Sex of the Last Wild Spix's Macaw Spix's Macaw

SCIENTIFIC CORRESPONDENCE 7 stains • Thus, the amount of cortex resentation of peripheral inputs in the 1 2 3 4 devoted to each appendage can be somatosensory system and they raise accurately determined. important questions about the develop To quantify the sensory input from each ment and maintenance of cortical areas. appendage, one half of the nose from Although the results are consistent with 104bp - each of four moles was thin-sectioned the findings in the somatosensory cortex 73bp - at a level where a single nerve branch of primates, where additional magnifica was visible for each appendage (b in tion of cortical areas occurs in response to 9 the figure). Each nerve branch was increased peripheral stimulation , the photographed and the myelinated fibres expanded areas in the mole somato Odel-restricted PCR products showing that the in each were counted. The cortex from the sensory cortex are not the result of an remaining wild Spix's macaw is male. Lane 1, corresponding hemisphere of each mole experimental manipulation. Because of wild bird; 2, negative extraction control; 3, known male; 4, known female. The larger was flattened, sectioned tangential to the the long evolutionary history of this fragment is 104 bp long and the female surface at 60-90 mm, and stained with functional fovea, we could ask whether W-chromosome-specific fragment is 73 bp. cytochrome oxidase to reveal the 11 bands there are phylogenie contributions to METHODS. DNA from the wild bird was representing each half nose (c). this cortical specialization, or whether extracted5 from 1-cm portions of the tips of 3 The sizes of the cortical representations the preferential cortical magnification moulted flight feathers collected over the past of the nasal appendages are not is simply the result of the regional 2 years. The negative extraction control was proportional to their peripheral innerva differences in patterns of stimulation taken through an identical procedure. 1.5% of tion densities (d). The 11th appendage, across the sensory surfaces during these extraction products or 50 ng genomic ontogeny (and thereafter). This question DNA from the reference samples were sub which is preferentially used to explore jected to semi-nested PCR. Primary amplifica objects, is greatly over-represented in might be addressed in neonatal star-nosed tion consisted of 20 cycles with primers (5' to cortex, occupying more than 25% of the moles. 3') P3, AGATATTCCGGATCTGATAGTGA, and nose field. In addition, appendages 1, 9 Kenneth C. Catania P2, TCTGCATCGCTAAATCCTTT; 1% of the pri and 10, which are also used during Department of Psychology, mary PCR product was subjected to 30 cycles 8 feeding , show disproportionate cortical Vanderbilt University, of amplification with P2 and Pi, ATATTCTG expansions. The 11th appendage is Nashville, Tennessee 37240, USA GATCTGATAGTGA(C/T)TC. Samples were dena 2 tured for 1.5 min at 95 °C, then cycled allocated approximately 130 1Lm of cortex 1. Welker, E. & Vander Laos, H. J. Neurosci. 6, per afferent, whereas most of the other 3355-3373 (1986). between 57 oc per 30 s, 72 oc per 15 s and 2. Wassle, H., Grunert, U., Rohrenbeck, J. & Boycott, B. B. 94 oc per 30 s with a 5-min final extension. appendages are allocated between 30 and Vision Res. 30, 1897-1911 (1990). 2 Products were precipitated, cut with Odel, re 50 1Lm per afferent. Similar results have 3. Drasdo, N. Nature 266, 554-556 (1977). precipitated and electrophoresed through a been obtained for the visual system in 4. Azzopardi, P. & Cowey, A. Nature 361, 719-721 (1993). 5. Silveira, L. C. L., Picanco-Dinz, C. W., Sampaio, L. F. S. & Visigel separation matrix (Stratagene). All rhesus monkeys, where ganglion cells in Oswaldo-Cruz, E. Vision Res. 29, 1471-1483 (1989). appropriate precautions and negative the retinal fovea occupied 3.3-5.9 times 6. Myerson, J., Manis, P. B., Miezin, F. M. & Allman, J. M. controls5 were implemented. The accuracy of Science 198, 855-857 (1977). more cortical area than ganglion cells in 7. Catania, K. C. & Kaas, J. H. J. camp. Neural. 