Sex of the Last Wild Spix's Macaw Spix's Macaw

Total Page:16

File Type:pdf, Size:1020Kb

Sex of the Last Wild Spix's Macaw Spix's Macaw SCIENTIFIC CORRESPONDENCE 7 stains • Thus, the amount of cortex resentation of peripheral inputs in the 1 2 3 4 devoted to each appendage can be somatosensory system and they raise accurately determined. important questions about the develop­ To quantify the sensory input from each ment and maintenance of cortical areas. appendage, one half of the nose from Although the results are consistent with 104bp - each of four moles was thin-sectioned the findings in the somatosensory cortex 73bp - at a level where a single nerve branch of primates, where additional magnifica­ was visible for each appendage (b in tion of cortical areas occurs in response to 9 the figure). Each nerve branch was increased peripheral stimulation , the photographed and the myelinated fibres expanded areas in the mole somato­ Odel-restricted PCR products showing that the in each were counted. The cortex from the sensory cortex are not the result of an remaining wild Spix's macaw is male. Lane 1, corresponding hemisphere of each mole experimental manipulation. Because of wild bird; 2, negative extraction control; 3, known male; 4, known female. The larger was flattened, sectioned tangential to the the long evolutionary history of this fragment is 104 bp long and the female surface at 60-90 mm, and stained with functional fovea, we could ask whether W-chromosome-specific fragment is 73 bp. cytochrome oxidase to reveal the 11 bands there are phylogenie contributions to METHODS. DNA from the wild bird was representing each half nose (c). this cortical specialization, or whether extracted5 from 1-cm portions of the tips of 3 The sizes of the cortical representations the preferential cortical magnification moulted flight feathers collected over the past of the nasal appendages are not is simply the result of the regional 2 years. The negative extraction control was proportional to their peripheral innerva­ differences in patterns of stimulation taken through an identical procedure. 1.5% of tion densities (d). The 11th appendage, across the sensory surfaces during these extraction products or 50 ng genomic ontogeny (and thereafter). This question DNA from the reference samples were sub­ which is preferentially used to explore jected to semi-nested PCR. Primary amplifica­ objects, is greatly over-represented in might be addressed in neonatal star-nosed tion consisted of 20 cycles with primers (5' to cortex, occupying more than 25% of the moles. 3') P3, AGATATTCCGGATCTGATAGTGA, and nose field. In addition, appendages 1, 9 Kenneth C. Catania P2, TCTGCATCGCTAAATCCTTT; 1% of the pri­ and 10, which are also used during Department of Psychology, mary PCR product was subjected to 30 cycles 8 feeding , show disproportionate cortical Vanderbilt University, of amplification with P2 and Pi, ATATTCTG­ expansions. The 11th appendage is Nashville, Tennessee 37240, USA GATCTGATAGTGA(C/T)TC. Samples were dena­ 2 tured for 1.5 min at 95 °C, then cycled allocated approximately 130 1Lm of cortex 1. Welker, E. & Vander Laos, H. J. Neurosci. 6, per afferent, whereas most of the other 3355-3373 (1986). between 57 oc per 30 s, 72 oc per 15 s and 2. Wassle, H., Grunert, U., Rohrenbeck, J. & Boycott, B. B. 94 oc per 30 s with a 5-min final extension. appendages are allocated between 30 and Vision Res. 30, 1897-1911 (1990). 2 Products were precipitated, cut with Odel, re­ 50 1Lm per afferent. Similar results have 3. Drasdo, N. Nature 266, 554-556 (1977). precipitated and electrophoresed through a been obtained for the visual system in 4. Azzopardi, P. & Cowey, A. Nature 361, 719-721 (1993). 5. Silveira, L. C. L., Picanco-Dinz, C. W., Sampaio, L. F. S. & Visigel separation matrix (Stratagene). All rhesus monkeys, where ganglion cells in Oswaldo-Cruz, E. Vision Res. 29, 1471-1483 (1989). appropriate precautions and negative the retinal fovea occupied 3.3-5.9 times 6. Myerson, J., Manis, P. B., Miezin, F. M. & Allman, J. M. controls5 were implemented. The accuracy of Science 198, 855-857 (1977). more cortical area than ganglion cells in 7. Catania, K. C. & Kaas, J. H. J. camp. Neural. 