

1.3.3.4 Dermal candidiasis

Fungi are part of the skin microbiota but can be pathogenic under certain circumstances.

Fungal skin infections plague around 20-25% of people worldwide and other skin conditions such as psoriasis and atopic dermatitis have connections to Candida colonization (31). Dermal

Candidiasis is one manifestation of CMC and as such, has some susceptibility factors in common with VVC and OPC.

1.3.4 Candida albicans

C. albicans is the most common cause of both mucosal and disseminated Candidiasis and, thus, is the most thoroughly studied of the Candida species. As an obligate commensal of mammals, it co-evolved with its hosts, and is perfectly adapted to its commensal lifestyle. 75% of humans carry Candida albicans and a healthy immune system keeps Candida in its

commensal mucosal niche (32). As in other fungal infections, disfunctions in the immune system are usually a factor in pathogenesis. C. albicans is one of only two Candida pathogens that are able to form true hyphae. Hyphae are capable of damaging epithelial tissues in vitro and much has been made of the role of hyphae in disease (33). Morphotype switching and epithelial damage are factors in C. albicans ability to disseminate from the gut to the blood-stream (34,

35).

1.3.5 Non-albicans Candida species

Although C. albicans is the most common cause of candidiasis in humans, several non- albicans Candida (NAC) species are also clinically relevant and their isolation from bloodstream infections has been increasing over time (36). The Candida species are a polyphyletic group

(derived from more than one common ancestor), placed in the same genus due to common characteristics (37). Of the species most commonly isolated from patients, C. albicans, C. tropicalis, C. parapsilosis, and C. dubliniensis are closely related while C. glabrata is a distant cousin, closer to the bread yeast Saccharomyces cerevisiae. The Candida species have different geographic distributions: C. albicans and C. glabrata are the most commonly isolated species in Europe and North America while C. tropicalis is the most prevalent species in India and Latin America (38). The patient populations at risk of infection by each species also differ.

For example, C. glabrata causes thrush in the elderly and denture-wearers and C. dubliniensis is most often responsible for thrush in HIV/AIDs patients.

The Candida species are generally polymorphic; most grow in yeast and pseudohyphal forms but only C. albicans and C. dubliniensis form true hyphae (37). Interestingly, C. dubliniensis is much less virulent that C. albicans, an indication that hyphal growth is only one of many traits contributing to virulence. Host phagocytes and epithelial cells respond differently to the different Candida species and much remains to be discovered in this area. Studying the mechanisms behind these differences could yield important information to guide our attempts to counter these pathogens (Miramón, Kasper and Hube, 2013; Whibley and Gaffen, 2015).

A recently arisen fungal pathogen, Candida auris, is causing a global public health threat in the form of serious outbreaks of invasive Candidiasis in health care settings (39, 40). C. auris was first described in 2009 in Japan and genetic analysis has shown that four separate clades arose simultaneously in different regions around the world. Difficulties in combatting this pathogen stem from problems with identifying it, its ability to form persistent biofilms on medical devices and its resistance to antifungal agents. Because it was only recently discovered, relatively little is known about C. auris interactions with host cells. In a zebrafish model and in coincubation with human neutrophils, recruitment, phagocytosis, killing and the formation of

NETs were all reduced against C. auris in comparison to C. albicans (41). It’s ability to avoid neutrophil detection and attack may contribute to its pathogenicity. However, more work is needed on interactions between host immunity and this threatening Candida species.

1.3.6 Candida parapsilosis

C. parapsilosis is the second (or third, depending on geographic location) most common

Candida species isolated from patients with invasive candidiasis (42, 43). Its incidence in the hospital setting is on the rise, although it’s geographic and patient population profiles differ from those of C. albicans. It disproportionately affects premature infants and unlike C. albicans, which is passed vertically from mother to infant during vaginal birth, C. parapsilosis was shown to originate mainly from exogenous sources such as hand carriage on caregivers. (34, 43, 44). C. parapsilosis also infects adult patients with indwelling devices, central venous catheters, prosthetics, and those receiving total parenteral nutrition, an indication of its ability to form persistent biofilms. Although C. parapsilosis is a commensal on the skin and in the gut, bloodstream isolates usually don’t match gut or skin isolates but, instead, often match isolates found on catheters. Because of the serious health threats pose by C. parapsilosis, several labs have made it their focus of study in recent years.

1.4 Virulence Factors

Gene knock-out studies have elucidated the importance of many virulence traits of C. albicans, including adhesins, secreted aspartyl proteinases (SAPs), lipases, and the ability to form true hyphae (33, 45–47). These studies have tested the effects of various C. albicans knock-out strains in vitro in epithelial and immune cell models and in vivo in mouse, rat, and recently, in zebrafish models. The discovery of virulence traits in C. parapsilosis lags behind C. albicans. However, C. parapsilosis also adheres to and invades epithelial cells in vitro, and causes illness in mouse and rat models (48–51). C. parapsilosis is unable to form true hyphae but its lipases and SAPs are important to its ability to damage host cells and cause disease (51–

54). Our current knowledge of the virulence traits of these two Candida species will be summarized.

1.4.1 Immune evasion

C. albicans uses several strategies to avoid detection by the immune system and to counter immune attack (55–57). Epitope masking is one strategy to avoid detection. The cell wall polysaccharide b-glucan is an important PAMP for recognition of C. albicans by the Dectin-

1 receptor, but it is mostly hidden under a layer of mannoprotein. b-glucan is unmasked during infection in a process involving neutrophil NET-mediated attack and the C. albicans response to attack: cell wall remodeling that exposes b-glucan.

C. albicans avoids phagocytosis by secreting SAPs, which degrade complement, and

Pra1, a complement inhibitor. SAPs 9 & 10 are also able to cleave histatin, a host antimicrobial peptide (13). Inside phagocytes, C. albicans catalase and superoxide dismutase counteract killing by host reactive oxygen species (ROS) (13). Secreted lipases allow Candida to take advantage of lipids in the host and also alter host immune responses by converting host arachidonic acid to prostaglandins (58–60). Neonates in intensive care are given lipid-rich parenteral nutrition and this may help to explain the why C. parapsilosis, with its complement of

lipases, seems particularly suited to infect this population (51). An excellent body of work has shown that C. parapsilosis lipases contribute to biofilm formation, suppression of immune signaling, virulence and survival in phagocytes (reviewed in (Toth et al., 2017)).

C. albicans and C. parapsilosis are able to survive in macrophages and, in vitro, can initiate filamentous growth and kill the host (62, 63). In vivo, however, macrophages and C. albicans reach a stand-off, with the yeast surviving and replicating but not able to germinate

(64). Survival within phagocytes can lead to dissemination from mucosal sites through the blood stream to organs of the body. Potentially aiding in dissemination, C. albicans and C. parapsilosis are able to prevent phagosome maturation and escape from macrophages through nonlytic extrusion (vomocytosis) (63, 65, 66).

1.4.2 Dissemination

To cause systemic disease, Candida species must breach barriers and gain access to normally sterile areas of the body (67–69). Skin and mucosal colonization can serve as a reservoir for Candida, from which it may invade. In the hospital setting, mechanical breach of barriers through injury, surgery or insertion of intravenous catheters is likely to provide a route of entry for Candida into the blood stream. However, several host- and pathogen-directed mechanisms have also been proposed to account for Candida dissemination.

Host inflammatory response to infection initiates the production of chemokines and cytokines which lead to a number of responses including vasodilation, edema and the recruitment of phagocytes to the site of infection. Thus, passive travel of yeast through gaps in tissue left by extravasating phagocytes is one possible route of entry into the blood stream (70).

Phagocytes engulf Candida at the site of infection and carry it by reverse migration back to the blood stream. They may then act as “Trojan Horses”, traveling in the blood flow to other parts of the body where they release their cargo. Release of viable Candida by macrophages occurs both by pyroptotic or necrotic lysis and by non-lytic exocytosis (66, 71, 72). A third mechanism, transcytosis, was suggested by the ability of hyphae and yeast to induce endocytosis of into

endothelial cells. Subsequent exocytosis into the lumen of blood vessels could allow dissemination (Sheppard and Filler, 2015, Grubb, et al 2008). Evidence from the zebrafish model indicates that phagocyte-dependent and -independent mechanisms are both at play in dissemination in vivo (Scherer et al., manuscript in preparation).

1.4.3 Morphogenesis

Candida species are pleiomorphic; able to form yeast, pseudohyphae, true hyphae and chlamydospores, and their ability to switch between morphologies is an essential virulence trait

(14, 73, 74). Yeast reproduce by budding and remain unicellular, pseudohyphae are oblong cells that remain attached in chains, while the hypha is a tube-shaped, mycelial growing form. In addition to these morphologies, Candida yeast also differentiate into at least two recognized phenotypes (white and opaque) and others have recently been reported (75–77). C. parapsilosis adopts the yeast and pseudohyphal form in nature and during infection but does not form true hyphae.

In mucosal candidiasis, the hyphal form is the most damaging and therefore thought of as the pathogenic form of C. albicans, whereas the yeast are thought to be commensal at mucosal sites (29, 33). Experiments using epithelial cells in culture and reconstituted human tissue (RHT) models have shown that hyphae are better able than yeast to invade and damage epithelial tissues (78, 79). Hyphae grow directionally and use mechanical force to penetrate tissue but also have other weapons (80). The yeast to hyphal transition is accompanied by changes in expression of a variety of virulence-related genes. Hyphae upregulate adhesin genes (HWP 1&2, ALS3, RBT1, HYR1), certain secreted aspartyl proteinases (SAPs 4-6), and

ECE1, one product of which is the recently discovered peptide, Candidalysin, that causes damage by forming pores in epithelial cells (46, 81). Hyphal expression of adhesins enables invasion by endocytosis into epithelial and endothelial cells (82, 83). Adhesins similar to those in

C. albicans are found on C. parapsilosis pseudohyphae (84, 85)

Candida morphology affects its interactions with immune cells. Phagocytes are less able to ingest and kill C. albicans hyphal forms, presumably because of their size and shape, but differential gene expression may also play a role (63). However, in C. parapsilosis, the size and orientation of pseudohyphae do not affect phagocytosis. Macrophages in vitro prefer to ingest yeast rather than hyphae and Candida species are able to undergo the switch to filamentous growth within macrophages C. albicans hyphal growth within macrophages killing the host cell

(86). Evidence from intravital imaging in the zebrafish indicates that C. albicans yeast are incapable of switching to hyphae in macrophages but are able to replicate in yeast form(64). In addition to their differential ability to cause disease in mucosal settings, yeast and hyphal forms also play different roles in dissemination of Candida disease, as recently demonstrated by

Seman and colleagues in the zebrafish (74).

1.4.4 Adhesion

The yeast form of Candida is probably the first to adhere to uncolonized surfaces, followed by the formation of hyphae and/or pseudohyphae with their greater adherence ability

(79). Adhesins include the Als family of proteins and Hwp1. Als 1-4 are expressed specifically by the hyphal form of C. albicans. Als3 binds to E-cadherin on epithelial cells and N-cadherin on endothelial cells (82).

Adhesive properties of C. parapsilosis clinical isolates were linked to their virulence in a buccal epithelial cell model (87). One adhesin gene, Cpar2_404800, has been identified and tested in buccal epithelial cells and a mouse model of urinary tract infection (84). Another, the product of gene CpAls7, was found to be effective in providing adhesion to extracellular matrix proteins (85, 88)

1.4.5 Invasion

Candida albicans invades epithelial tissues by two mechanisms: active penetration and induced endocytosis (89). Induced endocytosis has been recorded and intensively studied in vitro (and recently observed in vivo in the zebrafish – Scherer, et al, in prep) (89–91). In the

stratified squamous epithelial tissues on which C. albicans normally resides, however, active penetration of the outer layers of non-proliferative, inactive cells must occur before the fungus can be endocytosed by the active cells of the lower layers. Receptor-Induced Endocytosis (RIE) is a host-driven, actin-dependent, clathrin-mediated process. Live and killed Candida are endocytosed equally well and hyphae are more readily endocytosed than yeast. Invasins in the

Candida cell wall, upregulated in the yeast to hyphal switch (e.g. Als3, Ssa1), interact with host cell receptors to initiate the process. Receptors include the receptor tyrosine kinases Egfr and

Her2, E-cadherin on epithelial cells, and N-cadherin on endothelial cells (92). Active penetration is Candida-driven, requiring fungal factors including turgor pressure, growth of the hyphal tip and secretion of host tissue-damaging enzymes such as SAP2 and SAP5 (93, 94).

1.4.6 Damage

Intriguingly, invasion of tissue and the ensuing damage appear to be somewhat mechanistically separate events. Penetration of hyphae is required for significant damage to occur – non-hyphal species and yeast locked mutants do much less damage to epithelial tissue in vitro and are less virulent in vivo (95). Endocytosed cells are capable of causing damage but the process of endocytosis itself is not damaging, as endocytosis of dead C. albicans causes no damage (96). Sustained hyphal growth is required for damage to occur, as evidence by the D/D

EED1 mutant, which invades tissue but then reverts to pseudohyphal/yeast growth and causes little tissue damage (78). Invasion brings Candida into close contact with living cells of the epithelial layer where secreted molecules (i.e. SAPs, lipases, phospholipases and the peptide

Candidalysin) could more efficiently damage them.

Candida is also capable of manipulating host cell death pathways. C. albicans induces apoptosis in macrophages, neutrophils and epithelial cells (97–100). However, epithelial cells, in co-cultures with C. albicans, limit apoptotic pathways and the eventual cause of epithelial cell death is necrosis. The relative contribution of various damage mechanisms to disease progression in vivo is an exciting avenue for future study.

1.4.7 Biofilm formation

Biofilm formation on implanted medical devices, such as vascular and urinary catheters and dentures, can lead to systemic infection and therefore poses significant health risks. A biofilm is a three-dimensional structure formed by microbes on biotic and abiotic surfaces.

Mucosal candidiasis is essentially the formation of biofilms on mucosal tissues (101–103).

Candida biofilms begin with cell wall-mediated adherence of fungi. The yeasts proliferate to form a thin layer and as the biofilm matures, pseudohyphal and/or hyphal growth commences.

Biofilms mature as extracellular matrix (ECM) material is secreted and accumulates around and between the fungal cells. In the dispersal stage, yeast are budded off from the biofilm to travel to new sites of colonization.

Biofilm formation contributes to the virulence of Candida species. Biofilms are resistant to mechanical and other stresses and to attacks from the host immune system. Candida in biofilms are less susceptible to antifungal drugs because of their slower growth rate, the protection offered by the impermeable ECM surrounding the cells, the upregulation of efflux pumps, and the development of dormant persister cells. Perhaps due to changes in gene expression and epigenetics, yeast dispersing from biofilms are more virulent than those from the same isolates grown in suspension (103, 104).

C. albicans biofilms are highly structured, containing yeast, pseudohyphae, hyphae, and dormant, highly drug-resistant persister cells, all encased in a thick ECM of proteins, glycoproteins, carbohydrates, lipids and nucleic acids (103, 105). C. parapsilosis biofilms are thinner and less structured, contain both yeast and pseudohyphae, and have an ECM with a higher carbohydrate and lower protein content. A network of genes contributes to C. albicans biofilm formation. The network includes 6 master transcriptional regulators (Bcr1, Tec1, Efg1,

Ndt80, Rob1 and Brg1) which bind to the promoters of ~1,000 genes (106). Although fewer studies have addressed the genetics of C. parapsilosis biofilm formation, homologues for transcription factors Efg1 and Bcr1 and Als-like adhesin proteins play a role, as do the lipase

genes CpLIP1 and CpLIP2 (54, 105, 107, 108). Because biofilm formation on catheters and indwelling devises are closely linked to cases of deadly systemic candidiasis, host cell interactions with Candida biofilms is an active area of study.

1.5 Host Mucosal Immune Defenses

Mucosal tissue is a complex environment made up of many cell types. Epithelial cells and their associated extracellular matrix form physical barriers Epithelial layers are supported by mesenchymal tissue containing fibroblasts. Blood vessels, lined with endothelial cells, bring cells of the innate and adaptive immune system that migrate in an out of the mucosal layers.

Mucosal tissues are patrolled by resident immune cells, mainly macrophages. Each cell type has a role to play in the battle against pathogens and communication between cells is essential to their success in battle.

Unlike systemic Candida infection, which is associated with defects in innate immune cells, mucosal candidiasis occurs in people with defects in adaptive immunity. Therefore, I will discuss adaptive immune involvement in mucosal candidiasis first. However, the development of adaptive immunity depends on cells and signals of the innate immune system. Epithelial cells and cells of the innate immune system encounter Candida at the mucosa and recognize and signal about the infection, respond immediately, and carry out effective clearance at the direction of the adaptive immune system, so I will dedicate most of this section to their roles.

1.5.1 Mucosal adaptive immunity

The mucosal surfaces of healthy people are often colonized with Candida; thus, most people develop adaptive immunity to Candida as children. The importance of adaptive immunity in control of mucosal Candidiasis became apparent early in the HIV/AIDS epidemic since OPC is often the first indication that a patient has AIDS (109). This led to the realization that CD4+ (T helper) cells were essential in preventing mucosal candidiasis. The importance of Th1 immunity in fighting fungal infections is well-established in humans and in murine models. Th2 immunity is detrimental in most fungal infections because it dampens the immune response through the

production of anti-inflammatory cytokines. Whereas earlier work focused on Th1/Th2 balance, it’s now known that the more recently-discovered Th17 cell subset is a primary player in protection from both mucocutaneous and systemic candidiasis. In fact, defects in any gene component of the IL-17 signaling pathway (IL-17RA, IL-17RC, Act1) predispose patients to oral candidiasis.

Development of adaptive immunity begins with activities of the innate immune system.

PRRs on antigen-presenting cells (i.e. macrophages, dendritic cells) recognize three unique fungal PAMPS: chitin, glucans (a and b) and mannans (109, 110). Recognition leads to phagocytosis, then degradation of the pathogen and presentation of antigen to naïve T-cells.

Binding of these PAMPs initiates a signaling cascade leading to the induction of major histocompatibility complex (MHCs), co-stimulatory molecules and cytokines, which in turn leads to the induction of adaptive immunity via Th1 and Th17 differentiation Th17 immunity is induced when IL-1b, TGF-b and IL-6 prime CD4+ T cell precursors to differentiate into Th17 cells, while

IL-23 maintains and expands them.

Th-17 cells produce cytokines IL-17A, IL-17F, IL-21, IL-22, and GM-CSF (Conti &

Gaffen, 2015). GM-CSF is a chemokine that stimulates maturation of neutrophils in the bone marrow. IL-17A/F homo- and hetero-dimers are detected by the IL-17 receptor, a dimer of IL-

17RA and IL-17RC. Signaling proceeds through ACT1 and TRAF6 to activate transcription factors NF-kB, C/EBP and MAPK. IL-17 is thought to be detected mainly by non-hematopoietic cells where it induces the production of cytokines and anti-microbial peptides (111, 112). In mucosal Candidiasis, IL-17 acts on keratinocytes and epithelial cells to produce antimicrobial molecules such as S100A, b-defensins, and histatins.

Regulatory T cells have dual roles (110). They dampen immune responses through production of IL-10, TGF-b and IL-35 and they repress IL-12 release so reduce Th1 differentiation. Tilting the balance towards Th17 and away from regulatory T (Treg) cells

increases immunity to C. albicans while TNF-a antagonists, often used to treat inflammatory disease, promote Treg development and increase the risk of fungal disease. Treg cells also have positive functions with respect to fighting fungal infection. They are able to promote immune memory by shaping the response to the pathogen and they promote Th17 differentiation through sequestration of IL-2.

Humoral immunity targets antigens in the fungal cells wall: b-glucan and ALS3 in C. albicans (110). Immunoglobulins attack fungi in two ways: directly, by killing or inhibiting growth of fungi, and indirectly, by enhancing the microbicidal activity of effector cells through opsonization and activation of complement leading to phagocytosis or by antibody-directed cell toxicity leading to lysis of fungal cells. Vaccination against Candida could provide AIDS patients with immunity that doesn’t rely on CD4+ T cells and antibody therapies could be helpful to those who are immunocompromised in this arm of the immune system.

Activation of adaptive immunity is required for resolution of mucosal fungal infections.

The transition from innate to adaptive depends on antigen-presenting cells and on cytokines and chemokines produced by cells of the innate immune system. I will introduce the activities of the innate branch of immunity in the next section.

1.5.2 Mucosal innate immunity

Innate immune cells found in mucosal tissues include macrophages, dendritic cells, neutrophils and innate lymphoid cells. In addition, epithelial cells function in many ways as non- professional immune cells in their signaling and the production of secreted defenses against pathogens. These host cells carry PRRs that recognize Candida ligands then induce protective measures including phagocytosis, killing, and cytokine production which amplifies innate immune responses and also leads to the development of adaptive immunity.

1.5.2.1 Host receptors to recognize Candida

PRRs are germ-line encoded transmembrane proteins whose ligands include a wide variety of PAMPs (113–115). PRRs recognize three unique fungal pathogen-associated

PAMPS: chitin, glucans and mannans. Host cells detect Candida through classical PRRs such as the toll-like receptors (TLRs) and C-type lectin receptors (CLRs), and also through interactions between Candida cell wall proteins and several non-canonical receptors on epithelial cells.

The TLRs 2, 4, and 6 recognize fungal cell wall carbohydrates phospholipomannan, O- linked mannans, and zymosan, respectively (116). Intracellular receptors TLR7 and 9 recognize fungal RNA and DNA, respectively (68). Polymorphisms in TLR genes are linked to human susceptibility to fungal infections in situations involving immunosuppression (117–120). The importance of TLR signaling in Candida infection is somewhat disputed since mice deficient in the TLR adaptor, MyD88, are susceptible to infection by several fungal species while their human counterparts are not (121). In spite of this, several instances of cooperative signaling between TLRs and other receptors exist (122).

CLRs are the most important class of receptors for fungal recognition. They mediate fungal binding and phagocytosis, induction of antifungal effector mechanisms and production of cytokines, chemokines, and inflammatory lipids (113). The CLRs which detect Candida components include Dectin1, Dectin2, Mannose Receptor, Mincle, and DC-Sign. Mannose

Receptor (MR) on macrophages recognizes branched N-bound mannans from C. albicans.

Short, straight, O-linked mannans are recognized by TLR4 (123, 124). Different immune cell types recognize Candida species using different receptors; on dendritic cells (DCs), the receptor

DC-sign joins MR in detection of C. albicans mannans (116). Dectin-2 may also detect mannans but it must interact with Fc(g) receptor in order to signal.

Dectin-1 is a CLR that binds to b-glucan which makes up 60% of the C. albicans cell wall

(125). b-glucan is hidden under a layer of mannan but is exposed at bud scars and when

Candida is under immune attack (55, 56). Human studies reveal that Dectin-1 is required for defense against CMC and VVC but not disseminated Candidiasis (126, 127).

Synergy and overlap between different receptors could be one reason for the lack of a susceptible phenotype in humans with polymorphisms in certain receptor genes. Galectin

(GAL)3 and TLR2 cooperate to discriminate C. albicans from a non-infectious fungus (116). Cell wall component Chitin is recognized by TLR9, NOD2 and MR and stimulation produces an anti- inflammatory IL-10 response (128). Dectin-1 and TLR2 signaling cooperate to produce the protective IL-17 response to C. albicans through prostaglandin E2 and macrophages require co- stimulation of TLR2 and Dectin-1 to produce pro-inflammatory cytokine, TNF-a (129).

1.5.2.2 Signaling pathways

PRRs signal to initiate defensive mechanisms including phagocytosis, respiratory burst, and expression of genes involved in the inflammatory immune response and in directing the development of adaptive immunity (68, 126, 130–133). The CLRs use spleen tyrosine kinase

(SYK) adaptor and signaling requires an immunoreceptor tyrosine-based activation motif

(ITAM), either as part of the intracellular portion of the receptor itself, or, in the case of Dectin-2 and Mincle, in an adapter protein like FcRg. ITAMs are phosphorylated by src-family kinases leading to activation of SYK. In the case of Dectin-1, binding to b-1,3-glucans in the fungal cell wall initiates SYK activation. SYK then activates the CARD9-Bcl10-MALT1 complex which leads to NF-kB activation and production of cytokines and chemokines including TNF, IL-2, IL-10,

CXCL2, IL-1b, IL-6, and IL-23. Dectin-2 and Mincle also signal via CARD9-Bcl10_MALT1 and cytokine transcription occurs through ERK, p38 and MAP kinases. Caspase recruitment domain

(CARD) 9 is required to link Dectin1/Syk to Bcl10-Malt1-dependent NF-kB activation. CARD9- deficient mice are much more susceptible to systemic C. albicans infection and CARD9

mutation in humans is associated with susceptibility to both systemic and mucosal fungal infections.

Signaling and the output of signaling cascades in response to C. albicans differs in different host cell types. This is partially due to the complement of PRRs expressed by different cell types. Signaling patterns in individual cell types (macrophages, neutrophils and epithelial cells) will be detailed in the following sections.

