V12a145-Riazuddin Pgmkr

http://www.paper.edu.cn

Mutations in the gene encoding the ααα-subunit of rod phosphodiesterase in consanguineous Pakistani families

S. Amer Riazuddin,1,2 Fareeha Zulfiqar,2 Qingjiong Zhang,1 Wenliang Yao,1 Shouling Li,1 Xiaodong Jiao,1 Amber Shahzadi,2 Muhammad Amer,2 Muhammad Iqbal,2 Tayyab Hussnain,2 Paul Sieving,1 Sheikh Riazuddin,2 J. Fielding Hejtmancik1

(The first three and last two authors contributed equally to this publication).

1Ophthalmic Genetics and Visual Function Branch, National Eye Institute, National Institutes of Health, Bethesda, MD; 2Center of Excellence in Molecular Biology, University of the Punjab, Lahore Pakistan

Purpose: To localize and identify the gene and mutations causing autosomal recessive retinitis pigmentosa (RP) in consanguineous Pakistani families. Methods: Families were ascertained and patients underwent complete ophthalmological examinations. Blood samples were collected and DNA was extracted. A genome-wide scan was performed using 382 polymorphic microsatellite markers on genomic DNA from affected and unaffected family members, and lod scores were calculated. Results: A genome-wide scan of 50 families gave a lod score of 7.4172 with D5S2015 using HOMOG1. RP in all 4 linked families mapped to a 13.85 cM (14.87 Mb) region on chromosome 5q31-33 flanked by D5S2090 and D5S422. This region harbors the PDE6A gene, which is known to cause autosomal recessive RP. Sequencing of PDE6A showed a homozygous single base pair change; c.889C->T, single base pair insertion; c.2218-2219insT, and single base pair substitution in the splice acceptor site; IVS10-2A->G in each of three families. In the fourth family linked to this region, no disease-causing mutation was identified in the PDE6A gene. Conclusions: These results provide strong evidence that mutations in PDE6A result in recessive RP in three consanguineous Pakistani families. Although a fourth family was linked to markers in the 5q31-33 interval, no mutation was identified in PDE6A.

Retinis pigmentosa (RP) is the most common inherited RP (adRP) represents 15-20% of all cases; autosomal reces- retinal dystrophy, affecting approximately 1 in 5000 individuals sive RP (arRP) comprises 20-25% of cases (syndromic and worldwide [1,2]. RP primarily affects the rod photoreceptors, nonsyndromic); X-linked recessive RP makes up 10-15%, and whereas the function of the cone receptors is compromised as the remaining 40-55% of cases, in which family history is the disease progresses [3]. Ocular findings comprise atrophic absent, are called simplex RP (SRP), but many of these may changes of the photoreceptors and retinal pigment epithelium represent autosomal recessive RP [5-8]. (RPE) followed by appearance of melanin-containing struc- cGMP phosphodiesterase in the retinal rod cells is a key tures in the retinal vascular layer. Typical fundus appearance phototransduction enzyme. It is a heterotetrameric protein includes attenuated arterioles, bone-spicule pigmentation, and consisting of an α, β, and two γ subunits. As RP is primarily a waxy pallor of the optic disc. Affected individuals often have disease of rods, the components of the phototransduction cas- severely abnormal or nondetectable rod responses in the elec- cade are a primesite suspect as for the defect in RP. Huang et troretinograms (ERG) recordings even in the early stage of al. identified mutations (one homozygous and one compound the disease [3]. heterozygous) in the cGMP phosphodiesterase (NM_000440, RP may be inherited as an autosomal recessive, autoso- PDE6A, MIM 180071) gene in 2 autosomal recessive pedi- mal dominant, or as an X-linked recessive trait. To date, 39 grees while screening 340 unrelated patients with RP [9]. loci have been implicated in nonsyndromic RP, of which 30 Here we report four consanguineous Pakistani families genes are known [4]. These include genes encoding compo- with multiple individuals affected by arRP. Clinical findings nents of the phototransduction cascade, proteins involved in in these families are typical of early onset RP. Linkage analy- retinoid metabolism, cell-cell interaction proteins, photorecep- sis showed linkage to chromosome 5q31-33, a region includ- tor structural proteins, transcription factors, intracellular trans- ing PDE6A. Sequencing of PDE6A showed a homozygous port proteins and splicing factors [4]. Autosomal dominant single base pair change (c.889C->T), single base pair insertion (c.2218-2219insT), and a single base pair substitution in Correspondence to: J. Fielding Hejtmancik, M.D., PhD, OGVFB/ the splice acceptor site (IVS10-2A->G) in each of three fami- NEI/NIH, Building 10, Room 10B10, 10 Center Drive MSC 1860, lies. In the fourth family, in which the RP was linked to this Bethesda, MD, 20892-1860; Phone: 301-496-8300; FAX: 301-435- region, we did not identify any disease-causing mutation in 1598; email: [email protected] the PDE6A gene. 1283 转载中国科技论文在线 http://www.paper.edu.cn