351, the test was confirmed using DNA from Spix's the peripheral retina4. 549-567 (1995). and hyacinth macaws of known sex (n = 5, P 8. Catania, K. C. J. camp. Neural. 351, 536-548 (1995). = 0.03). Uncut secondary PCR product from These results are the first report of a 9. Jenkins, W. M., Merzenich, M. M., Ochs, M. T., Allard, T. 6 the wild bird was isolated , cloned using the disproportionately expanded cortical rep- & Guic-Robles, E. J. Neurophysiol. 63, 82-104 (1990). Stratagene pCR-Script SK(+) kit and sequenced (Amersham: 7-deaza-dGTP kit) to confirm that the product had originated from a Sex of the last wild Spix's macaw Spix's macaw. We thank Stratagene, M. Kelsey, P. W. H. Holland and J. R. Krebs for SIR- The Spix's macaw (Cyanopsitta chromosome whereas males have two Z advice and assistance. C-W and C-2 are spi.xii) is the world's most endangered chromosomes. Thus, the presence of a W­ subject to patent application 9413821.1. 1 bird . Only 32 now survive and since 1987 unique genetic marker is diagnostic of the only one individual has remained in the female sex. We recently described a tech­ sexes acts as a control to ensure the PCR wild. Coupled with a programme of nique to isolate sex-specific genetic mark­ amplification has been successful. releases, it is hoped that this individual ers4 and have used this method to identify We extracted DNA from feathers will help found a new wild population. a highly conserved gene (C-JV) from the moulted by the wild Spix's macaw using a Unfortunately, the Spix's macaw, like chicken which seems to be W-linked in all technique devised to purify ancient 5 most bird species, is sexually monomor­ birds, with the possible exception of the DNA • The PCR-based test described phic. Although behavioural observations primitive ratites (our unpublished data). above was used to demonstrate that C-W suggest that the wild bird is male, this has A second closely related gene (C-2) is was not present in the sample (see figure). never been verified. It is essential to have situated elsewhere in the genome. This confirmed that the wild bird is male. this information if a prospective mate is to Stratagene provided a genomic library A female Spix's macaw has recently been be released. from the closely related hyacinth macaw released as a prospective mate. Confirmation of the sex of the wild (Anodorhynchus hyacinthinus), and from Richard Griffiths Spix's macaw would normally involve its this we isolated a homologue of C-W and Bela Tiwari capture, but this course has been ruled designed PCR primers to amplify a 104- Ecology and Behaviour Group, out as a significant risk to the bird. The base-pair (bp) region of both C-W and C-2 Department of Zoology, only apparent alternative would be to use from Spix's macaw DNA. Sequence deter­ South Parks Road, a test based on the polymerase chain mination revealed that the C-W-derived Oxford OX1 3PS, UK 2 reaction (PCR) to identify the sex of this PCR product possessed a Ddel restriction 1. Wilson, E. 0. The Diversity of Life (Penguin, London, individual from the DNA traces present enzyme site which was absent in the C-2 1992). 3 2. Griffiths, R.. Tiwari, B. & Becher, S. A. Malec. Ecol. 1, in moulted feathers • Unfortunately, no product. Thus, PCR amplification and 191-194 (1992). such technique has been described applic­ Ddel cleavage of male Spix's macaw DNA 3. Taberlet, P. & Bouvet, P. Auk 108, 959-960 (1991). 4. Griffiths, R. & Tiwari, B. Proc. natn. Acad. Sci. U.S.A. 90, able to this, or indeed any other, bird yields only a single product of 104 bp, 8324-8326 (1993). species. whereas from female DNA two products 5. Thomas, W. K. & Piiiibo, S. Meth. Enzym. 224, 406-419 (1993). Birds exhibit female heterogamety: that are apparent, one of 104 and one of 73 bp. 6. Dretzen, G., Bellard, M., Sassone-Corsi, P. & Chambon, is, females have one W and one Z sex The presence of the C-2 product in both P. Analyt. Biochem. 112, 295-296 (1981). 454 NATURE · VOL 375 · 8 JUNE 1995 .
Loading...