1.5.2.3 Epithelial cells

While many details of myeloid cell detection of Candida have been determined, much less is known about how Candida is detected by the cells that make up epithelial tissues. When stimulated with live, heat-killed or UV-killed yeast or hyphae of C. albicans, epithelial cells in culture produce cytokines including IL-8, GM-CSF, IL1a, IL-6, IFNg, TNFa (80, 99). However, detection of Candida in epithelial cells doesn’t depend on TLR2, TLR4, MR or Dectin-1, which are used by phagocytes to detect Candida (99).

Results are not always in agreement on the role of Candida morphology in its detection by epithelial cells. In one study, cytokine production by epithelial cells was found to depend on the dose of Candida but not on the hyphal morphology (99). In another study, however, hyphal and non-hyphal Candida species strains could activate NF-kB and MAPK-cJun but this activation didn’t lead to cytokine production (134). Hyphae were required to activate the second phase of epithelial cells response which involved MKP1-cFos activation, and induced cytokine release (135). Later work implicated PI3K signaling which leads to responses that protect epithelial cells from damage, including suppression of apoptosis (136). Since the time of those studies, the discovery of Candidalysin, a hypha-specific, secreted, peptide toxin has provided a mechanism for the activation of the second phase of signaling (81, 137). Candidalysin acts by creating pores in epithelial cells, inducing calcium influx, and activating of the AP-1 transcription factor c-Fos via the ERK1/2, MKP1, MAPK signaling pathway (81). Candidalysin is key to

virulence traits in both oral and vaginal murine in vivo models and human cell culture models

(138).

In addition to cytokines that mediate phagocyte recruitment, epithelial cells attack pathogens directly by secreting defensive molecules including annexin A1, S100 alarmins, and the antimicrobial peptides b-defensin and cathelicidin (LL-37) in response to Candida infection

(80, 139, 140).

1.5.2.4 Neutrophils

Neutrophils are myeloid-derived innate immune effector cells. They are characterized by their granules and their multi-lobed nuclei. Neutrophils are the dominant cell type in early response to infection and injury (141). Their job is to identify, engulf and kill pathogen cells.

However, neutrophil activation is implicated in non-specific tissue damage and development of inflammatory diseases, autoimmunity, and ischemia-reperfusion injuries, so their responses need to be well-regulated.

Neutrophils play a role in fighting both mucosal and systemic Candidiasis. They were found to block filament invasion in zebrafish mucosal infection (142). Neutrophils are recruited to mucosal sites of infection by cytokines released by epithelial cells, innate lymphoid cells and tissue resident macrophages. During inflammatory responses, production of granulocyte macrophage colony stimulating factor (GM-CSF) ensures that hematopoiesis will provide a supply of replacement neutrophils.

Weapons in the neutrophil arsenal include phagocytosis and subsequent killing, release of granules, and production of neutrophil extracellular traps (NETs) (143). Phagocytosis depends on recognition of cell-wall components. Neutrophils recognize and phagocytose

Candida by at least two different mechanisms: one is opsonin and Fcg receptor-dependent and the second is opsonin-independent but depends on the lectin-binding site of complement receptor (CR)3. Once Candida is engulfed, the phagosome fuses with lysosomes and granules,

exposing Candida to a deadly cocktail of low pH, reactive oxygen species (ROS), reactive nitrogen species (RNS), proteases, and antimicrobial peptides. Neutrophil granules containing cytotoxic proteins and peptides aid in attacking fungi when they fuse with phagosomes or when released extracellularly during degranulation. NETs are a mesh of chromatin threads decorated with histones, proteases, and antimicrobial peptides (144). NETs bind to microbes and have been implicated in killing them. Evidence indicates that NETs cause damage C. albicans hyphae in vitro and in vivo (142, 145, 146).

Given their extensive repertoire of anti-fungal mechanisms, it should not be surprising that neutrophils respond differently to different Candida species. Neutrophils phagocytose and damage C. parapsilosis more efficiently than C. albicans (147, 148). Even though C. parapsilosis has more exposed b-glucan in the cell wall, its phagocytosis doesn’t depend on b- glucan detection by Dectin-1 while phagocytosis of C. albicans is reduced in neutrophils treated with a Dectin-1 antibody. Likewise, different mechanisms of attack are employed against the different Candida morphologies(149). Soluble lectin receptor, Gal3, enhanced phagocytosis of

C. parapsilosis yeast and C. albicans hyphae, but not C. albicans yeast. When encountering hyphae that are too large to ingest, neutrophils make contact, wrap around them and attack by secreting ROS and releasing NETs (55, 142, 150, 151). Extracellular release of ROS may serve as a mechanism for transmitting information about microbe size: higher ROS levels are tied to signaling that recruits more neutrophils to large hyphal forms that are difficult to ingest (152).

Understanding the variety of interactions between neutrophils and different Candida species may help us to better treat patients with Candidiasis.

1.5.2.5 Macrophages

Mononuclear phagocytes are myeloid cells that include monocytes, macrophages and dendritic cells. Circulating monocytes differentiate into dendritic cells or macrophages once they leave the bloodstream. Unlike neutrophils, which are thought to be primarily involved in killing pathogens, macrophages have a diversity of roles, including pro- and anti-inflammatory

signaling, phagocytosis and killing of pathogens and dead or dying cells, and antigen presentation (153). Macrophages come in several varieties: resident macrophages regulate repair and regeneration in tissues, activated inflammatory macrophages attack pathogens and present antigens in order to activate adaptive immunity. Different organs have their own specialized populations of macrophages such as microglial cells in the central nervous system or alveolar macrophages in the lungs.

Macrophages play a prominent role in protection from disseminated Candidiasis (154–

156). In mucosal candidiasis, evidence thus far indicates that their activities are non-essential

(142, 157). However, their presence at mucosal sites and their known roles in signaling and antigen presentation indicate that their activities may play a role in mucosal candidiasis.

The first step in phagocytosis by mononuclear cells is the recognition of Candida via

Dectin-1 in cooperation with other PRRs (154, 158). Macrophages are less effective than neutrophils in killing fungi; yeast are able to survive and replicate in macrophage phagosomes

(37). In vitro, phagocytosed yeast can switch to hyphal growth, activate cell death pathways and kill macrophages by lysing them (86). However, in vivo imaging in the zebrafish showed that macrophages allow replication but prevent germination of yeast (64). In some cases, macrophages provide a protective niche where fungal pathogens can evade killing by neutrophils and thus promote pathogenesis (159–161).

Resident macrophages are the first to encounter invading Candida and sound the alarm.

In addition to phagocytosing and killing pathogens, they play a protective role in disseminated

Candidiasis by signaling with cytokines and chemokines (CXCL1, IL-6 and TNFa) to recruit and activate more phagocytes (154, 155, 162). In mucosal Candida infection, this signaling role is likely shared with epithelial cells and other cell types. In the gut, signaling by resident macrophages dampens responsiveness to commensals. When macrophage signaling is disrupted, neutrophil-mediated inflammation results (163, 164).

PBMCs respond differently to C. albicans and C. parapsilosis and differences in their cell wall components are likely to be involved (165). In in vitro comparisons, peripheral blood mononuclear cells (PBMCs) produced cytokines in response to heat-killed C. albicans or C. parapsilosis but with different levels of key cytokines involved in T-helper cell differentiation

(166, 167). Macrophages exhibit a preference for phagocytosing C. albicans yeast over hyphae in vitro (168).

1.5.2.6 Cooperation and cross-talk in mucosal tissue

Mucosal epithelial tissues are made up of many cell types. In this complex environment all the cell types need to communicate appropriately with each other in order to protect us from pathogens and also to avoid damage from excess inflammation. This is one of the strongest arguments for studying host cell interactions during mucosal candidiasis in a live host. Some examples of cell-cell interactions follow.

In vitro responses often differ depending on the presence or absence of other cell types.

When neutrophils (PMNs) were added to reconstituted oral epithelial models they enhanced expression of cytokines, cathelicidin and b-defensins by epithelial cells and protected the epithelium from invasion and damage (169, 170).

It is well-established that immunity to oropharyngeal candidiasis depends on IL-17 signaling. The Leibundgut-Landmann and Gaffen labs have elucidated the cell-type specific communication related to IL-17’s protection against Candida. Using a mouse model of oropharyngeal candidiasis, they found that dendritic cells produced cytokines (IL-1b, IL-6, and

IL-23) to induce IL-17 production and that the majority of IL-17 production could be attributed to innate lymphoid cells (and not Th17cells) (171, 172). IL-17 is detected by oral epithelial cells which then release b-defensin-3 to control Candida infection (111). IL-1 receptor is essential for both the recruitment and hematopoiesis of neutrophils that protect the host from OPC. The IL-

1a cytokine signal is produced by keratinocytes in the Candida-infected tongue and received by

endothelial cells, which are the primary source of GM-CSF, a cytokine responsible for inducing the generation of new neutrophils from the bone marrow (173).

Finally, the effector functions of phagocytes are affected by the presence of their partners. Neutrophil and macrophage phagocytosis and killing in Candida challenges of a single phagocyte type were altered when the two phagocyte types were cocultured together with C. albicans (174).

In conclusion, Candida colonization and infection of the mucosal epithelium is a complex situation involving interactions among many host cell types and the pathogen. While in vitro experiments testing the interactions of single cell types with fungal pathogens can yield important information, it’s essential that the results be verified in a live infection model where a natural complement of cell types are present.

1.6 Models of Candida Infection

To learn about host-pathogen interactions during infection, one must have a good model. Researchers must consider how closely the model reflects human disease, the number of replicates needed, the ease of use, and the ability to manipulate the genetics of the model

(175). In this section, I will review the characteristics, advantages and disadvantages of in vitro and in vivo models that have traditionally been used to study candidiasis. I will devote section

1.7 to describing the model used in this dissertation, the zebrafish.

1.6.1 In vitro models

Much of what is known about the interactions between host cells and Candida has been discovered using in vitro models. These include leukocytes from human blood donors, bone marrow-derived macrophages/monocytes, mouse cell lines and human epithelial cell cultures. In vitro models allow the experimenter exquisite control over the physiochemical environment and ensure homogeneity of cell types. They enable the testing of pathogen or host cell mutations, treatments and drugs in an environment that isolates the effects of these factors. Many in vitro experiments utilize live cell imaging to track host-pathogen interactions. Their simplicity is an

advantage but also comes with a caution – what is seen in vitro doesn’t always translate to the live host.

1.6.1.1 Epithelial cell models

The simplest epithelial models are monolayers of epithelial cells. These can be primary cell cultures started from mouse or human tissue or, alternatively, immortalized epithelial cell lines can be used. For a more realistic model, 3-dimensional organotype epithelial models of human oral and vaginal mucosa have been created by growing epithelial cells on an inert polycarbonate filter in defined media (176). Three-dimensional models of oral mucosae can be made more realistic by growing them in a flow chamber with a saliva-like media and on a collagen gel embedded with fibroblasts (177, 178). Researchers have argued for the value of in vitro models made from human as opposed to murine epithelial cells for studying C. albicans because this fungus is primarily a human pathogen and doesn’t naturally infect mice.

1.6.1.2 Models of phagocyte-Candida interactions.

Parameters of the fungus and the host that affect host cells’ ability to phagocytose

Candida have been explored in suspension cultures of host cells. Protocols involve fluorescent labeling of yeast prior to coincubation with phagocytes, quenching of that labeling or secondary labeling of extracellular yeast, and fluorescent antibody labeling of host cells, followed by fluorescence microscopy or flow cytometry to detect the number of host cells with internalized yeast and the number of yeasts per phagocyte (179, 180). Suspension co-cultures mimic phagocyte/pathogen encounters in the blood stream, but in the live host, phagocytes more often encounter pathogens within tissues.

Models that include aspects of the tissue environment can more closely resemble the surroundings of phagocytes in vivo. As they move through tissues, phagocytes encounter extracellular matrix components. In vitro experiments showed that incorporating these molecules altered phagocyte responses to pathogens (181, 182). In another example, neutrophils tested in a model that mimics the endothelial lumen had increased longevity and

faster migration towards pathogens (183). These more realistic in vitro models will help to make sense of differences between the results of previous in vitro work and in vivo experiments and human clinical data.

1.6.2 In vivo models

Animal models bridge the gap between cell culture findings and human trials and are an absolutely essential part of the research process. The challenge is to choose a model that is representative of the human infection environment while balancing the needs of the researcher.

For the study of mucosal candidiasis, rodent models have been the standard. However, small vertebrate animals (zebrafish, Danio rerio) and invertebrates (e.g. Drosophila melanogaster,

Galleria mellonella, Caenorhabditis elegans) have been used successfully and have gained respect for their ease of handling, genetic manipulation, and microscopy, plus their relatively low cost.

1.6.2.1 Mouse and rat models

Rodent models have been used to study mucosal candidiasis at the body sites where it is found in humans: oropharynx, gut, and vagina. A model to study oral candidiasis was developed in rats using an acrylic device to mimic dentures. Oral infection in mice is only established after immunosuppression, treatment with antibiotics, or in mice with genetic defects in immunity (184, 185). C. albicans is not a natural commensal of rodents, which can be seen as an advantage in that the subjects will not have developed adaptive immunity to the organism prior to inoculation, allowing the study of the initial innate response.

Rats were the first rodents used to model Candida vaginitis, but mice have been used in recent experiments. In both rats and mice, the animals must be treated with estrogen to establish infection. This parallels human infection, where hormone levels affect susceptibility

(184, 186). The mouse model recapitulates human infection in characteristics of the immune response including the production of neutrophil chemoattractants, neutrophil infiltration, and the fact that protection is associated with the absence of a pro-inflammatory response (186).

As mammals, rodents have many characteristics of human subjects. For example, their body temperature approximates that of humans, which is important to the study of C. albicans since morphotype switching and growth is affected by temperature. Despite their many advantages, rodent models present some difficulties. Rodents are expensive to house and care for. Creating knock-outs is time-consuming and labor intensive. Ethical considerations require the use of only a few experimental subjects, making it difficult to detect small differences between experimental treatments. In vivo imaging of fungal infection in rodents is limited in both time and in which tissues are accessible.

1.6.2.2 Invertebrate models

The fruit fly, Drosophila melanogaster, the nematode, Caenorhabditis elegans, and the larva of the insect Galleria mellonella have been developed as models for fungal infection (187–

189). Their advantages are lower expense and the ability to use large numbers of animals per experiment. C. elegans and D. melanogaster can be inoculated by ingestion of fungi in their diet saving time over animals that need to be inoculated individually by injection. These invertebrates lack an adaptive immune system but possess hemocytes that function similarly to mammalian phagocytes. They are ideal for high throughput studies comparing different Candida species or mutants. An advantage of Galleria is that they can be kept at 37 C, the appropriate temperature for a human commensal like Candida. C. elegans has a transparent cuticle so intravital imaging of the whole animal is possible.

1.7 Zebrafish Models of Fungal Infection.

The zebrafish is essentially the only tiny vertebrate model in use for the study of Candida infection and is the model used in this dissertation. Therefore, I will devote a section of this literature review to a description of its advantages and the findings that it has facilitated. Much of the material in this section was written by the author and her advisor for publication in a review article entitled “The Zebrafish as a Model Host for Invasive Fungal Infections” (190).

The larval zebrafish has many of the advantages of invertebrate models: ease of care, access to large numbers of experimental animals, and relatively low cost. Over the past ten years, work from several laboratories has established mucosal, disseminated and localized infection models in zebrafish larvae, taking advantage of the transparency of the zebrafish larva to monitor single-cell dynamics over the long-term to understand determinants of infection progression, pathogenesis and immune response (160, 191–194). These studies have revealed numerous parallels between zebrafish and mammalian infection models, extended in vitro studies into a vertebrate host, and uncovered new and unexpected aspects of host-pathogen interaction in vivo.

1.7.1 The zebrafish toolkit

Because of the ease of live imaging, larval zebrafish provide an ideal model in which to investigate phagocyte–fungal pathogen interactions and host cell signaling. The small size of the zebrafish larva makes diffusion sufficient for gas exchange thus providing opportunities to view host cell–pathogen interactions in vivo. Additionally, living larvae can be imaged for multiple days in a row to follow the entire progression of an infection, another unique advantage of the system. To visualize the host side of these interactions, multiple established zebrafish lines exist which label neutrophils and macrophages or mark inflammatory gene expression

(195–199). In addition, many models of immune deficiency are established in the zebrafish

(200–203).

1.7.2 Phagocyte interactions with fungal pathogens

Established genetic and experimental methods for depletion of macrophages or inactivation of neutrophils allow for the specific contributions of these cell types to be elucidated

(142, 191, 201, 204–206). In the zebrafish, neutrophils and macrophages are recruited to yolk, hind-brain, and swimbladder infections of C. albicans. Using tools to manipulate signaling and phagocyte recruitment, a picture is emerging of the roles and activities of these innate immune cell populations, with interesting new findings. One conundrum in the field has been that

macrophages are important in immunity to C. albicans in vivo, but when isolated macrophages ingest yeast, the fungi germinate and kill the macrophages rapidly and efficiently in vitro (13,

207–209). However, during C. albicans infection in the zebrafish it is clear that macrophages can prevent fungal germination and thereby provide a crucial brake on the infection. In fact, the efficiency of fungal ingestion within the first four hours of infection is crucial for overall survival

(210). The engulfed yeast were found to survive, divide, then exit macrophages far from the infection site (Brothers et al., 2013; Scherer et al., manuscript in preparation), suggesting that C. albicans has a mixed intra-/extra-cellular lifestyle during infection that includes Trojan horse- mediated fungal dissemination.

Early phagocyte containment could be enhanced by opsonizing antibodies and is a crucial determinant of overall survival in the hindbrain ventricle infection model (210, 211).

Experiments also found that macrophage recruitment to filamentation-competent C. albicans requires both phagocyte oxidase (Phox) and dual-specific oxidase (Duox), revealing a new role for NADPH oxidases in phagocyte recruitment (210). In addition to phagocyte recruitment, zebrafish also allow for the assessment of phagocyte activation and recent work in both the swimbladder and yolk models of infection demonstrate that the major cell type expressing TNF-

α at the site of infection is the macrophage, whose presence there drives large increases in

TNF-α expression host-wide (Archambault et al., 2019, Scherer et al., manuscript in preparation). Taken together, these studies in the larval zebrafish have expanded our appreciation for the versatility of C. albicans, identified a new role for NADPH oxidases in the immune response and highlighted the importance of rapid macrophage responses in limiting lethal infection.

Neutrophils engulf C. albicans yeast and attack filaments in both the hindbrain ventricle and swimbladder (142, 210). Neutrophilic attack drives production of extracellular traps in the swimbladder and limits hyphal penetration of the epithelial barrier, providing a crucial element to mucosal immunity (142). This neutrophil response requires both PI3K and CXCR2, as in

mammalian systems (142). Extracellular neutrophil histones suggestive of neutrophil extracellular traps (NETs) were also observed after hindbrain infection with C. albicans (41).

Several reporter strains of C. albicans have also been used in larval zebrafish to probe the micro-environmental conditions of the fungi during infection. This has included sensors for oxidative stress (210), arginine starvation (213), and hyphal growth (211), revealing microclimates within the host to which the fungi are exposed. The ability to visualize infection has deepened our appreciation for mechanisms discovered in simplified cell culture interactions and has also sparked new hypotheses about fungal virulence and immunity that remain to be tested in mammalian systems.

1.7.3 Sites of infection

As vertebrates, zebrafish have multiple organs and anatomical sites for infection that are analogous to those in mammalian models and human hosts. An advantage in zebrafish is the ability to view the entire organism to follow the progression of infection (i.e. dissemination). The fish lacks some organs important in human fungal infections (lungs, for example) so it’s important to choose the best model to suit the experimental question.

1.7.3.1 Yolk

Injection of Candida into the embryonic zebrafish yolk sac is straightforward and can lead to systemic infection. The yolk sac provides nutrients to the developing larva and is surrounded by the yolk syncytial layer (YSL) which separates the yolk from the fish body proper

(214, 215). Early work using the embryonic zebrafish yolk showed that phagocytes were recruited to this site in response to sterile injury and to C. albicans infection (216, 217). These phagocytes likely arrive through a network of blood vessels in close proximity to the yolk which may also give pathogens potential routes of dissemination (218).

The yolk can be an excellent location for detailed imaging of phagocyte-fungal interactions. In a recent study, this injection site was used in zebrafish with macrophages expressing a photo-switchable reporter to show macrophages suffered a different fate after

interacting with C. albicans. Once they had interacted with the pathogen, macrophages tended to remain in the infection area and were more likely to die than “bystander” macrophages (219).

Currently, the yolk infection site is being used to dissect the complex web of host and pathogen factors contributing to the dissemination of C. albicans and has already led to the surprising discovery that yeast and hyphae do not synergize with each other in promoting dissemination

(Seman et al., 2018; Scherer et al., manuscript in preparation).

1.7.3.2 Hindbrain ventricle

The hindbrain ventricle (HBV) is a clear, fluid-filled space that can be inoculated via microinjection at 36-48 hpf (190). It is normally free from phagocytes so is especially well-suited to visualizing phagocyte recruitment and interactions through the thin epithelial layer covering the HBV. Although the HBV has no structural homology to mammalian structures, the ease of injection and subsequent imaging make it a worthwhile model for phagocyte-pathogen interactions.

Injection of C. albicans into the HBV led to insights into Chronic Granulomatous Disease

(CGD), a defect in host production of reactive oxygen species (ROS), which predisposes patients to disseminated fungal infection (220, 221). While ROS were previously known to play a role in the killing of C. albicans in vitro, live imaging of infected zebrafish embryos enabled the discovery of a separate role in promoting chemotaxis. Treating zebrafish with DPI or morpholinos to mimic CGD showed that both phagocyte oxidase (Phox) and dual-specific oxidase (Duox) play signaling roles in phagocyte recruitment, which promotes containment of infection and survival of the host, not by the immediate killing of C. albicans but by recruiting phagocytes which then ingest it and limit its germination (210).

Because containment of C. albicans by phagocytes at this site is closely tied to host survival, the HBV model is ideal to test the utility of biological antifungal therapies (211). It was found that non-specific human IgG enhances phagocytosis by zebrafish phagocytes and that polyclonal anti-Candida antibodies enhance containment of fungi in vivo and promote survival.

Thus, this model is useful for testing antifungal therapies that could enhance innate immune activity against C. albicans.

C. albicans cells that are not heterozygous at the mating-type loci are competent to switch between white and opaque forms (222). White cells are in general more virulent, although opaque cells have some enhancement in virulence at lower temperatures, something that has only been testable in the larval zebrafish because of its flexibility in body temperature

(223). Interestingly, opaque cells are poorly phagocytosed by mammalian and zebrafish phagocytes both in vitro and in vivo, which would potentially allow them to avoid phagocytic containment and permit them to grow as potentially pathogenic filaments (223).

1.7.3.3 Swimbladder

The zebrafish swimbladder is a mucosal, epithelial-lined, air-filled organ that functions to maintain and adjust buoyancy. The swimbladder displays homology with the mammalian lung in terms of anatomy, development, and gene expression (224–227), providing a clinically relevant model for fungal infections of the lungs such as Aspergillus and Cryptococcus. The swimbladder forms as an outgrowth of the foregut at 36-48 hours post-fertilization (hpf) and by 60 hpf, the swimbladder consists of three layers: an inner epithelium, a middle mesenchymal layer in which nerves and blood vessels are embedded, and an outer mesothelial layer (224, 227). While the larval zebrafish swimbladder lacks the complexity of mature mammalian mucosal epithelial surfaces, such as the tongue or intestine, ease of injection and imaging make it a suitable general model and a good bridge between cell culture and mammalian models. Its versatility is illustrated by its successful use in the study of a variety of infections including those caused by

Mucor circinelloides, Influenza A virus and Candida albicans/Pseudomonas aeruginosa coinfection (191, 228, 229)

The zebrafish inflates the swimbladder with air at around 4.5 days post-fertilization (dpf), and injection of microorganisms into the swimbladder lumen is a relatively simple endeavor.

Interactions between pathogens and host cells can be easily monitored at this site, as it is

patrolled by phagocytes of the innate immune system which are recruited in greater numbers in response to infection, LPS and sterile injury (230, 231). As in mucosal infection in vitro and in mammalian models, zebrafish activate NF-kB in the swimbladder tissue and express inflammatory cytokines in response to C. albicans infection (230). The air bubble creates a clear optical background which enhances imaging at the inner surface of the swimbladder. However, the air bubble also makes the swimbladder the thickest part of the larva, so imaging is usually limited to one half the width of the swimbladder, and the relatively later age at which the swim bladder develops limits experiments to later larval stages. The entire organ can be dissected for clearer imaging of interactions between host epithelial cells, phagocytes, and fungal yeast or hyphae (212, 230, 232).