METHODS The PCR primers for each exon were used for bidirectional Patient ascertainment: We recruited 50 consanguineous Pa- sequencing using BigDye Terminator Ready reaction mix ac- kistani families with nonsyndromic RP to participate in a col- cording to the manufacturer’s instructions (Applied laborative study between the Center of Excellence in Molecu- Biosystems). Sequencing products were resuspended in 10 ml lar Biology, Lahore, Pakistan and the National Eye Institute, of formamide (Applied Biosystems) and denatured at 95 °C Bethesda, Maryland. Our plan was to identify new disease for 5 min. Sequencing was performed on an ABI PRISM 3100 loci causing inherited vision diseases. Institutional review Automated sequencer (Applied Biosystems). Sequencing re- board (IRB) approval was obtained for this study from the sults were assembled and analyzed using the Seqman program National Eye Institute, Bethesda, MD, USA and the Center of of DNASTAR Software (DNASTAR Inc, Madison, WI). Excellence in Molecular Biology, Lahore, Pakistan. The par- ticipating subjects gave informed written consent, consistent RESULTS with the tenets of the Declaration of Helsinki. The families All affected individuals examined in all three families fit the described in this study are from the Punjab province of Paki- diagnostic criteria of RP. Fundus photographs of affected in- stan. A detailed medical history was obtained by interviewing dividuals showed typical changes of RP including a waxy pale family members. Fundus photographs of affected individuals optic disc, attenuation of retinal arteries, and bone-spicule pig- showed changes typical of RP, including waxy pale optic discs, ment deposits in the mid periphery of the retina as shown in attenuation of retinal arteries, and bone-spicule pigment de- Figure 1A-C. None of the unaffected individuals in either of posits in the mid periphery of the retina. Affected individuals four families complained of night blindness. Affected indi- had typical RP changes on ERG including loss of both the rod viduals had typical RP changes on ERG including loss of both and cone responses. Blood samples were collected from af- the rod and cone responses (Figure 2), while parents showed fected and unaffected family members. DNA was extracted no changes consistent with RP. As these families reside in re- by following a nonorganic method described by Grimberg et mote parts of Punjab province of Pakistan, the clinical records al. [10]. pertaining to the disease onset were not available. However, Genotyping and linkage analysis: A genome-wide scan was performed with 382 highly polymorphic fluorescent markers from the ABI PRISM Linkage Mapping Set MD-10 (PE TABLE 1. LIST OF PRIMERS FOR SEQUENCING PDE6A GENE Applied Biosystems, Foster City, CA) having an average spac- Annealing temperature ing of 10 cM. Multiplex polymerase chain reactions (PCR) Exon Forward primer Reverse primer (°C) ------were carried out by following guidelines given in the refer- Promoter TGGACAGAGAAGCCAAACAA TTCTCCACCTCCTCTGCTGT 65 ence [11]. PCR products from each DNA sample were pooled 1a CCAGACTGGACTTGTTGCAG GAACAGGCTCATGCGGTCT 65 and mixed with a loading cocktail containing HD-400 size 1b TGGAGGAGAGCGAAATCATC ACCTGTACCCCAGAACTCCA 65 standards (PE Applied Biosystems) and loading dye. The re- 2 CCGTTCCACTGTTCTTGCTC GCAAAGTTCAGGGGACTTCA 65 sulting PCR products were separated on a 5% Long Ranger 3 GCCAGAGGATGGATTTCTTC TAGGCACCTTCATTCCCATC 65 denaturing urea-polyacrylamide gel in an ABI 377 DNA sequencer and analyzed by using GENESCAN 3.1 and 4 TTGTTGTTATTCTCCAGCTAAGTG TTGAATGTGTGCCAAGACTC 65 GENOTYPER 2.1 software packages(PE Applied 5 GACTCATGGAGGTGGGACAT AGACAACCCAACGCAAAGAC 65 Biosystems). 6 AGATCAAGCCATTGCACTCC TTGCCCAATTCCAGAATCAC 65 Two point linkage analyses were performed using the 7 TGTAAGCAGGTGCTGAGAGC TCTTTCTTCCACGTGATCCA 65 FASTLINK version of MLINK from the LINKAGE Program 8 CCTTGGACAAGAACATGGTG CAGCAGAGTGGGTGGATTCT 65 Package [12,13]. Maximum lod scores were calculated using 9 TATCATCGTTGCCTCTGTGG TGTGATAGCGCAGTGACACC 65

