TROPICS Vol. 7 Qlg:795-207 Issued May 1998
Molecular Phylogeny of Dtpterocarp Specles Ustng Nucleotlde sequences of Trro Non-codrng Regtons rn Chloroplast DNA
Koichi KAMIYA & Ko HAIIi{DA College of Agriculture, Ehime University, Matsuyama 790-(D05, Japan Kazuhiko OGINO School of Environmental Science, University of Shiga Prefecture, Hikone 522,-8533, Jryan Thdashi K,Urm Bohnical Gardens, Graduate School of Science, Univenity of Tokyo 112-0001, Japan Tbuneyuki YAII{AZAKI Department of Biology, Faculty of Science, Kyushu Univenity, Fukuoka 81}0053, Japan Hua-Seng LEf Departrnent of Forestry,93660 Kuching Sarawak, Malaysia Peter Shaw ASHTION Harvard Institute for International Development, Cambridge, MA 02138, USA
ABSTRACT A total of 53 dipterocarp species belonging to ten genera were studied to examine phylogenetic relationships using the sequences of iwo non-coding regions in chloroplast DNA. Phylogenetic analysis showed the Selangan Batu, Yellow Meranti and While Meranti of the genus Shorea were monophyletic, while the Red Meranti was divided into three nalural clades. The relationships in the Red Meranti could not be ascertained because of an insufficient number ofnucleotide substitutions. The White Meranti was cluslered with sect. Pentacme and siluated in an outer position of the gems Hopea, Neobalanocarpus and Parashorec although the bootstrap probability was not high. Two of the three deciduous Shorea species collected in Thailand, one belonging lo White Meruti and the other to sect. Pentacme based on morphological and anatomical evidence, were found to constitute a monophyletic group clustering with the other White Meranties. The third species in the Selangan Batu was clustered with the other Selangan Batus. This suggests that the deciduous character in the genus Shoreahas evolved independently in differentlineages. The divergence within sections of the genus Sftorea was largest in sed. Mutica and smallest in sect. Richetioides. The genera Shorea and Hopea werc more divergenl than the other genera. These resulls suggest that they are the groups of phylogenetically more diversified species.
Key lVords: molecular phylogeny / dipterocarp species / genus Shorea I chloroplast DNA / trnLtrnF intergenic spacnr region / trnL intron
Dipterocarpaceae is subdivided into three subfamilies: Dipterocarpoideae, Monotoideae and Pakaraimoideae (Ashton, 1.982). Monotoideae is represented in Africa, Madagascar and South America by three genera. The monotypic genus Palwraimaea is placed in the Pakaraimoideae and is distributed throughout the lower slopes of Guyana Highlands, South America. Dipterocarpoideae is the largest subfamily and distributed throughout Malesia which is a biogeographical region including Malaysia, Indonesia, Philippines, Singapore, Brunei and Papua New Guinea. It includes L3 genera and 470 species (Symington, 1.943; Ashton, l98Z). Subfamily Dipterocarpoideae is classified into two tribes, Dipterocarpeae and Shoreae, primarily on the basis of chromosome number, the nature of the fruit sepals and wood anatomy (see Ashton, 1982). Out of the 13 genera, Shorea is the largest genus of Dipterocarpaceae. It consists of about 194 species and 163 of which occur in Malesia (Newman et al., 1996). The division of Slorea into four 196 K. Karr,rly4 K. HanapA, K. OcINo, T. KenrA, T. YeuezeKl, H.-S. Lne & P. S. AsHroN
major timber groups (Selangan Batu, White Meranti, Yellow Meranti and Red Meranti) agrees roughly with the division of the genus into sections (Newman, 1996). Ashton (1982) subdivided Shorea into ten sections mainly by the morphological features of the flower, more often by caryx lobe and wood anatomy. Tsumura et al. (1996) reported a phylogenetic study of 30 dipterocarp species using the restriction fragment length polymorphism (RFLP) of some genes of chloroplast DNA. These species were clearly separated into two species groups that correspond to two different basic chromosome numbers: the first group with n=7 and the other with n=11.. Their results agreed with the classification made by Ashton (1982). Moreover, their data indicated that Slprea bracteolata md S. singkawazg were closer to Hopea than to the other Shorea species. They suggested that Shorea is heterogeneous and its validity should be reexamined. They could not clearly show the infrageneric relationships of Slnrea because of insufficient number of polymorphic sites and the limited number of species studied. Here we constructed a phylogenetic tree in Dipterocarpaceae, mainly the genus Shorea to clarify the genetic relationships using direct sequencing of two non-coding regions in chloroplast DNA. The use of sequencing directly the amplified products of PCR is now expanding in plant systematics. DNA sequencing can provide a large data sets of discrete characters such as nucleotide substitutions, insertions and deletions (indels) and other structural changes (Gielly & Taberlet 1.994, Johnson & Soltis 1994). The goals of our study are thus two-fold: Firstly to determine the extent of chloroplast DNA divergence among dipterocarp species. Secondly to construct a molecular phylogenetic tree and compare it with the morphological classifications made by Ashton (1982\. In addition, we intend to clarify the relationships between the genera Shorea and Hopea, and the infrageneric relationships within the genus Shorea.
