DOCSLIB.ORG

V12a145-Riazuddin Pgmkr

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
V12a145-Riazuddin Pgmkr http://www.paper.edu.cn Molecular Vision 2006; 12:1283-91 <http://www.molvis.org/molvis/v12/a145/> ©2006 Molecular Vision Received 10 March 2006 | Accepted 28 August 2006 | Published 26 October 2006 Mutations in the gene encoding the ααα-subunit of rod phosphodiesterase in consanguineous Pakistani families S. Amer Riazuddin,1,2 Fareeha Zulfiqar,2 Qingjiong Zhang,1 Wenliang Yao,1 Shouling Li,1 Xiaodong Jiao,1 Amber Shahzadi,2 Muhammad Amer,2 Muhammad Iqbal,2 Tayyab Hussnain,2 Paul Sieving,1 Sheikh Riazuddin,2 J. Fielding Hejtmancik1 (The first three and last two authors contributed equally to this publication). 1Ophthalmic Genetics and Visual Function Branch, National Eye Institute, National Institutes of Health, Bethesda, MD; 2Center of Excellence in Molecular Biology, University of the Punjab, Lahore Pakistan Purpose: To localize and identify the gene and mutations causing autosomal recessive retinitis pigmentosa (RP) in con- sanguineous Pakistani families. Methods: Families were ascertained and patients underwent complete ophthalmological examinations. Blood samples were collected and DNA was extracted. A genome-wide scan was performed using 382 polymorphic microsatellite mark- ers on genomic DNA from affected and unaffected family members, and lod scores were calculated. Results: A genome-wide scan of 50 families gave a lod score of 7.4172 with D5S2015 using HOMOG1. RP in all 4 linked families mapped to a 13.85 cM (14.87 Mb) region on chromosome 5q31-33 flanked by D5S2090 and D5S422. This region harbors the PDE6A gene, which is known to cause autosomal recessive RP. Sequencing of PDE6A showed a homozygous single base pair change; c.889C->T, single base pair insertion; c.2218-2219insT, and single base pair substitution in the splice acceptor site; IVS10-2A->G in each of three families. In the fourth family linked to this region, no disease-causing mutation was identified in the PDE6A gene. Conclusions: These results provide strong evidence that mutations in PDE6A result in recessive RP in three consanguin- eous Pakistani families. Although a fourth family was linked to markers in the 5q31-33 interval, no mutation was identi- fied in PDE6A. Retinis pigmentosa (RP) is the most common inherited RP (adRP) represents 15-20% of all cases; autosomal reces- retinal dystrophy, affecting approximately 1 in 5000 individuals sive RP (arRP) comprises 20-25% of cases (syndromic and worldwide [1,2]. RP primarily affects the rod photoreceptors, nonsyndromic); X-linked recessive RP makes up 10-15%, and whereas the function of the cone receptors is compromised as the remaining 40-55% of cases, in which family history is the disease progresses [3]. Ocular findings comprise atrophic absent, are called simplex RP (SRP), but many of these may changes of the photoreceptors and retinal pigment epithelium represent autosomal recessive RP [5-8]. (RPE) followed by appearance of melanin-containing struc- cGMP phosphodiesterase in the retinal rod cells is a key tures in the retinal vascular layer. Typical fundus appearance phototransduction enzyme. It is a heterotetrameric protein includes attenuated arterioles, bone-spicule pigmentation, and consisting of an α, β, and two γ subunits. As RP is primarily a waxy pallor of the optic disc. Affected individuals often have disease of rods, the components of the phototransduction cas- severely abnormal or nondetectable rod responses in the elec- cade are a primesite suspect as for the defect in RP. Huang et troretinograms (ERG) recordings even in the early stage of al. identified mutations (one homozygous and one compound the disease [3]. heterozygous) in the cGMP phosphodiesterase (NM_000440, RP may be inherited as an autosomal recessive, autoso- PDE6A, MIM 180071) gene in 2 autosomal recessive pedi- mal