ILINK. Autosomal recessive RP was analyzed as a fully pen- 10 GGCAGCACACAGCTTATCAA ACAGTGCACAAACCCATGC 65 etrant trait with an affected allele frequency of 0.001. The 11 GTTGCAAGGACTTTGGAGGA ATGCTTTGCAAGGAGAAACC 65 marker order and distances between the markers were obtained 12 TCTGATCCTTCCAGCAGACC CACAGAGGAACAGCGTGTCT 65 from the Genethon database and the National Center for Bio- 13 GGCCATGCCTTCTTCATATT CAACGCTGTTGCTACCATGT 65 technology Information (NCBI) chromosome 5 sequence 14 CTCCTTACACCCGCCTTTTC CCACAAGACTTCCCTGTTGG 65 maps. For the initial genome scan equal, allele frequencies 15 TCACTTGTGGAGAAGGCTGA GCCAATGGGAAGAATGCTC 65 were assumed, while for fine mapping, allele frequencies were estimated from 96 unrelated and unaffected individuals from 16 CCATTGGTAGGTGGGTGACT CCTGGGCAACAGAGTGAGAT 65 the Punjab province of Pakistan. Admixture analysis was car- 17 GCCAATGTTAGCAGCTCAGG GCAAGAGCTGTCAGTGCATC 65 ried out using the HOMOG1 program [14] comparing linkage 18 GGGTGGAGAAAGGTGAGAGA AGTCCAAGCCTCATGACCTG 69 to D5S2015 at θ’s of 0.001, 0.01 0.02, 0.03, 0.04, 0.05, 0.06, 19 AGCAGGGGTAGGGGATTG CTCCATCATGGCGAGGTC 65 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, and 0.4 with absence of linkage. 20 TGCTTCATAGATAGGGTAGGTTTC CTGGTCACCTGCTAGGGTTT 65 Mutation screening: Individual exons of PDE6A were 21 GCTACTCCGAAGCAGCTCAT CACACACAGAATGGGGACAG 65 amplified by PCR using primer pairs as shown in Table 1. 22 GTCAAAGGGGAAGCCCACT GGTCTTCCACTGGCTTGAGT 61 Amplifications were carried out as described [15]. The PCR Conditions for PCR amplifications are described in Methods. An- products were analyzed on 2% agarose gel and were purified nealing temperature for each primer pair is given. by vacuum filtration manifold plate (Millipore, Billerica, MA). 1284 中国科技论文在线 http://www.paper.edu.cn

Figure 1. Fundus photograps of affected individuals. Funduscopy photographs of (A) individual 20 of family 61019 (affected 18 year old, B) individual 12 of family 61021 (affected 33 year old) and (C) individual 10 of family 61074 (affected 25 year old). There are changes typical of retinitis pigmentosa including attenuation of retinal arteries and bone-spicule pigment deposits in the mid periphery of the retina. 1285 中国科技论文在线 http://www.paper.edu.cn

