DOCSLIB.ORG

Biotransformation of Various Alkanes Using the Escherichia Coli Expressing an Alkane Hydroxylase System from Gordonia Sp. TF6

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biotransformation of Various Alkanes Using the Escherichia Coli Expressing an Alkane Hydroxylase System from Gordonia Sp. TF6 Biosci. Biotechnol. Biochem., 68 (10), 2171–2177, 2004 Biotransformation of Various Alkanes Using the Escherichia coli Expressing an Alkane Hydroxylase System from Gordonia sp. TF6 y Tadashi FUJII,1; Tatsuya NARIKAWA,1 Koji TAKEDA,1 and Junichi KATO2 1Bioresource Laboratories, Mercian Corporation, 1808 Nakaizumi, Iwata, Shizuoka 438-0078, Japan 2Department of Molecular Biotechnology Graduate School of Advanced Sciences of Matter, Hiroshima University, 1-3-1 Kagamiyama, Higashi-Hiroshima, Hiroshima 739-8530, Japan Received June 8, 2004; Accepted July 20, 2004 Biotransformation using alkane-oxidizing bacteria or rubredoxin reductase (AlkT), which act as electron their alkane hydroxylase (AH) systems have been little carriers between NADH and monooxygenase.2) Among studied at the molecular level. We have cloned and gram-positive bacteria, the AH systems of two Rhodo- sequenced genes from Gordonia sp. TF6 encoding an AH coccus strains, Q15 and NRRL B-16531, have been system, alkB2 (alkane 1-monooxygenase), rubA3 (rubre- studied in detail. Both organisms contained at least four doxin), rubA4 (rubredoxin), and rubB (rubredoxin alkane 1-monooxygenase gene homologues (alkB1, reductase). When expressed in Escherichia coli, these alkB2, alkB3, and alkB4).3) The alkB1 and alkB2 genes allowed the construction of biotransformation homologues were part of AH gene clusters, each systems for various alkanes. Normal alkanes with 5 to 13 encoding two rubredoxins (rubA1 and rubA2; rubA3 carbons were good substrates for this biotransforma- and rubA4), and, in the alkB1 cluster, a rubredoxin tion, and oxidized to their corresponding 1-alkanols. reductase (rubB).3) Surprisingly, cycloalkanes with 5 to 8 carbons were Several AH system genes had been expressed hetero- oxidized to their corresponding cycloalkanols as well. logously. A DNA region of about 35-kbp containing AH This is the first study to achieve biotransformation of system genes from P. putida GPo1 was cloned into an alkanes using the E. coli expressing the minimum E. coli strain and into a mutant strain of P. putida, component genes of the AH system. Our biotransfor- unable to grow on alkanes. These transformants metab- mation system has facilitated assays and analysis leading olized n-alkanes as shown by mineralization and growth to improvement of AH systems, and has indicated a assays.2) Heterologous expression of other alkane 1- cycloalkane oxidation pathway in microorganisms for monooxygenase genes from several bacteria such as the first time. Rhodococcus strains,3) Alcanivorax borkumensis AP1,4) Prauserella rugosa NRRL B-2295,4) and Mycobacteri- Key words: alkane hydroxylase; biotransformation; um tuberculosis H37Rv4) were confirmed using this Gordonia sp. TF6; cycloalkane oxidation P. putida system. Almost all the AH activities in these previous studies Alkanes are the most abundant family of hydro- were shown not by detection of the products, but by carbons in crude oil and are generated by many plants mineralization and growth assays in vivo. That is, AH and algae.1) Bacterial metabolism of normal alkanes (n- activity was detected only indirectly. In only one study alkanes) normally proceeds via sequential oxidation of a using P. putida strain PpS81, which lacks alcohol terminal methyl group to produce alcohol, aldehydes, dehydrogenase activity and carried the plasmids with a and finally fatty acids.1) It is known that many micro- DNA region of about 29-kbp containing AH system organisms are able to metabolize n-alkanes, but rela- genes, was the product of AH activity detected using the tively little is known about the system of alkane