MATERIALS AND METHODS
Materials I-eaf samples were obtained in a canopy biology plot of 8-ha and a long term ecological research plot of 52-ha at l,ambir Hills National Park, Sarawak, Malaysia. In the center of the canopy biology plor, all trees with diameter at breast height (DBH) more than L0cm were tagged and recorded by Ohkubo er a/.(personal communication). In the long term ecological research plot, all trees with DBH more than lcrn were tagged and recorded by Ia Frankie et al. (personal communication). Samples were collected from 36 tree species in five genera in August 1995 and August 1996. t€af samples were identified by the author (K. K.) by compairing with the specimens deposited in the laboratory of Lambir Hills National Park whose duplicates were deposited in the herbarium of the Forest Department of Sarawak in Kuching (personal communication by Momose er a/.).
Five species (Dipterocarpus alatus, Hopea odorata, Shorea obtusa, S. roxburghii and S. siamensis) were collected at the Botanical Garden in Hae Kew, Chiang Mai, Thailand in January L996. Nucleotide sequences from 1,2 species (Cotylelobiutn lanceolatwn, Anisoptera laevis, A. thurifera ssp. thurifero, A. costata, Neobalanocarpus heimii, Parashorea lucida, Dipterocarpus baudii, D. kerrii, Upuna borneensis, Dryobalanops oblongifulia, Shorea bracteolata and, Hopea nertosa\ were cited from Kajita et al. (1997 , in press). These species were collected at the Forest Research Institute of Malaysia (FRIM) arboretum and nursery. Voucher specimens collected here are deposited in FRIM herbarium. The information on each species is shown in Table 1. Molecular phylogeny of dipterocarp species 197
Table 1. Species analyzed with their section, subsection names and sources.
Species Field group Section* Subsection* Source** Shormbimpak Selangan Batu Shorm Barbata A Shorm exelliptica Shorea A Shorea falciferoides A Shorm geniculata A Shorea hnailandii A Shorm superba A Shorea obtusa B Shorm agami White Meranti Anthoshorea A Shorea bracteolata c Shorea ochracea A Shorea racburghii A Shorea faguetiann YellowMeranti Richetoides Riclutoides A Shorea laxa A Shorm patoicnsis A Shorea xanthophylla A Shoreabullata Red Meranti BraclrySptuae Braclryptqae A Shorm fallax A Shorm pauciflora A Shorea acuta Mutica Auriculatae A Shorm ferruginea A Shoren argentifolia Mutica A Shorea curtisii A Shor ea mncropter n ssp . rwcropt uifolin A Shorm ouata A Shorea pantifolia A Shorea qundrinerais A Shorea rubra A Shorea oaalis Oaalis A Shoreabeccarinna Pachycarpa A Shorea macrophylla A Shorea pilosa A Shorea sinmensis Pentacme Parashorea lucida Hopea dryobalanoides A Hopea grffithii A Hopu neraosa C Hopea odorata B
N eob aI ano cnrp us heimii
Dry ob alan ops ar omat ic a A
Dry ob al an op s lanc e olat a A D ry ob al an op s oblo n gifo Ii a C Dipterocarpus alatus B Dipterocarpus baudii C Dipterocarpus kerrii C
Dipt er o car pus palembanicus ssp . borneensis A Upuna borneensts Vatica micrmttha A Vatica oblongifolia A Vatica sarmar*ensis A Anisoptera laeuis C Anisopter a tlwr ifera ssp, tln r ifera c Anisoptera costata C
C o ty I eI ob ium Inn c e o latum
* The sections and subsections were cited from Ashton (1982). ** A: Lambir National Park, Sarawak, Malaysia. B: Botanical Gardery Haw Kew, Chiang Mai, Thailand. C: Cited from Kajita et al. (in press). 198 K. KarraryA, K. HennnA, K. OGrNo, T. KerrrA, T. YauazeKr, H.-S. LEE & P. S. AsrroN
DNA isolation and purilication Total DNA was isolated from living leaf tissues following the method of Terauchi (199a). The isolated DNA was dissolved into 400p1 of TE buffer (10mM Tris-HCl, pH7.5, 1mM EDTA ,pH8.0). For some species, total DNA was extracted from dried leaf tissues following the protocols of the CTAB method (Doyle & Doyle, 1990) with minor modification. Approximately 0.5-1.09 of leaf tissue were used for DNA isolation. The DNA was washed with 70Vo ethanol and dissolved into 500U,1 of TE buffer. Two pl of l0mg/ml RNaseA was added and incubated at37"C for t hour. The DNA solution was further purified by extraction using an equal volume of Tris-saturated phenol several times. The DNAwas dissolved into 20 to 100u1 of TE buffer.
