DOCSLIB.ORG

Acetate Activation in Methanosaeta Thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-Coa Synthetase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Acetate Activation in Methanosaeta Thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-Coa Synthetase Hindawi Publishing Corporation Archaea Volume 2012, Article ID 315153, 10 pages doi:10.1155/2012/315153 Research Article Acetate Activation in Methanosaeta thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-CoA Synthetase Stefanie Berger, Cornelia Welte, and Uwe Deppenmeier Institute for Microbiology and Biotechnology, University of Bonn, Meckenheimer Allee 168, 53115 Bonn, Germany Correspondence should be addressed to Uwe Deppenmeier, [email protected] Received 16 May 2012; Accepted 30 June 2012 Academic Editor: Francesca Paradisi Copyright © 2012 Stefanie Berger et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The thermophilic methanogen Methanosaeta thermophila uses acetate as sole substrate for methanogenesis. It was proposed that the acetate activation reaction that is needed to feed acetate into the methanogenic pathway requires the hydrolysis of two ATP, whereas the acetate activation reaction in Methanosarcina sp. is known to require only one ATP. As these organisms live at the thermodynamic limit that sustains life, the acetate activation reaction in Mt. thermophila seems too costly and was thus reevaluated. It was found that of the putative acetate activation enzymes one gene encoding an AMP-forming acetyl-CoA synthetase was highly expressed. The corresponding enzyme was purified and characterized in detail. It catalyzed the ATP-dependent formation of acetyl- CoA, AMP, and pyrophosphate (PPi) and was only moderately inhibited by PPi. The breakdown of PPi was performed by a soluble pyrophosphatase. This enzyme was also purified and characterized. The pyrophosphatase hydrolyzed the major part of PPi (KM = 0.27 ± 0.05 mM) that was produced in the acetate activation reaction. Activity was not inhibited by nucleotides or PPi. However, it cannot be excluded that other PPi-dependent enzymes take advantage of the remaining PPi and contribute to the energy balance of the cell. 1. Introduction 7–70 μM is needed [7]. Therefore, Methanosaeta species pre- vail over members of the genus Methanosarcina in low acetate Methanogenic archaea are of high ecological importance as environments frequently encountered in natural habitats. they are responsible for closure of the global carbon cycle Important biotechnological habitats are biogas facilities [8– and production of the greenhouse gases CO2 and methane 12], where Methanosaeta species are of special importance [1–3]. They are also an integral part of biogas reactors and for reactor performance and stability [12, 13]. contribute to the production of the combustible gas methane In acetate-degrading (aceticlastic) methanogenesis, ace- that is a source of renewable energy [4, 5]. Methanogenic tate first has to be activated at the expense of ATP. This reac- archaea use end products of anaerobic bacterial degradation tion can be catalysed by the high activity but low affinity ace- processes like H2/CO2 and acetate as substrates for growth. tate kinase/phosphotransacetylase (AK/PTA) system that is It is estimated that about two thirds of the methane used by Methanosarcina sp. [14, 15] or by the low-activity but produced by methanogenic archaea on earth derives from high-affinity AMP-dependent acetyl-CoA-synthetases (ACS) acetate degradation [6]. But despite its high abundance [16–18]. While the AK/PTA system generates ADP, Pi and only two genera are able to use acetate as substrate for acetyl-CoA from ATP, CoA, and acetate [15, 19, 20], the methanogenesis, namely, Methanosarcina and Methanosaeta. ACSconvertsATP,CoA,andacetatetoacetyl-CoA,AMPand While Methanosarcina species are metabolically versatile, pyrophosphate (PPi)[16, 18]. In the first step of aceticlastic members of the genus Methanosaeta are specialized on methanogenesis, acetyl-CoA is cleaved into its methyl and acetate utilization. This is reflected in a very high affinity for carbonyl moiety by the action of a CO dehydrogenase/acetyl- the substrate. For growth, a minimal concentration of only CoA synthase. In the course of this reaction, the carbonyl 2 Archaea group is oxidized to CO2 and electrons are transferred to to the manufacturer’s instructions (Ambion, Darmstadt, ferredoxin [21–23]. The methyl group is donated to the Germany). Preparations were treated with DNAse I to reduce methanogenic cofactor tetrahydrosarcinapterin and subse- DNA contaminations. Cleaning and concentration of RNA quently transferred to coenzyme M (CoM) by a membrane were achieved using the SurePrep RNA