—— Preview end. ——

Recommended publications
  • TAG Operational Structure
    PARROT TAXON ADVISORY GROUP (TAG) Regional Collection Plan 5th Edition 2020-2025 Sustainability of Parrot Populations in AZA Facilities ...................................................................... 1 Mission/Objectives/Strategies......................................................................................................... 2 TAG Operational Structure .............................................................................................................. 3 Steering Committee .................................................................................................................... 3 TAG Advisors ............................................................................................................................... 4 SSP Coordinators ......................................................................................................................... 5 Hot Topics: TAG Recommendations ................................................................................................ 8 Parrots as Ambassador Animals .................................................................................................. 9 Interactive Aviaries Housing Psittaciformes .............................................................................. 10 Private Aviculture ...................................................................................................................... 13 Communication ........................................................................................................................
    [Show full text]
  • AWI-WL-Hyacinth-Macaw-Comments
    January 27, 2017 VIA Electronic Submission to: http://www.regulations.gov Public Comments Processing Attn: FWS–R9– ES–2012–0013 Division of Policy and Directives Management U.S. Fish and Wildlife Service 4401 N. Fairfax Drive Arlington, VA 22203 Dear Branch Chief Van Norman: Thank you for the opportunity to comment on the proposed threatened listing and draft 4(d) rule for the hyacinth macaw (Anodorhynchus hyacinthinus). These comments are submitted on behalf of the Center for Biological Diversity (Center) and the Animal Welfare Institute (AWI). The Center is a nonprofit conservation organization with more than 1,200,000 members and online activists dedicated to the protection of endangered species and wild places. The Center and its members have a long standing interest in the conservation of foreign species and their habitat, including the hyacinth macaw. AWI is a nonprofit, charitable organization founded in 1951 and dedicated to reducing animal suffering caused by people. AWI has been engaged in efforts to confront issues associated with wildlife trade, particularly the commercial trade in wild-caught birds. We have had a long-standing interest in the conservation of the hyacinth macaw and concern for the detrimental effects of trade coupled with habitat loss on the species. We vehemently disagree with the suggestion that the hyacinth macaw should be listed as threatened instead of endangered under the Endangered Species Act (ESA or Act). Habitat loss is still a significant threat to this species, as is the pet trade. Moreover, the United States Fish and Wildlife Service’s (USFWS or Service) Significant Portion of the Range Policy (SPOR policy) is unlawful as evidenced by the agency’s decision here that the birds are threatened throughout their range and therefore a significant portion of their range need not be analyzed.
    [Show full text]
  • Threatened Parrots of the Neotropics
    sustain their numbers. Buffon's Macaw: Appendix I. Threatened Parrots Sometimes confused with the Mili­ tary Macaw. See A.F.A. Watchbird Oct/Nov 1986 and Dec/Jan 1990 for ofthe Neotropics clarification. These birds are seri­ by Nigel J. Col/ar ously declining throughout their International Council for Bird Preservation range in Central America. Captive Cambridge, United Kingdom breeding is desperately needed. Green-winged Macaws: Appen­ dix 11. Still being brought into the U.S. Parrots as Problems the deletion of Yellow-sided Parakeet The wild caught birds have proven Parrots are colourful, vegetarian, Pyrrhura hypoxantha (an invalid difficult to breed. Better success is playful and mimetic, so people find species), the relegation of Yellow­ possible utilizing captive bred birds them attractive, easy to keep, com­ faced Amazon Amazona xanthops to for breeding. panionable and entertaining. In popu­ near-threatened status, the promotion Hyacinth Macaws: Appendix I. lar consciousness, they are the most from near-threatened status of White­ Current population is estimated at high-profile of birds, commonly fea­ headed Amazon Amazona leuco­ 2500 to 5000 total population. lllegal tured in advertisements that seek to cephala, and the addition of El Oro trade continues to decimate their assert the tropical authenticity of a Parakeet Pyrrhura orcesi, Fuertes' population. Further captive breeding product, and often humourised in Hapalopsittaca fuertesi and Fire­ is necessary to maintain adequate cartoon form to assure the conviv­ eyed Parrots H. pyrrhops, Blue­ amounts ofbirds. iality of and complicity in the experi­ cheeked Amazona dufresniana and Military Macaws: Appendix I. ence the product offers. Alder Amazons A.