PCR amplification and DNA sequencing Two non-coding regions of chloroplast DNA including an intron of trnL (UAA) and an intergenic spacer between trnL (pAA) 3' and frzF (GAA) 5' exon were amplified by PCR (polymerase chain reaction). These regions are considerably useful for evolutionary studies of closely related species (Iaberlet et al., t99l). GeneAmp PCR System 2400 (Perkin Elmer) was used for the amplification. Primers were designed by Taberlet et al. (1991) to match the conserved regions for universal use. Sequences of the two pairs of the primers for the intron and the exon were 5'- CGAAATCGGTAGACGCTACG-3' and 5'-GGGGATAGAGGGACTTGAAC-3', and 5'- GGTTCAAGTCCCTCIATCCC-3' and 5'-ATTIGA\ACTGGTGACACGAG-3', respectively (Iaberlet et al., l99l). Approximately 0.1pg of the total DNA solution was subjected to 30 cycles of amplification (l-min denaturation at 94"C, 1-min annealing at 55, 51 or 46'C, 2-min extension at 72'C) after 5-min of preheating (94"C), and then final extension of 10-min at72"C. Reaction mixtures (50mL) contained 50mM KCl, L0mM Tris-HCl pH 8.3, 1.5mM MgCl2, 5pmol of each primer, 200mM of each of dAIR dTTR dGTP and dCTR and 2.5units of Taq polymerase (Pharmacia, Toyobo and Takara). PCR products were excised from ethidium bromide-stained agarose gel (Thkara LO3) with arazor blade under long-wave UV light at 365nm. These products were purified using GENECLEAN III (BIo 101). DNA sequencing was carried out using the dideoxy-chain termination method (Munay 1989). Purified PCR products were used as templates. The sequencing reaction was performed by using ABI PRISMTM Dye Terminator Cycle Sequencing Ready Reaction Kit @erkin Elmer). This reaction was done with the following parameters: 25 cycles of 30-sec at 96'C,30-sec at 50'C, and 4-min at 60'C. Sequencing primers were the same as those for the gene amplification. The DNA was precipitated with the reaction mixture by ethanol, washed with 70Vo ethanol and suspended in 2p1 of folmamide/50mM EDTA (pH 8.0). The DNA was denatured by incubating at 95"C for 2 minutes, and applied to 4Eo aqylamide gel. The electrophoresis data were scanned by the ABI 377 automatic sequencer.
Nucleotide data analysis Sequences of both strands were obtained and matched together to provide exact sequences. Multiple alignment of the sequencing data and the Neighbor-joining tree (Saitou & Nei, 1987) construction were carried out using CLUSTAL W version 1.4 (Ihompson et al., 1994). Sequence alignments were refined by naked eyes. A bootstrap analysis (Felsenstein, 1985) with 1000 replications were performed to test the significance of our phylogenetic fiee of nucleotide sequences using CLUSTAL W version 1.4. Maximum-parsimony trees were constructed using the computer softrvare PAUP Molecular phylogeny of dipterocarp species 799
Species Sequerrce Slorea (other goups) 14 TTTTATCCTACCCTTTCCCTTGTTAAGA 41 Slnrea (White Meranti) il .J ------CCTACCCTTTCCCTTGTTAAGA b ----+ ------TAcccrrrcccrrcrrAAcA Paraslorea TTTTATC C TAC C C TTTC C C TTGTTAAGA Hqea TTTTATC C TAC C C TTTC TC TTGTTAAGA Neofularnurpus TTTTATCCTAC CCTTTC CCTTCTTAAGA
Dryobahrops TTTTATC CTAC CCTTTC C CTTGTT AAGA Dipterocarpus TTTTAGCCTACCCTTTCCC------e Anisoptera TTTTATC C TAC C C TTTTC C TTGTTAAGA Cotylelobinm TTTTATC C TAC C C TTTC C C TTGTTAAGA - Vatica C + ------CCTACCCTTTCCCTTGTTAAGA d +------ccrrcrrAAcA Uputu TTTTATC CTAC CCTTTCC CTTGTTAAGA
Species Sequerrce
Shorea (other goups) 156 T------ATGATATACGTACAAAT6AGCAICGGAAIACATACCCCfI-IGAAFGAITCACIATCCATATCATTACTCAT 244 Shorea (White Meranti) T------ATGATATACGTACAAAT.AAGCATCGGAATGCATACCCCTTAIGAATGArICACAITCCATATCATTACTCAT Slprea (Yellow Meranti) T------.---ATGATATACGTACA.AATGAGCATCGGAAIACAIATCCCIA-TGAATGATTCACAATCCAGATCATTACTCAI Paraslwea T------.----ATGATATACGTACAAATGAGCATCGGMIACATACCCCrf-TGAATGATTCACAATCCAIATCATIACTCAT Hqea f +------T------.-----ATGATATACGIACA.AATGAGCATCGCMTACATACCCCTT-TCAATGATTCACAATCCATATCATTACTCAT Neofulanocarpus f ------ATGATATACGTANAGCATCGGAATACATACCCCTT-TffiTGATTCACAATCCATArcATTACTCAT Dryoblanops g r TTATGAIATATATGTATGATATACGTACAIAIGAGCATCGGAATATAIACCCCm-Til-GATACACAAICCATATCATIACTCAT Diptuocarpus T------.--AIGATATACGTACAAAEGAGCATCGGMTACATACCCCTT.TGAATGATICACAATCCATATCAMACTCAT Anisoptera T------ATGATATACGTACAAATGAGCATCGGAATCCAIATCCCTT-TGAATGATICATAATCCATATCATTACTCAT Cotylelobium T------ATGATATACGTACAAAEGAtrArcGGMTACATATCCCTE-TGAAIGATTCATAATCCATATCATTACTCAI Vatiu . T------ATGATATACGTACA.AATGAGCATCGGAATACATATCCCIT-TGAATGASTCATAATCCATATCATTACTCAT Upma I---.------ATGATATACGTACAAATGAGCATCGGAATACAEATCCC!T-TGAAIGATICATAATCCATATCATTACTCAT
Fig. l. Indels in the Intergenic spacer region between trnL and !rnF. Missing nucleotides are shown by "-'. The site numbers show the base position starting from the 5' end of the sequenced region to be 1, and are to be read vertically version 3.1.1 (Swofford, L993), applying heuristic searches with MULPARS, tree bisection- reconnection (IBR) branch swapping, random addition for ten times, and ACCTRAN optimization. We calculated variation within and between groups using a computer program ODEN version 1.1.L (Ina, 1994) and SEnj developed by Ina.