dominant, or as an X-linked recessive trait. To date, 39 grees while screening 340 unrelated patients with RP [9]. loci have been implicated in nonsyndromic RP, of which 30 Here we report four consanguineous Pakistani families genes are known [4]. These include genes encoding compo- with multiple individuals affected by arRP. Clinical findings nents of the phototransduction cascade, proteins involved in in these families are typical of early onset RP. Linkage analy- retinoid metabolism, cell-cell interaction proteins, photorecep- sis showed linkage to chromosome 5q31-33, a region includ- tor structural proteins, transcription factors, intracellular trans- ing PDE6A. Sequencing of PDE6A showed a homozygous port proteins and splicing factors [4]. Autosomal dominant single base pair change (c.889C->T), single base pair inser- tion (c.2218-2219insT), and a single base pair substitution in Correspondence to: J. Fielding Hejtmancik, M.D., PhD, OGVFB/ the splice acceptor site (IVS10-2A->G) in each of three fami- NEI/NIH, Building 10, Room 10B10, 10 Center Drive MSC 1860, lies. In the fourth family, in which the RP was linked to this Bethesda, MD, 20892-1860; Phone: 301-496-8300; FAX: 301-435- region, we did not identify any disease-causing mutation in 1598; email: [email protected] the PDE6A gene. 1283 转载 中国科技论文在线 http://www.paper.edu.cn Molecular Vision 2006; 12:1283-91 <http://www.molvis.org/molvis/v12/a145/> ©2006 Molecular Vision METHODS The PCR primers for each exon were used for bidirectional Patient ascertainment: We recruited 50 consanguineous Pa- sequencing using BigDye Terminator Ready reaction mix ac- kistani families with nonsyndromic RP to participate in a col- cording to the manufacturer’s instructions (Applied laborative study between the Center of Excellence in Molecu- Biosystems). Sequencing products were resuspended in 10 ml lar Biology, Lahore, Pakistan and the National Eye Institute, of formamide (Applied Biosystems) and denatured at 95 °C Bethesda, Maryland. Our plan was to identify new disease for 5 min. Sequencing was performed on an ABI PRISM 3100 loci causing inherited vision diseases. Institutional review Automated sequencer (Applied Biosystems). Sequencing re- board (IRB) approval was obtained for this study from the sults were assembled and analyzed using the Seqman program National Eye Institute, Bethesda, MD, USA and the Center of of DNASTAR Software (DNASTAR Inc, Madison, WI). Excellence in Molecular Biology, Lahore, Pakistan. The par- ticipating subjects gave informed written consent, consistent RESULTS with the tenets of the Declaration of Helsinki. The families All affected individuals examined in all three families fit the described in this study are from the Punjab province of Paki- diagnostic criteria of RP. Fundus photographs of affected in- stan. A detailed medical history was obtained by interviewing dividuals showed typical changes of RP including a waxy pale family members. Fundus photographs of affected individuals optic disc, attenuation of retinal arteries, and bone-spicule pig- showed changes typical of RP, including waxy pale optic discs, ment deposits in the mid periphery of the retina as shown in attenuation of retinal arteries, and bone-spicule pigment de- Figure 1A-C. None of the unaffected individuals in either of posits in the mid periphery of the retina. Affected individuals four families complained of night blindness. Affected indi- had typical RP changes on ERG including loss of both the rod viduals had typical RP changes on ERG including loss of both and cone responses. Blood samples were collected from af- the rod and cone responses (Figure 2), while parents showed fected and unaffected family members. DNA was extracted no changes consistent with RP. As these families reside in re- by following a nonorganic method described by Grimberg et mote parts of Punjab province of Pakistan, the clinical records