    [Show full text]
  • Federal Register/Vol. 83, No. 156/Monday, August 13, 2018
    39894 Federal Register / Vol. 83, No. 156 / Monday, August 13, 2018 / Rules and Regulations Authority: 42 U.S.C. 7401 et seq. Transport SIP to meet Infrastructure § 52.1020 Identification of plan. Requirements for the 2010 1-hour NO2 * * * * * Subpart U—Maine NAAQS’’ at the end of the table to read (e) Nonregulatory. ■ 2. Section 52.1020(e) is amended by as follows: adding an entry titled ‘‘Interstate MAINE NON REGULATORY Applicable geo- State submittal Name of non regulatory SIP provision graphic or non- date/effective EPA approved date 3 Explanations attainment area date ******* Interstate Transport SIP to meet Infra- Statewide ............ 2/21/2018 8/13/2018, [Insert Federal This approval addresses Prongs 1 structure Requirements for the Register citation]. and 2 of CAA section 2010 1-hour NO2 NAAQS. 110(a)(2)(D)(i)(I) only. 3 In order to determine the EPA effective date for a specific provision listed in this table, consult the Federal Register notice cited in this col- umn for the particular provision. [FR Doc. 2018–17248 Filed 8–10–18; 8:45 am] Program, U.S. Fish and Wildlife Service, the inadequacy of existing regulatory BILLING CODE 6560–50–P 5275 Leesburg Pike, MS: ES, Falls mechanisms; or (E) other natural or Church, VA 22041; telephone 703–358– manmade factors affecting its continued 2444. If you use a telecommunications existence. The primary causes attributed DEPARTMENT OF THE INTERIOR device for the deaf (TDD), call the to the decline of the hyacinth macaw Federal Relay Service at 800–877–8339. include habitat loss and degradation Fish and Wildlife Service SUPPLEMENTARY INFORMATION: (Factor A), hunting (Factor B), predation (Factor C), competition and low 50 CFR Part 17 Executive Summary reproduction rate (Factor E), and climate Why we need to publish a rule.
    [Show full text]
  • A Courting Behavioral Study on a Hyacinth Macaw (Anodorhynchus Hyacinthinus) Pair
    The Pegasus Review: UCF Undergraduate Research Journal (URJ) Volume 12 Issue 1 Article 2 2020 A Courting Behavioral Study on a Hyacinth Macaw (Anodorhynchus hyacinthinus) Pair Pamela Mulkay University of Central Florida Find similar works at: https://stars.library.ucf.edu/urj University of Central Florida Libraries http://library.ucf.edu This Article is brought to you for free and open access by the Office of Undergraduate Research at STARS. It has been accepted for inclusion in The Pegasus Review: UCF Undergraduate Research Journal (URJ) by an authorized editor of STARS. For more information, please contact STARS@ucf.edu. Recommended Citation Mulkay, Pamela (2020) "A Courting Behavioral Study on a Hyacinth Macaw (Anodorhynchus hyacinthinus) Pair," The Pegasus Review: UCF Undergraduate Research Journal (URJ): Vol. 12 : Iss. 1 , Article 2. Available at: https://stars.library.ucf.edu/urj/vol12/iss1/2 Mulkay: A Courting Behavioral Study on a Hyacinth Macaw Published 9-17 Vol. 12.1: April 8, 2020 THE PEGASUS REVIEW: UNIVERSITY OF CENTRAL FLORIDA UNDERGRADUATE RESEARCH JOURNAL A Courting Behavioral Study on a Hyacinth Macaw (Anodorhynchus hyacinthinus) Pair By: Pamela Mulkay Faculty Mentor: Frank Logiudice UCF Department of Biology ABSTRACT: This study observes the courtship behaviors of an Anodorhynchus hyacinthinus pair in the Central Florida Zoo and Botanical Gardens in Sanford, Florida. A. hyacinthinus reproductive behaviors occur in four steps in the following order: Allopreening, Cloacal allopreening, Back to Back Copulation Position and finally, Copulation (Schneider 2006). Behavioral observations were taken twice a week for an average of 2 to 3 hours each day for ten weeks. The resulting data was analyzed based on the different actions, types of movement, and types of maintenance observed of the A.