whole-cell reaction.5,6) In contrast, only the long DNA metabolism at the molecular level. region responsible for AH activity was characterized in The best-characterized system of n-alkane degrada- this study. tion is that of Pseudomonas putida GPo1.2) In this case, AH assays in vitro were performed with a reconsti- the initial oxidation step is performed by an alkane tuted hydroxylase system consisting of AlkB and AlkG hydroxylase (AH) system composed of a particulate expressed in E. coli, and with spinach ferredoxin nonheme integral-membrane alkane 1-monooxygenase reductase.6) But again, AH activity was detected only (AlkB) and two soluble proteins, rubredoxin (AlkG) and indirectly, this time by measuring cooxidation of y To whom correspondence should be addressed. Tel: +81-538-21-1134; Fax: +81-538-21-1135; E-mail: [email protected] Abbreviations: AH, alkane hydroxylase; GC–MS, gas chromatography–mass spectrometry; IPTG, isopropyl- -D-thiogalactopyranoside; n-alkanes, normal alkanes 2172 T. FUJII et al. Table 1. Primers Used in This Study Primers Sequence (50!30) Primer 16SF GTGTTTGATCCTGGCTCAG Primer 16SF GTATTACCGCGGCTGCTG Primer TS2S AAYAGAGCTCAYGARYTRGGTCAYAAG Primer Deg1RE GTGGAATTCGCRTGRTGRTCIGARTG Primer Inv1 AAGACCAACACCGGTCGCTACGAACGAT Primer Inv2 TTCGACAGCCAGCGCTCGAGGTCGTCCTT Primer Inv3 TGGCGACCCTGCACCGTGAACGCGGTGT Primer Inv4 TACAGCACTGGACATTAACCGAGACAAT Primer AEx1 TTAGATCTGCATGAGTACCGCACCGACCCC Primer AEx2 GGCTGCAGGCCCTGCTGTCCTGGGCGAAGT Primer MutA3F GCGATGAGCACATTCCGTTGACCGGTCTGCGA Primer MutA3R CAACGGAATGTGCTCATCGCGGCGACACCCC Primer MutA4F AATTTCAAGCTTTTCCGTTGAGAGGTATGCGG Primer MutA4R CAACGGAAAAGCTTGAAATTCATCGTACTGC R, A+G; Y, C+T; I, inosine. NADH. The extent of the AH reaction was very limited, previous study.10) Gordonia sp. TF6 was characterized possibly due to the insolubility of alkanes and enzymes and identified by biochemical tests and 16S rRNA gene in water. sequences. The biochemical tests were performed based Recently, much attention has been focused on the on Cowan and Steel’s manual.11) Part of the 16S rRNA importance of regio-selective oxidation of chemicals for gene of 479-bp was cloned and sequenced by PCR using the production of medicinal drugs. These oxidized Primer 16SF and Primer 16SR as shown in Table 1. chemicals can be prepared by chemical or biocatalytic reactions. The advantages of biocatalytic reactions are DNA manipulation. Chromosomal DNA from Gordo- that they are regio-selective, one-step reactions, and can nia sp. TF6 was prepared using Isoplant (Nippon Gene). take place at ambient temperature and pressure. Fur- Plasmids from E. coli strains were prepared using a thermore, biotransformation using living microbial cells GFX Micro Plasmid Prep Kit (Amersham Pharmacia by fermentation is useful, especially when the enzymatic Biotech). DNA ligation was performed using a Ligation reaction requires cofactors that must be regenerated. Kit (TaKaRa). All restriction enzymes were obtained Considerable interest is being devoted to the use of from TaKaRa. All amplifications by PCR or inverse bacterial alkane oxidation systems as biocatalysts for the PCR were performed in a reaction mixture (50 l) production of fine chemicals and pharmaceuticals. Using containing template DNA (50 ng), both primers (25 pM bacteria with alkane-oxidizing ability, biotransformation each), MgCl2 (2.5 mM), dNTPs (0.25 mM each), and LA reactions of various hydrocarbons, such as cumene,7) 2, Taq polymerase (1 U) in the buffer for LA Taq polymer- 5-dimethylhexane,8) and N-(2-hexylamino-4-phenylimi- ase (TaKaRa). The primers used in this study were dazole-1-yl)-acetamide9) have been performed. How- synthesized by Sigma Genosys, as shown in Table 1, ever, little study has been conducted on these biotrans- and the plasmids used in this study were constructed as formations at the molecular level. shown in Table 2. Site-directed mutagenesis was per- No AH system of Gordonia sp. has been characterized