RESULTS
Sequences oftwo non-coding regions ofchloroplast DNA The sequences of the trnL-trnF intergenic spacer region and the trnL intron were determined for 53 dipterocarp species. Two individuals were sequenced for each ofShoreaferruginea andS. faguetiana. The length ofthe intergenic spacer region varies from 3L1 to 396 bp and that ofthe intron from 452 to 481 bp. In the intergenic spacer region and the intron, several insertions/deletions (indels) were identified (Fig. 1 and Fig. 2). The following indels were found in the intergenic spacer region (Fig. 1): The species belonging to Shorea sect. Anthoshorea and the genus Vatica had common one (deletion) at position !4. Shorea bracteolata, S. ochracea, Vatica micrantha and V sarawakensls had the same indel between positions 1.4 and 19 (6 bp long)[Fig. 1 (a) and (c)]. Shorea agami had one between positions 14 andZl (S bp long) tFig. 1 (b)1. Vatica oblongifulia had one between positions 14 and 30 (17 bp long) tFig. t (d)1. The species inDipterocarpus had one (deletion) between positions 33 anLd4l (9 bp long) [Fig. 1 (e)]. Hopea nervosa and H. odorata had a large one (deletion) between positions 157 and 245 (9?bp long) [Fig. 1 (f)], but not found in H. dryobalanoides and H. griffithii. The species rn Dryobalanops had one (insertion) between positions 157 and l7O (L4 bp long) [Fig. 1 (g)]. In the intron, an indel (deletion) was found rnVatica between positions 75 and 80 (6 bp long) [Fig. 2 (h)]. Dipterocarpus palembanicus ssp. borneensris had one (insertion) between positions 197 arrd 204 (8 bp long) [Fig. 2 (i)]. But other species in Dipterocarpus did not have this indel. In Dipterocarpus, a 200 K. KanaryA, K. HanaoA, K. Ocrno, T. KenrA, T. Ynuezeru, H.-S. LEE & P. S. AsHroN
Spccics Sequerrce Sequerrce Slprea 70 TTTAAAAAAGCGTT 83 Slorea (other groups) L92 Paraslwea TTTAAAAAAGCGTT Shorea (Yellow Meranti) Hqea TTTAAAAAAGCGTT Panslurm Neofulanocarpts TTTAAAAAAGCGTT Hqea Dryofulanops TTTAAAAAAGCGTT Nafulancarpts Dipterocarpus TTTAAAAAAGCGTT Dryofularcps Anisoptera TTTAAAAAAGCGTT Diperccarpts (others) Cotylelobium TTTAAAAAAGCGTT Dip ero carpts pal e mfuni ckt ssp. Vatiu TTTAA---.-.GTT <- Anisoptera Uputu TTTAAAAAAGCGTT Cotylelobium Vatico AAGGA------TAAA Upwa AAGGA------TAAA
Slnrea 244 ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAAG 299 Paraslwea ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAAG Hqea ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAAG Nfulancarpus ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAAG Dryofulanopt ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAAG Dipterccarpus alatus ACACCTATTCTTITGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAGG Dipttocarpts fuudii ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA TAGGTTATAGCAAA AAGAATTATAGG <-J Diptaocarpts kerri ACACCTATTCTTTTGATTT CTATTTTETTA TAGGTTATAGCAAA TAGGTTATAGCAAA TAGGTTATAGCAAA AAGAATTATAGG <'-K Anisoptera ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAGG Cotylelobiunt ACACCTATTCTTTTGATTT I Vatica ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAAG Upuna ACACCTATTCTTTTGATTT CTATTTTTTTA TAGGTTATAGCAAA AAGAATTATAAG
Fig.2. Indels in the frrl intron. Missing nucleotides are shown by "-". The site numbers show base positions starting from the 5' end of the sequenced region to be 1, are to be read vertically. Repeated sequence in Dipterocarpus baudii and D. kerri is underlined. The inverted region in Cotylelobium is shown by an anon' and to be read "CTTATAATTCTTTTTGCTATAACCTATAAIArqu{{d\TAG'.
repeated sequence CIAGGTTAIAGCAAA) was found in the intron. This sequence is repeated twice rn Dipterocarpus baudii md D. palembanlcas ssp. borneensis [Fig. 2 (j), and three times in D. kenii [Fig. 2 (k). An inversion was found in Cotylelobium lanceolatum [Fig. Z (l). Nucleotide substitutions were not found among l) Shorea patoiensis, S. faguetiana and S. xanthophylln,2) S. ferruginec I and S. acuta, 3) Dryobalanops aromatica and D. oblongifolia, and 4) Anisoptera thurifera ssp. thuifera mdA. oblonga.
Genetic divergence between and within genera and sections of Shorea The nucleotide divergence within and between genra and sections in the genus Slnrea are estimated on the combined data set of the two non-coding regions (Tables 2 and 3). The divergence within genera @ble 3) ranged from 0.00355+0.00178 inAnisoptera andVatica to 0.01079t0.00164 in Shorea. The largest divergence among genera was obtained between Dipterocarpus and Hopea (0.04550+0.00718), and the smallest divergence was obtained between Vatica and Anisoptera (0.0098010.00314). Concerning the divergence within sections of Shorea (Iable 2), seci'' Mutica showed the largest divergence (0.00826f 0.00168), whereas sect. Richetioides had the smallest (0.00095 f 0.00068).