One example of an advance made possible by the swim bladder model, and the ability to longitudinally track infection progression and outcome in individual zebrafish larvae, is a study of tri-kingdom interactions between C. albicans, P. aeruginosa and the zebrafish host (229). These pathogens are often co-isolated in human lung infections, particularly in cystic fibrosis patients.

Bergeron et al. found a synergistic interaction between the two pathogens that led to elevated inflammation, as indicated by higher IL-6 expression and swimbladder edema, and increased C. albicans pathogenesis that manifested in greater fungal burden and more frequent epithelial invasion by fungal hyphae.

1.7.3.4 Egg

Infection of the zebrafish egg has been investigated as an approach for testing pathogen characteristics (233–237). While infection at this embryonic stage occurs before the development of many immune system components (238), the potential of this model lies in its applicability to high-throughput screens and studies. Two groups have developed robotic methods for injecting into the yolk of very early zebrafish embryos still within the chorion; one utilized computer image recognition to guide the needle (236) while the other used an agarose grid of dimples to hold the eggs, which naturally aligned themselves with the cellular material to

the side, making yolk injection without visual guidance possible (234). Using a bath infection method at 1 dpf, a recent study found a novel gene, ORF 19.1725, to be involved in C. albicans adhesion, penetration, and virulence (239).

1.7.3.5 Peritoneal cavity

While I have been focused on the utility of larval zebrafish, adult zebrafish also have advantages as a model. For example, the adaptive immune response to fungal infection can be studied in adult zebrafish (240, 241). In fact, the earliest use of zebrafish for the study of C. albicans infection employed intraperitoneal injection of adult fish, which showed that many aspects of Candida infection in mice could be replicated in the zebrafish model (217). These infections have yielded valuable transcriptome data from both host and the pathogen during infection (242). Combined with existing protein–protein interaction networks, these data have generated hypotheses about host and pathogen interactions at different stages of infection

(243–245).

1.7.4 Conclusion

The zebrafish is a valuable model for the study of host-pathogen interactions. Molecular and genetics tools have been developed and it is an affordable alternative to mammalian in vivo models. The limitations of the zebrafish (lack of adaptive immunity, temperature restrictions) require that the researcher carefully consider the questions best probed with this model. The ability to visualize infection has deepened our appreciation for mechanisms discovered in simplified cell culture interactions and has also sparked new hypotheses about fungal virulence and immunity that remain to be tested in mammalian systems.

1.8 Chapter Summary

In this introductory chapter, I hope I have provided an understanding of the complexity of host-microbe interactions at our mucosal surfaces. For my dissertation project, I chose the zebrafish swimbladder infection model to probe host immunity in mucosal infections by two species of the fungus, Candida. Intra-vital imaging of transgenic zebrafish with fluorescently

marked macrophages and neutrophils allows a close-up view of the interactions between phagocytes and fungal cells. Fish with fluorescent reporters for inflammatory signaling can help to elucidate the intricate dance of signaling and response that must occur in mucosal tissues to balance tolerance of commensals with protection from pathogens.

In modern medicine, physicians are frequently forced to balance immune suppression against immune stimulation to treat patients such as those undergoing transplants and chemotherapy. It is my intention that this work will provide a clearer picture of the roles of professional and non-professional innate immune cells that our new understanding will lead to better-targeted therapies designed to preserve immunity and prevent opportunistic fungal infection in vulnerable patients.

CHAPTER 2

INTRAVITAL IMAGING REVEALS DIVERGENT CYTOKINE AND CELLULAR IMMUNE

RESPONSES TO CANDIDA ALBICANS AND CANDIDA PARAPSILOSIS

2.1 Introduction

Fungal species of the genus Candida are commensals on mucosal surfaces in healthy human hosts but cause both invasive and mucosal Candidiasis when immune defenses are compromised(32, 246). While Candida albicans is the species most commonly isolated from patients, infections due to C. parapsilosis are increasing, especially in neonates born prematurely (42, 43, 247). In healthy hosts, Candida is maintained as a commensal through the defenses of professional immune cells and the barrier functions of the mucosal epithelium.

When these defenses are compromised, mucosal candidiasis ensues (32, 248). Understanding how host cells at mucosal surfaces interact with the fungal cells and how they coordinate their anti-fungal defenses will inform our attempts to prevent both systemic and mucosal disease (18,

249).

The mucosal epithelium is a complex environment and protection from mucosal candidiasis requires the combined actions of several cell types. In addition to their barrier functions, epithelial cells respond to Candida by inhibiting Candida growth with antimicrobial peptides and recruiting immune effector cells with alarmins and pro-inflammatory cytokines

(173, 250–252). Among immune cells, neutrophils play key roles in defense at mucosal surfaces and in preventing dissemination of C. albicans (38, 253). In vitro, neutrophil/epithelial cross-talk provides protection from C. albicans (254–256). However, neutrophil activity must be tightly controlled as evidenced by its role in worsening symptoms of vulvovaginal candidiasis (27, 257,

258). Monocytes/macrophages are essential for establishing protective immunity to disseminated infection but their role in mucosal infection is not completely clear (154–156, 259,

260). Evidence from mouse and zebrafish models points to the redundancy of macrophages in

mucosal C. albicans infections (142, 157). However, macrophages have been shown to protect against other fungi in mucosal infection (261–264). C. parapsilosis is known to interact with macrophages and monocytes in vitro but the roles of phagocytes in controlling C. parapsilosis infection have not yet been explored in any live vertebrate infection model.

Epithelial cells and patrolling phagocytes are the first host cells to detect pathogens and signal to coordinate defenses against mucosal candidiasis (24, 112, 248). In vitro experiments with single cell types have shown that epithelial cells and phagocytes differ with respect to inflammatory signaling during challenge by C. albicans and C. parapsilosis. Epithelial cells from oral and intestinal sources (oral cell lines SCC15 and TR146 and primary human enterocyte cell line H4) respond in vitro to C. albicans by producing pro-inflammatory cytokines but produce little cytokine response to C. parapsilosis (135, 254, 265). On the other hand, professional innate immune cells, including human peripheral blood mononuclear cells, murine peritoneal macrophages, and the murine macrophage cell line J774.2, produce pro-inflammatory cytokines in response to both heat-killed C. albicans and C. parapsilosis (165–167). These contradictory results make it difficult to predict how the different cell types in mucosal tissues coordinate defense against these opportunistic fungal pathogens, so we sought to measure immune responses in a tractable vertebrate mucosal infection model.

In vitro experiments are limited to a few host-cell types and in vivo imaging in mammalian models is technically difficult (169, 266, 267). Complex signaling interactions between different host cell populations during mucosal Candida albicans infection were hinted at in studies using in vitro models with two or more host cell types (255, 256) and have been further elucidated using fluorescence-activated cell sorting of infected mouse tissue (171–173).

Although these studies have shed light on the signaling roles and interactions of various host cell types with C. albicans, there remain significant gaps in our knowledge about the dynamics and cell-type specificity of immune responses in the host, especially with respect to infections with other clinically important Candida species such as C. parapsilosis. To further explore these

in vitro and in vivo findings using intravital imaging, we turned to the zebrafish swimbladder mucosal model, which mimics many aspects of mammalian infection (142, 230). The swimbladder is a natural site of fungal infection initiation in the fish that shares functional, anatomical, ontological and transcriptional similarities to the lung (224, 226, 227, 268–274). We compared the mucosal immune response to two clinically relevant Candida species in an environment containing multiple host cell types, measuring several aspects of the immune response, including pathway activation, cytokine production and innate immune recruitment.

While C. albicans activated nuclear factor kappa B (NF-kB) signaling and elicited a strong pro- inflammatory cytokine response at this mucosal site, the host inflammatory response to C. parapsilosis was muted, similar to what has been found in vitro for epithelial cells. Live single- cell imaging suggests that NF-kB activation and tumor necrosis factor alpha (TNFα) upregulation occur in different cellular subsets. Interestingly, the inflammatory cytokine response was not predictive of phagocyte behavior, as neutrophils and macrophages were recruited to and attacked both Candida species. Nevertheless, neutrophils were essential for protection only from C. albicans but not C. parapsilosis, confirming their known role in attacking hyphae. The differential immune responses to the two species reveal a disconnection between chemokine production and phagocyte recruitment. Single-cell intravital imaging further suggests that there is tissue-specific activation of NF-kB and TNFα expression in mucosal candidiasis.

2.2. Results

2.2.1 C. albicans causes lethal infection but C. parapsilosis does not.

C. parapsilosis and C. albicans are opportunistic pathogens that live commensally on mucosal surfaces of healthy humans and elicit different reactions from immune and epithelial cells in vitro

(135, 265). To explore the relative virulence of these two fungal species in the mucosal setting in a live vertebrate host, we modified the zebrafish swimbladder infection model previously developed in our lab (142, 230, 275). We infected with a larger inoculum of 50-100 yeast to

promote morbidity without immuno-compromising the host (Fig. 2.1A). Both Candida species grew readily in the swimbladder, with C. albicans covering about twice as much area as C. parapsilosis by 24 hours post infection (hpi) (Fig. 2.1B). In the high-inoculum infection of immunocompetent fish used in this study, the swimbladder remained fully inflated and appeared healthy in the first hours after infection (Fig. 2.1C). However, within 24 hpi signs of disease were apparent, with swimbladders becoming partially (Fig. 2.1D) or completely (Fig. 2.1E) deflated.

Over time, the swimbladder could become greatly distended (Fig. 2.1F) and in C. albicans infections, hyphae sometimes breached the swimbladder epithelium, a factor predictive of fish death (142, 229). C. parapsilosis infection caused no mortality within 4 days post-infection (dpi), while C. albicans-infected animals began to perish at 2 dpi and reached 20% mortality by 4 dpi

(Fig. 2.1G). Thus, in these high-inoculum infections, only C. albicans caused patterns of disease leading to mortality that were similar to those previously seen in immunocompromised fish and in a mixed fungal/bacterial infection (142, 229).

2.2.2 Zebrafish infected with C. albicans produce higher levels of inflammatory cytokines than C. parapsilosis-infected fish.

Because we saw differences in the severity of the infections, we expected to find different inflammatory responses to the two Candida species. We measured changes in the expression of six inflammation-associated cytokines at 24 hpi (Fig. 2.2). In C. albicans infection, expression was significantly elevated above control levels for all six cytokines and higher than observed in C. parapsilosis infection for 4 of 6 cytokines. In contrast, in C. parapsilosis-infected fish, the median levels of cytokine expression were not significantly elevated above controls.

Thus, C. albicans evokes a stronger whole-fish cytokine response than C. parapsilosis during in vivo mucosal infection, demonstrating that there are important differences in the immune response at this early time point—hours before mortality is observed.

Figure 2.1. C. albicans is more virulent than C. parapsilosis in the zebrafish swimbladder infection model. (A) Zebrafish were infected in the swimbladder at 4 days post-fertilization (dpf) with 50-100 yeast. (B) Candida burden at 24 hours post infection (hpi) as quantified from confocal z-projections. Data were pooled from 4 experiments. (C-F) Examples of infected swimbladders in Tg(mpx:mCherry):uwm7Tg zebrafish, infected with C. parapsilosis (C, D) or C. albicans (E, F). Depicted are: normal appearance of swimbladder (C; 6hpi), partial swimbladder deflation (D; 24 hpi), complete deflation (E; 24 hpi), distended swimbladder (F; 24 hpi). Scale bars: 150 µm. Dotted white line indicates boundary of swimbladder. (G) Injected fish were monitored for survival for 4 dpi. Data pooled from 3 independent experiments. Statistics as described in Materials and Methods. *, P<0.05, **, P<0.01.

Figure 2.2. C. albicans elicits higher levels of cytokine expression than C. parapsilosis.

Zebrafish were infected at 4 dpf as above. At 24 hpi, total RNA was extracted from groups of 9-

14 fish. Gene expression levels were determined by qPCR relative to mock-infected fish using the 2-∆∆Ct method. Data from 11 independent experiments. Notations above each bar indicate the significance of the difference between experimental treatments and vehicle-injected controls. Notations above the brackets indicate if there was a difference between C. parapsilosis and C. albicans-infected fish. Statistics as described in Materials & Methods: *, P<0.05, **,

P<0.01, ***, P<0.001, ****, P<0.0001, (ns) not significant, P>0.05). Abbreviations: serum amyloid A (saa), tumor necrosis factor (tnf)-α, interleukin-10 (il-10), C-C motif chemokine ligand

2 (ccl2), C-X-C motif ligand 8 (cxcl8), interleukin-6 (il-6).

2.2.3 The local inflammatory signaling pattern mirrors whole-fish cytokine levels.

The whole-fish qPCR data showed overall cytokine responses but did not give us any spatial information about inflammatory signaling or indicate the cell types involved. In the

zebrafish, local immune activation and cytokine signaling by epithelial tissue and innate immune cells can be imaged in real time in the live host. Two key signaling components activated by

Candida are NF-kB and TNFα (134, 158, 230, 276–278). TNFα expression is activated downstream of NF-kB and other signaling pathways, and is implicated in protective cross-talk between polymorphonuclear cells and the oral epithelium (256, 279).

To detect activation of NF-kB at the infection site, we used a transgenic zebrafish line

Tg(NF-kB:EGFP) that reports on pathway activity in multiple cell types and is activated in the swimbladder upon mucosal infection (195, 230). Imaging of infected fish at 24 hpi revealed significant induction of NF-kB in C. albicans-infected fish but only basal levels of activity in C. parapsilosis-infected fish (Fig. 2.3A-D). As expected, we found GFP expression in several tissues, but not the swimbladder, under homeostatic conditions (195). To visualize local cytokine expression, we used TgBAC(tnfa:GFP)) reporter fish (196). Again, we only saw significant activation of tnfa:GFP in C. albicans and not C. parapsilosis infections (Fig. 2.4A-D).

Figure 2.3. Transcription Factor NF-kB is activated during C. albicans but not C. parapsilosis infection. Transgenic Tg(NF-kB:EGFP) zebrafish were infected and imaged as above. (A-C) Images representing the median level of NF-kB activation for Vehicle (A),

Figure 2.3 continued. C. parapsilosis (B), and C. albicans (C) injections. Maximum projections of 12 z-slices. Left: overlay of fluorescence and DIC. Middle column: overlay of fluorescence with dotted outline of swimbladder. Right column: thresholded image for quantification. (D)

Quantification of NF-kB activation. Data from 3 independent experiments. All scale bars: 150

µm. Statistics as described in Materials & Methods: *, P<0.05, **, P<0.01, ***, P<0.001, n.s. not significant, P>0.05.

Figure 2.4. Pro-inflammatory cytokine TNFα is expressed during C. albicans but not C. parapsilosis infection. (A-D) TgBAC(tnfa:GFP) reporter fish were infected and imaged at 24 hpi as above. (A) Quantification of TNFα expression. Data from 3 independent experiments. (B-

D) Representative images of swimbladders with median level of TNFα expression are shown for

Vehicle control (B) and C. parapsilosis (C), and C. albicans (D) infections. Left column:

Maximum projections of 15-18 z-slices. Right column, dotted outline of swimbladder. All scale bars: 150 µm. Statistics as described in Materials & Methods: *, P<0.05, **, P<0.01, ***,

P<0.001, n.s. not significant, P>0.05.

Intriguingly, despite the well-characterized connections between NF-kB and TNFα, our in vivo imaging revealed differences in the spatial patterns of NF-kB activation and expression of

TNFα during C. albicans infection. NF-kB:EGFP fluorescence was more diffuse (Fig. 2.3C) while tnfa:GFP expression was more punctate and visible mainly near C. albicans yeast and hyphae (Fig. 2.4D). These patterns of activity were especially interesting because previous work has shown that, in addition to the resident phagocytes present without infection, there are recruited phagocytes present within the epithelial-lined swimbladder at this time post-infection

(142, 229, 230)(see also below).

2.2.4 Signaling patterns differ in macrophages and epithelial tissue.

While live imaging of transgenic fish at low resolution narrowed the location of signaling to the infection site, it did not allow us to identify which cell types were activated and contributing to swimbladder fluorescence. Because of the differences in NF-kB and TNFα patterns, we reasoned that the two signaling components might be activated in different cell types. To examine cellular expression at high-resolution and distinguish between fluorescence within the swimbladder and fluorescence in overlying tissue, we dissected swimbladders from C. albicans- infected zebrafish using the method previously developed in our laboratory (232). Imaging of

Tg(NF-kB:EGFP) zebrafish swimbladders immediately after dissection revealed GFP-positive cells of the epithelial layer both near and distant from the area at the back of the swimbladder containing fungi (Fig. 2.5A). This is also illustrated in a single representative slice by outlining fluorescent cells and adding the tissue landmarks (Fig. 2.5B). In TgBAC(tnfa:GFP) zebrafish,

GFP-positive cells were not seen in the epithelial layer but many GFP-positive cells were intermingled with yeast and hyphae (Fig. 2.5C). This is again illustrated in a representative z- slice (Fig. 2.5D). The morphology and location of these cells is consistent with that of phagocytes.

Figure 2.5. Patterns of NF-kB activation and TNFα expression differ. Dissected swimbladders from C. albicans-infected fish were imaged at 24 hpi. (A) Z-projection of 3 slices of a dissected Tg(NF-kB:EGFP) swimbladder with moderate EGFP expression. (B) Single z- slice from blue square in the z-stack in A, with outlines of fungi, EGFP+ cells and epithelial layers based on DIC image. (C) Z-projection of 7 slices of a TgBAC(tnfa:GFP) swimbladder with high GFP expression. (D) Single z-slice from blue square in the z-stack in A, with outlines of fungi, GFP+ cells and epithelial layers based on DIC image. Scale bars 150 µm (A, C), 50 µm

(B,D).

To further characterize these cells displaying immune activation we assessed their motility by crossing Tg(NF-kB:EGFP) or TgBAC(tnfa:GFP) fish with mpeg1:dTomato (red

macrophage; (199)) reporter fish and using time-lapse imaging to view the shape, behavior and identity of GFP-fluorescing cells in infected fish. We found in time-lapse experiments that mpeg1:dTomato+ macrophages were occasionally double-positive for NF-kB:EGFP or tnfa:GFP

(Fig. 2.6A-B; 6/43 macrophages for NF-kB:EGFP and 7/35 macrophages for tnfa:GFP). Cells that are GFP+ are outlined and were followed for more than 16 minutes (Fig. 2.6Ai-iii and 2.6Bi- iii). In TgBAC(tnfa:GFP) fish all GFP+ cells (7/7) were also dTomato+, indicating that they are macrophages, while this was only the case for a minority of GFP+ cells in Tg(NF-kB:EGFP) fish

(5/57; Fig. 2.6Aii and 2.6Bii). Many GFP+ cells were motile in tnfa:GFP transgenics (5/7) but only a few were motile in NF-kB:EGFP transgenics (3/57; Fig. 2.6Aiii and 2.6Biii). This indicates that while TNFα expression in the swimbladder is limited to macrophages, NF-kB signaling is activated in both macrophages and other cells likely to be epithelial. Time lapse videos may be found attached to the published article reporting this work (212).

Large, non-motile cells, in Tg(NF-kB:EGFP) fish such as cell #2 (Fig. 2.6Aiii, yellow dotted outline) were EGFP+ but dTomato-, suggesting they are not macrophages. In fact, the position and behavior of such cells suggest that they reside in the swimbladder epithelial layer, consistent with what is observed in dissected swimbladders (Fig. 2.5A, B). In TgBAC(tnfa:GFP) fish, some stationary cells, such as cell #4 in the time-lapse (Fig. 2.6Biii, yellow dotted outline), were interacting with Candida and were identified as macrophages based on their mpeg1:dTomato expression. These time-lapse data thus indicate that TNFα-expressing cells are more likely to be motile macrophages while NF-kB is most frequently activated in non-motile cells with epithelial morphology.

Figure 2.6. Tissue Partitioning of NF-kB activation and TNFα expression. Dissected swimbladders from C. albicans-infected fish were imaged at 24 hpi. (A, B) Still images from time lapses taken at 24 hpi. (A) Tg(NF-kB:EGFP) x mpeg1:dTomato (red macrophage) zebrafish at time = 0:00 of the time lapse in movie S1 (212). The leftmost image is a maximum-projection overlay of all colors using a middle plane from DIC. (Ai; column 2) Zoomed-in images of the areas outlined in the blue square. Dotted lines outline example cells that either moved (white outlines; cells 1, 3) or remained stationary (yellow outlines; cell 2) over the 16 minute-long time- lapse. (Aii; column 3) The GFP channel was eliminated to demonstrate red fluorescence of macrophages. Cells 1 and 3 are dTomato+ (macrophages), while cell 2 is not. Aiii; column 4)

Schematics showing the positions of each cell at the times indicated in the grayscale legend.

Only cells 1 & 3 change shape or position. (B) TgBAC(tnfa:GFP) x mpeg1:dTomato zebrafish at time = 0:00 of the time lapse in movie S2 (212). (Bi; Column 2) Outlines of example cells (white; moved; cells 5 & 6; yellow; stationary; cell 4). (Bii; Column 3) Cells 4, 5, and 6 are dTomato+

(macrophages). (Biii; Column 4): Schematics showing movement over time. Cells 5 & 6 change shape and position over the course of the time lapse but cell 4 does not. Color channels: z projection of 13 (A) or 11(B) slices, DIC: single z-slice. Scale bars 150 µm (A, B), 50 µm (Ai-iii,

Bi-iii).

2.2.5 Neutrophils are recruited to infection and attack both C. albicans and C. parapsilosis.

The activation of NF-kB and expression of TNFα at the infection site in C. albicans- infected fish, combined with the qPCR data showing that the chemokines CXCL8 and CCL2 were only upregulated in C. albicans infection, suggested that phagocytes might be recruited only to C. albicans infections. We measured neutrophil recruitment using the

Tg(mpx:mCherry)uwm7Tg fish line, which has been characterized to express red fluorescence almost exclusively in neutrophils (198). To our surprise, we found increased neutrophil recruitment compared to mock-infections (11/fish) for both C. parapsilosis (25/fish) and C. albicans (50/fish) infections (Fig. 2.7A-D).

Because of the different cytokine milieu elicited by the two fungal species, we reasoned that there might be differential interactions of neutrophils with each species of fungi at the infection site. We examined z-stack images slice-by-slice and catalogued interactions between neutrophils and Candida (Fig. 2.7E-G). In C. albicans infection, significantly more neutrophils per fish were involved in interactions with the fungus, although this is not surprising considering their greater numbers in C. albicans-infected swimbladders (Fig. 2.7H). Interactions in which neutrophils had ingested C. parapsilosis (Fig 2.7E blue arrows) or C. albicans yeast cells (G, blue arrows) or were wrapped around C. albicans hyphae (“frustrated phagocytosis”) (Fig. 2.7F, yellow arrows) were counted as phagocytosis. When all neutrophils interacting with Candida were considered together, similar percentages were engaged in phagocytosis in C. parapsilosis

(~65%) and C. albicans (~72%) infections (Fig. 2.7I). Thus, despite the lower numbers of neutrophils in C. parapsilosis infection and the differing cytokine environment, neutrophils had similar levels of activity against each fungal species.

Figure 2.7. Neutrophils respond to infections of both Candida species.

Tg(mpx:mCherry):uwm7Tg zebrafish (red neutrophils) were infected as above and imaged at 24 hpi. Data are pooled from 5 independent experiments. (A-C) Representative images from

Vehicle (A), C. parapsilosis (B) or C. albicans (C) cohorts. Maximum projections, z-slices: n=19

(A), n=18 (B), n=16 (C), with (left) and without (right) single DIC z-slice. (D) Neutrophils per fish in the swimbladder lumen at 24 hpi. (E-G) Examples of neutrophils (red) interacting with C. parapsilosis (E, green) or C. albicans (F&G, green). Interactions include contact, phagocytosis

(E, G, blue arrows) and “frustrated phagocytosis” (F, yellow arrows). Maximum projections, n slices: n=3 (E, F), n=9 (G). (H) Neutrophils per fish involved in interactions with C. parapsilosis or C. albicans at 24 hpi. (I) Percentage of interacting neutrophils engaged in phagocytosis at 24

Figure 2.7 continued. hpi. (J) Neutrophils per fish interacting with yeast of C. parapsilosis, and yeast or hyphae of C. albicans. Number of neutrophils scored for Vehicle, C. parapsilosis and C. albicans, respectively: 191, 525 and 652. Statistics as described in Materials & Methods: *,

P<0.05, **, P<0.01, ***, P<0.001, ****, P<0.0001, n.s., not significant, P>0.05. Scale bars: 150

µm (A-C), 40 µm (E-G).

Dimorphic switching of C. albicans is considered an important virulence trait, although little is known about how different morphotypes interact with immune cells in vivo. In the swimbladder, C. albicans injected as yeast switch rapidly to hyphal growth within the first 3 hpi

(229, 232), and here we found that C. parapsilosis remains in yeast form throughout the infection period. Neutrophils were found interacting more often with C. albicans hyphae than with yeast, which could be due to the large number of hyphal segments present (Fig. 2.7J).