formed using the GeneTailor Site-Directed Mutagenesis at the molecular level. In this study we isolated a n- System (Invitrogen). DNA sequencing analysis was decane utilizing bacterium, Gordonia sp. TF6, and from done using the BigDye Terminator v3.1 Cycle Sequenc- this strain genes encoding an AH system (alkane 1- ing Kit (Applied Biosystems). monooxygenase, rubredoxins, and rubredoxin reductase) were cloned, sequenced, and expressed in E. coli. This is Cloning of a DNA fragment encoding part of AlkB2. the first study to achieve biotransformation of alkanes In order to clone part of the gene encoding AlkB2, we using the E. coli expressing the minimum component used the method described previously.12) Highly degen- genes of the AH system. erate primers, Primer TS2S and Primer deg1RE, shown in Table 1, were designed on the basis of conserved Materials and Methods sequence motifs. Degenerate PCR was performed for 25 cycles of denaturation (98 C, 20 s), annealing (40 C, Isolation of Gordonia sp. TF6. We isolated the n- 1 min), and extension (68 C, 1 min) with these primers decane utilizing bacterium Gordonia sp. TF6 from the and Gordonia sp. TF6 chromosomal DNA. About 550- soil on a tennis court in Fujisawa, Kanagawa, Japan by bp of PCR product was amplified, ligated into pT7 Blue the methods described previously.10) Growth assay of T-vector (Novagen), and sequenced. Gordonia sp. TF6 was performed using submerged medium with 1% (v/v) n-alkane with 5 to 16 carbons. Inverse PCR for sequences of the DNA region The medium compositions were the same as shown in encoding the AH system. In order to clone the 50- and Biotransformation Using E. coli Expressing an Alkane Hydroxylase System 2173 Table 2. Plasmids Used in This Study Plasmids Relevant characteristics Genotype pAL526 pTrcHisA (Invitrogen) derivative containing 2825-bp BglII–PstI alkB2, rubA3, rubA4, rubB insert amplified by PCR with Primer AEx1 and Primer AEx2 pAL520 pAL526 derivative digested
Load more

Recommended publications
  • Biotransformation of Medium-Chain Alkanes Using Recombinant P450 Monooxygenase from Alcanivorax Borkumensis SK2 Expressed in Escherichia Coli
    Korean J. Chem. Eng., 27(3), 905-909 (2010) DOI: 10.1007/s11814-010-0131-9 RAPID COMMUNICATION Biotransformation of medium-chain alkanes using recombinant P450 monooxygenase from Alcanivorax borkumensis SK2 expressed in Escherichia coli Sang-Ho Baik† Department of Food Science and Human Nutrition, and Research Institute of Human Ecology, Chonbuk National University, Jeonju, Jeonbuk 561-756, Korea (Received 11 May 2009 • accepted 6 September 2009) Abstract−A bioconversion system for medium-chain alkanes was constructed by using a recombinant Escherichia coli whole-cell biocatalyst expressing P450 monooxygenase genes, ferredoxin, and ferredoxin reductase cloned from Alcanivorax borkumensis as an operon. The recombinant E. coli harboring the P450 gene and two related expression component enzymes, ferredoxin and ferredoxin reductase, was constructed in a single vector pET21(a) and successfully expressed in E. coli BL21(DE3) as a soluble form, showing a molecular weight of 53 kDa on 10% SDS-PAGE. When the cell-free extract of E. coli BL21 expressing p450 monooxygenase was subjected to reduced CO difference spectral analysis, a soret band near 450 nm appeared indicating that the cloned P450 was expressed as a functionally active enzyme. The E. coli cells harboring the expressed P450 gene were able to convert n-octane and 1-decene, producing approximately 450 µg/ml of n-octanol and 290 µg/ml of 1,2-epoxydecane, respectively, at pH 7.0 and 30 oC. However, the recombinant E. coli cells were not able to convert the branched alkane, 2,6,10,14-tetramethylpentadecane (C19). Key words: P450 Monooxygenase, Medium-chain Alkane, Esheriachia coli INTRODUCTION (Rd) and Rd reductase, for alkane hydroxylase activity, are thought to be mainly related to the first hydroxylation step of alkanes [7,8].