Phylogenetic trees using the two non-coding regions Neighbor-joining (NJ) trees were constructed using the combined data set of the two non-coding regions (Fig. 3). The NJ tree showed that the genera Anisoptera, Vatica, Dipterocarpus and Dryobalanops were monophyletic. The genera Hopea md, Neobahnocarpus formed an independent cluster in thelarge Slorea group. In the genus Shorea, the Selangan Batu group (sect. Slnrea'1, Yellow Meranti group (sect. Richetioides) and White Meranti group (sect.,4nthoshorea) were monophyletic. The White Meranti group including one species from Thailand (Shorea roxburghii) and another Thai species (Shorea siamensis, sect. Pentacme) formed an independent cluster. Another Thai species, Molecular phylogeny of dipterocarp species 20r
Table 2. Nucleotide diversities* within and among genera. Among genera Genus No. species Within genus
1 Shorea 33 0.01,079+ 0.00164 0.00361 0.004s8 0.00684 0.00s21 0.00s46 2 Hopea 4 0.009s9 + 0.00258 0.0182s 0.00s0s 0.00718 0.00s64 0.00s87 3 Dryobalanops 3 0.00455 t 0.00201 0.02182 0.02488 0.00722 0.00569 0.00592 4 Dipterocarpus 4 0.00s33 r 0.00199 0.0408s 0.044s0 0.04300 - 0.00717 0.00736 5 Anisoptera 3 0.00355 r 0.00L78 0.02596 0.02901 0.02661, 0.0411s - 0.00314 6 Vatica 3 0.00355 + 0.00L78 0.02818 0.03131 0.02522 0.04324 0.0098 * Nucleotide diversities are calculated by Kimura's two parameter method (1980). Nucleotide diversities among genera are shown below dialogal and standird deviations calculated by Nei and Jin's method (1989) are shown above dialogal.
Table 3. Nucleotide diversities* within and among sections Shsrea. Among sections Section No. species Within genus
1 Shsrea 5 0.00237 + 0.00106 0.00426 0.00368 0.00251 0.00254 0.00253 2 Anthoshorea 3 0.00237 t 0.00137 0.01552 0.00471 0.00352 0.00358 0.00366 3 Richetioides s 0.00095 t 0.00068 0.01238 0.01841 0.00322 0.00323 0.00323 4 Braclryptera 3 0.00316 + 0.00162 0.00752 0.012u 0.01038 - 0.00139 0.00105 5 Mutica 1L 0.00826 r 0.00168 0.01034 0.01486 0.01317 0.00601 0.00143 6 PacLrycarpa 3 0.00237 + 0.00137 0.00712 0.01311 0.00983 0.00276 0.00s97 * Nucleotide diversities are calculated by Kimura's two parameter method (1980). Nucleotide diversities among sections are shown below dialogal and standard deviations calculated by Nei and Jin's method (1989) are shown above dialogal.
Shorea obtusq. belonging to Selangan Batu clustered with the main Selangan Batu species group. Pa.rashorea lucida chstered with Slnrea rubra (sect. Mutica) and S. ovalis (sect. Ovalis). The Red Meranti group was divided into three clades and several independent branches. The NJ tree was similar to the shict consensus of the Maximum-parsimony tree, except for the resolution within the Anisoptera-Upuna-Cotylelobium-Vatica clade and within the Shorea clade (Fig. 4). Maximum- parsimony analysis using eight outgroup species (Upwa borneensis, Cotylelobium lanceolatum, Vatica micrantha, V oblongifulia, V sarawakensis, Anisoptera laevis, A. thurifera ssp. thuriftra and A. costata) resulted n l29Z most parsimonious trees with a length of 205 steps, a consistency index (CI) of 0.805, and a retention index (HI) of 0.195.