al. [10]. pertaining to the disease onset were not available. However, Genotyping and linkage analysis: A genome-wide scan was performed with 382 highly polymorphic fluorescent mark- ers from the ABI PRISM Linkage Mapping Set MD-10 (PE TABLE 1. LIST OF PRIMERS FOR SEQUENCING PDE6A GENE Applied Biosystems, Foster City, CA) having an average spac- Annealing temperature ing of 10 cM. Multiplex polymerase chain reactions (PCR) Exon Forward primer Reverse primer (°C) -------- ------------------------- -------------------- ----------- were carried out by following guidelines given in the refer- Promoter TGGACAGAGAAGCCAAACAA TTCTCCACCTCCTCTGCTGT 65 ence [11]. PCR products from each DNA sample were pooled 1a CCAGACTGGACTTGTTGCAG GAACAGGCTCATGCGGTCT 65 and mixed with a loading cocktail containing HD-400 size 1b TGGAGGAGAGCGAAATCATC ACCTGTACCCCAGAACTCCA 65 standards (PE Applied Biosystems) and loading dye. The re- 2 CCGTTCCACTGTTCTTGCTC GCAAAGTTCAGGGGACTTCA 65 sulting PCR products were separated on a 5% Long Ranger 3 GCCAGAGGATGGATTTCTTC TAGGCACCTTCATTCCCATC 65 denaturing urea-polyacrylamide gel in an ABI 377 DNA se- quencer and analyzed by using GENESCAN 3.1 and 4 TTGTTGTTATTCTCCAGCTAAGTG TTGAATGTGTGCCAAGACTC 65 GENOTYPER 2.1 software packages(PE Applied 5 GACTCATGGAGGTGGGACAT AGACAACCCAACGCAAAGAC 65 Biosystems). 6 AGATCAAGCCATTGCACTCC TTGCCCAATTCCAGAATCAC 65 Two point linkage analyses were performed using the 7 TGTAAGCAGGTGCTGAGAGC TCTTTCTTCCACGTGATCCA 65 FASTLINK version of MLINK from the LINKAGE Program 8 CCTTGGACAAGAACATGGTG CAGCAGAGTGGGTGGATTCT 65 Package [12,13]. Maximum lod scores were calculated using 9 TATCATCGTTGCCTCTGTGG TGTGATAGCGCAGTGACACC 65 ILINK. Autosomal recessive RP was analyzed as a fully pen- 10 GGCAGCACACAGCTTATCAA ACAGTGCACAAACCCATGC 65 etrant trait with an affected allele frequency of 0.001. The 11 GTTGCAAGGACTTTGGAGGA ATGCTTTGCAAGGAGAAACC
Load more

Recommended publications
  • RPE65 Mutant Dog/ Leber Congenital Amaurosis
    Rpe65 mutant dogs Pde6A mutant dogs Cngb1 mutant dogs rAAV RPE65 Mutant Dog/ Leber Congenital Amaurosis Null mutation in Rpe65 retinal function (ERG & dim light vision) Failure of 11-cis retinal supply to photoreceptors (visual cycle) Retina only slow degeneration (S-cones and area centralis degeneration – variable) RPE lipid inclusions 8 Mo 3.5 yr The Visual (Retinoid) Cycle retinal pigment All-trans-retinol epithelium (Vitamin A) RPE65 11-cis-retinal Visual pigments All-trans-retinal rod and cone outer segments All-trans-retinol Gene supplementation therapy for RPE65 Leber Congenital Amaurosis Initial trials in dogs – very successful Outcome in humans Some improvement in visual function Appears to not preserve photoreceptors in longer term Questions Is there preservation of photoreceptors? Why is outcome in humans not so successful? Does RPE65 Gene Therapy Preserve Photoreceptors? Rpe65-/- dogs: Early loss of S-cones Slow LM cone loss Very slow rod loss Exception – region of high density of photoreceptors – rapid loss Gene therapy preservation of photoreceptors Limitations to Human Functional Rescue and Photoreceptor Preservation Hypothesis The dose of gene therapy delivered is a limiting factor for the efficacy of treatment Specific aim To compare the clinical efficacy and the levels of expression of RPE65 protein and the end product of RPE65 function (11-cis retinal) of various doses of RPE65 gene therapy in Rpe65 -/- dogs Methods Tested total dose of 8x108 to 1x1011 vg/eye ERG Scotopic b wave Vision testing % correct choice RPE65 protein expression Dose of gene therapy +/+ 8x108 4x109 2x1010 1x1011 RPE65 GAPDH RPE65 protein expression RPE65/DAPI/ autofluorescence Chromophore levels 11-cis retinal levels undetectable In Rpe65 -/- All-trans retinal Chromophore vs clinical outcomes Scotopic b wave r2 = 0.91 p < 0.0001 Vision testing % correct choice r2 = 0.58 p = 0.02 RPE65 gene expression Human vs.