Molecular Vision 2006; 12:1283-91 ©2006 Molecular Vision the clinical records of the affected individuals available to us marker with families 61074 and 61081, respectively. did suggest there was no intrafamilial variability. For fine mapping additional markers, D5S2090, D5S812, A genome-wide scan was performed using a set of 382 D5S2015, D5S2013 and D5S1469 from the Genethon data- polymorphic markers spanning the human genome at approxi- base were analyzed as shown in Table 2 (panels A-D) and mately 10 cM intervals (ABI Linkage Mapping Set MD10, Figure 3A-D. Two point linkage analyses gave further evi- Version 2.5). During the genome-wide scan, cosegregation of dence for linkage to markers on chromosome 5q31-33 with RP with alleles of a microsatellite marker, D5S410, was noted maximum lod scores of 3.96 with D5S2013, and D5S1469 at in families 61019, 61021, 61074, and 61081 and marker, θ=0 and 3.75 with D5S2090 at θ=0 for family 61019; 3.21 D5S436 in family 61074 and 61081. In the genome-wide scan with D5S2015 at θ=0 and 3.01 with D5S1469 at θ=0 for fam- significantly positive lod scores were obtained with D5S410, ily 61021; 3.39 with D5S1469 at θ=0 and 3.23 with markers showing lod scores of 3.96, 2.54, 1.19, and 3.68 at θ=0 with D5S812 and D5S2015 at θ=0 for family 61074 and 4.0 with families 61019, 61021, 61074 and 61081, respectively and D5S2015 at θ=0 and 4.18 with markers D5S2013 and D5S1469 lod scores of 3.39 and 3.50 at θ=0 with D5S436, an adjacent at θ=0 for family 61081.

Figure 2. Electroretinograms of affected and unaffected individuals. Electroretinogram recordings for individual 10 of Family 61074 (affected 25 year old); right eye, (A) Combined rod and cone response right eye (B) Cone response, left eye (C) Combined rod and cone response right eye (D) Cone response, individual 11 of family 61074 (affected 20 year old); right eye (E) Combined rod and cone response right eye (F) Cone response, Left eye (G) Combined rod and cone response left eye (H) Cone response, individual 12 of family 61074 (affected 15 year old); right eye (I) Combined rod and cone response right eye (J) Cone response and Left eye (K) Combined rod and cone response left eye (L) Cone response and normal control (unaffected 32 year old); right eye (M) Combined rod and cone response right eye (N) Cone response and Left eye (O) Combined rod and cone response right eye (P) Cone response left eye. 1286 中国科技论文在线 http://www.paper.edu.cn

When linkage results from the entire data set were sub- 0.9944, 0.9947, and 0.9991, respectively, while conditional jected to admixture analysis, heterogeneity was suggested with probabilities of linkage for the remaining families are >0.005. a=0.05 and a maximum ln (likelihood) for linkage with het- Taken together, the four linked families localize the arRP gene erogeneity of 17.0596, corresponding to an hlod=7.4172. These to a 13.85 cM (14.87 Mb) region on chromosome 5q31-33 values give a likelihood ratio R=37,750:1 favoring linkage, flanked by D5S2090 and D5S422. and a c2=34.119, corresponding to a p>0.0001 if an asymp- Visual inspection of the haplotypes in this region sup- totic c2 distribution is assumed. The conditional probabilities ported the linkage analysis (Figure 3), localizing the disease of linkage of families 61019, 61021, 61074, 61081 are 0.9922, to a region of chromosome 5q31-33 flanked by D5S2090 and