DISCUSSION
Intergeneric and infrageneric relationships Both phylogenetic trees of Neighbor-joining and Maximum-parsimony methods were obtained. These trees showed an essentially identical topology. We will use the NJ tree for the rest of the discussion. In Malaysia, the genus Slarea is divided into four groups by the color of the timber: the Selangan Batu, Red Meranti, White Meranti and Yellow Meranti. Symington (1943) pointed out that these field groups conespond to the botanical sections with the exception of the Red Meranties in which he recognized three botanical groups. Thus the Selangan Batu was equivalent to sect. Shorea, the White Meranti with sect. Anthoshorea, and the Yellow Meranti with sect. Richetioides. The Red Meranti, however, with sections Brachypterae, Mutica, Ovalis, and Pachycarpae is botanically heterogeneous as Ashton (1964) emphasized. 202 K. KnuryA, K. HenaoA, K. OcrNo, T. KAJIA, T. YAUAZAKT, H.-S. Len & P. S. AsHroN
Upuna bomeensis Anisoptera laais
996 Anisoptera thuifera ssp. thurifera Anisoptera costata C o ty I el ob ium lan c eolatum Vatica oblongifulia Vatica micrantlra Vatica sarawakensis Dipterocaypus pal embani as s sp . Dorneensts Dipterocarry alnnn Dipterocarpts fuudii Dipuocafrys kerrii Dry obalanaps oblon gifolia 1000 Dryobalanops aratutica Dryobalanops lorcuhn Shorea bractulata 972 Slwrea agoni Shorea odtracea Slnrea roxburgii Shorea siamensis N e ob alano carlrus h eimii Hopea dorata Hopea neryosa Hopea dryobalanoides Hopea grffithii 701 Slnrea paucitlora Slnrea argmtifolia Slnrea wata @ Shorea obtusa Shorea biawak Slnrea geniculan 793 Shorea saperba Shorea falciferoides Shorea havilandii Shorea laca Slnrea fagrctinru L Shorea xanthophylla Yellow Meranti Shorea fasuetiarw 2 Shorea patoiensis Parashorea lucidn Shorea rubra 480 Shorea ovalis @ Slwrea mouophylla Slwrea parvifolia Shorea qtndrinerttis Shorea femtginea 2 Shorea mncroptua ssp. macropterifolia Slnrea nnfia @ 881f Shorea ferntginea I Shorea rurtisii Shorea bullan Shorea pilosa Shorea beccarinrw Shorea fallax 0.01
Fig. 3. NeighborJolning tree for the two non-codlng reglons by Klmurars two parameter method. The numbers above and below branches indicate bootstrap value based on 1fl)0 replicates. Bootstrap values of 400 and under are not shown. The branch length shows relative evolutionary distance represented by the number of nucleotide substitutions per site. Scale represents 0.01 changes per site. This tree is rooted with the genenAnisoptera, Cotylebbiurn, Vatica and IJpwa. Molecular phylogeny of dipterocarp species 203
Anisoptera laqis Anisoptera thurifera Anisoptera costata 1. Slnrea bi.awak 1. Slwrea falciferoidcs 1 Sltorea genimlan Sltorea lnvilardii Sltorea sapuba Slnrea obnna Slprea faguetiana 1 Slprea fagadinnn 2 Slwru lam Shorea patoiensis Sltorea xantlaphylln Slwrea bullata Sltorea fallax Slwrea parciflora Slwrea argmtifolia Shorea wata Shorea aL:utn Slnrea femtginea 1 Slnrea ferruginea 2 Slrcrea tnacropaa Sharea curtisii Slnrea parvtfolia Slnrea qn**nsvX Shorea beccaiana Slnrea rnacroplrylla Slnrea pilosa Sltorea ruba Sltorea ovalis Parashoru lucida Hopea dryobalarnidcs Hopea grffithii Hopea nervosa Hopea dordn Neobalarncafry heimii Shorea agarni Shorea bracteolatn 0 Slnrea odtraea L Shoru roxburgii 0 Slwrea siamensis 0 Dryobalntops aromatim 5 Dryobalntops larceolan D ry obal anops ob lo n g ifu I in Dipterocarpw ahtw Diptocarpts baudii I Diptero carps palernbaniats . Dipterocarpts kerrii Upna bomeeruis Vatica micrantlw Vatica oblongifulia Vatica sarawakensis
C o ty I el ob ium lanc eo latum
Ftg. 4. The strlct consensus tree of 1292 most parsfunonlous trees for the two non'codlng regions. The numben above bnnches indicate the number. of base substitutions. The total tree length is 205' Consistency index is 0.805. Retention index is 0.195. Btack rectangles alphabetized from a to I represent the unique indels shown in the Figs. 1 and 2. This tree is rootcd lvith the gaeruAaisoptta, Cotylebbitn\ Vatica allrd Upwa. 204 K. KauryA, K. HaneoA, K. OcrNo, T. KeurA, T. Yenaeznru, H.-S. Len & P. S. AsHroN
Our results indicated that the White Meranti is monophyletic with sect. Pentacme(bootstrap probability was 97.2Vo) and it was the first group that diverged from the other Slprea species. Both the White Meranti and sect. Pentacme have unequal cotyledons and contain silica in the cells of radial tissue, while in the other groups of Shorea cotyledons are equal and silica is mostly absent (Ashton, L982). These observations are consistent with the classification mentioned above. The Selangan Batu group usually produces more hard timber compared with other groups (Symington, L943). In our phylogenetic tree, the species belonging to the Selangan Batu group was monophyletic (bootsfrap probability was 79.3Vo). The Yellow Meranti group is distinguished from the other groups by the character of the anther, wood and bark anatomy and the yellow-brown heartwood (Symington, 1943; Ashton, L982; Newman et al., 1996). Our phylogenetic tree showed that the Yellow Meranti group is also a monophyletic group (bootstrap probability was 96.9Vo).In this study, the molecular tree was consistent with the morphological classification except for the Red Meranti group. The Red Meranties have pale to dark red or occasionally brown color of heartwood (Meijea 1964). The Red Meranti group comprised three natural clades. Shorea ferruginea, S. macroptera ssp. macropterifulia and S. acuta were clustered (bootstrap probability was 83.6Vo), and this conforms with Ashton's (1982) sect. Mutica subsect. lzriculnta.Howeve! most of the other relationships in the Red Meranti group could not be ascertained because the bootstrap probabilities were very low The data in this study are insufficient for the classification of species in the Red Meranti group. Our