Overall, these data are consistent with the known activities of neutrophils against C. albicans hyphae and yeast in vitro (143, 146, 150, 152). In summary, neutrophils are recruited to and actively interact with fungal cells of both Candida species, despite the nearly undetectable levels of inflammatory cytokine production in C. parapsilosis infection.

2.2.6 Macrophages are recruited to infections of both Candida species.

Although patrolling macrophages play an important role in initiation of inflammation through the production of cytokines and are essential for controlling invasive candidiasis, they are thought to play a redundant role in mucosal Candida infection (86, 142, 155, 157, 231, 280,

281). Nevertheless, we observed a significant C. albicans-specific induction of ccl2 that suggested macrophages would be recruited only upon C. albicans infection. To our surprise, we found increased numbers of macrophages in the swimbladders of both C. parapsilosis-infected and C. albicans-infected fish (Fig. 2.8A-D; medians: Mock-infected:3 C.p.:6, C.a.:9).

Figure 2.8. Both C. albicans and C. parapsilosis elicit macrophage recruitment.

Figure 2.8 continued. Transgenic mpeg1:GAL4/UAS:nfsB-mCherry zebrafish (red macrophages) were infected and imaged at 24 hpi. (A-C) Representative images of zebrafish swimbladders injected with vehicle (A), C. parapsilosis (B) or C. albicans (C). Maximum projections, n slices: n=16 (A), n=13 (B, C), with (left) and without (right) single DIC z-slice, (D)

Macrophages per fish in the swimbladder lumen. Data pooled from 7 independent experiments.

(E) Macrophages per fish interacting with C. parapsilosis or C. albicans. (F) Percentage of interacting macrophages engaged in phagocytosis. (G) Number of macrophages interacting with fungi. Number of macrophages scored for Vehicle, C. parapsilosis and C. albicans, respectively:

137, 135 and 367. Statistics as described in Materials & Methods: *, P<0.05, **, P<0.01, ***,

P<0.001, ****, P<0.0001, n.s. not significant, P>0.05). Scale bars: (A-C) 150 µm.

Patterns of macrophage interaction with Candida cells were remarkably similar to those of neutrophils. We found more macrophages interacting with the pathogen in C. albicans infections (median: 5 per fish) than in C. parapsilosis infections (median: 2 per fish) (Fig. 2.8E).

As was the case for neutrophils, similar percentages (around 60%) of macrophages interacting with the two pathogens were engaged in phagocytosing them (Fig. 2.8F). Macrophages, like neutrophils, were found interacting with C. albicans hyphae more often than with yeast (Fig.

2.8G). Thus, macrophages are recruited to infections of both Candida species and although they are found in lower numbers than neutrophils, they interact with and phagocytose both species.

2.2.7 Functional neutrophils are required for protection from C. albicans but not C. parapsilosis infection.

High levels of neutrophil engagement suggested to us that these cells play an important role in the immune response to both Candida species in the swimbladder model. We were interested to see if neutrophilic inflammation is protective, as in the murine oral infection models, or damaging, as in human vulvovaginal infection (140, 257). To block neutrophil function, we

employed the transgenic fish line, Tg(mpx:mCherry-2A-Rac2D57N) (D57N), a model of leukocyte adhesion deficiency in which neutrophils are present but defective in extravasation and phagocytosis (201, 282–284). In the low-dose swimbladder infection model, neutrophils in

D57N zebrafish fail to migrate into the C. albicans-infected swimbladder and this makes the fish susceptible to invasive disease (142). When infected with higher doses of C. albicans, D57N zebrafish exhibited nearly 100% mortality by 4 dpi as compared to only 50% mortality in their wild-type (WT) siblings (Fig. 2.9A). Surprisingly, survival rates for D57N fish infected with C. parapsilosis were not significantly different from the nearly 100% survival found in their WT siblings, despite the lack of neutrophil recruitment that was expected in this fish line (Fig. 2.9A).

C. albicans-infected D57N fish had more severe infections than their WT siblings, with extensive growth of filaments that often breached the swimbladder epithelium.

We reasoned that inactivation of neutrophils could alter cytokine signaling through opposing mechanisms: greater damage to epithelial and other tissues could release damage- associated molecular patterns and provoke higher expression of inflammatory cytokines; alternatively, the absence of neutrophils at the site of infection could eliminate their contribution to amplification of the inflammatory response (285). Surprisingly, we found that D57N fish had nearly identical levels of tnfa, and cxcl8 (Fig. 2.9B) as well as saa, il-10 and il-1b (Fig. 2.9C) expression as compared to their WT siblings when infected with C. albicans. Levels of these cytokines were also similar in both WT and D57N infections with C. parapsilosis. These data suggest that neutrophil inactivation does not have a strong overall net effect on inflammatory signaling.

Figure 2.9. Neutrophil defects impact immunity to C. albicans but not C. parapsilosis infection.

Figure 2.9 continued. (A) Tg(mpx:mCherry-2A-Rac2D57N) zebrafish (D57N) and their wildtype (WT) siblings were infected at 4 dpf and monitored for four days. Survival curves are based on data pooled from 3 independent experiments. (B, C) qPCRs of cohorts of 10 fish, in 3 independent experiments, performed as described for Fig. 2.2. The median log2 fold changes relative to vehicle-injected fish are plotted. Grey bars (WT), red bars (D57N mutant); dotted bars

(C. parapsilosis-infected) and solid bars (C. albicans-infected) fish. Notations above individual bars indicate differences between Candida-infected and vehicle-injected groups. Notations above brackets indicate differences between WT and D57N fish. Statistics as described in

Materials & Methods: *, P<0.05, **, P<0.01, ***, P<0.001, n.s. not significant, P>0.05.

2.3 Discussion

Candida albicans and Candida parapsilosis are opportunistic yeast pathogens that live as commensals of healthy people but breach epithelial barriers to cause serious illness in immunocompromised patients. To understand how fungi breach this barrier, it is important to study the interactions between Candida cells and host defenses at mucosal surfaces in the intact host. By modeling mucosal Candida infection in the transparent larval zebrafish, we were able to visualize interactions between host immune cells, epithelial cells and fungal pathogens in 4D in the live host. We discovered that mucosal infection by C. albicans, but not C. parapsilosis, caused significant mortality, activated NF-kB signaling, and evoked a strong local pro-inflammatory response. Despite the differential ability of the two species to activate inflammatory pathways, infections with both species stimulated recruitment of neutrophils and macrophages that actively attacked the fungi. Overall, our findings suggest that the contrasting immune responses to the two species of Candida in the swimbladder more closely resemble in vitro epithelial cell responses than in vitro mononuclear phagocyte responses, suggesting an important role for the epithelium in the overall inflammatory response.

The lack of C. parapsilosis virulence in the zebrafish is consistent with what has been seen in other infection models. This is the case for disseminated and mucosal disease in mice

(50), as well as in vitro challenges with epithelial cells (135, 265, 286). Although C. parapsilosis is a common commensal fungus (43, 287), its virulence is usually associated with the hospital setting and it is thought that predisposing conditions such as epithelial damage or barrier breach by medical interventions lead to disseminated infection(38, 287). In zebrafish models of C. albicans infection, penetrating hyphae are closely associated with mortality and yeast-locked strains have limited virulence (74, 142, 229). Hyphal growth has also been clearly implicated in epithelial destruction in vitro and in mouse disease models (47, 62, 95, 288). Thus, while the reduced ability of C. parapsilosis to cause mortality in the absence of neutrophil function may be due to any number of differences between the two species, the lack of filamentous growth and expression of genes co-regulated with the hyphal switch (such as candidalysin) are likely to be major determinants of differential virulence (81, 289).

Infection with C. albicans, but not with C. parapsilosis, elicited strong pro-inflammatory responses, as measured by whole-fish cytokine expression and local activation of NF-kB signaling and TNFα expression. This differential response is similar to what has been seen in epithelial cells in vitro, where many fungi activate NF-kB but only a challenge with C. albicans leads to further activation of inflammatory pathways and production of cytokines (135, 265,

277). Our results contrast with what is seen in phagocytes, which respond strongly ex vivo to both Candida species by producing pro-inflammatory cytokines (165, 166). One caveat to the work here, however, is that only single isolates of each species were tested in the zebrafish, and there are known isolate-specific differences in immune recognition and activation (289–

295). It is intriguing that, in spite of the presence of phagocytes in both C. albicans and C. parapsilosis swimbladder infections, the signaling response in vivo to these mucosal infections is more similar to the simplified Candida-human epithelium challenges than to the ex vivo

Candida-phagocyte challenges. C. parapsilosis supernatants have been shown to have an inhibitory effect on C. albicans-mediated invasion and damage to epithelial cells in co-culture with C. albicans and on virulence in swimbladder infection; this may explain the lack of immune signaling in response to C. parapsilosis in vivo seen here (296). Our results are consistent with the idea that epithelial cells have a prominent role in regulating the overall inflammatory response to Candida at mucosal surfaces, in addition to acting as a physical barrier and initiating immune responses (297–300).

Using transgenic reporter zebrafish, we found differential patterns for activation of NF-kB and expression of TNFα in the swimbladder during C. albicans infection. NF-kB activation alone was seen in the epithelial layer surrounding the swimbladder, although both NF-kB activation and TNFα expression were observed in cells that were not part of the epithelial layer, including macrophages. This may mean that the activation of immune pathways results in different responses in different cell types; for example, in epithelial cells in vitro, NF-kB is activated but doesn’t lead to cytokine production (301). Alternatively, these differences may result from the different receptors mediating C. albicans recognition in epithelial cells and phagocytes (18, 302,

303) or from cross-talk among cell types as the infection progresses (171, 173). It is unlikely that this differential expression pattern is due to reporter-line differences, as many cell types, including epithelial cells and innate immune cells, are capable of activating NF-kB and expressing TNFα in these fish lines (195, 196, 230, 304–308). Nonetheless, because no reporter gene completely recapitulates the activity of the native locus, these results should be extended through experiments using complementary reporters and reagents to test native expression patterns. Work with transgenic reporters for other signaling components such as IL-1

(197) could contribute to deciphering this puzzle.

Phagocyte recruitment and activation is often associated with proinflammatory cytokine and chemokine production, but we observed recruitment and active engagement of both

macrophages and neutrophils without significant cytokine elicitation in C. parapsilosis infection

(309–311). Several non-cytokine chemoattractants such as reactive oxygen species, lipids and secreted fungal molecules are associated with fungal infection in mouse and zebrafish infection models (140, 210, 221, 252, 312–316). Thus, phagocyte recruitment in C. parapsilosis infection may be the result of non-cytokine signals, underlining the potential importance of these alternative chemoattractants.

Although C. albicans and C. parapsilosis are two of the most common causes of systemic fungal infections, the risk factors for the two species differ. In humans, neutropenia is a major risk factor for disseminated C. albicans infection but only a small percentage of C. parapsilosis cases involve neutrophil depletion (43, 287). Likewise, immunosuppressed mice are highly susceptible to C. albicans but not C. parapsilosis disseminated infection (317, 318).

These differences are reflected in the experiments presented here, which show that neutrophils are not required for immunity to C. parapsilosis infection, in contrast to the earlier finding that neutrophils are essential for protection from C. albicans mucosal infection (142). This difference may indicate that neutrophils are important in controlling hyphal growth of C. albicans, but redundant for managing C. parapsilosis, whose yeast-only morphology may be contained by the remaining phagocytes (55, 142). Indeed, in the zebrafish, neutrophils and macrophages interacted with both hyphae and yeast of C. albicans, consistent with results from in vitro neutrophil and macrophage challenges (148, 168, 174). C. parapsilosis yeast and pseudohyphae are readily engulfed and killed by phagocytes in vitro, while engulfment of C. albicans requires longer times that vary with hyphal size and orientation (63, 147, 148, 180, 319,

320). Although macrophages are known to protect from disseminated candidiasis, our recent work and that of others indicates macrophages are redundant with respect to protection from mucosal C. albicans infection (142, 155, 157). In our higher-dose model, macrophages were recruited in significant numbers, activated NF-kB, expressed TNFα, and interacted with both

Candida species. It is intriguing that macrophages upregulate TNFα upon C. albicans but not C.

parapsilosis infection, suggesting that epithelial-macrophage crosstalk or damage-induced signaling regulates cytokine production.

Overall, our work points to the unique characteristics of the zebrafish model (ease of live imaging, availability of transgenic lines) for discovery of previously unattainable information about host-pathogen interactions in vivo. Our comparison of host responses to two Candida species indicates that, unlike C. albicans, C. parapsilosis does not cause strong inflammatory responses or invasive disease at this mucosal site. We found a disconnect between inflammatory responses and phagocyte recruitment/activity that emphasizes the need for further study of signaling molecules that act on innate immune cells. Finally, imaging of single-cell patterns of gene activation paints a more complex picture of cell type-specific signaling during mucosal candidiasis. In sum, the tissue-specific aspects of host response against Candida species is an important and understudied aspect of disease that will benefit from future studies in zebrafish, mammalian hosts and more complex in vitro challenge systems with more cell types.

2.4 Materials and Methods

2.4.1 Candida strains and growth conditions

Candida strains used in this study are listed in Table 2.1. Candida was maintained in YPD media (DIFCO; 20 g/L peptone, 10 g/L yeast extract) containing 2% glucose and glycerol (30%) at -80 C, then grown on YPD agar plates at 30°C. Single colonies were picked to 5 ml YPD liquid and grown at 30°C overnight on a rotator wheel (New Brunswick Scientific). Prior to injection into zebrafish swimbladders, Candida cultures were washed 3x in phosphate buffered saline (PBS), counted on a hemocytometer and resuspended in 5% polyvinylpyrrolidone (PVP)

(Sigma-Aldrich) in PBS at a concentration of 5 x 107 cells/ml.

Table 2.1 Candida strains Strain Source/Reference R. L. Gratacap, J. F. Rawls, and R. T. C. albicans SC5314 Caf2.1-dTom-NATr Wheeler, Dis. Model. Mech. 6: 1260–70, 2013, doi: 10.1242/dmm.012039 R. T. Wheeler, D. Kombe, S. D. Agarwala, C. albicans WT-GFP (SC5314 (Peno1- and G. R. Fink, PLoS Pathog. 4: 1–12, 2008, yEGFP -NAT)) 3 doi: 10.1371/journal.ppat.1000227 A. C. Bergeron, B. G. Seman, J. H. Hammond, L. S. Archambault, D. A. Hogan, C. albicans SC5314 Caf2:FR and R. T. Wheeler, Infect. Immun., 2017, doi:10.1128/IAI.00475-17 C. parapsilosis clinical isolate 4175 (A010) CpURA3/CpURA3 ENO1/ENO1::GFP-NAT1 S. Gonia, B. Larson, and C. A. Gale, Yeast, C. parapsilosis clinical isolate 4175 (A010) 33(2): 63–9, 2016, doi: 10.1002/yea.3141 CpURA3/CpURA3 ENO1-mCherry- NAT1/ENO1

2.4.2 Animal care and maintenance

Adult zebrafish were held in recirculating systems (Aquatic Habitats) at the University of

Maine Zebrafish Facility, under a 14/10-hour light/dark cycle, and water temperature of 28°C; they were fed with Hikari Micro Pellets (HK40, Pentair Aquatic Ecosystems). Zebrafish strains used in this study are described in Table 2.2. Spawned eggs were collected and reared to 4 days post fertilization (dpf) at 33°C in E3 (5 mM sodium chloride, 0.174 mM potassium chloride,

0.33 mM calcium chloride, 0.332 mM magnesium sulfate, 2 mM HEPES in Nanopure water, pH

7) supplemented with 0.02 mg/ml of 1-phenyl-2-thiourea (PTU) (Sigma-Aldrich, St. Louis, MO) to prevent pigmentation. A temperature of 33ºC was chosen as an intermediate temperature between the typical lab environment for zebrafish (28ºC) and temperatures found in mouse and human (30ºC on skin to 37ºC core, (321, 322)). We note that, although temperature is a cue used by C. albicans to control morphology, other in vivo signals drive strong hyphal growth in the zebrafish, even at 28ºC (323).

Table 2.2 Zebrafish lines Line Source/Reference Wildtype AB Zebrafish International Resource Center (ZIRC) S. Renshaw and C. Loynes, Blood 108:3976–3978, Tg(mpx:GFP)i114Tg 2006, doi: 10.1182/blood-2006-05-024075 S. K. Yoo, Q. Deng, P. J. Cavnar, Y. I. Wu, K. M. Hahn, Tg(mpx:mCherry) and A. Huttenlocher, Dev. Cell 18: 226–236, 2010, uwm7Tg doi: 10.1016/j.devcel.2009.11.015 F. Ellett, L. Pase, J. W. Hayman, A. Andrianopoulos, and Tg(mpeg1:GAL4)gl24Tg G. J. Lieschke, Blood, 117:e49-56, 2011, doi: 10.1182/blood-2010-10-314120. M. G. Goll, R. Anderson, D. Y. R. Stainier, A. C. Spradling, Tg(UAS-E1b:NTR- and M. E. Halpern, Genetics, 182: 747–755, 2009, mCherry)c264Tg doi: 10.1534/genetics.109.102079 A. J. Pagan et al., Cell Host Microbe, 18: 15–26, 2015, Tg(mpeg1:dTomato) doi: 10.1016/j.chom.2015.06.008 TgBAC(tnfa:GFP: L. Marjoram et al., Proc. Natl. Acad. Sci., 112: 201424089, pd1028Tg 2015, doi: 10.1073/pnas.1424089112 Tg(6xHsa.NFKBN:EGFP) M. Kanther et al., Gastroenterology, 141: 197–207, 2011, nc1Tg doi: 10.1053/j.gastro.2011.03.042 Q. Deng, S. K. Yoo, P. J. Cavnar, J. M. Green, and Tg(mpx:mCherry,rac2_ A. Huttenlocher, Dev. Cell, 21: 735–45, 2011, D57N)zf307Tg doi: 10.1016/j.devcel.2011.07.013

When using D57N zebrafish, heterozygous transgenic fish were crossed with opposite sex AB fish and progeny were sorted for the presence of mCherry in neutrophils (D57N) or its absence (WT siblings). To obtain heterozygous offspring with consistent fluorescence levels,

Tg(NF-kB:EGFP) or TgBAC(tnfa:GFP) fish were crossed with opposite sex AB fish and embryos were screened on a Zeiss Axiovision VivaTome microscope (Carl Zeiss Microscopy,

LLC) for basal GFP expression before injecting. mpeg1:GAL4/UAS:nfsB-mCherry embryos were obtained by crossing Tg(mpeg1:GAL4):gl24Tg (199) with opposite sex Tg(UAS-E1b:NTR- mCherry):c264Tg fish (198).

2.4.3 Zebrafish infections. Zebrafish infections were carried out by glass needle injection into the swimbladder as previously described (232). Briefly, 4 dpf zebrafish were anaesthetized with Tris-buffered tricaine methane sulfonate (160 µg/ml; Tricaine; Western

Chemicals, Inc., Ferndale, WA) and injected with 4 nL PVP alone or PVP containing 5 x 107

yeast cells/ml of C. albicans or C. parapsilosis. Infected fish were placed in individual wells of a

96-well glass-bottom imaging dish (Greiner Bio-One, Monroe, NC) and screened for inoculum of

50-100 yeast on a Zeiss Axiovision VivaTome microscope. For survival curves, injected fish that passed screening were held for 4 days post-injection and monitored daily for survival.

2.4.4 Fluorescence microscopy. For imaging, fish were anaesthetized with Tricaine then immobilized in 0.5% low-melting-point agarose (Lonza, Switzerland) in E3 containing

Tricaine and arranged in a 96-well glass-bottom imaging plate. Images were made on an

Olympus IX-81 inverted microscope with an FV-1000 laser scanning confocal system (Olympus,

Waltham, MA), using a 20x/0.7 NA or 10x/0.4 NA objective lens. EGFP, dTomato/mCherry, and infra-red fluorescent proteins were detected by laser/optical filters for excitation/emission at 488 nm/505 to 525 nm, 543 nm/560 to 620 nm, and 635 nm/655 to 755 nm, respectively. Images were collected with Fluoview (Olympus) software.

2.4.5 Dissected swimbladders. After live imaging, chosen zebrafish were euthanized with Tricaine overdose at 25-27 hpi and swimbladders were removed with fine forceps as described (232). Swimbladders were transferred to 0.4% low melt agarose in PBS on a 25 x 75 x 1.0 mm microscope slide and covered with an 18 x 18 mm, no. 1.5 cover slip. Pre-applied dabs of high vacuum grease (Dow Corning, Midland, MI) at the corners of the cover slip prevented crushing and deflation of the swimbladder. The slides were imaged within 15 minutes on an Olympus IX-81 inverted confocal microscope using a 20x/0.7 NA objective lens as described above.

2.4.6 Quantitative real-time PCR. Total RNA was extracted by homogenizing groups of

10-14 whole, euthanized larvae in TRIzol (Invitrogen, Carlsbad, CA). Cleanup was achieved using an RNeasy kit (Qiagen, Germantown, MD) according to the manufacturer’s protocol with the addition of an on-column DNase step (New England BioLabs, Ipswich, MA). RNA was eluted in 20 µL of nuclease-free water and stored at -80°C. cDNA was synthesized from 500 ng of RNA per sample using iScript reverse transcription (RT) supermix for RT-qPCR (Bio-Rad,

Hercules, CA) and a no-RT reaction was performed for each sample. qPCR was carried out using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad), in 10 µL reactions, using 1µL cDNA per reaction and 0.3 µM primer concentration, on a CFX96 thermocycler (Bio-Rad).

Threshold cycles (Ct) and dissociation curve were analyzed with Bio-Rad CFX Manager software. The change in gene expression was normalized to gapdh (ΔCt) then compared to vehicle-injected controls (ΔΔCt) using the 2-∆∆Ct method (324). Primers (Integrated DNA

Technologies) are listed in Table 2.3.

Table 2.3 qPCR primer information Gene Sequence (5’-3’) Reference C. J. Cambier et al., Nature: 505:218–22, 2014, ccl2 Fw, GTCTGGTGCTCTTCGCTTTC Rv, TGCAGAGAAGATGCGTCGTA doi:10.1038/nature12799 cxcl8 Fw, TGCATTGAAACAGAAAGCCGACG A. C. Bergeron, B. G. Seman, J. H. Hammond, L. Rv, ATCTCCTGTCCAGTTGTCATCAAGG S. Archambault, D. A. Hogan, and R. T. Wheeler, Fw, GGACGTGAAGACACTCAGAGACG Infect. Immun., p. IAI.00475-17, 2017, il6 Rv, AAGGTTTGAGGAGAGGAGTGCTG doi:10.1128/IAI.00475-17 F. J. Roca et al., J. Immunol., 181: 5071–5081, il10 Fw, ATTTGTGGAGGGCTTTCCTT Rv, AGAGCTGTTGGCAGAATGGT 2008, doi:10.4049/jimmunol.181.7.5071 B. Lin et al., Mol. Immunol., 44: 295–301, 2007, saa Fw, CGGGGTCCTGGGGGCTATTG Rv, GTTGGGGTCTCCGCCGTTTC doi: 10.1016/J.MOLIMM.2006.03.001 R. L. Gratacap, J. F. Rawls, and R. T. Wheeler, Fw, CGCATTTCACAAGCGAATTT tnfa Rv, CTGGTCCTGGTCATCTCTCC Dis. Model. Mech. 6: 1260–70, 2013, doi:10.1242/dmm.012039 C. J. Mattingly, T. H. Hampton, K. M. Brothers, N. E. Griffin, and A. Planchart, Environ. Health gapdh Fw, TGGGCCCATGAAAGGAAT Rv, ACCAGCGTCAAAGATGGATG Perspect., 117: 981–7, 2009, doi:10.1289/ehp.0900555

2.4.7 Image analysis. The percent of the swimbladder covered by Candida at 24hpi was determined using Fiji software (ImageJ environment,(325)) applied to maximum projection images from stacks of 15-25 z-slices. Images were taken with identical acquisition settings to ensure comparability. The swimbladder area was delineated and % coverage of Candida fluorescence above a set threshold (corresponding to background fluorescence) was calculated.

Images of the swimbladder area of Tg(NF-kB:EGFP) and TgBAC(tnfa:GFP) fish were analyzed using Fiji software. Images covered the swimbladder from midline to skin in 5 µm z-slices. The

number of slices per image ranged from 12 to 22, depending on the size of the fish. Time lapse images were processed in Fiji using descriptor-based registration (326). Neutrophils and macrophages were outlined and counted in Fluoview (Olympus), from images taken at 24 hpi.

2.4.8 Statistical analysis. Statistical analyses were carried out using GraphPad Prism 7 software (GraphPad Software, Inc., LaJolla, CA). All significant differences are indicated in the figures; *, **, ***, and **** indicate p values of <0.05, <0.01, <0.001, and <0.0001, respectively.