TABLE 2. TWO POINT LOD SCORES OF 61019, 61021, 61074, AND 61081 FOR CHROMOSOME 5Q31-33 MARKERS

A: Marker cM Mb 0.00 0.01 0.05 0.10 0.20 0.30 0.40 Zmax θmax ------D5S436* 147.49 145.18 -0.47 1.61 2.01 1.93 1.46 0.86 0.33 2.01 0.05 D5S2090 150.34 147.21 3.75 3.67 3.35 2.94 2.09 1.23 0.47 3.75 0.00 D5S812 150.34 148.98 2.83 2.77 2.54 2.24 1.62 1.00 0.45 2.83 0.00 D5S2015 152.62 149.55 3.06 3.00 2.74 2.41 1.72 1.03 0.43 3.06 0.00 D5S2013 152.62 149.56 3.96 3.88 3.57 3.15 2.30 1.43 0.63 3.96 0.00 D5S1469 153.16 149.94 3.96 3.88 3.57 3.15 2.30 1.43 0.63 3.96 0.00 D5S410* 156.47 152.75 3.96 3.89 3.59 3.19 2.36 1.49 0.66 3.96 0.00 D5S422* 164.19 162.08 -0.71 0.84 1.31 1.33 1.06 0.66 0.27 1.34 0.07 D5S400* 174.8 168.83 -0.31 1.24 1.69 1.69 1.36 0.89 0.40 1.71 0.15

B: Marker cM Mb 0.00 0.01 0.05 0.10 0.20 0.30 0.40 Zmax θmax ------D5S436* 147.49 145.18 -inf 1.18 1.65 1.65 1.32 0.86 0.40 1.65 0.10 D5S2090 150.34 147.21 -inf 1.18 1.64 1.64 1.32 0.86 0.39 1.64 0.05 D5S812 150.34 148.98 2.53 2.47 2.25 1.96 1.38 0.82 0.35 2.53 0.00 D5S2015 152.62 149.55 3.21 3.15 2.87 2.52 1.79 1.06 0.43 3.21 0.00 D5S2013 152.62 149.56 2.78 2.72 2.45 2.11 1.40 0.73 0.23 2.78 0.00 D5S1469 153.16 149.94 3.01 2.94 2.68 2.33 1.63 0.93 0.36 3.01 0.00 D5S410* 156.47 152.75 2.54 2.48 2.25 1.97 1.39 0.83 0.36 2.54 0.10 D5S422* 164.19 162.08 -2.08 -0.58 -0.01 0.14 0.15 0.11 0.05 0.17 0.22 D5S400* 174.8 168.83 -10.7 -3.87 -1.92 -1.17 -0.57 -0.31 -0.14 -0.14 0.4

C: Marker cM Mb 0.00 0.01 0.05 0.10 0.20 0.30 0.40 Zmax θmax ------D5S436* 147.49 145.18 3.39 3.34 3.09 2.78 2.12 1.40 0.66 3.39 0.00 D5S2090 150.34 147.21 2.69 2.63 2.39 2.09 1.50 0.93 0.41 2.69 0.00 D5S812 150.34 148.98 3.23 3.17 2.93 2.62 1.95 1.24 0.50 3.23 0.00 D5S2015 152.62 149.55 3.23 3.17 2.93 2.62 1.95 1.24 0.50 3.23 0.00 D5S2013 152.62 149.56 1.19 1.19 1.14 1.02 0.70 0.38 0.13 1.19 0.00 D5S1469 153.16 149.94 3.39 3.34 3.09 2.78 2.12 1.40 0.66 3.39 0.00 D5S410* 156.47 152.75 1.19 1.18 1.14 1.09 0.67 0.37 0.13 1.19 0.00 D5S422* 164.19 162.08 -inf 1.18 1.65 1.66 1.35 0.88 0.34 1.67 0.11 D5S400* 174.8 168.83 -inf -2.65 -0.74 -0.08 0.32 0.33 0.19 0.33 0.30