    [Show full text]
  • Ex-Situ Biodegradation of Petroleum Hydrocarbons Using Alcanivorax Borkumensis Enzymes
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/322824019 Ex-situ Biodegradation of petroleum hydrocarbons using Alcanivorax borkumensis enzymes Article in Biochemical Engineering Journal · January 2018 DOI: 10.1016/j.bej.2018.01.014 CITATIONS READS 0 26 4 authors, including: Sarra Magdouli Tarek Rouissi Institut National de la Recherche Scientifique Institut National de la Recherche Scientifique 15 PUBLICATIONS 118 CITATIONS 29 PUBLICATIONS 88 CITATIONS SEE PROFILE SEE PROFILE Satinder Kaur Brar Institut National de la Recherche Scientifique 230 PUBLICATIONS 3,462 CITATIONS SEE PROFILE Some of the authors of this publication are also working on these related projects: Fate of emerging contaminants in watewater treatment plants View project Occurrence of nano-particles in the environment View project All content following this page was uploaded by Sarra Magdouli on 01 February 2018. The user has requested enhancement of the downloaded file. Accepted Manuscript Title: Ex-situ Biodegradation of petroleum hydrocarbons using Alcanivorax borkumensis enzymes Authors: Tayssir Kadri, Sara Magdouli, Tarek Rouissi, Satinder Kaur Brar PII: S1369-703X(18)30015-9 DOI: https://doi.org/10.1016/j.bej.2018.01.014 Reference: BEJ 6863 To appear in: Biochemical Engineering Journal Received date: 7-9-2017 Revised date: 19-12-2017 Accepted date: 13-1-2018 Please cite this article as: Tayssir Kadri, Sara Magdouli, Tarek Rouissi, Satinder Kaur Brar, Ex-situ Biodegradation of petroleum hydrocarbons using Alcanivorax borkumensis enzymes, Biochemical Engineering Journal https://doi.org/10.1016/j.bej.2018.01.014 This is a PDF file of an unedited manuscript that has been accepted for publication.
    [Show full text]
  • Microbial Communities Responding to Deep-Sea Hydrocarbon Spills Molly C. Redmond1 and David L. Valentine2 1. Department of Biolo
    Microbial Communities Responding to Deep-Sea Hydrocarbon Spills Molly C. Redmond1 and David L. Valentine2 1. Department of Biological Sciences, University of North Carolina at Charlotte, [email protected] 2. Department of Earth Science and Marine Science Institute, University of California, Santa Barbara, [email protected] Abstract The 2010 Deepwater Horizon oil spill in the Gulf of Mexico can be considered the world’s first deep-sea hydrocarbon spill. Deep-sea hydrocarbon spills occur in a different setting than surface oil spills and the organisms that respond must be adapted to this low temperature, high pressure environment. The hydrocarbon composition can also be quite different than at the sea surface, with high concentrations of dissolved hydrocarbons, including natural gas, and suspended droplets of petroleum. We discuss the bacteria that may respond to these spills and factors that affect their abundance, based on data collected during the Deepwater Horizon spill and in microcosm experiments in the following years. 1. Introduction When the Deepwater Horizon mobile offshore drilling unit exploded on April 20, 2010 and sank two days later, it caused the world’s first major deep-sea oil spill. Previous well blowouts such as Ixtoc I in the Gulf Mexico in 1979 and Platform A in the Santa Barbara Channel in 1969 also caused significant undersea spills, but the shallower depths of these spills (50-60 m) resulted in most of oil reaching the sea surface. In contrast, the Deepwater Horizon well was 1500 m below the sea surface and ~25% the hydrocarbons emitted remained dissolved or suspended in a deep-sea intrusion layer at depths between 900 and 1300 m (Ryerson et al.