When data failed to pass the D'Agostino & Pearson test for normal distribution of data, or when the number of samples was too small to determine normality, non-parametric statistics were used (Fig. 2.1B, Fig. 2.2, Fig. 2.3D, Fig. 2.4A, Fig. 2.7H, Fig. 2.8D-E, Fig. 2.9B-C). Kaplan-Meier survival curves were subjected to a log-rank (Mantel-Cox) test then Bonferroni correction was used to determine statistical difference between pairs of treatments (Fig. 2.1G, Fig. 2.9A). NF- kB activation, TNFα expression, macrophage recruitment, and qPCR results were analyzed using the Kruskal-Wallis test by ranks and Dunn’s test for multiple comparisons (Fig. 2.2, Fig.

2.3D, Fig. 2.4A, Fig. 2.8D, Fig. 2.9B). Neutrophil recruitment data were normally distributed so an ANOVA with Tukey’s test for multiple comparison’s was used (Fig. 2.7D). To compare

Candida burden and phagocyte interactions, we used the Mann-Whitney test (Fig. 2.1B, Fig.

2.7H, Fig. 2.8E). The Fisher’s Exact test was used to compare the neutrophils and macrophages engaged in phagocytosis of the two Candida species (Fig. 2.7I, Fig. 2.8F). Paired t-tests were used to compare interactions of phagocytes with C. albicans hyphae and yeast (Fig.

2.7J, Fig. 2.8G).

2.4.9 Ethics statement. All zebrafish studies were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National

Institutes of Health (327). All animals were treated in a humane manner and euthanized with

Tricaine overdose according to guidelines of the University of Maine IACUC as detailed in protocol number A2015-11-03.

CHAPTER 3

CANDIDA PARAPSILOSIS PROTECTS ZEBRAFISH FROM INFECTION

BY CANDIDA ALBICANS

3.1 Introduction

Candida species cause invasive candidiasis in premature infants. The route of entry into the bloodstream is thought to be through immature or damaged epithelial barriers (35, 328,

329). Deadly illnesses of the gastrointestinal tract of premature infants such as necrotizing enterocolitis and spontaneous intestinal perforation are correlated with invasive candidiasis

(330–332). While both species are isolated from blood stream infections in neonates, C. parapsilosis has less ability than C. albicans to damage and invade epithelial cells in culture

(139, 265).

Since the two Candida species colonize the gut in neonates, we hypothesized that they might interact in ways that could alter the damage to the mucosal epithelium. Although it might be expected that the mixed infection would lead to synergistic or additive damage, researchers in the lab of Dr. Cheryl Gale found that C. parapsilosis protected premature intestinal epithelial cells (pIECs) from invasion and damage by C. albicans (296). The protection was found to depend on both a physical interaction that was correlated with the adhesiveness of C. parapsilosis for C.albicans hyphae and for epithelial cells, but also on a substance secreted by

C. parapsilosis. I collaborated with the Gale lab to determine whether this phenomenon also occurs in vivo. In the zebrafish swimbladder mucosal infection model, co-injection of C. albicans yeast with cell-free fractions from C. parapsilosis cultures decreased infection parameters and mortality. These results suggest that non-invasive commensals could be used to interfere with virulence of pathogens and could provide a non-pharmacological method of protecting infants from invasive disease.

3.2 Results and Discussion

To test the protective ability of C. parapsilosis in vivo, zebrafish were infected in the swimbladder with C. albicans yeast suspended in C. parapsilosis supernatant, C. albicans supernatant, or unconditioned medium. This infection model recapitulates a number of aspects of in vitro C. albicans–epithelial interactions, permits mucosal infection in the context of a vertebrate immune system and allows for high inoculum doses that cause infection without immunosuppression. Therefore, this optically transparent disease model is more complex than in vitro challenge of epithelial cells but is not as complex as the mouse intestinal colonization model, which is reliant on antibiotic treatment for colonization and requires both physical disturbance and immunosuppression to yield lethal infection (333). Cell-free fractions of C. albicans and C. parapsilosis cultures, as well as medium alone, had no effect on zebrafish viability. When C. albicans was suspended in C. parapsilosis supernatant, mortality was significantly reduced (Figure 3.1B) as compared to C. albicans suspended in its own supernatant or fresh unconditioned medium. The effect of C. parapsilosis cells along with cell- free fractions on zebrafish viability could not be tested due to the number of yeast in the mixed inoculum being beyond the physical constraints of microinjection into the zebrafish swimbladder.

Deflation of the swimbladder and breaching of the swimbladder epithelium by hyphae are visual hallmarks of C. albicans infection in zebrafish (232). Nearly half of the fish infected with C. albicans suspended in C. albicans supernatant experienced swimbladder deflation at 24 hpi. By contrast, significantly fewer fish had deflated swimbladders when C. albicans was suspended in C. parapsilosis supernatants (Figure 3.1C). In addition, there was a trend toward more breaching of the swimbladder epithelium by C. albicans hyphae with addition of C. albicans supernatant than for C. parapsilosis supernatant or control media, although this difference did not reach statistical significance (Figure 3.1D). Together, these results indicate that C. parapsilosis supernatants protect zebrafish from the effects of C. albicans infection.

Figure 3.1. Candida parapsilosis cell-free culture fraction protects zebrafish from infection by Candida albicans. (A) Schematic of infection model. The larval zebrafish swimbladder offers a transparent vertebrate mucosal infection model that is amenable to non- invasive imaging of both the host and the pathogen. (B–D) Zebrafish at 4 days post-fertilization with inflated swimbladders were infected in their swimbladders by glass needle injection with C. albicans yeast cells (C.a.) suspended in control (H4) media or in supernatants from C. parapsilosis (C.p. Supt) or C. albicans (C.a. Supt.) cultures. (B) Relative survival of fish infected with C. albicans with or without Candida supernatants. All C. albicans-infected fish cohorts are significantly different from their respective controls. C. parapsilosis supernatants significantly

Figure 3.1 continued. reduce the mortality of a C. albicans infection (denoted by γ). Matching

Greek letters label individual comparisons: α, p < 0.01; β, p < 0.0001; γ, p < 0.05. Survival data are pooled from two independent experiments, n = 20 per group. All pair-wise comparisons were made with the Mantel–Cox test. (C,D) Fish from the experiment in (B) were viewed by fluorescence microscopy at 24 h post-infection and scored for two indicators of infection, swimbladder deflation [(C) **p < 0.01] and breaching of epithelial barrier (D). Data were pooled from two independent experiments and analyzed by Fisher’s exact test with Bonferroni correction (Control media, n = 22, C.a. supernatant, n = 21, C.p. supernatant, n = 22).

The inhibitory effect of C. parapsilosis on C. albicans virulence supports the idea that factors contributing to the commensal vs. pathogenic nature of microbes are modulated by other microbes. It is notable that the zebrafish swimbladder is not sterile, so the conservation of a protective effect in this mucosal model suggests that the in vitro results have relevance in vivo.

The effects on C. albicans virulence should be confirmed in further animal studies.

While the in vitro work in this study pointed to two mechanisms of inhibition, by C. parapsilosis cells and by cell-free supernatants, it is interesting to note that cell-free supernatants alone appeared to reduce the ability (although not significantly) of C. albicans to penetrate the zebrafish swimbladder epithelial layer (Figure 3.1D).

C. parapsilosis is a pathogen that is particularly associated with infants in neonatal intensive care (43, 44). Thus, it is somewhat surprising that it has a role in protection from C. albicans-induced damage to epithelial cells and mortality in zebrafish. These results lend support to the idea that C. parapsilosis enters the host through sites other than mucosal tissues such as intravascular catheters. However, they don’t rule out the possibility of C. parapsilosis entry into the blood stream through epithelial damage caused by other microbes, including C. albicans.

3.3 Materials and Methods

Fungal growth conditions and Preparation of cell and cell-Free Fractions for assays

Yeast strains (see Table 2.1) were propagated and maintained as described previously (334).

Strains were recovered from 15% glycerol stocks stored at −80°C by plating onto Yeast

Peptone Dextrose agar and incubating at 30°C overnight. Individual colonies were then suspended and grown in synthetic dextrose complete medium containing 2% glucose at 30°C overnight prior to assays being performed. Cell concentrations were determined microscopically using a hemocytometer. To obtain cell-free culture fractions, yeast cells were grown as described above, sub-cultured into H4 tissue culture medium at a concentration of 2 × 106 cells/mL and grown at 30°C for 12 h. Yeast cells were pelleted by centrifugation at 13,000 rpm for 3 min. The supernatants were removed carefully using a pipet, so as not to disturb the cell pellet. Supernatants were visualized microscopically using 60× magnification in multiple random fields to ensure that no yeast cells were present.

Zebrafish growth, Maintenance, and infection All animal studies were carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All animals were treated in a humane manner according to guidelines of the University of Maine IACUC as detailed in protocol number A2015-11-03. The

UMaine IACUC/Ethics Committee approved this protocol. Animals were euthanized by tricaine overdose.

Infected animals were monitored twice daily for signs of infection and morbid animals were euthanized. Wild-type AB zebrafish were maintained as described previously (232).

Zebrafish larvae were grown in E3 medium (5.0 mM NaCl, 0.17 mM KCl, 0.33 mMCaCl, 0.33 mM MgSO4, 2 mM HEPES, pH 7) plus 0.3 μg/mL methylene blue for the first 6 h post- fertilization, then switched to E3 supplemented with 10 μg/mL 1-phenyl-2-thiourea to suppress pigmentation. The C. albicans CAF2.1-dTom-NATr strain was used for all experiments in zebrafish and was grown and prepared for infections as described previously (64, 230).

Overnight cultures were washed three times in calcium- and magnesium-free PBS and yeast cell concentrations were determined microscopically using a hemocytometer. Cell suspensions were adjusted to a concentration of 5 × 107 cells/mL in 5% polyvinylpirrolidone dissolved inH4 media alone or fungal culture supernatants. Zebrafish larvae were infected with yeast by injection into the swimbladder at 4 days post-fertilization (dpf) as previously described (232).

Infected fish were individually screened at 2 h post-infection (hpi) on a Zeiss Axiovision

Vivatome microscope. Mock-infected and infected fish were divided randomly into two cohorts.

One cohort of 10 fish was held for 4 days, with counting and removal of deceased fish each day.

The second cohort of fish was rescreened at 24 hpi and infection parameters (swimbladder deflation and epithelial breaching) were recorded. Statistical analysis was performed on

GraphPad Prism version 7.00 for Mac (GraphPad Software, La Jolla, CA, USA, www.graphpad.com). Survival curves were analyzed using a log-rank (Mantel–Cox) test.

Fisher’s exact test, with Bonferroni correction for multiple tests, was used to detect differences in infection parameters among groups.

CHAPTER 4

CONCLUSIONS AND FUTURE DIRECTIONS

In this study, we explored interactions between fungal and host cells at a mucosal site using intravital imaging of the zebrafish swimbladder. This work represents a first in vivo look at

C. parapsilosis interactions with host cells and has led to the discovery of unexpected host responses. We found a disconnect between host cell inflammatory cytokine signaling, which occurs in C. albicans but not C. parapsilosis infection, and phagocyte engagement with the pathogen, which we saw with either Candida species. Detailed, single-cell analysis of time-lapse images indicated that the signaling of epithelial cells and phagocytes differs, confirming that these cell types have different roles in communicating information about the infection. In experiments that complemented in vitro work by the Cheryl Gale lab, we found that C. parapsilosis secreted substance(s) led to a reduction in mortality and signs disease caused by

C. albicans. Our results emphasize the value of visualizing host-pathogen interactions at the cellular level in the live zebrafish host.

4.1 Host Responses to C. parapsilosis and C. albicans

When they encounter C. albicans or C. parapsilosis in vitro, phagocytes (PBMCs) respond to either species by producing pro-inflammatory cytokines. However, in vitro challenge of epithelial cells with these two fungal species results in significant production of cytokines only in response to C. albicans. Because epithelial cells and patrolling phagocytes both encounter the fungus in the mucosal environment of the zebrafish swimbladder, we expected a pro- inflammatory response to C. albicans, but it was difficult to predict the overall response to C. parapsilosis.

As expected, we found a whole-fish pro-inflammatory response, epithelial cell activation of NF-kB, and macrophage expression of TNFa in response to C. albicans. However, none of these responses occurred in C. parapsilosis infection. This result was particularly surprising in light of the fact that macrophages and neutrophils were attracted to the swimbladders of C.

parapsilosis-infected fish and interacted with the fungus there. Because these responses match those of epithelial cells in vitro, our results support the notion that epithelial cell signaling drives the overall response at mucosal surfaces (171, 173, 335). However, we have yet to provide mechanistic explanations for our observations.

Several possible mechanisms could account for differences in host responses to these

Candida species. First, C. albicans and C. parapsilosis yeast have different cell wall compositions (57, 336, 337). This may lead to differential sensing of these two pathogens by epithelial and/or immune cell PRRs and thus differential activation of pro-inflammatory pathways. Second, morphology plays a role in sensing of fungal pathogens. The yeast to hyphal switch is accompanied by changes in gene expression, many of which are not strictly related to morphology. Some gene-expression changes lead to differences in cell wall components, complicating explanations that rely on the different morphologies to explain differences in virulence. Lastly, apart from potentially being sensed differently by host cells through PRRs or simply on the basis of size (150), hyphae are capable of damaging epithelial cells through direct penetration and by production of the toxin, candidalysin. Thus, sensing of hypha-related damage could account for the difference in responses to C. albicans and C. parapsilosis.

In order to test the first hypothesis –differences in cell wall components lead to differential sensing by host cells – we have carried out preliminary experiments comparing host responses to a yeast-locked strain of C. albicans (NRG1OEX-iRFP-NATR) and to C. parapsilosis.

C. albicans:NRG1 caused no mortality in the zebrafish and recruited a similar number of neutrophils as mock-infection. Cytokine levels in NRG1-infected fish were similar to C. parapsilosis-infected and mock-infected fish and much lower than in WT C. albicans infection

(Archambault & Wheeler, unpublished). Since host responses to C. parapsilosis and C. albicans in yeast form were similar, the results seem to indicate that it is something about hyphae that alerts the host and causes a pro-inflammatory response. However, it is not possible to

determine whether the differences we see are because hyphae are sensed differently or because of another unknown characteristic of hyphae.

Evidence from epithelial cells in culture supports the idea that damage sensing plays a role in inflammatory responses. Epithelial cells activate pro-inflammatory signaling pathways and produce cytokines in response to Candida species that are capable of growing as true hyphae and that cause damage but not to C. parapsilosis and other non-hyphal, non-damaging species (135). In addition to cytokine expression, DAMPs from damaged epithelial cells may serve to recruit and activate phagocytes. ROS can serve as a DAMP and ROS is important for recruitment of phagocytes to C. albicans infection of the zebrafish hindbrain (210). Damage also initiates host cell eicosanoid signaling that is important for early recruitment of neutrophils (338).

Two experiments could help to dissect the contributions of PAMP detection and damage detection to the pro-inflammatory responses we see in C. albicans infection in the swimbladder.

Previous work in our lab has shown that a Candidalysin mutant strain ( D/Dece1) caused less damage to the swimbladder epithelium and recruited fewer neutrophils than WT C. albicans

(81). Measuring cytokines in D/Dece1-infected fish by qPCR could help determine the contribution of pathogen sensing by PAMPs (which should be similar in the WT and mutant infection) and damage (which is lower in the mutant infection) to the inflammatory response to

C. albicans. Further information about the role of damage signaling could be ascertained by treating C. parapsilosis-infected and NRG-1-infected fish with exogenous Candidalysin peptide to cause damage to epithelial cells while maintaining the PAMP environment of the yeast form.

If damage signaling is driving inflammatory responses, we should see increased cytokine expression in these infections.

4.2 C. parapsilosis-Host Interactions

Many pathogens manipulate host inflammatory responses to avoid detection, phagocytosis and killing, and to aid in dissemination (339). C. parapsilosis is known to secrete

lipid mediators which could suppress host immune responses(340). In collaborative work with the Gale lab, we showed that a C. parapsilosis-secreted substance protects zebrafish with swimbladder infections and epithelial cells in culture from damage by C. albicans (296). Pro- inflammatory cytokines such as TNFa cause vasodilation, swelling and loosening of the intracellular matrix, which facilitates extravasation of phagocytes and their ability to crawl through tissues to the site of infection (278). These effects might also allow C. albicans hyphae to penetrate and damage tissues more easily. If a C. parapsilosis-secreted substance has a suppressing effect on inflammatory signaling, it could help to explain how it protects from C. albicans’ damage and also explain the negligible cytokine signaling we saw in response to C. parapsilosis infection. Further work to determine the nature of the secreted substance could lead to a better understanding of the nature of this protection. Separation and testing of lipid and peptide fractions of C. parapsilosis supernatants would be a logical next step.

4.3 Conclusions

In this study we chose to investigate mucosal disease caused by two fungal species, the common commensal/opportunistic pathogen, C. albicans, and the understudied, but clinically relevant, C. parapsilosis. Intravital imaging of the transparent zebrafish model revealed the intimate details of host-pathogen interactions at the cellular level. Interesting and unexpected details of signaling by epithelial cells and phagocytes were revealed in transgenic reported fish.

Some of our results stand in direct contrast to those obtained when single cell types encounter these fungi in vitro. Although much remains to be discovered concerning pathogen virulence traits and host responses in mucosal candidiasis, our study showcases the value of in vivo observations of host-pathogen interactions and provides important insights into the behavior and signaling of cells at mucosal surfaces.

REFERENCES

1. Bakalar N. 2016. Earth May Be Home to a Trillion Species of Microbes. New York Times.

2. Locey KJ, Lennon JT. 2016. Scaling laws predict global microbial diversity. Proc Natl Acad Sci U S A 113:5970–5.

3. Schloss PD, Girard RA, Martin T, Edwards J, Thrash JC. 2016. Status of the Archaeal and Bacterial Census: an Update. MBio 7:1–10.

4. Citation Amann R, Rosselló-Móra R. 2016. After all, only millions? mBio 7:999–1015.

5. McFall-Ngai MJ. 2015. Giving microbes their due - animal life in a microbially dominant world. J Exp Biol 218:1968–1973.

6. Sender R, Fuchs S, Milo R. 2016. Are We Really Vastly Outnumbered? Revisiting the Ratio of Bacterial to Host Cells in Humans. Cell 164:337–340.

7. Min YW, Rhee P-L. 2015. The Role of Microbiota on the Gut Immunology. Clin Ther 37:968–975.

8. Rieder R, Wisniewski PJ, Alderman BL, Campbell SC. 2017. Microbes and mental health: A review. Brain Behav Immun 66:9–17.

9. Dzutsev A, Goldszmid RS, Viaud S, Zitvogel L, Trinchieri G. 2015. The role of the microbiota in inflammation, carcinogenesis, and cancer therapy. Eur J Immunol 45:17– 31.

10. Wheeler ML, Limon JJ, Underhill DM. 2017. Immunity to Commensal Fungi: Detente and Disease. Annu Rev Pathol Mech Dis 12:359–385.

11. Pirofski L, Casadevall A. 2008. The Damage-Response Framework of Microbial Pathogenesis and Infectious Diseases, p. 135–146. In GI Microbiota and Regulation of the Immune System. Springer New York, New York, NY.

12. Chu H, Mazmanian SK. 2013. Innate immune recognition of the microbiota promotes host-microbial symbiosis. Nat Immunol 14:668–75.

13. Höfs S, Mogavero S, Hube B. 2016. Interaction of Candida albicans with host cells: virulence factors, host defense, escape strategies, and the microbiota. J Microbiol.

14. Köhler JR, Hube B, Puccia R, Casadevall A, Perfect JR. 2017. Fungi that Infect Humans. Microbiol Spectr 5:1–29.

15. Tischler BY, Hohl TM. 2019. Menacing Mold: Recent Advances in Aspergillus Pathogenesis and Host Defense. J Mol Biol.

16. Casadevall A, Coelho C, Alanio A. 2018. Mechanisms of Cryptococcus neoformans- Mediated Host Damage. Front Immunol 9:855.

17. Clancy CJ, Reboli AC, Vazquez JA, Marr KA, Schuster MG, Pappas PG, Kauffman CA, Ostrosky-Zeichner L, Andes DR, Sobel JD, Walsh TJ, Zaoutis TE. 2016. Clinical Practice Guideline for the Management of Candidiasis: 2016 Update by the Infectious Diseases Society of America. Clin Infect Dis 62:civ933.

18. Swidergall M, Filler SG. 2017. Oropharyngeal Candidiasis: Fungal Invasion and Epithelial Cell Responses. PLoS Pathog 13:1–7.

19. Richardson J, Ho J, Naglik J. 2018. Candida–Epithelial Interactions. J Fungi 4:22.

20. Wisplinghoff H, Bischoff T, Tallent SM, Seifert H, Wenzel RP, Edmond MB. 2004. Nosocomial bloodstream infections in US hospitals: analysis of 24,179 cases from a prospective nationwide surveillance study. Clin Infect Dis 39:309–317.

21. Okada S, Puel A, Casanova J-L, Kobayashi M. 2016. Chronic mucocutaneous candidiasis disease associated with inborn errors of IL-17 immunity. Clin Transl Immunol 5:e114.

22. Soltész B, Tóth B, Shabashova N, Bondarenko A, Okada S, Cypowyj S, Abhyankar A, Csorba G, Taskó S, Sarkadi AK, Méhes L, Rozsíval P, Neumann D, Chernyshova L, Tulassay Z, Puel A, Casanova J-L, Sediva A, Litzman J, Maródi L. 2013. New and recurrent gain-of-function STAT1 mutations in patients with chronic mucocutaneous candidiasis from Eastern and Central Europe. J Med Genet 50:567–78.

23. Fidel PL. 2011. Candida-host interactions in HIV disease: implications for oropharyngeal candidiasis. Adv Dent Res 23:45–49.

24. Villar CC, Dongari-Bagtzoglou A. 2008. Immune defence mechanisms and immunoenhancement strategies in oropharyngeal candidiasis. Expert Rev Mol Med 10:e29.

25. Vazquez JA. 2010. Optimal management of oropharyngeal and esophageal candidiasis in patients living with HIV infection. HIV AIDS (Auckl) 2:89–101.

26. Lortholary O, Petrikkos G, Akova M, Arendrup MC, Arikan-Akdagli S, Bassetti M, Bille J, Calandra T, Castagnola E, Cornely OA, Cuenca-Estrella M, Donnelly JP, Garbino J, Groll AH, Herbrecht R, Hope WW, Jensen HE, Kullberg BJ, Lass-Flörl C, Meersseman W, Richardson MD, Roilides E, Verweij PE, Viscoli C, Ullmann AJ. 2012. ESCMID* guideline for the diagnosis and management of Candida diseases 2012: patients with HIV infection or AIDS. Clin Microbiol Infect 18 Suppl 7:68–77.

27. Peters BM, Yano J, Noverr MC, Fidel PL. 2014. Candida Vaginitis: When Opportunism Knocks, the Host Responds. PLoS Pathog 10.

28. Gonçalves B, Ferreira C, Alves CT, Henriques M, Azeredo J, Silva S. 2016. Vulvovaginal candidiasis: Epidemiology, microbiology and risk factors. Crit Rev Microbiol 42:905–927.

29. Cassone A. 2015. Vulvovaginal Candida albicans infections: Pathogenesis, immunity and vaccine prospects. BJOG An Int J Obstet Gynaecol.

30. Fidel PL, Barousse M, Espinosa T, Ficarra M, Sturtevant J, Martin DH, Quayle AJ, Dunlap K. 2004. An intravaginal live Candida challenge in humans leads to new hypotheses for the immunopathogenesis of vulvovaginal candidiasis. Infect Immun 72:2939–46.

31. Kühbacher A, Burger-Kentischer A, Rupp S. 2017. Interaction of Candida Species with the Skin. Microorganisms 5:32.

32. Brown GD, Denning DW, Gow N a R, Levitz SM, Netea MG, White TC. 2012. Hidden killers: human fungal infections. Sci Transl Med 4:165rv13.

33. Gow NAR, Brown AJP, Odds FC. 2002. Fungal morphogenesis and host invasion. Curr Opin Microbiol 5:366–71.

34. Miranda LN, van der Heijden IM, Costa SF, Sousa API, Sienra RA, Gobara S, Santos CR, Lobo RD, Pessoa VP, Levin AS. 2009. Candida colonisation as a source for candidaemia. J Hosp Infect 72:9–16.

35. Koh AY, Köhler JR, Coggshall KT, Van Rooijen N, Pier GB. 2008. Mucosal Damage and Neutropenia Are Required for Candida albicans Dissemination. PLoS Pathog 4:e35.