tree, therefore, indicated that the genus Shorea was paraphyletic. In this study, the cluster of White Meranti and sect. Pentacme were situated in an outer position of the genera Hopea, Parashorea and Neobalanocarpus. The genera Hopea and, Shorea are morphologically very similar to each other, differing only in a single character. ln Hopea, two outer sepals exist and they are slightly or markedly thicker than the inner three and develop into wings in the fruit. hr Shorea, three outer sepals exist and they are thicker than the inner two and normally develop into large wings (or lobes) in the fruit (Ashton, 1982). The genus Hopea is also included in the genus Slnrea by RFLP analysis (Isumura et al., 1996). The genus Hopea was divided into two sections and four subsections by Ashton (1982): subsect. Dryobalanoides and subsect. Sphaerocarpae under sect. Dryobalanoides and subsect. Hopea and subsect. Pierua under sect. Hopea. In out phylogenetic trees, Hopea dryobalanoides and H. griffithii (subsect. Dryobalanoides , sect. Dryobalanoides) clustered together (bootstrap probability was 99.9Vo) consistent with the morphological classification of Ashton (L982). Parashorea has three longer and two shorter wings like the Shorea species (Ashton, 1982; Newman et al., 1996). Symington (1943) pointed out that Parashorea is a well-defined taxonomic group with close affinity to Shorea, in particular to sect. Anthoshorea (White Meranti group). In our NJ tree, howeve4 Parashorea lucida cltstered with Shorea ovalis (sect. Ovalis) and, S. rubra (sect. Mutica), but not significantly. Y*jita et al. (1997, in press), on the other hand, positioned Parashorea lucida n an outer place of Slnrea (S. ova&s and S. macroptera). The genus Neobalanocarpus was pointed out to have very close affinity with sect. Hopea subsect. Hopea (Ashton, 1982). Our results showed that Neobalanocarpw is a sister group of the genus Hopea (bootstrap probability was 85.57o) and supports his view This is also confirmed by Kajita et al. (1997, in press). Three deciduous species of the genus Shorea were collected in Thailand. Two of them, Shorea obtusa and S. siamensis are the main components of dry dipterocarp forests (Smitinand ef al., l98O). S. siamensis belongs to sect. Pentacme (Ashton, 1982). This clustered with S. roxburghii (sect. Anthoshorea) in our tree (bootstrap probability was 1007o). Actually, S. obmsa was pointed out to be included in sect. Shorea (Smitinand et al., L98O). S. obtusa clustered with the Malayan species Molecular phylogeny of dipterocarp species 205 classified in sect. Shorea (bootstrap probability was 68.17o). These results suggest that deciduous species of the genus Shorea in Thailand may have evolved in at least two independent lineages.
Variation within and between sections and genera The genera Shorea and Hopea showed the largest variation among the genera (Table 2). Thus the species differentiation in these two genera are considered to be older than that of the other genera. This conforms with their respective biogeography: The genera Hopea md Shorea sect' Shorea and Anthoshorea occur from Sri Lanka to Malesia whereas sect. Richetioides and the sections in Red Meranti are mostly endemic to Malesia (Ashton' 1982). 3). Sect. Mutica showed the largest average divergence compared with other sections (Table However, irmong some species of sect. Mutica, the numbers of nucleotide substitution are very small or none. These results suggest that sect. Mutica is the complex of the species which had diversified both recently and in ancient times. While sect. Richetioides has smallest divergence compared with other sections. This result suggests that the species in sect. Richetioides diverged very recently' The average rate of nucleotide substitution in chloroplast genes of higher plants is estimated to be Shorea 1.0-3.0 X tg-9 per site per year (Wolfe et al., t987). Using this value, the divergence time of and that and Hopea is estimated to be 6-18 MYA, that of Slnrea and Dryobalanops to be 7-22 MYA' of Shorea and Dipterocarpus to be l4-4t MYA. These estimates roughly coincide with the estimated age of the diversification of Dipterocarpoideae in the Tertiary period (Hotta, 1974).
Number of nucleotide substitutions in two non-coding regions In the present study, intergeneric and some of the infrageneric relationships were ascertained' However, several infrageneric relationships could not be clarified owing to an insufficient number of nucleotide substitutions. In angiosperms, sequence variations in chloroplast genes such as rbcLhave been widely used for inferring phylogenies at higher taxonomic levels (e.g. Chase et aI., 1993). Unfortunately, slow evolutionary rate of rbcl does not assure the resolution for solving the (L994) relationships between closely related species (Gielly & Taberlet, 1994)' Gielly and Taberlet found demonstrated that the trnl intron evolves 2.71 times faster than does rbcl on an average. They that of that the evolution of the trnL-trnF intergenic spacer is, on an average, 4.89 times faster than rbcl. As yet, the intergenic spacer and the intron did not provide enough information to resolve genes to inftageneric relationships in our study. It is therefore, necessiuy to use faster evolving clarify the rate the relationships in detail. The sequences of chloroplast DNA are known to evolve at only half nuclear of nuclear DNA (Wolfe et at., 1987). Infrageneric relationships may be clarified by using DNA in addition to chloroplast DNA.
ACKNOWLEDGMENTS We are gratetul to H. Tachida and E. Nitasaka, Kyushu Univenity for their useful suggestions in the data analysis and DNA experiments; J. Kuwahara and T' Yamakura' for Osaka City University for their support during the field work in t ambir National Park; Y. Ina providing a computer program SEnj.