    [Show full text]
  • The Transcriptional Response of Prokaryotes to Phytoplanktonderived Dissolved Organic Matter in Seawater
    bs_bs_banner Environmental Microbiology (2014) doi:10.1111/1462-2920.12434 The transcriptional response of prokaryotes to phytoplankton-derived dissolved organic matter in seawater Sara Beier,1,2* Adam R. Rivers,3 Mary Ann Moran3 Introduction and Ingrid Obernosterer1,2 Prokaryotes are main processors of marine dissolved 1UPMC University Paris 06, UMR 7621, LOMIC, UMS organic matter (DOM), much of which is derived from 2348, Observatoire Océanologique, Banyuls/mer phytoplankton exudates (Baines and Pace, 1991; Benner, F-66650, France. 2002). Taxonomically distinct phytoplankton species 2CNRS, UMR 7621, LOMIC, Observatoire produce DOM with different chemical composition Océanologique, Banyuls/mer F-66650, France. (Biersmith and Benner, 1998; Sarmento et al., 2013). 3Department of Marine Sciences, University of Georgia, Thus, the question of whether prokaryotic community Athens, GA 30602, USA. composition changes in response to phytoplankton DOM of different origins has been investigated. Outcomes of Summary these studies have differed, however, with some indicat- ing pronounced compositional responses and others only To better understand the functional responses in weak effects (Van Hannen et al., 1999; Lekunberri et al., prokaryotes to dissolved organic matter (DOM), we 2012; Sarmento and Gasol, 2012; Landa et al., 2013b). compared the transcriptional pattern of natural pro- One explanation for these contrasting results could karyotic communities grown in continuous cultures be that both specialist and generalist strategies exist on seawater amended with phytoplankton-derived among prokaryotic taxa (Langenheder et al., 2005; DOM. Metatranscriptomic reads were classified taxo- Gómez-Consarnau et al., 2012; Dinasquet et al., 2013). nomically (by genomic binning) and functionally Depending on the degree of selectivity for specific organic (using Kyoto Encyclopedia of Genes and Genomes), substrates, specialist or generalist behaviour could domi- and the relative gene expression of individual taxa nate a community.
    [Show full text]
  • Membrane Fatty Acid Composition and Cell Surface Hydrophobicity Of
    molecules Article Membrane Fatty Acid Composition and Cell Surface Hydrophobicity of Marine Hydrocarbonoclastic Alcanivorax borkumensis SK2 Grown on Diesel, Biodiesel and Rapeseed Oil as Carbon Sources Maria Konieczna 1, Martin Olzog 1, Daniela J. Naether 2, Łukasz Chrzanowski 3 and Hermann J. Heipieper 1,* ID 1 Department of Environmental Biotechnology, Helmholtz Centre for Environmental Research-UFZ, Permoserstr, 15, 04318 Leipzig, Germany; [email protected] (M.K.); [email protected] (M.O.) 2 Department of Molecular Biosciences, Goethe University Frankfurt, Max-von-Laue-Str, 9, 60438 Frankfurt, Germany; [email protected] 3 Faculty of Chemical Technology, Poznan University of Technology, 60-965 Poznan, Poland; [email protected] * Correspondence: [email protected]; Tel.: +49-341-2351694 Academic Editors: Carla C. C. R. de Carvalho and Maria José Caramujo Received: 18 May 2018; Accepted: 12 June 2018; Published: 13 June 2018 Abstract: The marine hydrocarbonoclastic bacterium Alcanivorax borkumensis is well known for its ability to successfully degrade various mixtures of n-alkanes occurring in marine oil spills. For effective growth on these compounds, the bacteria possess the unique capability not only to incorporate but also to modify fatty intermediates derived from the alkane degradation pathway. High efficiency of both these processes provides better competitiveness for a single bacteria species among hydrocarbon degraders. To examine the efficiency of A. borkumensis to cope with different sources of fatty acid intermediates, we studied the growth rates and membrane fatty acid patterns of this bacterium cultivated on diesel, biodiesel and rapeseed oil as carbon and energy source. Obtained results revealed significant differences in both parameters depending on growth substrate.
    [Show full text]
  • Contribution of Cyanobacterial Alkane Production to the Ocean Hydrocarbon Cycle
    Contribution of cyanobacterial alkane production to SEE COMMENTARY the ocean hydrocarbon cycle David J. Lea-Smitha,1, Steven J. Billerb, Matthew P. Daveyc, Charles A. R. Cottona, Blanca M. Perez Sepulvedad, Alexandra V. Turchyne, David J. Scanland, Alison G. Smithc, Sallie W. Chisholmb,f, and Christopher J. Howea aDepartment of Biochemistry, University of Cambridge, Cambridge CB2 1QW, United Kingdom; bDepartment of Civil and Environmental Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139; cDepartment of Plant Sciences, University of Cambridge, Cambridge CB2 3EA, United Kingdom; dSchool of Life Sciences, University of Warwick, Coventry CV4 7AL, United Kingdom; eDepartment of Earth Sciences, University of Cambridge, Cambridge CB2 3EQ, United Kingdom; and fDepartment of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139 Edited by John M. Hayes, Woods Hole Oceanographic Institution, Berkeley, CA, and approved September 8, 2015 (received for review April 14, 2015) Hydrocarbons are ubiquitous in the ocean, where alkanes such as The second pathway generates alkenes, primarily nonadecene and pentadecane and heptadecane can be found even in waters minimally 1,14-nonadecadiene, via a polyketide synthase enzyme (Ols) (13). polluted with crude oil. Populations of hydrocarbon-degrading bacte- The abundance and ubiquity of cyanobacteria in the marine envi- ria, which are responsible for the turnover of these compounds, are ronment suggests hydrocarbon production in the oceans could be also found throughout marine systems, including in unpolluted waters. considerable and broadly distributed geographically (14, 15). These observations suggest the existence of an unknown and wide- We focused our studies on the two most abundant marine spread source of hydrocarbons in the oceans.