36. Wisplinghoff H, Ebbers J, Geurtz L, Stefanik D, Major Y, Edmond MB, Wenzel RP, Seifert H. 2014. Nosocomial bloodstream infections due to Candida spp. in the USA: Species distribution, clinical features and antifungal susceptibilities. Int J Antimicrob Agents 43:78–81.

37. Miramón P, Kasper L, Hube B. 2013. Thriving within the host: Candida spp. interactions with phagocytic cells. Med Microbiol Immunol 202:183–195.

38. Whibley N, Gaffen SL. 2015. Beyond Candida albicans: Mechanisms of immunity to non- albicans Candida species. Cytokine.

39. Chowdhary A, Sharma C, Meis JF. 2017. Candida auris: A rapidly emerging cause of hospital-acquired multidrug-resistant fungal infections globally. PLOS Pathog 13:e1006290.

40. Jeffery-Smith A, Johnson EM, Taori SK, Borman A, Jeffery K, Schelenz S, Manuel R, Brown CS. 2017. Candida auris : a Review of the Literature. Clin Microbiol Rev 31:1–18.

41. Johnson CJ, Davis JM, Huttenlocher A, Kernien JF, Nett JE. 2018. Emerging Fungal Pathogen Candida auris Evades Neutrophil AttackmBio. American Society for Microbiology.

42. Bliss JM. 2015. Candida parapsilosis : An emerging pathogen developing its own identity. Virulence 6:109–111.

43. Trofa D, Gácser A, Nosanchuk JD. 2008. Candida parapsilosis, an emerging fungal pathogen. Clin Microbiol Rev 21:606–25.

44. Chow BDW, Linden JR, Bliss JM. 2012. Candida parapsilosis and the neonate: epidemiology, virulence and host defense in a unique patient setting. Expert Rev Anti Infect Ther 10:935–46.

45. Calderone RA, Fonzi WA. 2001. Virulence factors of Candida albicans. Trends Microbiol 9:327–35.

46. de Groot PWJ, Bader O, de Boer AD, Weig M, Chauhan N. 2013. Adhesins in human fungal pathogens: Glue with plenty of stick. Eukaryot Cell.

47. Felk A, Kretschmar M, Albrecht A, Schaller M, Beinhauer S, Nichterlein T, Sanglard D, Korting HC, Schafer W, Hube B. 2002. Candida albicans Hyphal Formation and the Expression of the Efg1-Regulated Proteinases Sap4 to Sap6 Are Required for the Invasion of Parenchymal Organs. Infect Immun 70:3689–3700.

48. Gacser A. 2015. Adhesins in Candida parapsilosis : understudied players in virulence. Virulence 5594:00–00.

49. Bahri R, Curt S, Saidane-Mosbahi D, Rouabhia M. 2010. Normal human gingival epithelial cells sense C. parapsilosis by toll-like receptors and module its pathogenesis through antimicrobial peptides and proinflammatory cytokines. Mediators Inflamm 2010:940383.

50. Arendrup M, Horn T, Frimodt-Møller N. 2002. In vivo pathogenicity of eight medically relevant Candida species in an animal model. Infection 30:286–291.

51. Trofa D, Soghier L, Long C, Nosanchuk JD, Gacser A, Goldman DL. 2011. A rat model of neonatal candidiasis demonstrates the importance of lipases as virulence factors for Candida albicans and Candida parapsilosis. Mycopathologia 172:169–78.

52. Horváth P, Nosanchuk JD, Hamari Z, Vágvölgyi C, Gácser A. 2012. The identification of gene duplication and the role of secreted aspartyl proteinase 1 in Candida parapsilosis virulence. J Infect Dis 205:923–33.

53. Tóth A, Németh T, Csonka K, Horváth P, Vágvölgyi C, Vizler C, Nosanchuk JD, Gácser A. 2014. Secreted Candida parapsilosis lipase modulates the immune response of primary human macrophages. Virulence 5:555–562.

54. Gácser A, Trofa D, Schäfer W, Nosanchuk JD. 2007. Targeted gene deletion in Candida parapsilosis demonstrates the role of secreted lipase in virulence. J Clin Invest 117:3049–3058.

55. Hopke A, Nicke N, Hidu EE, Degani G, Popolo L, Wheeler RT. 2016. Neutrophil Attack Triggers Extracellular Trap-Dependent Candida Cell Wall Remodeling and Altered Immune Recognition. PLoS Pathog 12:e1005644.

56. Wheeler RT, Kombe D, Agarwala SD, Fink GR. 2008. Dynamic, morphotype-specific Candida albicans Beta-glucan exposure during infection and drug treatment. PLoS Pathog 4:1–12.

57. Gow N a R, Hube B. 2012. Importance of the Candida albicans cell wall during commensalism and infection. Curr Opin Microbiol 15:406–12.

58. Grózer Z, Tóth A, Tóth R, Kecskeméti A, Vágvölgyi C, Nosanchuk JD, Szekeres A, Gácser A. 2015. Candida parapsilosis produces prostaglandins from exogenous arachidonic acid and OLE2 is not required for their synthesis. Virulence 6:85–92.

59. Nguyen LN, Gacser A, Nosanchuk JD. 2011. Secreted lipases supply fatty acids for yeast growth in the absence of de novo fatty acid synthesis. Virulence 2:37–41.

60. Noverr MC, Phare SM, Toews GB, Coffey MJ, Huffnagle GB. 2001. Pathogenic yeasts Cryptococcus neoformans and Candida albicans produce immunomodulatory prostaglandins. Infect Immun 69:2957–63.

61. Toth R, Toth A, Vagvolgyi C, Gacser A. 2017. Candida parapsilosis secreted lipase as an important virulence factor. Curr Protein Pept Sci 18:1–7.

62. Lo H, Ko JR, Didomenico B, Loebenberg D, Cacciapuoti A, Fink GR. 1997. Nonfilamentous C . albicans Mutants Are Avirulent. Cell 90:939–949.

63. Tóth R, Tóth A, Papp C, Jankovics F, Vágvölgyi C, Alonso MF, Bain JM, Erwig L-P, Gácser A. 2014. Kinetic studies of Candida parapsilosis phagocytosis by macrophages and detection of intracellular survival mechanisms. Front Microbiol 5:633.

64. Brothers K, Newman Z, Wheeler R. 2011. Live imaging of disseminated candidiasis in zebrafish reveals role of phagocyte oxidase in limiting filamentous growth. Eukaryot Cell 10:932–944.

65. Gilbert AS, Wheeler RT, May RC. 2015. Fungal pathogens: Survival and replication within macrophages. Cold Spring Harb Perspect Med 5.

66. Bain JM, Lewis LE, Okai B, Quinn J, Gow NAR, Erwig L-P. 2012. Non-lytic expulsion/exocytosis of Candida albicans from macrophages. Fungal Genet Biol 49:677– 8.

67. Lionakis MS. 2014. New insights into innate immune control of systemic candidiasis. Med Mycol 52:555–64.

68. Lionakis MS, Netea MG. 2013. Candida and host determinants of susceptibility to invasive candidiasis. PLoS Pathog 9:e1003079.

69. Grubb SEW, Murdoch C, Sudbery PE, Saville SP, Lopez-Ribot JL, Thornhill MH. 2008. Candida albicans-endothelial cell interactions: A key step in the pathogenesis of systemic candidiasis. Infect Immun 76:4370–4377.

70. Razakandrainibe R, Combes V, Grau GE, Jambou R. 2013. Crossing the wall: The opening of endothelial cell junctions during infectious diseases. Int J Biochem Cell Biol 45:1165–1173.

71. Krysan DJ, Sutterwala FS, Wellington M. 2014. Catching fire: Candida albicans, macrophages, and pyroptosis. PLoS Pathog 10:e1004139.

72. O’Meara TRO, Duah K, Guo CX, Maxson ME, Gaudet RG, Koselny K, Wellington M, Powers ME, Macalpine J, Meara MJO, Veri AO, Grinstein S, Noble SM, Krysan D, Gray- owen SD, Cowen E. 2018. High-Throughput Screening Identifies Genes Required for Candida albicans Induction of Macrophage Pyroptosis. MBio 9:1–20.

73. Jacobsen ID, Wilson D, Wächtler B, Brunke S, Naglik JR, Hube B. 2012. Candida albicans dimorphism as a therapeutic target. Expert Rev Anti Infect Ther 10:85–93.

74. Seman BG, Moore JL, Scherer AK, Blair BA, Manandhar S, Jones JM, Wheeler RT. 2018. Yeast and filaments have specialized, independent activities in a zebrafish model of Candida albicans infection. Infect Immun IAI.00415-18.

75. Noble SM, Gianetti BA, Witchley JN. 2017. Candida albicans cell-type switching and functional plasticity in the mammalian host. Nat Rev Microbiol.

76. Braunsdorf C, LeibundGut-Landmann S, Braunsdorf C, LeibundGut-Landmann S. 2018. Modulation of the Fungal-Host Interaction by the Intra-Species Diversity of C. albicans. Pathogens 7:11.

77. Soll DR. 2014. The role of phenotypic switching in the basic biology and pathogenesis of Candida albicans. J Oral Microbiol 6:1–12.

78. Zakikhany K, Naglik JR, Schmidt-Westhausen A, Holland G, Schaller M, Hube B. 2007. In vivo transcript profiling of Candida albicans identifies a gene essential for interepithelial dissemination. Cell Microbiol 9:2938–54.

79. Moyes DL, Richardson JP, Naglik JR. 2015. Candida albicans- epithelial interactions and pathogenicity mechanisms: Scratching the surface. Virulence 6:338–346.

80. Hebecker B, Naglik JR, Hube B, Jacobsen ID. 2014. Pathogenicity mechanisms and host response during oral Candida albicans infections. Expert Rev Anti Infect Ther. Informa UK, Ltd.

81. Moyes DL, Wilson D, Richardson JP, Mogavero S, Tang SX, Wernecke J, Höfs S, Gratacap RL, Robbins J, Runglall M, Murciano C, Blagojevic M, Thavaraj S, Förster TM, Hebecker B, Kasper L, Vizcay G, Iancu SI, Kichik N, Häder A, Kurzai O, Luo T, Krüger T, Kniemeyer O, Cota E, Bader O, Wheeler RT, Gutsmann T, Hube B, Naglik JR. 2016. Candidalysin is a fungal peptide toxin critical for mucosal infection. Nature.

82. Phan QT, Myers CL, Fu Y, Sheppard DC, Yeaman MR, Welch WH, Ibrahim AS, Edwards JE, Filler SG. 2007. Als3 is a Candida albicans invasin that binds to cadherins and induces endocytosis by host cells. PLoS Biol 5:e64.

83. Liu Y, Filler SG. 2011. Candida albicans Als3, a multifunctional adhesin and invasin. Eukaryot Cell 10:168–73.

84. Bertini A, Zoppo M, Lombardi L, Rizzato C, De Carolis E, Vella A, Torelli R, Sanguinetti M, Tavanti A. 2016. Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection. Virulence 7:1–13.

85. Neale MN, Glass KA, Longley SJ, Kim DJ, Laforce-Nesbitt SS, Wortzel JD, Shaw SK, Bliss JM. 2018. Role of the inducible adhesin, CpAls7, in binding ofCandida parapsilosisto extracellular matrix under fluid shear. Infect Immun 86:IAI.00892-17.

86. Vázquez-Torres A, Balish E. 1997. Macrophages in resistance to candidiasis. Microbiol Mol Biol Rev 61:170–92.

87. Bertini A, De Bernardis F, Hensgens L a M, Sandini S, Senesi S, Tavanti A. 2013. Comparison of Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis adhesive properties and pathogenicity. Int J Med Microbiol 303:98–103.

88. Rapala-Kozik M, Bochenska O, Jankowska U, Kedracka-Krok S, Kozik A, Zajac D, Karkowska-Kuleta J. 2015. Fibronectin-, vitronectin- and laminin-binding proteins at the cell walls of Candida parapsilosis and Candida tropicalis pathogenic yeasts. BMC Microbiol 15:197.

89. Wächtler B, Citiulo F, Jablonowski N, Förster S, Dalle F, Schaller M, Wilson D, Hube B. 2012. Candida albicans-epithelial interactions: dissecting the roles of active penetration, induced endocytosis and host factors on the infection process. PLoS One 7:e36952.

90. Zhu W, Filler SG. 2010. Interactions of Candida albicans with epithelial cells. Cell Microbiol 12:273–82.

91. Moreno-Ruiz E, Galán-Díez M, Zhu W, Fernández-Ruiz E, D’Enfert C, Filler SG, Cossart P, Veiga E. 2009. Candida albicans internalization by host cells is mediated by a clathrin- dependent mechanism. Cell Microbiol 11:1179–1189.

92. Sheppard DC, Filler SG. 2015. Host cell invasion by medically important fungi. Cold Spring Harb Perspect Med 5:a019687.

93. Villar CC, Kashleva H, Nobile CJ, Mitchell AP, Dongari-Bagtzoglou A. 2007. Mucosal tissue invasion by Candida albicans is associated with E-cadherin degradation, mediated by transcription factor Rim101p and protease Sap5p. Infect Immun 75:2126–35.

94. Samsel A, Seneff S. 2013. Glyphosate’s Suppression of Cytochrome P450 Enzymes and Amino Acid Biosynthesis by the Gut Microbiome: Pathways to Modern Diseases. Entropy 15:1416–1463.

95. Saville SP, Lazzell AL, Monteagudo C, Lopez-ribot JL. 2003. Engineered Control of Cell Morphology In Vivo Reveals Distinct Roles for Yeast and Filamentous Forms of Candida albicans during Infection. Eukaryot Cell 2:1053–60.

96. Park H, Myers CL, Sheppard DC, Phan QT, Sanchez A a., Edwards JE, Filler SG. 2005. Role of the fungal Ras-protein kinase A pathway in governing epithelial cell interactions during oropharyngeal candidiasis. Cell Microbiol 7:499–510.

97. Villar CC, Zhao XR. 2010. Candida albicans induces early apoptosis followed by secondary necrosis in oral epithelial cells. Mol Oral Microbiol 25:215–25.

98. Villar CC, Chukwuedum Aniemeke J, Zhao X-R, Huynh-Ba G. 2012. Induction of apoptosis in oral epithelial cells by Candida albicans. Mol Oral Microbiol 27:436–48.

99. Wagener J, Weindl G, de Groot PWJ, de Boer AD, Kaesler S, Thavaraj S, Bader O, Mailänder-Sanchez D, Borelli C, Weig M, Biedermann T, Naglik JR, Korting HC, Schaller M. 2012. Glycosylation of Candida albicans cell wall proteins is critical for induction of innate immune responses and apoptosis of epithelial cells. PLoS One 7:e50518.

100. Rotstein D, Parodo J, Taneja R, Marshall JC. 2000. Phagocytosis of Candida albicans induces apoptosis of human neutrophils. Shock 14:278–283.

101. Ganguly S, Mitchell AP. 2011. Mucosal biofilms of Candida albicans. Curr Opin Microbiol 14:380–5.

102. Nobile CJ, Johnson AD. 2015. Candida albicans Biofilms and Human Disease. Annu Rev Microbiol 69:71–92.

103. Polke M, Hube B, Jacobsen ID. 2015. Candida survival strategies. Adv Appl Microbiol 91:139–235.

104. Taff HT, Mitchell KF, Edward JA, Andes DR. 2013. Mechanisms of Candida biofilm drug resistance. Future Microbiol 8:1325–1337.

105. Cavalheiro M, Teixeira MC. 2018. Candida Biofilms: Threats, Challenges, and Promising Strategies. Front Med 5.

106. Nobile CJ, Fox EP, Nett JE, Sorrells TR, Mitrovich QM, Hernday AD, Tuch BB, Andes DR, Johnson AD. 2012. A recently evolved transcriptional network controls biofilm development in Candida albicans. Cell 148:126–38.

107. Silva S, Negri M, Henriques M, Oliveira R, Williams DW, Azeredo J. 2011. Adherence and biofilm formation of non-Candida albicans Candida species. Trends Microbiol 19:241–247.

108. Connolly LA, Riccombeni A, Grózer Z, Holland LM, Lynch DB, Andes DR, Gácser A, Butler G. 2013. The APSES transcription factor Efg1 is a global regulator that controls morphogenesis and biofilm formation in Candida parapsilosis. Mol Microbiol 90:36–53.

109. Conti HR, Gaffen SL. 2015. IL-17-Mediated Immunity to the Opportunistic Fungal Pathogen Candida albicans. J Immunol 195:780–8.

110. Verma A, Wüthrich M, Deepe GS, Klein B. 2015. Adaptive Immunity to Fungi. Cold Spring Harb Perspect Med 5:a019612.

111. Conti HR, Bruno VM, Childs EE, Daugherty S, Hunter JP, Mengesha BG, Saevig DL, Hendricks MR, Coleman BM, Brane L, Solis N, Cruz JA, Verma AH, Garg A V., Hise AG, Richardson JP, Naglik JR, Filler SG, Kolls JK, Sinha S, Gaffen SL. 2016. IL-17 Receptor Signaling in Oral Epithelial Cells Is Critical for Protection against Oropharyngeal Candidiasis. Cell Host Microbe 20:606–617.

112. Sparber F, LeibundGut-Landmann S. 2015. Interleukin 17-Mediated Host Defense against Candida albicans. Pathogens 4:606–619.

113. Hardison SE, Brown GD. 2012. C-type lectin receptors orchestrate antifungal immunity. Nat Immunol 13:817–22.

114. Richardson JP, Moyes DL, Ho J, Naglik JR. 2018. Candida innate immunity at the mucosa. Semin Cell Dev Biol.

115. Lionakis MS, Iliev ID, Hohl TM. 2017. Immunity against fungi. JCI Insight 2.

116. Netea MG, Brown GD, Kullberg BJ, Gow N a R. 2008. An integrated model of the recognition of Candida albicans by the innate immune system. Nat Rev Microbiol 6:67– 78.

117. Brown G. 2011. Innate antifungal immunity: the key role of phagocytes. Annu Rev Immunol 29:1–21.

118. Plantinga TS, Johnson MD, Scott WK, van de Vosse E, Velez Edwards DR, Smith PB, Alexander BD, Yang JC, Kremer D, Laird GM, Oosting M, Joosten LAB, van der Meer JWM, van Dissel JT, Walsh TJ, Perfect JR, Kullberg BJ, Netea MG. 2012. Toll-like receptor 1 polymorphisms increase susceptibility to candidemia. J Infect Dis 205:934–43.

119. Van der Graaf CAA, Netea MG, Morré SA, Den Heijer M, Verweij PE, Van der Meer JWM, Kullberg BJ. 2006. Toll-like receptor 4 Asp299Gly/Thr399Ile polymorphisms are a risk factor for Candida bloodstream infection. Eur Cytokine Netw 17:29–34.

120. Woehrle T, Du W, Goetz A, Hsu HY, Joos TO, Weiss M, Bauer U, Brueckner UB, Marion Schneider E. 2008. Pathogen specific cytokine release reveals an effect of TLR2 Arg753Gln during Candida sepsis in humans. Cytokine 41:322–329.

121. Picard C, von Bernuth H, Ghandil P, Chrabieh M, Levy O, Arkwright PD, McDonald D, Geha RS, Takada H, Krause JC, Creech CB, Ku C-L, Ehl S, Maródi L, Al-Muhsen S, Al- Hajjar S, Al-Ghonaium A, Day-Good NK, Holland SM, Gallin JI, Chapel H, Speert DP, Rodriguez-Gallego C, Colino E, Garty B-Z, Roifman C, Hara T, Yoshikawa H, Nonoyama S, Domachowske J, Issekutz AC, Tang M, Smart J, Zitnik SE, Hoarau C, Kumararatne DS, Thrasher AJ, Davies EG, Bethune C, Sirvent N, de Ricaud D, Camcioglu Y, Vasconcelos J, Guedes M, Vitor AB, Rodrigo C, Almazán F, Méndez M, Aróstegui JI, Alsina L, Fortuny C, Reichenbach J, Verbsky JW, Bossuyt X, Doffinger R, Abel L, Puel A, Casanova J-L. 2010. Clinical features and outcome of patients with IRAK-4 and MyD88 deficiency. Medicine (Baltimore) 89:403–25.

122. Ifrim DC, Joosten L a B, Kullberg B-J, Jacobs L, Jansen T, Williams DL, Gow N a R, van der Meer JWM, Netea MG, Quintin J. 2013. Candida albicans primes TLR cytokine responses through a Dectin-1/Raf-1-mediated pathway. J Immunol 190:4129–35.

123. Netea MG, Gow NAR, Munro CA, Bates S, Collins C, Ferwerda G, Hobson RP, Bertram G, Hughes HB, Jansen T, Jacobs L, Buurman ET, Gijzen K, Williams DL, Torensma R, McKinnon A, MacCallum DM, Odds FC, Van der Meer JWM, Brown AJP, Kullberg BJ. 2006. Immune sensing of Candida albicans requires cooperative recognition of mannans and glucans by lectin and Toll-like receptors. J Clin Invest 116:1642–50.

124. van der Graaf CAA, Netea MG, Verschueren I, van der Meer JWM, Kullberg BJ. 2005. Differential cytokine production and Toll-like receptor signaling pathways by Candida albicans blastoconidia and hyphae. Infect Immun 73:7458–64.

125. Gow NAR, Netea MG, Munro CA, Ferwerda G, Bates S, Mora-Montes HM, Walker L, Jansen T, Jacobs L, Tsoni V, Brown GD, Odds FC, Van der Meer JWM, Brown AJP, Kullberg BJ. 2007. Immune recognition of Candida albicans beta-glucan by dectin-1. J Infect Dis 196:1565–71.

126. Filler SG. 2012. Insights from human studies into the host defense against candidiasis. Cytokine 58:129–32.

127. Ferwerda B, Ph D, Ferwerda G, Plantinga TS, Janet A, Spriel AB Van, Venselaar H, Elbers CC. 2009. Human Dectin-1 Deficiency and Mucocutaneous Fungal Infections. N Engl J Med 361:1760–1767.

128. Wagener J, Malireddi RKS, Lenardon MD, Köberle M, Vautier S, MacCallum DM, Biedermann T, Schaller M, Netea MG, Kanneganti T-D, Brown GD, Brown AJP, Gow N a R. 2014. Fungal chitin dampens inflammation through IL-10 induction mediated by NOD2 and TLR9 activation. PLoS Pathog 10:e1004050.

129. Vautier S, MacCallum DM, Brown GD. 2012. C-type lectin receptors and cytokines in fungal immunity. Cytokine 58:89–99.

130. Gross O, Gewies A, Finger K, Schäfer M, Sparwasser T, Peschel C, Förster I, Ruland J. 2006. Card9 controls a non-TLR signalling pathway for innate anti-fungal immunity. Nature 442:651–6.

131. Glocker E-O, Hennigs A, Nabavi M, Schäffer AA, Woellner C, Salzer U, Pfeifer D, Veelken H, Warnatz K, Tahami F, Jamal S, Manguiat A, Rezaei N, Amirzargar AA, Plebani A, Hannesschläger N, Gross O, Ruland J, Grimbacher B. 2009. A homozygous CARD9 mutation in a family with susceptibility to fungal infections. N Engl J Med 361:1727–35.

132. Herbst M, Gazendam R, Reimnitz D, Sawalle-Belohradsky J, Groll A, Schlegel P-G, Belohradsky B, Renner E, Klepper J, Grimbacher B, Kuijpers T, Liese J. 2015. Chronic Candida albicans Meningitis in a 4-Year-Old Girl with a Homozygous Mutation in the CARD9 Gene (Q295X). Plast Reconstr Surg.

133. Plato A, Hardison SE, Brown GD. 2015. Pattern recognition receptors in antifungal immunity. Semin Immunopathol.

134. Moyes DL, Runglall M, Murciano C, Shen C, Nayar D, Thavaraj S, Kohli A, Islam A, Mora-Montes H, Challacombe SJ, Naglik JR. 2010. A biphasic innate immune MAPK response discriminates between the yeast and hyphal forms of Candida albicans in epithelial cells. Cell Host Microbe 8:225–35.

135. Moyes DL, Murciano C, Runglall M, Kohli A, Islam A, Naglik JR. 2012. Activation of MAPK/c-Fos induced responses in oral epithelial cells is specific to Candida albicans and Candida dubliniensis hyphae. Med Microbiol Immunol 201:93–101.

136. Moyes DL, Shen C, Murciano C, Runglall M, Richardson JP, Arno M, Aldecoa-Otalora E, Naglik JR. 2014. Protection against epithelial damage during Candida albicans infection is mediated by PI3K/Akt and mammalian target of rapamycin signaling. J Infect Dis 209:1816–1826.

137. Richardson JP, Krüger T, Hube B, Ho J, Bader O, Mogavero S, Carrano G, Wilson D, Coleman BM, Schulz D, Ponde NO, Naglik JR, Blagojevic M, Kichik N, Verma AH, De La Cruz Diaz J, Kniemeyer O, Enoiu SI, Gaffen SL, Moyes DL. 2018. Processing of Candida albicans Ece1p Is Critical for Candidalysin Maturation and Fungal Virulence. MBio 9:1– 16.