D: Marker cM Mb 0.00 0.01 0.05 0.10 0.20 0.30 0.40 Zmax θmax ------D5S471* 129.83 119.07 -inf -1.11 -0.08 0.37 0.24 0.15 0.11 0.39 0.15 D5S2115* 138.64 134.74 -inf -1.35 -0.13 0.25 0.40 0.29 0.14 0.41 0.21 D5S436* 147.49 145.18 3.50 3.43 3.13 2.74 1.96 1.20 0.52 3.50 0.00 D5S2090 150.34 147.21 3.26 3.19 2.90 2.54 1.81 1.09 0.46 3.26 0.00 D5S812 150.34 148.98 2.58 2.52 2.28 1.98 1.37 0.79 0.31 2.58 0.00 D5S2015 152.62 149.55 4.00 3.92 3.57 3.13 2.23 1.33 0.54 4.00 0.00 D5S2013 152.62 149.56 4.18 4.09 3.73 3.27 2.33 1.40 0.58 4.18 0.00 D5S1469 153.16 149.94 4.18 4.09 3.73 3.27 2.33 1.40 0.58 4.18 0.00 D5S410* 156.47 152.75 3.68 3.60 3.28 2.88 2.05 1.24 0.52 3.68 0.00 D5S422* 164.19 162.08 -inf -4.33 -1.83 -0.94 -0.30 -0.09 -0.01 -0.01 0.40 D5S400* 174.8 168.83 -inf -4.55 -1.97 -1.03 -0.32 -0.08 -0.01 -0.01 0.40

Two-point lod scores of (A) 61019, (B) 61021, (C) 61074, and (D) 61081 for chromosome 5q31-33 markers. Asterisk represents marker included in genome-wide scan. 1287 中国科技论文在线 http://www.paper.edu.cn

D5S410. Recombination events at D5S436 in affected indi- Similarly, recombination events at D5S422 in affected in- vidual 9 of family 61019 and at D5S2090 in affected indi- dividual 13 of family 61074, and at D5S400 in affected individual 9 of family 61021 identify marker D5S2090 as the proxi- vidual 15 of family 61021, and affected individuals 11 and 13 mal flanking marker. of family 61074 identified D5S422 as the distal flanking

Figure 3. Pedigree of families 61019, 61021, 61074, and 61081 showing 5q31-33 haplotypes. Squares represents male participants, circles represents females. Darkened symbols symbolize affected individuals. Double lines between individuals indicate consanguineous mating, and a di- agonal line through a symbol denotes a deceased family member. The haplotype analysis of eleven adjacent chromosome 5q31-33 microsatellite markers are shown. Alleles forming the risk haplotype are shaded black, alleles cosegregating with cataracts but not showing homozygosity are shaded gray, and alleles not cosegregating with cataracts are shown in white.

1288 中国科技论文在线 http://www.paper.edu.cn

Figure 4. Sequence chromato- grams of affected and control individuals. The forward and reverse sequence chromato- grams of (A) unaffected carrier individual 19 of Family 61019, (B) individual 20 of family 61019 showing a homozygous single base change in exon 4 (c.889C>T, C) individual 14 of family 61021, heterozygous in contrast to (D) individual 15 of family 61021 who is homozygous for a single base pair insertion in exon 17 (c.2218- 2219insT, E) unaffected individual 09 of family 61074 and (F) individual 10 of family 61074 showing a single homozygous base pair substitution in the splice acceptor site of exon 11 (IVS10-2A>G).

TABLE 3. SEQUENCE CHANGES IN THE PDE6A GENE IN THREE PAKISTANI FAMILIES Exon Base change Predicted protein change Protein change ------Probable disease-causing mutations in PDE6A gene 4 c.889C>T Premature termination Arg256>Ter 11 IVS10-2A>G Deletion of 22 amino acids p.K470_L491del 17 c.2218-2219insT Frame shift & premature termination p.Y700fsX714

Sequences changes in the PDE6A gene that are not believed to be pathogenic

1 c.297A>G Silent polymorphism Glu59>Glu 1 c.424C>A Silent polymorphism Arg102>Arg 1 c.451A>C Silent polymorphism Arg111>Arg 1 c.585C>T Silent polymorphism Asn155>Asn 2 c.618G>A Silent polymorphism Val166>Val 5 IVS5 +33A>G Noncoding polymorphism ----- 11 IVS10-34A>G Noncoding polymorphism ----- 18 IVS17-16T>G Noncoding polymorphism ----- 22 IVS21-37T>C Noncoding polymorphism ----- Sequence changes in the PDE6A gene in three Pakistani families.