    [Show full text]
  • Characterization of Bacterial Hydrocarbon Degradation Potential in the Red Sea Through Metagenomic and Cultivation Methods
    Characterization of Bacterial Hydrocarbon Degradation Potential in the Red Sea Through Metagenomic and Cultivation Methods Dissertation by Patrick Bianchi In Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy King Abdullah University of Science and Technology Thuwal, Kingdom of Saudi Arabia February, 2018 2 EXAMINATION COMMITTEE PAGE The dissertation of Patrick Bianchi is approved by the examination committee. Committee Chairperson: Prof. Daniele Daffonchio Committee Members: Prof. Peiying Hong, Prof. Timothy Ravasi, Prof. Sara Borin 3 © February, 2018 Patrick Bianchi All Rights Reserved 4 ABSTRACT Characterization of Bacterial Hydrocarbon Degradation Potential in the Red Sea Through Metagenomic and Cultivation Methods Patrick Bianchi Prokaryotes are the main actors in biogeochemical cycles that are fundamental in global nutrient cycling. The characterization of microbial communities and isolates can enhance the comprehension of such cycles. Potentially novel biochemical processes can be discovered in particular environments with unique characteristics. The Red Sea can be considered as a unique natural laboratory due to its peculiar hydrology and physical features including temperature, salinity and water circulation. Moreover the Red Sea is subjected to hydrocarbon pollution by both anthropogenic and natural sources that select hydrocarbon degrading prokaryotes. Due to its unique features the Red Sea has the potential to host uncharacterized novel microorganisms with hydrocarbon- degrading pathways. The focus of this thesis is on the characterization at the metagenomic level of the water column of the Red Sea and on the isolation and characterization of novel hydrocarbon-degrading species and genomes adapted to the unique environmental characteristics of the basin. The presence of metabolic genes responsible of both linear and aromatic hydrocarbon degradation has been evaluated from a metagenomic survey and a meta-analysis of already available datasets.
    [Show full text]
  • Transcriptional Profiling of the Marine Oildegrading Bacterium Alcanivorax Borkumensis During Growth on Nalkanes
    RESEARCH LETTER Transcriptional pro¢ling ofthe marine oil-degrading bacterium Alcanivorax borkumensis during growth on n-alkanes Julia S. Sabirova1, Anke Becker2, Heinrich Lunsdorf¨ 3, Jean-Marc Nicaud4, Kenneth N. Timmis5 & Peter N. Golyshin6 1Department of Bioscience and Bioengineering, Ghent University, Ghent, Belgium; 2Institute of Biology III, Faculty of Biology, University of Freiburg, Freiburg, Germany; 3Department of Vaccinology and Applied Microbiology, HZI-Helmholtz Centre for Infection Research, Braunschweig, Germany; 4Laboratoire de Microbiologie et de Gen´ etique´ Moleculaire,´ INRA Centre de Grignon, Thiverval-Grignon, France; 5Department of Environmental Microbiology, HZI-Helmholtz Centre for Infection Research, Braunschweig, Germany; and 6School of Biological Sciences, Bangor University, Bangor Gwynedd, UK Correspondence: Julia S. Sabirova, Abstract Laboratory of Industrial Microbiology and Biocatalysis, Faculty of Bioscience The marine oil-degrading bacterium Alcanivorax borkumensis SK2 has attracted Engineering, Ghent University, Coupure Links significant interest due to its hydrocarbonoclastic lifestyle, its alkane-centered 653, B-9000 Ghent, Belgium. Tel.: 132 9 264 metabolism, and for playing an important ecological role in cleaning up marine oil 93 85; fax: 132 9 264 62 31; spills. In this study, we used microarray technology to characterize the transcrip- e-mail: [email protected] tional responses of A. borkumensis to n-hexadecane exposure as opposed to pyruvate, which led to the identification of a total of 220 differentially expressed Received 21 December 2010; revised 15 March genes, with 109 genes being upregulated and 111 genes being downregulated. 2011; accepted 31 March 2011. Among the genes upregulated on alkanes are systems predicted to be involved in Final version published online 20 April 2011.