    [Show full text]
  • Pinho & Nogueira.Fm
    ORNITOLOGIA NEOTROPICAL 14: 29–38, 2003 © The Neotropical Ornithological Society HYACINTH MACAW (ANODORHYNCHUS HYACINTHINUS) REPRODUCTION IN THE NORTHERN PANTANAL, MATO GROSSO, BRAZIL João Batista Pinho1 & Flávia M.B. Nogueira2 Instituto de Biociências, Universidade Federal de Mato Grosso, Av. Fernando Correa da Costa, s/n, 78060-900, Cuiabá, MT, Brazil. E-mail: 1pinho@cpd.ufmt.br & 2fnog@zaz.com.br Resumo. – Reprodução de Arara Azul (Anodorhynchus hyacinthinus) no norte do Pantanal de Mato Grosso, Brasil. – A Arara Azul (Anodorhynchus hyacinthinus) é uma das muitas espécies da fauna bra- sileira que é ameaçada pela atividade humana, principalmente devido a perda de habitat. A população total com de cerca de 3.000 indivíduos de Arara Azul de vida livre ocorrem principalmente no Pantanal de Mato Grosso, Brasil, uma das maiores áreas alagadas do mundo. Queimadas para a manutenção das pastagens e o tráfico ilegal tem sido e ainda são as maiores ameaças para a sobrevivência da espécie no Pantanal. Nós estudamos as necessidades ambientais, o sucesso reprodutivo e aspectos da biologia reprodutiva da Arara Azul em uma área de 31.000 ha na região norte do Pantanal, de modo a aumentar as informações necessá- rias para elaboração de estratégias de manejo e conservação desta espécie. Procuramos por ninhos, marca- mos e medimos as cavidades dos ninhos e tentamos identificar o potencial de forrageamento e de sítios de nidificação que podem ser colonizados no futuro. Na área de estudo, as Araras Azuis usam cavidades de árvores para nidificar, em árvores entre 10–25 m de altura, a maioria nas bordas de matas. Catorze ninhos foram encontrados (0,045 ninho/100 ha), sendo 12 (85,7%) em apenas uma espécie de árvore, Sterculia ape- tala (Sterculiaceae).
    [Show full text]
  • The Hyacinth Macaw: Brazil, but I Am Uncertain of This and Have Not Been Able to Verify It
    story was transmitted over time and distance because it is amusing. It might have originated with the Bororo of The Hyacinth Macaw: Brazil, but I am uncertain of this and have not been able to verify it. I relate a South American Indian Folktale it here for your enjoyment. Hyacinth Macaw by Jonathan E. Reyman, Ph.D. In the beginning, Hyacinth Macaw Research Associate - Anthropology Illinois State Museum resembled some other birds, but he Research and Collections Center was much bigger. He was all blue, so Springfield, IL 62703-3535 it was often difficult to see him against the sky when he flew above the forest. And his beak was straight so that he could peck at trees to eat the insects­ olktales about the Scarlet Macaw another lowland group, and peoples his favorite food-that lived under and Amazon parrot recorded living in the Andean foothills and their bark, and so that he could sip F during my 1967 fieldwork mountains, most often Otavalan Indians nectar from flowers like his smaller among the Cayapa Indians of (Map 1) who traveled widely selling brother, hummingbird. Esmeraldas Province, northwestern their hand woven textiles. Each group Hyacinth Macaw lived a carefree Ecuador (see Map 1) were published had a distinctive style of clothing spe­ life. Because he was so much bigger in the July/August 1997 issue of the cific to them (photo 2). I learned much than most other birds, he had nothing a/a Watchbird. As I wrote, one of my about these other peoples despite the tasks was to accompany the Cayapa fact that we communicated in Spanish on trading expeditions to record what that was not the native language of any they sold or exchanged and what they of us.