    [Show full text]
  • A Multistep Bioinformatic Approach Detects Putative Regulatory
    BMC Bioinformatics BioMed Central Research article Open Access A multistep bioinformatic approach detects putative regulatory elements in gene promoters Stefania Bortoluzzi1, Alessandro Coppe1, Andrea Bisognin1, Cinzia Pizzi2 and Gian Antonio Danieli*1 Address: 1Department of Biology, University of Padova – Via Bassi 58/B, 35131, Padova, Italy and 2Department of Information Engineering, University of Padova – Via Gradenigo 6/B, 35131, Padova, Italy Email: Stefania Bortoluzzi - [email protected]; Alessandro Coppe - [email protected]; Andrea Bisognin - [email protected]; Cinzia Pizzi - [email protected]; Gian Antonio Danieli* - [email protected] * Corresponding author Published: 18 May 2005 Received: 12 November 2004 Accepted: 18 May 2005 BMC Bioinformatics 2005, 6:121 doi:10.1186/1471-2105-6-121 This article is available from: http://www.biomedcentral.com/1471-2105/6/121 © 2005 Bortoluzzi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results: Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences.
    [Show full text]
  • Novel Variants in Phosphodiesterase 6A and Phosphodiesterase 6B Genes and Its Phenotypes in Patients with Retinitis Pigmentosa in Chinese Families
    Novel Variants in Phosphodiesterase 6A and Phosphodiesterase 6B Genes and Its Phenotypes in Patients With Retinitis Pigmentosa in Chinese Families Yuyu Li Beijing Tongren Hospital, Capital Medical University Ruyi Li Beijing Tongren Hospital, Capital Medical University Hehua Dai Beijing Tongren Hospital, Capital Medical University Genlin Li ( [email protected] ) Beijing Tongren Hospital, Capital Medical University Research Article Keywords: Retinitis pigmentosa, PDE6A,PDE6B, novel variants, phenotypes Posted Date: May 20th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-507306/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/15 Abstract Background: Retinitis pigmentosa (RP) is a genetically heterogeneous disease with 65 causative genes identied to date. However, only approximately 60% of RP cases genetically solved to date, predicating that many novel disease-causing variants are yet to be identied. The purpose of this study is to identify novel variants in phosphodiesterase 6A and phosphodiesterase 6B genes and present its phenotypes in patients with retinitis pigmentosa in Chinese families. Methods: Five retinitis pigmentosa patients with PDE6A variants and three with PDE6B variants were identied through a hereditary eye disease enrichment panel (HEDEP), all patients’ medical and ophthalmic histories were collected, and ophthalmological examinations were performed, then we analysed the possible causative variants. Sanger sequencing was used to verify the variants. Results: We identied 20 mutations sites in eight patients, two heterozygous variants were identied per patient of either PDE6A or PDE6B variants, others are from CA4, OPTN, RHO, ADGRA3 variants. We identied two novel variants in PDE6A: c.1246G > A;p.(Asp416Asn) and c.1747T > A;p.(Tyr583Asn).