    [Show full text]
  • Characterization of Hydrocarbonoclastic Bacterial Communities from Mangrove Sediments in Guanabara Bay, Brazil
    Research in Microbiology 157 (2006) 752–762 www.elsevier.com/locate/resmic Characterization of hydrocarbonoclastic bacterial communities from mangrove sediments in Guanabara Bay, Brazil Elcia Margareth S. Brito a,b,∗, Rémy Guyoneaud b, Marisol Goñi-Urriza b, Antony Ranchou-Peyruse b, Arnaud Verbaere b, Miriam A.C. Crapez d, Julio César A. Wasserman a,c, Robert Duran b a Departamento de Geoquímica Ambiental, Universidade Federal Fluminense, RJ, Brazil b Laboratoire d’Ecologie Moleculaire, EA3525, Université de Pau et des Pays de l’Adour, Pau, France c Programa de Pós-Graduação em Ciência Ambiental/LAGEMAR, Universidade Federal Fluminense, RJ, Brazil d Departamento de Biologia Marinha, Universidade Federal Fluminense, RJ, Brazil Received 3 November 2005; accepted 20 March 2006 Available online 4 April 2006 Abstract Hydrocarbonoclastic bacterial communities inhabiting mangrove sediments were characterized by combining molecular and culture-dependent approaches. Surface sediments were collected at two sampling sites in Guanabara Bay (Rio de Janeiro, Brazil) and used to inoculate in vitro en- richment cultures containing crude oil to obtain hydrocarbonoclastic bacterial consortia. In parallel, in situ mesocosms (located in the Guapimirim mangrove) were contaminated with petroleum. Comparison of bacterial community structures of the different incubations by T-RFLP analyses showed lower diversity for the enrichment cultures than for mesocosms. To further characterize the bacterial communities, bacterial strains were isolated in media containing hydrocarbon compounds. Analysis of 16S rRNA encoding sequences showed that the isolates were distributed within 12 distinct genera. Some of them were related to bacterial groups already known for their capacity to degrade hydrocarbons (such as Pseudomonas, Marinobacter, Alcanivorax, Microbulbifer, Sphingomonas, Micrococcus, Cellulomonas, Dietzia,andGordonia groups).
    [Show full text]
  • The Long-Chain Alkane Metabolism Network of Alcanivorax Dieselolei
    ARTICLE Received 30 Jan 2014 | Accepted 5 Nov 2014 | Published 12 Dec 2014 DOI: 10.1038/ncomms6755 The long-chain alkane metabolism network of Alcanivorax dieselolei Wanpeng Wang1,2,3,4 & Zongze Shao1,2,3,4 Alkane-degrading bacteria are ubiquitous in marine environments, but little is known about how alkane degradation is regulated. Here we investigate alkane sensing, chemotaxis, signal transduction, uptake and pathway regulation in Alcanivorax dieselolei. The outer membrane protein OmpS detects the presence of alkanes and triggers the expression of an alkane chemotaxis complex. The coupling protein CheW2 of the chemotaxis complex, which is induced only by long-chain (LC) alkanes, sends signals to trigger the expression of Cyo, which participates in modulating the expression of the negative regulator protein AlmR. This change in turn leads to the expression of ompT1 and almA, which drive the selective uptake and hydroxylation of LC alkanes, respectively. AlmA is confirmed as a hydroxylase of LC alkanes. Additional factors responsible for the metabolism of medium-chain-length alkanes are also identified, including CheW1, OmpT1 and OmpT2. These results provide new insights into alkane metabolism pathways from alkane sensing to degradation. 1 State Key Laboratory Breeding Base of Marine Genetic Resources, Third Institute of Oceanography, SOA, Xiamen 361005, China. 2 Key Laboratory of Marine Genetic Resources, Third Institute of Oceanography, SOA, Xiamen 361005, China. 3 Key Laboratory of Marine Genetic Resources of Fujian Province, Xiamen 361005, China. 4 Fujian Collaborative Innovation Center for Exploitation and Utilization of Marine Biological Resources, Xiamen 361005, China. Correspondence and requests for materials should be addressed to Z.S.