1289 中国科技论文在线 http://www.paper.edu.cn

Molecular Vision 2006; 12:1283-91 ©2006 Molecular Vision marker. Lack of homozygosity at D5S422 and D5S400 in af- in an internal deletion of 22 amino acids of the PDE6A pro- fected individual 9 of family 61019, individuals 9, 12, and 15 tein (p.K470_L491del). As the individuals heterozygous for of family 61021 and affected individuals 7, 14, and 17 of fam- acceptor site mutation are unaffected, it seems unlikely that ily 61081 also suggested that the disease-causing gene lay the mutant protein interferes with the proper functioning of proximal to marker D5S422. Alleles for D5S812, D5S2013, the wild-type protein. D5S2015, D5S1469, and D5S410 were homozygous for all As described, family 61081 showeed significant linkage affected individuals in families 61019, 61021, 61074, and independently to chromosome 5q31-34, but no sequence varia- 61081. tions segregating with the disease phenotype in the family were The linked region on chromosome 5q31-33 harbored detected in the 22 coding exons of PDE6A or in the 462 bases PDE6A (NM_000440), which has been described as a cause directly upstream of the gene. We cannot rule out the possibil- of arRP. The PDE6A gene contains 22 exons and encodes an ity that there might be a sequence change internal to one of 860 amino acid protein (NP_000431). Sequencing of PDE6A the introns affecting splicing. Family 61081 is linked to the showed changes in three of the four families studied (Figure region with a proximal marker D5S2115 and distal marker 4). The affected individuals of family 61019 showed a single D5S422, a linked region of 25.55 cM (27.34). This region base change in exon 4: c.889C>T, resulting in a premature does not contain any previously reported RP-causing genes termination (p.R256X). The affected individuals of family except PDE6A. Further efforts are being made to identify the 61021 showed a single base pair insertion in exon 17; c.2218- mutation as well as the gene causing RP in family 61081. Iden- 2219insT, leading to a frame shift and premature termination tification of additional genes involved in causing RP will of the protein; p.Y700LfsX714. In family 61074, the PDE6A greatly enhance our understanding of the retinal biology at a gene showed a single base pair substitution in conserved splice molecular level and the physiology of retinal photoreceptors. acceptor site in exon 11; IVS10-2A>G. In addition, sequencing of PDE6A in family members disclosed nine new poly- ACKNOWLEDGEMENTS morphisms (Table 3). Sequencing of the 22 coding exons and We acknowledge the family members who donated samples intron-exon junctions of PDE6A in affected members of fam- to make this work possible. The authors are thankful to Amir ily 61081 did not show a disease-causing mutation. In addi- Niazi (optometrist, Layton Rahmatullah Benevolent Trust tion, sequencing of 462 bp upstream of the coding sequences Hospital, Lahore) for his expert help in the identification of of the gene did not disclose any sequence variations segregat- families. We thank the Ministry of Science and Technology, ing with the disease phenotype in the family. Islamabad Pakistan and National Institutes for Health, Bethesda forr funding. DISCUSSION This study was supported, in part by Higher Education Here we report characterization of four consanguineous Pa- Commission, Ministry of Science and Technology Islamabad, kistani families with multiple family members affected with Pakistan and by funds from the intramural program of Na- autosomal recessive RP, the localization of the arRP gene in tional Eye Institute, National Institutes of Health, Bethesda, these families to a 13.85 cM (14.87 Mb) region on chromo- MD. some 5q31-33 flanked by D5S2090 and D5S422, and asso- ciation of RP with mutations in the PDE6A gene in three of REFERENCES the families. These mutations include a single base pair change 1. Bunker CH, Berson EL, Bromley WC, Hayes RP, Roderick TH. (c.889C>T), a single base pair insertion (c2218-2219insT), Prevalence of retinitis pigmentosa in Maine. Am J Ophthalmol and in the third family a single base substitution in the splice 1984; 97:357-65. acceptor site (IVS10-2A>G). Two of the three point muta- 2. Bundey S, Crews SJ. A study of retinitis pigmentosa in the city of Birmingham. J Med Genet 1986; 23:188. tions (c.889C>T and c2218-2219insT) are predicted to results 3. Bird AC. Retinal photoreceptor dystrophies LI. Edward Jackson in premature terminations p.R256X and p.Y700LfsX714, re- Memorial Lecture. Am J Ophthalmol 1995; 119:543-62. spectively, whereas the third mutation (IVS10-2A>G), would 4. Hims MM, Diager SP, Inglehearn CF. Retinitis pigmentosa: genes, result in skipping of exon 11 during mRNA processing. proteins and prospects. Dev Ophthalmol 2003; 37:109-25. The PDE6A gene consists of 22 exons spanning approxi- 5. Boughman JA, Conneally PM, Nance WE. Population genetic stud- mately 45-50 kb on chromosome 5q31-33 and encoding for a ies of retinitis pigmentosa. Am J Hum Genet 1980; 32:223-35. protein of 860 amino acids. Nonsense mutations in mamma- 6. Boughman JA, Caldwell RJ. Genetic and clinical characterization lian genes generally lead to unstable mRNAs that are degraded of a survey population with retinitis pigmentosa. Prog Clin Biol by nonsense mediated decay, unless the mutation is present in Res 1982; 82:147-66. 7. Jay M. Figures and fantasies: the frequencies of the different ge- the last exon [16]. Hence, two of three mutations reported here netic forms of retinitis pigmentosa. Birth Defects Orig Artic Ser (p.R256X and p.Y700LfsX714) are expected to produce un- 1982; 18:167-73. stable transcripts that might be degraded by nonsense medi- 8. Inglehearn CF. Molecular genetics of human retinal dystrophies. ated decay. Conversely, the mRNA carrying the splice accep- Eye 1998; 12:571-9. tor site mutation (IVS10-2A>G) is expected to be stable and 9. Huang SH, Pittler SJ, Huang X, Oliveira L, Berson EL, Dryja TP. processed by the cellular splicing machinery. The processed Autosomal recessive retinitis pigmentosa caused by mutations mRNA transcript is expected to skip exon 11. This should not in the alpha subunit of rod cGMP phosphodiesterase. Nat Genet shift the reading frame of the protein, but is predicted to result 1995; 11:468-71. 1290 中国科技论文在线 http://www.paper.edu.cn