    [Show full text]
  • Gene Therapy Provides Long-Term Visual Function in a Pre-Clinical Model of Retinitis Pigmentosa Katherine J. Wert Submitted in P
    Gene Therapy Provides Long-term Visual Function in a Pre-clinical Model of Retinitis Pigmentosa Katherine J. Wert Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2013 © 2013 Katherine J. Wert All rights reserved ABSTRACT Gene Therapy Provides Long-term Visual Function in a Pre-clinical Model of Retinitis Pigmentosa Katherine J. Wert Retinitis pigmentosa (RP) is a photoreceptor neurodegenerative disease. Patients with RP present with the loss of their peripheral visual field, and the disease will progress until there is a full loss of vision. Approximately 36,000 cases of simplex and familial RP worldwide are caused by a mutation in the rod-specific cyclic guanosine monophosphate phosphodiesterase (PDE6) complex. However, despite the need for treatment, mouse models with mutations in the alpha subunit of PDE6 have not been characterized beyond 1 month of age or used to test the pre- clinical efficacy of potential therapies for human patients with RP caused by mutations in PDE6A. We first proposed to establish the temporal progression of retinal degeneration in a mouse model with a mutation in the alpha subunit of PDE6: the Pde6anmf363 mouse. Next, we developed a surgical technique to enable us to deliver therapeutic treatments into the mouse retina. We then hypothesized that increasing PDE6α levels in the Pde6anmf363 mouse model, using an AAV2/8 gene therapy vector, could improve photoreceptor survival and retinal function when delivered before the onset of degeneration. Human RP patients typically will not visit an eye care professional until they have a loss of vision, therefore we further hypothesized that this gene therapy vector could improve photoreceptor survival and retinal function when delivered after the onset of degeneration, in a clinically relevant scenario.
    [Show full text]
  • Clinical Laboratory Services
    Final Adoption March 19, 2021 101 CMR: EXECUTIVE OFFICE OF HEALTH AND HUMAN SERVICES 101 CMR 320.00: CLINICAL LABORATORY SERVICES Section 320.01: General Provisions 320.02: Definitions 320.03: Covered and Excluded Billing Situations 320.04: General Rate Provisions and Maximum Fees 320.05: Allowable Fees 320.06: Filing and Reporting Requirements 320.07: Severability 320.01: General Provisions (1) Scope and Purpose. 101 CMR 320.00 governs the payment rates for clinical laboratory services rendered to publicly aided individuals. The rates set forth in 101 CMR 320.00 do not apply to individuals covered by M.G.L. c. 152 (the Workers’ Compensation Act). Rates for services rendered to such individuals are set forth in 114.3 CMR 40.00: Rates for Services Under M.G.L. c. 152, Worker’s Compensation Act. (2) Applicable Dates of Service. Rates contained in 101 CMR 320.00 apply for dates of service provided on or after January 1, 2021. (3) Coverage. The payment rates in 101 CMR 320.00 are full compensation for clinical laboratory services rendered to publicly aided individuals. (4) Coding Updates and Corrections. EOHHS may publish procedure code updates and corrections in the form of an administrative bulletin. Updates may reference coding systems including but not limited to the American Medical Association’s Current Procedural Terminology (CPT). The publication of such updates and corrections lists (a) codes for which only the code numbers changed, with the corresponding cross-references between existing and new codes; (b) deleted codes for which there are no corresponding new codes; and (c) codes for entirely new services that require pricing.
    [Show full text]
  • Mutation Causes Progressive Retinal Atrophy in the Cardigan Welsh Corgi Dog
    cGMP Phosphodiesterase-a Mutation Causes Progressive Retinal Atrophy in the Cardigan Welsh Corgi Dog Simon M. Petersen–Jones,1 David D. Entz, and David R. Sargan PURPOSE. To screen the a-subunit of cyclic guanosine monophosphate (cGMP) phosphodiesterase (PDE6A) as a potential candidate gene for progressive retinal atrophy (PRA) in the Cardigan Welsh corgi dog. METHODS. Single-strand conformation polymorphism (SSCP) analysis was used to screen short introns of the canine PDE6A gene for informative polymorphisms in members of an extended pedigree of PRA-affected Cardigan Welsh corgis. After initial demonstration of linkage of a poly- morphism in the PDE6A gene with the disease locus, the complete coding region of the PDE6A gene of a PRA-affected Cardigan Welsh corgi was cloned in overlapping fragments and sequenced. SSCP-based and direct DNA sequencing tests were developed to detect the presence of a PDE6A gene mutation that segregated with disease status in the extended pedigree of PRA-affected Cardigan Welsh corgis. Genomic DNA sequencing was developed as a diagnostic test to establish the genotype of Cardigan Welsh corgis in the pet population. RESULTS. A polymorphism within intron 18 of the canine PDE6A gene was invariably present in the homozygous state in PRA-affected Cardigan Welsh corgis. The entire PDE6A gene was cloned from one PRA-affected dog and the gene structure and intron sizes established and compared with those of an unaffected animal. Intron sizes were identical in affected and normal dogs. Sequencing of exons and splice junctions in the affected animal revealed a 1-bp deletion in codon 616. Analysis of PRA-affected and obligate carrier Cardigan Welsh corgis showed that this mutation cosegregated with disease status.