138. Richardson JP, Willems HME, Moyes DL, Shoaie S, Barker KS, Tan SL, Palmer GE, Hube B, Naglik JR, Peters BM. 2018. Candidalysin drives epithelial signaling, neutrophil recruitment, and immunopathology at the vaginal mucosa. Infect Immun 86:1–15.

139. Moyes DL, Richardson JP, Naglik JR. 2015. Candida albicans-epithelial interactions and pathogenicity mechanisms: Scratching the surface. Virulence.

140. Yano J, Kolls JK, Happel KI, Wormley F, Wozniak KL, Fidel PL. 2012. The acute neutrophil response mediated by S100 alarmins during vaginal Candida infections is independent of the Th17-pathway. PLoS One 7:e46311.

141. Harvie EA, Huttenlocher A. 2015. Neutrophils in host defense: new insights from zebrafish. J Leukoc Biol 98:523–37.

142. Gratacap RL, Scherer AK, Seman BG, Wheeler RT. 2017. Control of mucosal candidiasis in the zebrafish swimbladder depends on neutrophils that block filament invasion and drive extracellular trap production. Infect Immun 85:IAI.00276-17.

143. Gazendam RP, van de Geer A, Roos D, van den Berg TK, Kuijpers TW. 2016. How neutrophils kill fungi. Immunol Rev.

144. Urban CF, Nett JE. 2018. Neutrophil extracellular traps in fungal infection. Semin Cell Dev Biol. Elsevier Ltd.

145. Hopke A, Wheeler RT. 2017. In vitro Detection of Neutrophil Traps and Post-attack Cell Wall Changes in Candida Hyphae. Bio-protocol 7.

146. Kenno S, Perito S, Mosci P, Vecchiarelli A, Monari C. 2016. Autophagy and reactive oxygen species are involved in neutrophil extracellular traps release induced by C. albicans morphotypes. Front Microbiol 7:879.

147. Linden JR, Maccani MA, Laforce-Nesbitt SS, Bliss JM. 2010. High efficiency opsonin- independent phagocytosis of Candida parapsilosis by human neutrophils. Med Mycol 48:355–64.

148. Linden JR, Kunkel D, Laforce-Nesbitt SS, Bliss JM. 2013. The role of galectin-3 in phagocytosis of Candida albicans and Candida parapsilosis by human neutrophils. Cell Microbiol 15:1127–42.

149. Linden JR, De Paepe ME, Laforce-Nesbitt SS, Bliss JM. 2013. Galectin-3 plays an important role in protection against disseminated candidiasis. Med Mycol 51:641–51.

150. Branzk N, Lubojemska A, Hardison SE, Wang Q, Gutierrez MG, Brown GD, Papayannopoulos V. 2014. Neutrophils sense microbe size and selectively release neutrophil extracellular traps in response to large pathogens. Nat Immunol 15.

151. Wozniok I, Hornbach A, Schmitt C, Frosch M, Einsele H, Hube B, Löffler J, Kurzai O. 2008. Induction of ERK-kinase signalling triggers morphotype-specific killing of Candida albicans filaments by human neutrophils 10:807–820.

152. Warnatsch A, Tsourouktsoglou TD, Branzk N, Wang Q, Reincke S, Herbst S, Gutierrez M, Papayannopoulos V. 2017. Reactive Oxygen Species Localization Programs Inflammation to Clear Microbes of Different Size. Immunity 46:421–432.

153. Gordon S, Taylor PR. 2005. Monocyte and macrophage heterogeneity. Nat Rev Immunol 5:953–964.

154. Duggan S, Leonhardt I, Hünniger K, Kurzai O. 2015. Host response to Candida albicans bloodstream infection and sepsis. Virulence 6:1–11.

155. Lionakis MS, Swamydas M, Fischer BG, Plantinga TS, Johnson MD, Jaeger M, Green NM, Masedunskas A, Weigert R, Mikelis C, Wan W, Lee C-CR, Lim JK, Rivollier A, Yang JC, Laird GM, Wheeler RT, Alexander BD, Perfect JR, Gao J-L, Kullberg B-J, Netea MG, Murphy PM. 2013. CX3CR1-dependent renal macrophage survival promotes Candida control and host survival. J Clin Invest 123:5035–5051.

156. Qian Q, Jutila MA, Van Rooijen N, Cutler JE. 1994. Elimination of mouse splenic macrophages correlates with increased susceptibility to experimental disseminated candidiasis. J Immunol 152:5000–5008.

157. Break TJ, Jaeger M, Solis N V., Filler SG, Rodriguez C a., Lim JK, Lee C-CR, Sobel JD, Netea MG, Lionakis MS. 2015. CX3CR1 Is Dispensable for Control of Mucosal Candida albicans Infections in Mice and Humans. Infect Immun 83:958–965.

158. Netea MG, Joosten LAB, van der Meer JWM, Kullberg B-J, van de Veerdonk FL. 2015. Immune defence against Candida fungal infections. Nat Rev Immunol 15:630–642.

159. Ellett F, Pazhakh V, Pase L, Benard EL, Weerasinghe H, Azabdaftari D, Alasmari S, Andrianopoulos A, Lieschke GJ. 2018. Macrophages protect Talaromyces marneffei conidia from myeloperoxidase-dependent neutrophil fungicidal activity during infection establishment in vivo. PLOS Pathog 14:e1007063.

160. Rosowski EE, Raffa N, Knox BP, Golenberg N, Keller NP, Huttenlocher A. 2018. Macrophages inhibit Aspergillus fumigatus germination and neutrophil-mediated fungal killing. PLOS Pathog 14:e1007229.

161. Kasper L, Seider K, Hube B. 2015. Intracellular survival of Candida glabrata in macrophages: immune evasion and persistence. FEMS Yeast Res 15:fov042.

162. Drummond RA, Swamydas M, Oikonomou V, Zhai B, Dambuza IM, Schaefer BC, Bohrer AC, Mayer-Barber KD, Lira SA, Iwakura Y, Filler SG, Brown GD, Hube B, Naglik JR, Hohl TM, Lionakis MS. 2019. CARD9+ microglia promote antifungal immunity via IL-1β- and CXCL1-mediated neutrophil recruitment. Nat Immunol 20:559–570.

163. Grainger JR, Wohlfert EA, Fuss IJ, Bouladoux N, Askenase MH, Legrand F, Koo LY, Brenchley JM, Fraser IDC, Belkaid Y. 2013. Inflammatory monocytes regulate pathologic responses to commensals during acute gastrointestinal infection. Nat Med 19:713–721.

164. Leonardi I, Li X, Iliev ID. 2018. Macrophage interactions with fungi and bacteria in inflammatory bowel disease. Curr Opin Gastroenterol 34:1.

165. Estrada-Mata E, Navarro-Arias MJ, Pérez-García LA, Mellado-Mojica E, López MG, Csonka K, Gacser A, Mora-Montes HM. 2016. Members of the Candida parapsilosis Complex and Candida albicans are Differentially Recognized by Human Peripheral Blood Mononuclear Cells. Front Microbiol 6:1–11.

166. Tóth A, Csonka K, Jacobs C, Vágvölgyi C, Nosanchuk JD, Netea MG, Gácser A. 2013. Candida albicans and Candida parapsilosis induce different T-cell responses in human peripheral blood mononuclear cells. J Infect Dis 208:690–8.

167. Németh T, Tóth A, Hamari Z, Falus A, Éder K, Vágvölgyi C, Guimaraes AJ, Nosanchuk JD, Gácser A. 2014. Transcriptome profile of the murine macrophage cell response to Candida parapsilosis. Fungal Genet Biol 65:48–56.

168. Keppler-Ross S, Douglas L, Konopka JB, Dean N. 2010. Recognition of yeast by murine macrophages requires mannan but not glucan. Eukaryot Cell 9:1776–1787.

169. Weindl G, Wagener J, Schaller M. 2011. Interaction of the mucosal barrier with accessory immune cells during fungal infection. Int J Med Microbiol 301:431–5.

170. Steubesand N, Kiehne K, Brunke G, Pahl R, Reiss K, Herzig K-H, Schubert S, Schreiber S, Fölsch UR, Rosenstiel P, Arlt A. 2009. The expression of the beta-defensins hBD-2 and hBD-3 is differentially regulated by NF-kappaB and MAPK/AP-1 pathways in an in vitro model of Candida esophagitis. BMC Immunol 10:36.

171. Gladiator A, Wangler N, Trautwein-Weidner K, LeibundGut-Landmann S. 2013. Cutting edge: IL-17-secreting innate lymphoid cells are essential for host defense against fungal infection. J Immunol 190:521–5.

172. Sparber F, Dolowschiak T, Mertens S, Lauener L, Clausen BE, Joller N, Stoitzner P, Tussiwand R, LeibundGut-Landmann S. 2018. Langerin+DCs regulate innate IL-17 production in the oral mucosa during Candida albicans-mediated infection. PLoS Pathog 14:e1007069.

173. Altmeier S, Toska A, Sparber F, Teijeira A, Halin C, LeibundGut-Landmann S. 2016. IL-1 Coordinates the Neutrophil Response to C. albicans in the Oral Mucosa. PLoS Pathog 12:e1005882.

174. Rudkin FM, Bain JM, Walls C, Rudkin FM, Bain JM, Walls C, Lewis LE, Gow NAR, Erwig LP. 2013. Altered Dynamics of Candida albicans Phagocytosis by Macrophages and PMNs When Both Phagocyte Subsets Are Presents 4:1–10.

175. Zon L. 2016. Modeling human diseases: an education in interactions and interdisciplinary approaches. Dis Model Mech 9:597–600.

176. Schaller M, Zakikhany K, Naglik JR, Weindl G, Hube B. 2006. Models of oral and vaginal candidiasis based on in vitro reconstituted human epithelia. Nat Protoc 1:2767–73.

177. Diaz PI, Xie Z, Sobue T, Thompson A, Biyikoglu B, Ricker A, Ikonomou L, Dongari- Bagtzoglou A. 2012. Synergistic interaction between Candida albicans and commensal oral streptococci in a novel in vitro mucosal model. Infect Immun 80:620–32.

178. de Carvalho Dias K, de Sousa DL, Barbugli PA, Cerri PS, Salih VM, Vergani CE. 2018. Development and characterization of a 3D oral mucosa model as a tool for host-pathogen interactions. J Microbiol Methods 152:52–60.

179. Nagy I, Filkor K, Németh T, Hamari Z, Vágvölgyi C, Gácser A. 2011. In vitro interactions of Candida parapsilosis wild type and lipase deficient mutants with human monocyte derived dendritic cells. BMC Microbiol 11:122.

180. Sheth CC, Hall R, Lewis L, Brown AJP, Odds FC, Erwig LP, Gow NAR. 2011. Glycosylation status of the C. albicans cell wall affects the efficiency of neutrophil phagocytosis and killing but not cytokine signaling. Med Mycol 49:513–24.

181. Byrd AS, O’Brien XM, Johnson CM, Lavigne LM, Reichner JS. 2013. An extracellular matrix-based mechanism of rapid neutrophil extracellular trap formation in response to Candida albicans. J Immunol 190:4136–48.

182. O’Brien XM, Reichner JS. 2016. Neutrophil Integrins and Matrix Ligands and NET Release. Front Immunol 7:363.

183. Hind LE, Ingram PN, Beebe DJ, Huttenlocher A. 2018. Interaction with an endothelial lumen increases neutrophil lifetime and motility in response to P. aeruginosa. Blood blood-2018-05-848465.

184. Conti HR, Huppler AR, Whibley N, Gaffen SL. 2014. Animal Models for Candidiasis, p. 19.6.1-19.6.17. In Current Protocols in Immunology. John Wiley & Sons, Inc., Hoboken, NJ, USA.

185. Solis N V, Filler SG. 2012. Mouse model of oropharyngeal candidiasis. Nat Protoc 7:637– 42.

186. Cassone A, Sobel JD. 2016. Experimental models of vaginal candidiasis and their relevance to human candidiasisInfection and Immunity. American Society for Microbiology Journals.

187. Jacobsen ID. 2014. Galleria mellonella as a model host to study virulence of Candida. Virulence 5:237–9.

188. Brunke S, Quintin J, Kasper L, Jacobsen ID, Richter ME, Hiller E, Schwarzmuller T, D’Enfert C, Kuchler K, Rupp S, Hube B, Ferrandon D. 2015. Of mice, flies - and men Comparing fungal infection models for large-scale screening efforts. Dis Model Mech 8:473–486.

189. Pukkila-Worley R, Peleg AY, Tampakakis E, Mylonakis E. 2009. Candida albicans Hyphal Formation and Virulence Assessed Using a Caenorhabditis elegans Infection Model. Eukaryot Cell 8:1750–1758.

190. Rosowski E, Knox B, Archambault L, Huttenlocher A, Keller N, Wheeler R, Davis J, Rosowski EE, Knox BP, Archambault LS, Huttenlocher A, Keller NP, Wheeler RT, Davis JM. 2018. The Zebrafish as a Model Host for Invasive Fungal Infections. J Fungi 4:136.

191. Voelz K, Gratacap RL, Wheeler RT. 2015. A zebrafish larval model reveals early tissue- specific innate immune responses to Mucor circinelloides. Dis Model Mech 8:1375–1388.

192. Pagan AJ, Yang CT, Cameron J, Swaim LE, Ellett F, Lieschke GJ, Ramakrishnan L. 2015. Myeloid growth factors promote resistance to mycobacterial infection by curtailing granuloma necrosis through macrophage replenishment. Cell Host Microbe 18:15–26.

193. Wang K, Fang X, Ma N, Lin Q, Huang Z, Liu W, Xu M, Chen X, Zhang W, Zhang Y. 2015. Myeloperoxidase-deficient zebrafish show an augmented inflammatory response to challenge with Candida albicans. Fish Shellfish Immunol 44:109–16.

194. Herbst S, Shah A, Mazon Moya M, Marzola V, Jensen B, Reed A, Birrell MA, Saijo S, Mostowy S, Shaunak S, Armstrong-James D. 2015. Phagocytosis-dependent activation of a TLR9-BTK-calcineurin-NFAT pathway co-ordinates innate immunity to Aspergillus fumigatus. EMBO Mol Med 7:240–58.

195. Kanther M, Sun X, Mühlbauer M, Mackey LC, Flynn EJ, Bagnat M, Jobin C, Rawls JF. 2011. Microbial colonization induces dynamic temporal and spatial patterns of NF-κB activation in the zebrafish digestive tract. Gastroenterology 141:197–207.

196. Marjoram L, Alvers A, Deerhake ME, Bagwell J, Mankiewicz J, Cocchiaro JL, Beerman RW, Willer J, Sumigray KD, Katsanis N, Tobin DM, Rawls JF, Goll MG, Bagnat M. 2015. Epigenetic control of intestinal barrier function and inflammation in zebrafish. Proc Natl Acad Sci 112:201424089.

197. Nguyen-Chi M, Phan QT, Gonzalez C, Dubremetz J-FF, Levraud J-PP, Lutfalla G. 2014. Transient infection of the zebrafish notochord with E. coli induces chronic inflammation. Dis Model Mech 7:871–882.

198. Yoo SK, Deng Q, Cavnar PJ, Wu YI, Hahn KM, Huttenlocher A. 2010. Differential Regulation of Protrusion and Polarity by PI(3)K during Neutrophil Motility in Live Zebrafish. Dev Cell 18:226–236.

199. Ellett F, Pase L, Hayman JW, Andrianopoulos A, Lieschke GJ. 2011. Mpeg1 Promoter Transgenes Direct Macrophage-Lineage Expression in Zebrafish. Blood 117:e49-56.

200. van der Vaart M, van Soest JJ, Spaink HP, Meijer AH. 2013. Functional analysis of a zebrafish myd88 mutant identifies key transcriptional components of the innate immune system. Dis Model Mech 6:841–54.

201. Deng Q, Yoo SK, Cavnar PJ, Green JM, Huttenlocher A. 2011. Dual roles for Rac2 in neutrophil motility and active retention in zebrafish hematopoietic tissue. Dev Cell 21:735–45.

202. Bojarczuk A, Miller KA, Hotham R, Lewis A, Ogryzko N V., Kamuyango AA, Frost H, Gibson RH, Stillman E, May RC, Renshaw SA, Johnston SA. 2016. Cryptococcus neoformans Intracellular Proliferation and Capsule Size Determines Early Macrophage Control of Infection. Sci Rep 6:21489.

203. Tobin DM, May RC, Wheeler RT. 2012. Zebrafish: a see-through host and a fluorescent toolbox to probe host-pathogen interaction. PLoS Pathog 8:e1002349.

204. Shiau CE, Kaufman Z, Meireles AM, Talbot WS. 2015. Differential Requirement for irf8 in Formation of Embryonic and Adult Macrophages in Zebrafish. PLoS One 10:e0117513.

205. Bernut A, Herrmann J-L, Kissa K, Dubremetz J-F, Gaillard J-L, Lutfalla G, Kremer L. 2014. Mycobacterium abscessus cording prevents phagocytosis and promotes abscess formation. Proc Natl Acad Sci U S A 111:E943.

206. Su F, Juarez MA, Cooke CL, Lapointe L, Shavit JA, Yamaoka JS, Lyons SE. 2007. Differential regulation of primitive myelopoiesis in the zebrafish by Spi-1/Pu.1 and C/ebp1. Zebrafish 4:187–99.

207. Calderone R, Sturtevant J. 1994. Macrophage Interactions with Candida.

208. Seider K, Heyken A, Lüttich A, Miramón P, Hube B. 2010. Interaction of pathogenic yeasts with phagocytes: survival, persistence and escape. Curr Opin Microbiol 13:392– 400.

209. Lorenz MC, Fink GR. 2002. Life and Death in a Macrophage: Role of the Glyoxylate Cycle in Virulence: FIG. 1. Eukaryot Cell 1:657–662.

210. Brothers K, Gratacap R, Barker S, Newman Z, Norum A, RT W. 2013. NADPH oxidase- driven phagocyte recruitment controls Candida albicans filamentous growth and prevents mortality. PLoS … 9:e1003634.

211. Bergeron AC, Barker SE, Brothers KM, Prasad BC, Wheeler RT. 2017. Polyclonal anti- Candida antibody improves phagocytosis and overall outcome in zebrafish model of disseminated candidiasis. Dev Comp Immunol 68:69–78.

212. Archambault LS, Trzilova D, Gonia S, Gale C, Wheeler RT. 2019. Intravital Imaging Reveals Divergent Cytokine and Cellular. MBio 10:1–18.

213. Jiménez-López C, Collette JR, Brothers KM, Shepardson KM, Cramer RA, Wheeler RT, Lorenz MC. 2013. Candida albicans induces arginine biosynthetic genes in response to host-derived reactive oxygen species. Eukaryot Cell 12:91–100.

214. Kondakova EAA, Efremov VII. 2014. Morphofunctional transformations of the yolk syncytial layer during zebrafish development. J Morphol 275:206–216.

215. D’Amico L a, Cooper MS. 2001. Morphogenetic domains in the yolk syncytial layer of axiating zebrafish embryos. Dev Dyn 222:611–624.

216. Redd MJ, Kelly G, Dunn G, Way M, Martin P. 2006. Imaging macrophage chemotaxis in vivo: Studies of microtubule function in zebrafish wound inflammation. Cell Motil Cytoskeleton 63:415–422.

217. Chao C-C, Hsu P-C, Jen C-F, Chen I-H, Wang C-H, Chan H-C, Tsai P-W, Tung K-C, Wang C-H, Lan C-Y, Chuang Y-J. 2010. Zebrafish as a model host for Candida albicans infection. Infect Immun 78:2512–21.

218. Fishelson L. 1995. Ontogenesis of cytological structures around the yolk sac during embryologic and early larval development of some cichlid fishes. J Fish Biol 47:479–491.

219. Tucey TM, Verma J, Harrison PF, Snelgrove SL, Lo TL, Scherer AK, Barugahare AA, Powell DR, Wheeler RT, Hickey MJ, Beilharz TH, Naderer T, Traven A. 2018. Glucose Homeostasis Is Important for Immune Cell Viability during Candida Challenge and Host Survival of Systemic Fungal Infection. Cell Metab 27:988-1006.e7.

220. Segal BH, Grimm MJ, Khan ANH, Han W, Blackwell TS. 2012. Regulation of innate immunity by NADPH oxidase. Free Radic Biol Med 53:72–80.

221. Hogan D, Wheeler RT. 2014. The complex roles of NADPH oxidases in fungal infection. Cell Microbiol 16:1156–1167.

222. Bennett RJ. 2015. The parasexual lifestyle of Candida albicans. Curr Opin Microbiol 28:10–17.

223. Mallick EM, Bergeron AC, Jones SK, Newman ZR, Brothers KM, Creton R, Wheeler RT, Bennett RJ. 2016. Phenotypic plasticity regulates Candida albicans interactions and virulence in the vertebrate host. Front Microbiol 7:1–18.

224. Winata CL, Korzh S, Kondrychyn I, Zheng W, Korzh V, Gong Z. 2009. Development of zebrafish swimbladder: The requirement of Hedgehog signaling in specification and organization of the three tissue layers. Dev Biol 331:222–236.

225. Yin A, Korzh S, Winata CL, Korzh V, Gong Z. 2011. Wnt signaling is required for early development of zebrafish swimbladder. PLoS One 6:e18431.

226. Zheng W, Wang Z, Collins JE, Andrews RM, Stemple D, Gong Z. 2011. Comparative transcriptome analyses indicate molecular homology of zebrafish swimbladder and mammalian lung. PLoS One 6.

227. Robertson GN, McGee CAS, Dumbarton TC, Croll RP, Smith FM. 2007. Development of the swimbladder and its innervation in the zebrafish, Danio rerio. J Morphol 268:967–985.

228. Gabor KA, Goody MF, Mowel WK, Breitbach ME, Gratacap RL, Witten PE, Kim CH. 2014. Influenza A virus infection in zebrafish recapitulates mammalian infection and sensitivity to anti-influenza drug treatment. 7.

229. Bergeron AC, Seman BG, Hammond JH, Archambault LS, Hogan DA, Wheeler RT. 2017. Candida and Pseudomonas interact to enhance virulence of mucosal infection in transparent zebrafish. Infect Immun IAI.00475-17.

230. Gratacap RL, Rawls JF, Wheeler RT. 2013. Mucosal candidiasis elicits NF-κB activation, proinflammatory gene expression and localized neutrophilia in zebrafish. Dis Model Mech 6:1260–70.

231. Zhang L, Wang CC. 2014. Inflammatory response of macrophages in infection. Hepatobiliary Pancreat Dis Int.

232. Gratacap RL, Bergeron AC, Wheeler RT. 2014. Modeling mucosal candidiasis in larval zebrafish by swimbladder injection. J Vis Exp e52182.

233. Chen YZ, Yang YL, Chu WL, You MS, Lo HJ. 2015. Zebrafish egg infection model for studying Candida albicans adhesion factors. PLoS One 10:1–11.

234. Carvalho R, de Sonneville J, Stockhammer OW, Savage NDL, Veneman WJ, Ottenhoff THM, Dirks RP, Meijer AH, Spaink HP. 2011. A high-throughput screen for tuberculosis progression. PLoS One 6:1–8.

235. Spaink HP, Cui C, Wiweger MI, Jansen HJ, Veneman WJ, Marín-Juez R, De Sonneville J, Ordas A, Torraca V, van der Ent W, Leenders WP, Meijer AH, Snaar-Jagalska BE, Dirks RP. 2013. Robotic injection of zebrafish embryos for high-throughput screening in disease models. Methods 62:246–254.

236. Wang W, Liu X, Gelinas D, Ciruna B, Sun Y. 2007. A fully automated robotic system for microinjection of zebrafish embryos. PLoS One 2:e862.

237. Lu J-J, Lo H-J, Wu Y-M, Chang J-Y, Chen Y-Z, Wang S-H. 2018. DST659 genotype of Candida albicans showing positive association between biofilm formation and dominance in Taiwan. Med Mycol 56:972–978.

238. Herbomel P, Thisse B, Thisse C. 1999. Ontogeny and behaviour of early macrophages in the zebrafish embryo. Development 126:3735–45.

239. Deng F, Lin C. 2018. Identification and characterization of ORF19.1725, a novel gene contributing to the white cell pheromone response and virulence-associated functions in Candida albicans. Virulence 9:866–878.

240. Lin C, Lin C-N, Wang Y-C, Liu F-Y, Chuang Y-J, Lan C-Y, Hsieh W-P, Chen B-S. 2014. The role of TGF-β signaling and apoptosis in innate and adaptive immunity in zebrafish: a systems biology approach. BMC Syst Biol 8:116.

241. Wu CC, Chen B Sen. 2016. A systems biology approach to the coordination of defensive and offensive molecular mechanisms in the innate and adaptive host-pathogen interaction networks. PLoS One 11:1–20.