    [Show full text]
  • Voluntary Intake by Hyacinth Macaws (Anodorhynchus Hyacinthinus)
    VOLUNTARY INTAKE BY HYACINTH MACAWS (ANODORHYNCHUS HYACINTHINUS) María Julieta Olocco Diz, Ing P.A., Nutritionist Nutrition Department, Temaikèn Foundation, Escobar, Buenos Aires, ARGENTINA Abstract In August 2004 two juvenile Hyacinth Macaws (Anodorhynchus hyacinthus) arrived at Temaikèn Wild Animal Park. Their feathers were in very bad condition and they weighed 1,230 g on average. At the very beginning, a diet with a great variety of ingredients was given. Two months later, during a first 5-day period leftovers were measured. At that moment the animals weighed 1,305 g on average. Once it was identified which ingredients were preferred, during a second 14-day period the animals were offered a new high calorie diet in order to improve their weight. After that, a maintenance diet was given twice a day and leftovers were measured again. The diet consumed during this third 5-day period, was 50% water; 16.86% crude protein on Dry Matter Basis (DMB) and 15.39% crude fat (DMB). At this time animals averaged 1333.55 g. At the end of the trial these birds had increased their feed intake from 9% to 13% of their body weight on an as-fed basis. Their feather colour also progressively improved. Introduction The Hyacinth Macaw (Anodorhynchus hyacinthinus) is the biggest parrot in the world. Historically, its distribution included central Brazil, Argentina, Paraguay and Bolivia. In Brazil, the former wide distribution has shrunk to the Pantanal area and small dispersed points. The natural habitat is the Pantanal Biome, which is completely flooded for nearly 5 months. On those soils, groves of Acrocomia sp.
    [Show full text]
  • Literature Cited for Proposed Listing of Hyacinth Macaw
    Hyacinth Macaw Literature Cited Abramson, J., B.L. Speer, and J.B. Thomsen. 1995. The Large Macaws: Their care, breeding, and conservation. Raintree Publications. Fort Bragg, California. Allgayer, M.C., N.M.R. Guedes, C. Chiminazzo, M. Cziulik, and T.A. Weimer. 2009. Clinical Pathology and Parasitologic Evaluation of Free-Living Nestlings of the Hyacinth Macaw (Anodorhynchus hyacinthinus). Journal of Wildlife Diseases 45(4): 972–981. Antas, P.T.Z., L.A. Carrara, and R.S. Yabe. 2006. Radio tracking adult Hyacinth Macaws in the Pantanal, central Brazil. Journal of Ornithology 147: 128–129. Arima, E.Y. and C. Uhl. 1997. Ranching in the Brazilian Amazon in a National Context: Economics, Policy, and Practice. Society & Natural Resources 10: 433–451. Barona, E., N. Ramankutty, G. Hyman, and O.T. Coomes. 2010. The role of pasture and soybean in deforestation of the Brazilian Amazon. Environmental Research Letters 5: 1–10. Barrionuevo, A. 2012. In Brazil, Fears of a Slide Back for Amazon Protection. New York Times. Downloaded from http://www.nytimes.com/2012/01/25/world/americas/in-brazil- protection-of-amazon-rainforest-takes-a-step-back.html?pagewanted=all. Accessed January 25, 2012. Basile, A. 2009. Declaration of Anthony Basile. Public Comment submitted to the U.S. Fish and Wildlife Service on September 15, 2009. Available on www.regulations.gov (FWS-R9- IA-2009-0016-0068, Attachment 9). Best, B.J., N. Krabbe, C.T. Clarke, and A.L. Best. 1995. Red-masked Parakeet Aratinga erythrogenys and Grey-cheeked Parakeet Brotogeris pyrrhopterus: two threatened parrots from Tumbesian Ecuador and Peru? Bird Conservation International 5: 233–250.
    [Show full text]
  • Hyacinth Macaw Anodorhynchus Hyacinthinus
    Hyacinth Macaw Anodorhynchus hyacinthinus Class: Aves Order: Psittaciformes Family: Psittacidae Characteristics: Hyacinth (also known as hyacinthia) macaw is the largest species of parrot. Average size is a body length of 100 cm. They are easily recognizable by their brilliant cobalt blue feathers and yellow circling the eye and lower beak. Behavior: Like all macaws, hyacinths have loud, raucous calls that allow them to communicate with each other over long distances, although it has been said to be “less harsh” than the calls of other macaws (IUCN). They prefer to live in dry forests or even in trees in savannah grasslands. Reproduction: Range & Habitat: They nest primarily in pre-existing holes in trees or occasionally cave Lightly forested areas of Brazil, faces in July and December and lay a clutch of two to three eggs which eastern Bolivia and northern incubates for a month. Usually only a single chick will make it to maturity. Paraguay. The chicks will fledge (leave the nest) at around 3 months old but will remain with the parents until around 6 months old (National Aquarium), (Archive). Diet: Wild: Predominately seeds from native palms Zoo: A variety of nuts, primate biscuits and parrot pellets, assorted fruits and vegetables Conservation: Lifespan: up to 60-75 years in Hyacinths are currently classified as vulnerable by the IUCN. Their captivity, 50 years in the wild. declining numbers are due to habitat fragmentation and the illegal pet trade. Throughout the 2000s they were classified as endangered but have Special Adaptations: Their beaks been downlisted to vulnerable as their decline has not been as rapid as can crack some of the hardest nuts previously thought.