    [Show full text]
  • Splice-Site Mutations Identified in PDE6A Responsible for Retinitis Pigmentosa in Consanguineous Pakistani Families
    Molecular Vision 2015; 21:871-882 <http://www.molvis.org/molvis/v21/871> © 2015 Molecular Vision Received 1 July 2014 | Accepted 15 August 2015 | Published 18 August 2015 Splice-site mutations identified in PDE6A responsible for retinitis pigmentosa in consanguineous Pakistani families Shahid Y. Khan,1 Shahbaz Ali,2 Muhammad Asif Naeem,2 Shaheen N. Khan,2 Tayyab Husnain,2 Nadeem H. Butt,3 Zaheeruddin A. Qazi,4 Javed Akram,3,5 Sheikh Riazuddin,2,3,5 Radha Ayyagari,6 J. Fielding Hejtmancik,7 S. Amer Riazuddin1 (The first two and last two authors contributed equally to this work.) 1The Wilmer Eye Institute, Johns Hopkins University School of Medicine, Baltimore MD; 2National Centre of Excellence in Molecular Biology, University of the Punjab, Lahore, Pakistan; 3Allama Iqbal Medical College, University of Health Sciences, Lahore, Pakistan; 4Layton Rahmatulla Benevolent Trust Hospital, Lahore Pakistan; 5National Centre for Genetic Diseases, Shaheed Zulfiqar Ali Bhutto Medical University, Islamabad Pakistan;6 Shiley Eye Institute, University of California San Diego, La Jolla CA; 7Ophthalmic Genetics and Visual Function Branch, National Eye Institute, National Institutes of Health, Bethesda MD Purpose: This study was conducted to localize and identify causal mutations associated with autosomal recessive retinitis pigmentosa (RP) in consanguineous familial cases of Pakistani origin. Methods: Ophthalmic examinations that included funduscopy and electroretinography (ERG) were performed to confirm the affectation status. Blood samples were collected from all participating individuals, and genomic DNA was extracted. A genome-wide scan was performed, and two-point logarithm of odds (LOD) scores were calculated. Sanger sequencing was performed to identify the causative variants.
    [Show full text]
  • Phosphodiesterase 6 Subunits Are Expressed and Altered in Idiopathic
    Nikolova et al. Respiratory Research 2010, 11:146 http://respiratory-research.com/content/11/1/146 RESEARCH Open Access Phosphodiesterase 6 subunits are expressed and altered in idiopathic pulmonary fibrosis Sevdalina Nikolova1, Andreas Guenther1,2, Rajkumar Savai1, Norbert Weissmann1, Hossein A Ghofrani1, Melanie Konigshoff3, Oliver Eickelberg3, Walter Klepetko4, Robert Voswinckel1,5, Werner Seeger1,5, Friedrich Grimminger1, Ralph T Schermuly1,5, Soni S Pullamsetti1,5* Abstract Background: Idiopathic Pulmonary Fibrosis (IPF) is an unresolved clinical issue. Phosphodiesterases (PDEs) are known therapeutic targets for various proliferative lung diseases. Lung PDE6 expression and function has received little or no attention. The present study aimed to characterize (i) PDE6 subunits expression in human lung, (ii) PDE6 subunits expression and alteration in IPF and (iii) functionality of the specific PDE6D subunit in alveolar epithelial cells (AECs). Methodology/Principal Findings: PDE6 subunits expression in transplant donor (n = 6) and IPF (n = 6) lungs was demonstrated by real-time quantitative (q)RT-PCR and immunoblotting analysis. PDE6D mRNA and protein levels and PDE6G/H protein levels were significantly down-regulated in the IPF lungs. Immunohistochemical analysis showed alveolar epithelial localization of the PDE6 subunits. This was confirmed by qRT-PCR from human primary alveolar type (AT)II cells, demonstrating the down-regulation pattern of PDE6D in IPF-derived ATII cells. In vitro, PDE6D protein depletion was provoked by transforming growth factor (TGF)-b1 in A549 AECs. PDE6D siRNA- mediated knockdown and an ectopic expression of PDE6D modified the proliferation rate of A549 AECs. These effects were mediated by increased intracellular cGMP levels and decreased ERK phosphorylation. Conclusions/Significance: Collectively, we report previously unrecognized PDE6 expression in human lungs, significant alterations of the PDE6D and PDE6G/H subunits in IPF lungs and characterize the functional role of PDE6D in AEC proliferation.