351, the test was confirmed using DNA from Spix's the peripheral retina4. 549-567 (1995). and hyacinth macaws of known sex (n = 5, P 8. Catania, K. C. J. camp. Neural. 351, 536-548 (1995). = 0.03). Uncut secondary PCR product from These results are the first report of a 9. Jenkins, W. M., Merzenich, M. M., Ochs, M. T., Allard, T. 6 the wild bird was isolated , cloned using the disproportionately expanded cortical rep- & Guic-Robles, E. J. Neurophysiol. 63, 82-104 (1990). Stratagene pCR-Script SK(+) kit and sequenced (Amersham: 7-deaza-dGTP kit) to confirm that the product had originated from a Sex of the last wild Spix's macaw Spix's macaw. We thank Stratagene, M. Kelsey, P. W. H. Holland and J. R. Krebs for SIR- The Spix's macaw (Cyanopsitta chromosome whereas males have two Z advice and assistance. C-W and C-2 are spi.xii) is the world's most endangered chromosomes. Thus, the presence of a W subject to patent application 9413821.1. 1 bird . Only 32 now survive and since 1987 unique genetic marker is diagnostic of the only one individual has remained in the female sex. We recently described a tech sexes acts as a control to ensure the PCR wild. Coupled with a programme of nique to isolate sex-specific genetic mark amplification has been successful. releases, it is hoped that this individual ers4 and have used this method to identify We extracted DNA from feathers will help found a new wild population. a highly conserved gene (C-JV) from the moulted by the wild Spix's macaw using a Unfortunately, the Spix's macaw, like chicken which seems to be W-linked in all technique devised to purify ancient 5 most bird species, is sexually monomor birds, with the possible exception of the DNA • The PCR-based test described phic. Although behavioural observations primitive ratites (our unpublished data). above was used to demonstrate that C-W suggest that the wild bird is male, this has A second closely related gene (C-2) is was not present in the sample (see figure). never been verified. It is essential to have situated elsewhere in the genome. This confirmed that the wild bird is male. this information if a prospective mate is to Stratagene provided a genomic library A female Spix's macaw has recently been be released. from the closely related hyacinth macaw released as a prospective mate. Confirmation of the sex of the wild (Anodorhynchus hyacinthinus), and from Richard Griffiths Spix's macaw would normally involve its this we isolated a homologue of C-W and Bela Tiwari capture, but this course has been ruled designed PCR primers to amplify a 104- Ecology and Behaviour Group, out as a significant risk to the bird. The base-pair (bp) region of both C-W and C-2 Department of Zoology, only apparent alternative would be to use from Spix's macaw DNA. Sequence deter South Parks Road, a test based on the polymerase chain mination revealed that the C-W-derived Oxford OX1 3PS, UK 2 reaction (PCR) to identify the sex of this PCR product possessed a Ddel restriction 1. Wilson, E. 0. The Diversity of Life (Penguin, London, individual from the DNA traces present enzyme site which was absent in the C-2 1992). 3 2. Griffiths, R.. Tiwari, B. & Becher, S. A. Malec. Ecol. 1, in moulted feathers • Unfortunately, no product. Thus, PCR amplification and 191-194 (1992). such technique has been described applic Ddel cleavage of male Spix's macaw DNA 3. Taberlet, P. & Bouvet, P. Auk 108, 959-960 (1991). 4. Griffiths, R. & Tiwari, B. Proc. natn. Acad. Sci. U.S.A. 90, able to this, or indeed any other, bird yields only a single product of 104 bp, 8324-8326 (1993). species. whereas from female DNA two products 5. Thomas, W. K. & Piiiibo, S. Meth. Enzym. 224, 406-419 (1993). Birds exhibit female heterogamety: that are apparent, one of 104 and one of 73 bp. 6. Dretzen, G., Bellard, M., Sassone-Corsi, P. & Chambon, is, females have one W and one Z sex The presence of the C-2 product in both P. Analyt. Biochem. 112, 295-296 (1981). 454 NATURE · VOL 375 · 8 JUNE 1995 .

Load more