242. Chen YY, Chao C-C, Liu F-C, Hsu P-C, Chen H-F, Peng S-C, Chuang Y-J, Lan C-Y, Hsieh W-P, Wong DSH. 2013. Dynamic transcript profiling of Candida albicans infection in zebrafish: a pathogen-host interaction study. PLoS One 8:e72483.

243. Kuo Z-Y, Chuang Y-J, Chao C-C, Liu F-C, Lan C-Y, Chen B-S. 2013. Identification of infection- and defense-related genes via a dynamic host-pathogen interaction network using a Candida albicans-zebrafish infection model. J Innate Immun 5:137–52.

244. Wang Y-C, Lin C, Chuang M-T, Hsieh W-P, Lan C-Y, Chuang Y-J, Chen B-S. 2013. Interspecies protein-protein interaction network construction for characterization of host- pathogen interactions: a Candida albicans-zebrafish interaction study. BMC Syst Biol 7:79.

245. Wang YC, Tsai IC, Lin C, Hsieh WP, Lan CY, Chuang YJ, Chen B Sen. 2014. Essential functional modules for pathogenic and defensive mechanisms in candida albicans infections. Biomed Res Int 2014.

246. Pfaller MA, Andes DR, Diekema DJ, Horn DL, Reboli AC, Rotstein C, Franks B, Azie NE. 2014. Epidemiology and outcomes of invasive candidiasis due to non-albicans species of Candida in 2,496 patients: Data from the Prospective Antifungal Therapy (PATH) registry 2004-2008. PLoS One 9.

247. Pammi M, Holland L, Butler G, Gacser A, Bliss JM. 2013. Candida parapsilosis Is a Significant Neonatal Pathogen. Pediatr Infect Dis J 32:e206–e216.

248. Verma A, Gaffen S, Swidergall M. 2017. Innate Immunity to Mucosal Candida Infections. J Fungi 3:60.

249. Koh AY. 2016. Identifying host immune effectors critical for protection against Candida albicans infections. Virulence 7:745–747.

250. Naglik JR, König A, Hube B, Gaffen SL. 2017. Candida albicans–epithelial interactions and induction of mucosal innate immunity. Curr Opin Microbiol 40:104–112.

251. Swidergall M, Ernst JF. 2014. Interplay between Candida albicans and the antimicrobial peptide armory. Eukaryot Cell 13:950–7.

252. Yano J, Palmer GE, Eberle KE, Peters BM, Vogl T, McKenzie AN, Fidel PL. 2014. Vaginal epithelial cell-derived S100 alarmins induced by Candida albicans via pattern recognition receptor interactions are sufficient but not necessary for the acute neutrophil response during experimental vaginal candidiasis. Infect Immun 82:783–92.

253. Trautwein-Weidner K, Gladiator a, Nur S, Diethelm P, LeibundGut-Landmann S. 2014. IL-17-mediated antifungal defense in the oral mucosa is independent of neutrophils. Mucosal Immunol 1–11.

254. Dongari-Bagtzoglou A, Villar CC, Kashleva H. 2005. Candida albicans-infected oral epithelial cells augment the anti-fungal activity of human neutrophils in vitro. Med Mycol 43:545–549.

255. Schaller M, Boeld U, Oberbauer S, Hamm G, Hube B, Korting HC. 2004. Polymorphonuclear leukocytes (PMNs) induce protective Th1-type cytokine epithelial responses in an in vitro model of oral candidosis. Microbiology 150:2807–2813.

256. Weindl G, Naglik JR, Kaesler S, Biedermann T, Hube B, Korting HC, Schaller M. 2007. Human epithelial cells establish direct antifungal defense through TLR4-mediated signaling. J Clin Invest 117:3664–72.

257. Jabra-Rizk MA, Kong EF, Tsui C, Nguyen MH, Clancy CJ, Fidel PL, Noverr M. 2016. Candida albicans pathogenesis: Fitting within the host-microbe damage response framework. Infect Immun 84:2724–2739.

258. Yano J, Peters BM, Noverr MC, Fidel PL. 2018. Novel Mechanism behind the Immunopathogenesis of Vulvovaginal Candidiasis: “Neutrophil Anergy.” Infect Immun 1– 12.

259. Lionakis MS, Lim JK, Lee C-CR, Murphy PM. 2011. Organ-Specific Innate Immune Responses in a Mouse Model of Invasive Candidiasis. J Innate Immun 3:180–199.

260. Ngo LY, Kasahara S, Kumasaka DK, Knoblaugh SE, Jhingran A, Hohl TM. 2014. Inflammatory monocytes mediate early and organ-specific innate defense during systemic candidiasis. J Infect Dis 209:109–119.

261. Brunel SF, Bain JM, King J, Heung LJ, Kasahara S, Hohl TM, Warris A. 2017. Live Imaging of Antifungal Activity by Human Primary Neutrophils and Monocytes in Response to A. fumigatus. J Vis Exp 1–9.

262. Espinosa V, Jhingran A, Dutta O, Kasahara S, Donnelly R, Du P, Rosenfeld J, Leiner I, Chen CC, Ron Y, Hohl TM, Rivera A. 2014. Inflammatory Monocytes Orchestrate Innate Antifungal Immunity in the Lung. PLoS Pathog 10.

263. Garth JM, Steele C. 2017. Innate Lung Defense during Invasive Aspergillosis: New Mechanisms. J Innate Immun 9:271–280.

264. Xu S, Shinohara ML. 2017. Tissue-resident macrophages in fungal infections. Front Immunol 8:1–7.

265. Falgier C, Kegley S, Podgorski H, Heisel T, Storey K, Bendel CM, Gale CA. 2011. Candida Species Differ in Their Interactions With Immature. Pediatr Res 69:384–389.

266. Jain R, Tikoo S, Weninger W. 2016. Recent advances in microscopic techniques for visualizing leukocytes in vivo. F1000Research 5:915.

267. Kreisel D, Nava RG, Li W, Zinselmeyer BH, Wang B, Lai J, Pless R, Gelman AE, Krupnick AS, Miller MJ. 2010. In vivo two-photon imaging reveals monocyte-dependent neutrophil extravasation during pulmonary inflammation. Proc Natl Acad Sci 107:18073– 18078.

268. Oehlers SH, Flores MV, Chen T, Hall CJ, Crosier KE, Crosier PS. 2011. Topographical distribution of antimicrobial genes in the zebrafish intestine. Dev Comp Immunol 35:385– 391.

269. Sullivan LC, Daniels CB, Phillips ID, Orgeig S, Whitsett J a. 1998. Conservation of Surfactant Protein A: Evidence for a Single Origin for Vertebrate Pulmonary Surfactant. J Mol Evol 46:131–138.

270. Field HA, Ober EA, Roeser T, Stainier DYR. 2003. Formation of the digestive system in zebrafish. I. Liver morphogenesis. Dev Biol 253:279–290.

271. Galuppi R, Fioravant M, Delgado M, Quaglio F, Caffara M, Tampieri M. 2001. Segnalazione di due casi do micosi della vescica natatoia in Parus aurata e Carrassius auratus. Boll Soc Ital Patol Ittica 32:26–34.

272. Hatai K, Fujimaki Y, Egusa S, Jo Y. 1986. A visceral mycosis in ayu fry, Plecoglossus altivelis Temminck & Schlegel, caused by a species of Phoma. J Fish Dis 9:111– 116.

273. Lapennas GN, Schmidt-Nielsen K. 1977. Swimbladder Permeability to Oxygen. J Exp Biol 67.

274. Ross A, Yasutake W, Fisheries SL-J of the, 1975 U. 1975. Phoma herbarum, a Fungal Plant Saprophyte, as a Fish Pathogen. J Fish Board Canada 32:1648–1652.

275. Gratacap RL, Wheeler RT. 2014. Utilization of zebrafish for intravital study of eukaryotic pathogen-host interactions. Dev Comp Immunol 46:108–15.

276. Dev A, Iyer S, Razani B, Cheng G. 2011. NF-κB and innate immunity. Curr Top Microbiol Immunol 349:115–43.

277. Roeder A, Kirschning CJ, Schaller M, Wagner H, Korting H-C, Rupec RA. 2004. Induction of Nuclear Factor – kB and c-Jun / Activator Protein – 1 via Toll-Like Receptor 2 in Macrophages by Antimycotic-Treated Candida albicans 190.

278. Zelová H, Hošek J. 2013. TNF-α signalling and inflammation: Interactions between old acquaintances. Inflamm Res 62:641–651.

279. Steele C, Fidel Jr. PL. 2002. Cytokine and chemokine production by human oral and vaginal epithelial cells in response to Candida albicans. Infect Immun 70:577–583.

280. Davies LC, Taylor PR. 2015. Tissue-resident macrophages: then and now. Immunology 144:541–548.

281. Murray PJ, Wynn TA. 2011. Protective and pathogenic functions of macrophage subsets. Nat Rev Immunol 11:723–737.

282. Ambruso DR, Knall C, Abell AN, Panepinto J, Kurkchubasche A, Thurman G, Gonzalez- Aller C, Hiester A, deBoer M, Harbeck RJ, Oyer R, Johnson GL, Roos D. 2000. Human neutrophil immunodeficiency syndrome is associated with an inhibitory Rac2 mutation. Proc Natl Acad Sci U S A 97:4654–9.

283. Troeger A, Williams DA. 2013. Hematopoietic-specific Rho GTPases Rac2 and RhoH and human blood disorders. Exp Cell Res 319:2375–2383.

284. Williams D a, Tao W, Yang F, Kim C, Gu Y, Mansfield P, Levine JE, Petryniak B, Derrow CW, Harris C, Jia B, Zheng Y, Ambruso DR, Lowe JB, Atkinson SJ, Dinauer MC, Boxer L. 2000. Dominant negative mutation of the hematopoietic-specific Rho GTPase, Rac2, is associated with a human phagocyte immunodeficiency. Blood 96:1646–1654.

285. De Oliveira S, Rosowski EE, Huttenlocher A. 2016. Neutrophil migration in infection and wound repair: Going forward in reverse. Nat Rev Immunol.

286. Silva S, Henriques M, Oliveira R, Azeredo J, Malic S, Hooper SJ, Williams DW. 2009. Characterization of Candida parapsilosis infection of an in vitro reconstituted human oral epithelium. Eur J Oral Sci 117:669–75.

287. van Asbeck EC, Clemons K V., Stevens DA. 2009. Candida parapsilosis: a review of its epidemiology, pathogenesis, clinical aspects, typing and antimicrobial susceptibility. Crit Rev Microbiol 35:283–309.

288. Dalle F, Wächtler B, L’Ollivier C, Holland G, Bannert N, Wilson D, Labruère C, Bonnin A, Hube B. 2010. Cellular interactions of Candida albicans with human oral epithelial cells and enterocytes. Cell Microbiol 12:248–71.

289. Tóth R, Nosek J, Mora-Montes HM, Gabaldon T, Bliss JM, Nosanchuk JD, Turner SA, Butler G, Vágvölgyi C, Gácser A. 2019. Candida parapsilosis : from Genes to the Bedside. Clin Microbiol Rev 32.

290. Cassone A, Bernardis F De, Pontieri E, Carruba G, Girmenia C, Martino P, Fernandez- Rodriguez M, Quindos G, Ponton J. 1995. Biotype Diversity of Candida parapsilosis and Its Relationship to the Clinical Source and Experimental Pathogenicity. J Infect Dis 171:967–975.

291. MacCallum DM, Castillo L, Nather K, Munro CA, Brown AJP, Gow NAR, Odds FC. 2009. Property differences among the four major Candida albicans strain clades. Eukaryot Cell 8:373–87.

292. Marakalala MJ, Vautier S, Potrykus J, Walker LA, Shepardson KM, Hopke A, Mora- Montes HM, Kerrigan A, Netea MG, Murray GI, MacCallum DM, Wheeler R, Munro CA, Gow NAR, Cramer RA, Brown AJP, Brown GD. 2013. Differential Adaptation of Candida albicans In Vivo Modulates Immune Recognition by Dectin-1. PLoS Pathog 9:e1003315.

293. Schönherr FA, Sparber F, Kirchner FR, Guiducci E, Trautwein-Weidner K, Gladiator A, Sertour N, Hetzel U, Le GTT, Pavelka N, D’Enfert C, Bougnoux ME, Corti CF, LeibundGut-Landmann S. 2017. The intraspecies diversity of C. albicans triggers qualitatively and temporally distinct host responses that determine the balance between commensalism and pathogenicity. Mucosal Immunol 10:1335–1350.

294. Tóth R, Alonso MF, Bain JM, Vágvölgyi C, Erwig L-PP, Gácser A, Toth R, Alonso MF, Bain JM, Agvolgyi C, Erwig L-PP, Gacser A. 2015. Different Candida parapsilosis clinical isolates and lipase deficient strain trigger an altered cellular immune response. Front Microbiol 6:1102.

295. Treviño-Rangel R de J, Rodríguez-Sánchez IP, Elizondo-Zertuche M, Martínez-Fierro ML, Garza-Veloz I, Romero-Díaz VJ, González JG, González GM. 2014. Evaluation of in vivo pathogenicity of Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis with different enzymatic profiles in a murine model of disseminated candidiasis. Med Mycol 52:240–245.

296. Gonia S, Archambault L, Shevik M, Altendahl M, Fellows E, Bliss JM, Wheeler RT, Gale CA. 2017. Candida parapsilosis Protects Premature Intestinal Epithelial Cells from Invasion and Damage by Candida albicans. Front Pediatr 5:1–10.

297. Peterson LW, Artis D. 2014. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat Rev Immunol. Nature Publishing Group.

298. Weitnauer M, Mijošek V, Dalpke AH. 2016. Control of local immunity by airway epithelial cells. Mucosal Immunol. Nature Publishing Group.

299. Whitsett JA, Alenghat T. 2015. Respiratory epithelial cells orchestrate pulmonary innate immunity. Nat Immunol 16:27–35.

300. Yano J, Noverr MC, Fidel PL. 2017. Vaginal heparan sulfate linked to neutrophil dysfunction in the acute inflammatory response associated with experimental vulvovaginal candidiasis. MBio 8:e00211-17.

301. Moyes DL, Murciano C, Runglall M, Islam A, Thavaraj S, Naglik JR. 2011. Candida albicans yeast and hyphae are discriminated by MAPK signaling in vaginal epithelial cells. PLoS One 6:e26580.

302. Dambuza IM, Brown GD. 2018. Sensing fungi at the oral epithelium. Nat Microbiol 3:4–5.

303. Netea MG, Kullberg BJ. 2010. Epithelial sensing of fungal invasion. Cell Host Microbe 8:219–20.

304. Cronan MRR, Beerman RWW, Rosenberg AFF, Saelens JWW, Johnson MGG, Oehlers SHH, Sisk DMM, Jurcic Smith KL, Medvitz NAA, Miller SEE, Trinh LAA, Fraser SEE, Madden JFF, Turner J, Stout JEE, Lee S, Tobin DMM, Jurcic Smith KL, Medvitz NAA, Miller SEE, Trinh LAA, Fraser SEE, Madden JFF, Turner J, Stout JEE, Lee S, Tobin DMM. 2016. Macrophage Epithelial Reprogramming Underlies Mycobacterial Granuloma Formation and Promotes Infection. Immunity 45:861–876.

305. Espín-Palazón R, Stachura DL, Campbell CA, García-Moreno D, Del Cid N, Kim AD, Candel S, Meseguer J, Mulero V, Traver D. 2014. Proinflammatory signaling regulates hematopoietic stem cell emergence. Cell 159:1070–1085.

306. Progatzky F, Cook HT, Lamb JR, Bugeon L, Dallman MJ. 2015. Mucosal inflammation at the respiratory interface: a zebrafish model. Am J Physiol Lung Cell Mol Physiol 310:ajplung.00323.2015.

307. Smith CJ, Wheeler MA, Marjoram L, Bagnat M, Deppmann CD, Kucenas S. 2017. TNFa/TNFR2 signaling is required for glial ensheathment at the dorsal root entry zone. PLoS Genet 13:e1006712.

308. Vincent WJB, Harvie EA, Sauer JD, Huttenlocher A. 2017. Neutrophil derived LTB4 induces macrophage aggregation in response to encapsulated Streptococcus iniae infection. PLoS One 12:e0179574.

309. Lammermann T. 2016. In the eye of the neutrophil swarm--navigation signals that bring neutrophils together in inflamed and infected tissues. J Leukoc Biol 100:55–63.

310. Rot A, von Andrian UH. 2004. Chemokines in Innate and Adaptive Defense: Basic Chemokinese Grammar for Immune Cells. Annu Rev Immunol 22:891–928.

311. Sarris M, Masson JB, Maurin D, Van Der Aa LM, Boudinot P, Lortat-Jacob H, Herbomel P. 2012. Inflammatory Chemokines Direct and Restrict Leukocyte Migration within Live Tissues as Glycan-Bound Gradients. Curr Biol 22:2375–2382.

312. Caffrey-Carr AK, Hilmer KM, Kowalski CH, Shepardson KM, Temple RM, Cramer RA, Obar JJ. 2018. Host-derived leukotriene B4 is critical for resistance against invasive pulmonary aspergillosis. Front Immunol 8:2–11.

313. Edens HA, Parkos CA, Liang TW, Jesaitis AJ, Cutler JE, Miettinen HM. 1999. Non- serum-dependent chemotactic factors produced by Candida albicans stimulate chemotaxis by binding to the formyl peptide receptor on neutrophils and to an unknown receptor on macrophages. Infect Immun 67:1063–1071.

314. Gabrielli E, Sabbatini S, Roselletti E, Kasper L, Perito S, Hube B, Cassone A, Vecchiarelli A, Pericolini E. 2016. In vivo induction of neutrophil chemotaxis by secretory aspartyl proteinases of Candida albicans. Virulence 5594.

315. Geiger J, Wessels D, Lockhart SR, Soll DR. 2004. Release of a potent polymorphonuclear leukocyte chemoattractant is regulated by white-opaque switching in Candida albicans. Infect Immun 72:667–77.

316. Hargarten JC, Moore TC, Petro TM, Nickerson KW, Atkin AL. 2015. Candida albicans Quorum Sensing Molecules Stimulate Mouse Macrophage Migration. Infect Immun 83:3857–3864.

317. Bistoni F, Vecchiarelli A, Cenci E, Sbaraglia G, Perito S, Cassone A. 1984. A comparison of experimental pathogenicity of Candida species in cyclophosphamide- immunodepressed mice. Sabouraudia 22:409–18.

318. Mellado E, Cuenca-Estrella M, Regadera J, González M, Díaz-Guerra TM, Rodríguez- Tudela JL. 2000. Sustained gastrointestinal colonization and systemic dissemination by Candida albicans, Candida tropicalis and Candida parapsilosis in adult mice. Diagn Microbiol Infect Dis 38:21–28.

319. Lehrer RI. 1972. Functional aspects of a second mechanism of candidacidal activity by human neutrophils. J Clin Invest 51:2566–2572.

320. Lewis LE, Bain JM, Lowes C, Gillespie C, Rudkin FM, Gow NAR, Erwig L-P. 2012. Stage specific assessment of Candida albicans phagocytosis by macrophages identifies cell wall composition and morphogenesis as key determinants. PLoS Pathog 8:e1002578.

100

321. Bast DJ, Yue M, Chen X, Bell D, Dresser L, Saskin R, Mandell LA, Low DE, de Azavedo JCS. 2004. Novel murine model of pneumococcal pneumonia: use of temperature as a measure of disease severity to compare the efficacies of moxifloxacin and levofloxacin. Antimicrob Agents Chemother 48:3343–8.

322. McFadden ER, Pichurko BM, Bowman HF, Ingenito E, Burns S, Dowling N, Solway J. 1985. Thermal mapping of the airways in humans. J Appl Physiol 58:564–70.

323. Seman B. 2018. Characterizing the Role of Fungal Shape in a Zebrafish Model of Invasive Candidiasis.

324. Schmittgen TD, Livak KJ. 2008. Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3:1101–1108.

325. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez J-Y, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods 9:676–82.

326. Preibisch S, Saalfeld S, Schindelin J, Tomancak P. 2010. Software for bead-based registration of selective plane illumination microscopy data. Nat Methods. Nature Publishing Group.

327. 2011. GUIDE FOR THE CARE AND USE OF LABORATORY ANIMALS Eighth Edition Committee for the Update of the Guide for the Care and Use of Laboratory Animals Institute for Laboratory Animal Research Division on Earth and Life Studies. National Academies Press.

328. Coates EW, Karlowicz MG, Croitoru DP, Buescher ES. 2005. Distinctive distribution of pathogens associated with peritonitis in neonates with focal intestinal perforation compared with necrotizing enterocolitis. Pediatrics 116:e241-6.

329. Saiman L, Ludington E, Pfaller M, Rangel-Frausto S, Wiblin RT, Dawson J, Blumberg HM, Patterson JE, Rinaldi M, Edwards JE, Wenzel RP, Jarvis W. 2000. Risk factors for candidemia in Neonatal Intensive Care Unit patients. The National Epidemiology of Mycosis Survey study group. Pediatr Infect Dis J 19:319–24.

330. Kaufman DA, Gurka MJ, Hazen KC, Boyle R, Robinson M, Grossman LB. 2006. Patterns of fungal colonization in preterm infants weighing less than 1000 grams at birth. Pediatr Infect Dis J 25:733–7.

331. Heisel T, Podgorski H, Staley CM, Knights D, Sadowsky MJ, Gale CA. 2015. Complementary Amplicon-Based Genomic Approaches for the Study of Fungal Communities in Humans. PLoS One 10:e0116705.

332. Pappu-Katikaneni LD, Rao KPP, Banister E. 1990. Gastrointestinal Colonization with Yeast Species and Candida Septicemia in Very Low Birth Weight Infants. Mycoses 33:20–23.

333. Koh AY. 2013. Murine models of Candida gastrointestinal colonization and dissemination. Eukaryot Cell 12:1416–22.

101

334. Sherman F. 2002. Getting started with yeast. Methods Enzymol 350:3–41.

335. Verma AH, Richardson JP, Zhou C, Coleman BM, Moyes DL, Ho J, Huppler AR, Ramani K, Mcgeachy MJ, Mufazalov IA, Waisman A, Kane LP, Biswas PS, Hube B, Naglik JR, Gaffen SL. 2017. Oral epithelial cells orchestrate innate type 17 responses to Candida albicans through the virulence factor candidalysin. Sci Immunol 8834:1–12.

336. Lima-Neto RG, Beltrão EIC, Oliveira PC, Neves RP. 2011. Adherence of Candida albicans and Candida parapsilosis to epithelial cells correlates with fungal cell surface carbohydrates. Mycoses 54:23–9.

337. Pérez-García LA, Csonka K, Flores-Carreón A, Estrada-Mata E, Mellado-Mojica E, Németh T, López-Ramírez LA, Toth R, López MG, Vizler C, Marton A, Tóth A, Nosanchuk JD, Gácser A, Mora-Montes HM. 2016. Role of Protein Glycosylation in Candida parapsilosis Cell Wall Integrity and Host Interaction. Front Microbiol 7:306.

338. Huang C, Niethammer P. 2018. Tissue Damage Signaling Is a Prerequisite for Protective Neutrophil Recruitment to Microbial Infection in Zebrafish. Immunity 48:1006-1013.e6.

339. Sellge G, Kufer TA. 2015. PRR-signaling pathways: Learning from microbial tactics. Semin Immunol 27:75–84.

340. Chakraborty T, Thuer E, Heijink M, Tóth R, Bodai L, Vágvölgyi C, Giera M, Gabaldón T, Gácser A. 2018. Eicosanoid biosynthesis influences the virulence of Candida parapsilosis. Virulence 9:1019–1035.

102

BIOGRAPHY OF THE AUTHOR

Linda S. Archambault was born in 1960, as Linda S. Handrich, in Northampton,

Massachusetts, USA. She graduated from Oak Hill High School in Wales, Maine, in 1978. She graduated Cum Laude with a Bachelor of Science degree in Biology from Bates College,

Lewiston, Maine, in 1982 and was elected to Phi Beta Kappa. In 1986, she received a Master of

Arts degree in Marine Biology from Boston University Marine Program, Woods Hole,

Massachusetts. From 1986 to 2002, Linda was a homemaker and entrepreneur in Bristol,

Maine. She then worked as Research and Education Coordinator at The Lobster Conservancy in Friendship, Maine from 2002-2006. She taught science and mathematics at Lincoln Academy in Newcastle, Maine from 2006-2010. She served as Research Assistant to Dr. Paula Schlax in the Chemistry Department at Bates College, Lewiston, Maine from 2011-2013. In 2013, she joined the lab of Robert W. Wheeler at The University of Maine, Orono, Maine. She is an author of nine articles published in scientific journals. Linda is a member of the American Society for

Microbiology and the Medical Mycological Society of the Americas. She is a candidate for the

Doctor of Philosophy degree in Biochemistry from The University of Maine in August 2019.

103