10. Grimberg J, Nawoschik S, Belluscio L, McKee R, Turck A, 13. Lathrop GM, Lalouel JM. Easy calculations of lod scores and Eisenberg A. A simple and efficient non-organic procedure for genetic risks on small computers. Am J Hum Genet 1984; the isolation of genomic DNA from blood. Nucleic Acids Res 36:460-5. 1989; 17:8390. 14. Ott J. Linkage analysis and family classification under heteroge- 11. Riazuddin SA, Yasmeen A, Zhang Q, Yao W, Sabar MF, Ahmed neity. Ann Hum Genet 1983; 47:311-20. Z, Riazuddin S, Hejtmancik JF. A new locus for autosomal re- 15. Riazuddin SA, Yasmeen A, Yao W, Sergeev YV, Zhang Q, Zulfiqar cessive nuclear cataract mapped to chromosome 19q13 in a F, Riaz A, Riazuddin S, Hejtmancik JF. Mutations in betaB3- Pakistani family. Invest Ophthalmol Vis Sci 2005; 46:623-6. crystallin associated with autosomal recessive cataract in two 12. Schaffer AA, Gupta SK, Shriram K, Cottingham RW Jr. Avoid- Pakistani families. Invest Ophthalmol Vis Sci 2005; 46:2100-6. ing recomputation in linkage analysis. Hum Hered 1994; 44:225- 16. Hentze MW, Kulozik AE. A perfect message: RNA surveillance 37. and nonsense-mediated decay. Cell 1999; 96:307-10.

The print version of this article was created on 26 Oct 2006. This reflects all typographical corrections and errata to the article through that date. Details of any changes may be found in the online version of the article. α 1291