    [Show full text]
  • Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss
    cells Review Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss 1, 1, 1 1,2,3 1 Gayle B. Collin y, Navdeep Gogna y, Bo Chang , Nattaya Damkham , Jai Pinkney , Lillian F. Hyde 1, Lisa Stone 1 , Jürgen K. Naggert 1 , Patsy M. Nishina 1,* and Mark P. Krebs 1,* 1 The Jackson Laboratory, Bar Harbor, Maine, ME 04609, USA; [email protected] (G.B.C.); [email protected] (N.G.); [email protected] (B.C.); [email protected] (N.D.); [email protected] (J.P.); [email protected] (L.F.H.); [email protected] (L.S.); [email protected] (J.K.N.) 2 Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand 3 Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand * Correspondence: [email protected] (P.M.N.); [email protected] (M.P.K.); Tel.: +1-207-2886-383 (P.M.N.); +1-207-2886-000 (M.P.K.) These authors contributed equally to this work. y Received: 29 February 2020; Accepted: 7 April 2020; Published: 10 April 2020 Abstract: Inherited retinal degeneration (RD) leads to the impairment or loss of vision in millions of individuals worldwide, most frequently due to the loss of photoreceptor (PR) cells. Animal models, particularly the laboratory mouse, have been used to understand the pathogenic mechanisms that underlie PR cell loss and to explore therapies that may prevent, delay, or reverse RD. Here, we reviewed entries in the Mouse Genome Informatics and PubMed databases to compile a comprehensive list of monogenic mouse models in which PR cell loss is demonstrated.
    [Show full text]
  • Exclusion of the PDE6A Gene for Generalised Progressive Retinal Atrophy in 11 Breeds of Dog G Dekomien, J T Epplen
    Animal Genetics, SHORT COMMUNICATION 2000, 31, 135±139 Exclusion of the PDE6A gene for generalised progressive retinal atrophy in 11 breeds of dog G Dekomien, J T Epplen Summary The critical effector enzyme of the visual cascade is cGMP PDE, a heterotetrameric pro- The cyclic guanosine monophosphate specific tein attached to the disc membrane. PDE phosphodiesterase (cGMP-specific PDE) is a hydrolyses 39,59-cGMP to 59-GMP. PDE6A and key enzyme in the phototransduction cascade PDE6B are catalytic subunits, that are com- of the vertebrate retina. This enzyme consists plexed as dimers in rods while in cones PDEA of two catalytic a and b subunits, two homodimers exist. Both, the PDE6A and PDE6B identical inhibitory g subunits as well as a d genes show mutations leading to RP in humans subunit. Mutations in PDE6A and the PDE6B (Danciger et al. 1995; Huang et al. 1995; genes lead to autosomal recessive (ar) forms of McLaughlin et al. 1993). RP represents a geneti- retinitis pigmentosa (RP) in human and to the cally heterogeneous progressive photoreceptor homologous disease in dogs, designated gen- degeneration in man which always ends in eralised progressive retinal atrophy (gPRA). blindness. The disease is transmitted according We investigated the PDE6A gene in 13 gPRA- to different modes of inheritance: autosomal affected dog breeds including healthy animals, dominant (adRP) and recessive (arRP), X-linked obligate gPRA carriers and gPRA-affected dogs. (XLRP), digenic as well as maternal. The In the coding region of PDE6A only a rare homologous group of photoreceptor degenera- sequence variation (G103A; Asp35Asn) was tion is designated as gPRA in dogs.