    [Show full text]
  • The Following Is a Section of a Document Properly Cited As: Snyder, N., Mcgowan, P., Gilardi, J., and Grajal, A. (Eds.) (2000) P
    The following is a section of a document properly cited as: Snyder, N., McGowan, P., Gilardi, J., and Grajal, A. (eds.) (2000) Parrots. Status Survey and Conservation Action Plan 2000–2004. IUCN, Gland, Switzerland and Cambridge, UK. x + 180 pp. © 2000 International Union for Conservation of Nature and Natural Resources and the World Parrot Trust It has been reformatted for ease of use on the internet . The resolution of the photographs is considerably reduced from the printed version. If you wish to purchase a printed version of the full document, please contact: IUCN Publications Unit 219c Huntingdon Road, Cambridge, CB3 0DL, UK. Tel: (44) 1223 277894 Fax: (44) 1223 277175 Email: info@books.iucn.org The World Parrot Trust World Parrot Trust UK World Parrot Trust USA Order on-line at: Glanmor House PO Box 353 www.worldparrottrust.org Hayle, Cornwall Stillwater, MN 55082 TR27 4HB, United Kingdom Tel: 651 275 1877 Tel: (44) 1736 753365 Fax: 651 275 1891 Fax (44) 1736 751028 Island Press Box 7, Covelo, California 95428, USA Tel: 800 828 1302, 707 983 6432 Fax: 707 983 6414 E-mail: ipwest@igc.apc.org Order on line: www.islandpress.org The views expressed in this publication are those of the authors and do not necessarily reflect those of IUCN or the Species Survival Commission. Published by: IUCN, Gland, Switzerland, and Cambridge, UK. Copyright: © 2000 International Union for Conservation of Nature and Natural Resources and the World Parrot Trust Reproduction of this publication for educational and other non-commercial purposes is authorised without prior written permission from the copyright holders provided the source is fully acknowledged.
    [Show full text]
  • In the Office of Endangered Species U.S. Fish & Wildlife Service United
    In the Office of Endangered Species U.S. Fish & Wildlife Service United States Department of Interior Photo: iStockPhoto A Petition to List 14 Species of Foreign Parrots, Macaws, & Cockatoos as Threatened or Endangered Under the Endangered Species Act, 16 U.S.C. §§ 1531 et seq. January 29, 2008 Petitioner: Friends of Animals, 777 Post Road, Suite 205, Darien, Connecticut 06820 Petition Prepared by: Jamie Cotter, Matthew Willson, Kay Bond, Esq., & Lee Hall, Esq. Table of Contents I. Introduction…………………………………………………………………..1 II. The ESA Listing Process…………………………………………………….2 A. ESA’s Listing Requirements…………………………………………….2 B. Listing Decision Basis………………………………………....................2 III. BirdLife International, NatureServe, and the IUCN Red List……………3 A. BirdLife International………………………………………...................3 B. NatureServe………………………………………………………………4 C. IUCN Red List……………………………………………………………4 IV. Species Accounts……………………………………………………………..6 A. Blue-throated macaws (Ara glaucogularis)…………………………….6 1. Description……………………………………………………...6 2. Distribution and Range……………………………..................6 3. Life History……………………………………………………..6 4. Abundance and Trend…………………………………………7 5. Threats………………………………………………………….7 B. Blue-headed macaws (Propyrrhura couloni)…………………………....9 1. Description……………………………………………………...9 2. Distribution and Range……………………………..................9 3. Life History……………………………………………………..9 4. Abundance and Trend………………………………………..10 5. Threats………………………………………………………...10 C. Crimson shining parrots……………………………………………….11 1. Description…………………………………………………….11
    [Show full text]