REFERENCES
Snte Oford University Press' 242 pp' Ashton, P. S . L964 . A Marual of the Dipterocarp Trees of Brunei ' Flora Malesiana. Series I - Spermatophyta, 9 (2):237-552 (Dipterocarpaceae). Martinus Nijhoff Publ., The Netherlands' -LggZ. 206 K. KeuIYA, K. HaneoA, K. OcrNo, T. KaurA, T. Yarraezeru, H.-S. Lnn & p. S. AsuroN
chase, M' w., soltis, D.8., olmstead, R. G., Morgan, D., ks, D. H., Mishler, B. D., Duvall, M. R., y.-L., Price, R. A., Hills, H. G., eiu, Kron, K. A., Rettig, J. H., conti, E., palmer, J. D., Manhart, J. R., Sytsma, K. J., Michels, H. J., Kress, W. J., Karol, K. G., Clark, W. D., Hedren, M., Gaut, B. S., Jansen, R. K., Kim, K. -J., wimpee, c. F.,. Smith, J. F, Furnier, G. R., strauss, s. H., Xiang, e. -y., Plunkett,G. M. , Soltis, P. S., Swensen, S. M., Williams, S. E., Gadek, p. A., euinn, C. J., Eguiarte, L' 8., Golenberg, E., Learn, G. H., Jr., Graham, s. w., Barrett, s. c. H., Dayanandan, S. & Albert , V' A. 1993. Phylogenetics of seed plants: An analysis of nucleotide sequences from the plastid gene rbcL. Annals of Missouri Botanical Garden 80: 52g-5g0. Doyle, J. & Doyle, L. 1990. Isolation of plant DNA from fresh tissue. Focus 12: L3-15. Felsenstein, J. 1985' Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783-79t.
GiellS L' & Taberlet, P' 1994. The use of chloroplast DNA to resolve plant phylogenies: Noncoding versus rbcl sequences. Mo l. Biol. Evol. ll (5): 7 69 -7 77 . Hotta, M. L974. History and Geography of Plants, Evolutionary Biology in plants III, 204 pp. Sanseido, Tokyo. Johnson, L. A. & Soltis, D. E. t994. rzarK DNA sequences and phylogenetic reconstruction in Saxifragaceae s. str. Systernatic Botany 19 (1): 143-156. Kajita, T., Kamiya, K., Nakamura, N. Thchida, H., wickneswari, R., Tsumura, y., yoshimaru, H. & Yamazaki, T. 1998. Molecular phylogeny of Dipterocarpaceae in Southeast Asia based on nucleotide sequences of matK, trnL inll.on, ard trnL-trnF intergenic spacer region in chloroplast DNA. Mol. Phy. Evol. (in press). Kimura, M. 19s0. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol.16: Lll-L}o. Meijer, W. & Wood, G. H' S. 1964' Dipterocarps of Sabah (North Borneo).Sabah Forest Record No. 5, Forest Department, Sandakan. Murray, V. 1989. Improved double-strand DNA sequencing using the linear polymerase chain reaction. Nucleic Acids research 17: Z5t-257. Nei, M. & Jin, 1989' L. Variances of the average numbers of nucleotide substitutions within and between populations. Mo l. Bio. Evol. 6: 290-300. Newman, N. F, Burgess, P. F. & Whitmore, T. C. 1996. Manuals of Dipterocarps for Foresters. Borneo Island Light Hardwoods, ?s7 pp. Royal Botanic Garden Edinburgh. Saitou, N' & Nei, M. 1987' The Neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Bio. Evol. 4: 406-425. Smitinand, T., Santisuk, T. & Phengklai, C. 1.980. The manual of Dipterocarpaceae of mainland South-East Asia. Thai forestry Bulletin 12: L-IIO. Swofford, D. L. 1993' PAUP: Phylogenetic Analysis Using Parsimony, Version 3.1.1. The Illinois Natural History Survey, Champaign. Symington, c. F. 1943. Foresters manual of Dipterocarps. Malayan Forest Records No. 1.6, 244 pp. (Reprinted with plates and historical introduction, University of Malaya press, Kuala Lumpur, Le74). Thberlet, P., Gielly, L., Pautou, G. & Bouvet, G. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. plant Molecular Biology 17: 1105-1109. Terauchi, R. 1994' A polymorphic microsatellite marker from the tropical tree Dryobalanops lanceolata (Dipterocarpaceae). Jpn. J. Genet. 69: 567_576. Thompson, J. D., Higgins, D. G., Gibson, T. J. Lgg4. CLUSTAL W: improving the sensitivity of Molecular phylogeny of dipterocarp species
progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choices. Nucleic Acids Res.t2: 4673-4680' Tsumura, K., Kawahara, T., Wickneswari, R. & Yoshimura, K. L996. Molecular phylogeny of Dipterocarpaceae in Southeast Asia using RFLP of PCR- amplified cNoroplast genes. Theor Appl. Genet.93:22-29. plant Wolfe, K., Li, W.-H. & Sharp, P. M. L987. Rates of nucleotide substitution vary greatly among mitchondrial, chloroplast, and nuclear DNAs. Ploc. Natl. Acad' Sci. USA 84: 9054 -9058' Received APril 1'6' 1998 AccePted MaY t2,L998
I6;F-, HE Jt, ,'gF,ffia, IEEB, ilffiHffi' H'-s' IrE, P' s' AsIrroN *f*{6otFffi FRffi H@ffi EE?,91&Hrttc79t\li*t+ffiMatft T.trr