    [Show full text]
  • Hydrocarbonoclastic Alcanivorax Isolates Exhibit Different Physiological and Expression Responses to N-Dodecane
    ORIGINAL RESEARCH published: 21 December 2016 doi: 10.3389/fmicb.2016.02056 Hydrocarbonoclastic Alcanivorax Isolates Exhibit Different Physiological and Expression Responses to n-dodecane Marta Barbato 1, 2 †, Alberto Scoma 1 †, Francesca Mapelli 2, Rebecca De Smet 3, Ibrahim M. Banat 4, Daniele Daffonchio 2, 5, Nico Boon 1* and Sara Borin 2* 1 Centre for Microbial Ecology and Technology, Ghent University, Ghent, Belgium, 2 Department of Food, Environmental and Edited by: Nutritional Sciences, University of Milan, Milan, Italy, 3 Department of Medical and Forensic Pathology, University of Ghent, Raquel Peixoto, Ghent, Belgium, 4 School of Biomedical Sciences, University of Ulster, Coleraine, UK, 5 Biological and Environmental Sciences Federal University of Rio de Janeiro and Engineering Division, King Abdullah University of Science and Technology, Thuwal, Saudi Arabia (UFRJ), Brazil Reviewed by: Zongze Shao, Autochthonous microorganisms inhabiting hydrocarbon polluted marine environments State Oceanic Administration, China play a fundamental role in natural attenuation and constitute promising resources for Henrique Fragoso Santos, Federal University of Rio de Janeiro bioremediation approaches. Alcanivorax spp. members are ubiquitous in contaminated (UFRJ), Brazil surface waters and are the first to flourish on a wide range of alkanes after an oil-spill. Adriana Ururahy Soriano, Following oil contamination, a transient community of different Alcanivorax spp. develop, Petrobras (Petróleo Brasileiro S. A.), Brazil but whether they use a similar physiological, cellular and transcriptomic response to *Correspondence: hydrocarbon substrates is unknown. In order to identify which cellular mechanisms are Nico Boon implicated in alkane degradation, we investigated the response of two isolates belonging [email protected] Sara Borin to different Alcanivorax species, A.
    [Show full text]
  • An Impaired Metabolic Response to Hydrostatic Pressure Explains
    www.nature.com/scientificreports OPEN An impaired metabolic response to hydrostatic pressure explains Alcanivorax borkumensis recorded Received: 25 February 2016 Accepted: 18 July 2016 distribution in the deep marine Published: 12 August 2016 water column Alberto Scoma1, Marta Barbato2, Sara Borin2, Daniele Daffonchio2,3 & Nico Boon1 Alcanivorax borkumensis is an ubiquitous model organism for hydrocarbonoclastic bacteria, which dominates polluted surface waters. Its negligible presence in oil-contaminated deep waters (as observed during the Deepwater Horizon accident) raises the hypothesis that it may lack adaptive mechanisms to hydrostatic pressure (HP). The type strain SK2 was tested under 0.1, 5 and 10 MPa (corresponding to surface water, 500 and 1000 m depth, respectively). While 5 MPa essentially inactivated SK2, further increase to 10 MPa triggered some resistance mechanism, as indicated by higher total and intact cell numbers. Under 10 MPa, SK2 upregulated the synthetic pathway of the osmolyte ectoine, whose concentration increased from 0.45 to 4.71 fmoles cell−1. Central biosynthetic pathways such as cell replication, glyoxylate and Krebs cycles, amino acids metabolism and fatty acids biosynthesis, but not β-oxidation, were upregulated or unaffected at 10 MPa, although total cell number was remarkably lower with respect to 0.1 MPa. Concomitantly, expression of more than 50% of SK2 genes was downregulated, including genes related to ATP generation, respiration and protein translation. Thus, A. borkumensis lacks proper adaptation to HP but activates resistance mechanisms. These consist in poorly efficient biosynthetic rather than energy-yielding degradation-related pathways, and suggest that HP does represent a major driver for its distribution at deep-sea.
    [Show full text]