    [Show full text]
  • Characterization of a Canine Model of Autosomal Recessive Retinitis Pigmentosa Due to a PDE6A Mutation
    Characterization of a Canine Model of Autosomal Recessive Retinitis Pigmentosa due to a PDE6A Mutation Nalinee Tuntivanich,1,2 Steven J. Pittler,3 Andy J. Fischer,4 Ghezal Omar,4 Matti Kiupel,5 Arthur Weber,6 Suxia Yao,3 Juan Pedro Steibel,7 Naheed Wali Khan,8 and Simon M. Petersen-Jones1 PURPOSE. To characterize a canine model of autosomal reces- rogressive retinal atrophy (PRA) is the canine equivalent of sive RP due to a PDE6A gene mutation. Pretinitis pigmentosa (RP) in humans. Typically, RP and PRA METHODS. Affected and breed- and age-matched control pup- cause a rod-led retinal degeneration leading to significant visual pies were studied by electroretinography (ERG), light and impairment. The age at onset and rate of retinal degeneration electron microscopy, immunohistochemistry, and assay for ret- varies between the different forms of the conditions. Both PRA inal PDE6 levels and enzymatic activity. and RP show genetic heterogeneity with autosomal recessive, autosomal dominant, and X-linked forms being recognized in RESULTS. The mutant puppies failed to develop normal rod- both species. Currently, there are 21 genes that have been mediated ERG responses and had reduced light-adapted a-wave shown to be mutated in autosomal recessive RP and an addi- amplitudes from an early age. The residual ERG waveforms tional five mapped loci identified (RetNet; http://www.sph. originated primarily from cone-driven responses. Development uth.tmc.edu/retnet/ provided in the public domain by the of photoreceptor outer segments stopped, and rod cells were University of Texas Houston Health Science Center, Houston, lost by apoptosis.
    [Show full text]
  • Phosphodiesterase 1 (Pde1) at the Crossroads of Calcium And
    PHOSPHODIESTERASE 1 (PDE1) AT THE CROSSROADS OF CALCIUM AND CYCLIC NUCLEOTIDE SIGNALING IN DIABETIC NEPHROPATHY by Asim Bikash Dey A Dissertation Submitted to the Faculty of Purdue University In Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy Department of Biology Indianapolis, Indiana May 2020 THE PURDUE UNIVERSITY GRADUATE SCHOOL STATEMENT OF COMMITTEE APPROVAL Dr. Simon J. Atkinson Department of Biology Dr. Mark C. Kowala Eli Lilly and Company Dr Ruben C. Aguilar Purdue University Dr. Guoli Dai Department of Biology Dr. Anthony J. Baucum II Department of Biology Approved by: Dr. Theodore R. Cummins Head of the Graduate Program 2 Dedicated to my family 3 ACKNOWLEDGMENTS I greatly appreciate Dr. Simon Atkinson at IUPUI and Dr. Mark Kowala at Eli Lilly and Company, my supervisors, for their support and encouragement throughout my graduate work in parallel to my day job. Their unrelenting support and profound belief in me have been instrumental in completing this work. Special thanks to Dr. Kowala for his flexibility that made it easier to juggle graduate work and the demands of a full-time job. I’m deeply indebted to Dr. Mark Rekhter whose unconditional support at all stages of my thesis made this a reality. Your insightful comments and input have helped me develop my critical analytical skills and help me become a better scientist. Completion of my experiments would not have been possible without your critical input, technical assistance and constant support over the last several years. I also would like to thank my committee members, Dr. Guoli Dai, Dr.
    [Show full text]