Cleanup and Con- bound Na+ translocating methyltransferase. Reduction of centration kit (Fisher Scientific, Schwerte, Germany). RNA the methyl group to methane with coenzyme B as electron purity was quantified spectrophotometrically by examining donor leads to the formation of the so-called heterodisul- the 260 nm/280 nm ratio as well as by denaturing agarose gel fide (CoM-S-S-CoB). Only recently we demonstrated that electrophoresis. Methanosaeta (Mt.) thermophila uses the heterodisulfide as Primers for qRT-PCR were designed using the Primer3 terminal electron acceptor in an anaerobic respiratory chain software (http://frodo.wi.mit.edu/primer3/input.htm). For with reduced ferredoxin as the sole electron donor [24]. the highly homologous ACS genes, the least homologous However, the way this organism conserves energy is not yet areas were used as templates to guarantee specificity of the fully understood. It can be estimated that the amount of ions primers. The genes encoding glyceraldehyde-3-phosphate translocated over the cytoplasmic membrane in the course dehydrogenase (GAP-DH, mthe 0701) and ribosomal pro- of aceticlastic methanogenesis could be sufficient for the tein S3P (mthe 1722) were chosen as reference genes. phosphorylation of two ADP molecules. Yet AMP-dependent Sequences of the primers used can be seen from Table 1. acetyl-CoA synthetase and soluble pyrophosphatase (PPiase) PCR reactions were performed according to the man- activities could be demonstrated for the closely related Mt. ufacturer’s instructions (http://www1.qiagen.com)withon concilii [16, 18, 25]. Taking non-energy coupled hydrolysis average 250 ng of RNA. The QuantiTect SYBR Green of pyrophosphate into account, two ATP equivalents are RT-PCR kit (Qiagen, Hilden, Germany) and the iCycler consumed in the course of the acetate activation reaction. (Bio-Rad, Munich, Germany) were used for labeling and According to this model, the obligate aceticlastic methanogen quantification, respectively. For data analysis, the Bio-Rad Mt. thermophila is not able to conserve energy during iCycler software was used. Each PCR product gave a single methanogenesis. To clarify this contradiction, the acetate narrow peak in the melting curve analysis. A relative value activation reaction in Mt. thermophila was reevaluated by (ΔCt) for the initial target concentration in each reaction gene expression analysis and characterization of ACS and was determined by subtracting Ct values of the reference PPiase. genes from those of the genes of interest. By subtracting ΔCt values, comparisons among the genes of interest could be accomplished. In addition, negative-control assays were 2. Materials and Methods included that were not incubated with reverse transcriptase. 2.1. Materials. All chemicals and reagents were purchased These assays contained only traces of DNA that were not from Sigma-Aldrich (Munich, Germany) or Carl Roth removed by DNase treatment. The Ct values of the negative GmbH (Karlsruhe, Germany). Restriction endonucleases, controls were analyzed and were at least five cycles higher T4 DNA ligase, Taq DNA polymerase, and PCR reagents than the assays with reverse transcriptase treatment. were purchased from Fermentas (St. Leon-Rot, Germany). Phusion DNA polymerase was purchased from New England 2.4. Cloning into Expression Vectors. Genes from Mt. Biolabs (Frankfurt am Main, Germany). Oligonucleotides thermophila were amplified from chromosomal DNA were synthesized by Eurofins (Ebersberg, Germany). extracted with CTAB [26]. Restriction endonuclease sites were inserted by PCR; Primers had the following sequences (recognition sites for restriction endonucleases 2.2. Bioinformatics. For Blast analyses, the respective tool are underlined): mthe 0236 for ATGGTAGGTCTCAAA- on NCBI (http://www.ncbi.nlm.nih.gov/) was used. For the TGGCAGATAATATCTATGTGGTCGGG, mthe 0236 rev batch Blast analysis, those proteins that had a threshold ATGGTAGGTCTCAGCGCTCTTCTTGAATGCGGA- E-value e−40 were referred to as homologous. The < CTCGAGC, mthe 1194 for ATGGTAACCTGCATTAGC- programs PsiPred (http://bioinf.cs.ucl.ac.uk/psipred/)and GCCGCTGAGACTGCAAAGACTGCTG, mthe 1194 rev InterPro (http://www.ebi.ac.uk/interpro/)wereutilizedfor ATGGTAACCTGCATTATATCAGACTATGAGCGG- bioinformatic analyses of CBS domains. GATGTTCTCG. For cloning of the pyrophosphatase gene (mthe 0236), Eco31I was used, for cloning of the AMP- 2.3. qRT-PCR. Total RNA from Mt. thermophila DSM 6194 dependent ACS gene (mthe 1194) BveI. Amplicons were cut was isolated by TRI Reagent extraction. 250 mL cultures were and ligated into pASK-IBA3 or pASK-IBA5 (IBA GmbH, grown anaerobically to the mid- to late- exponential growth Gottingen,¨ Germany) to produce pASK-mthe0236-3 and phase in DSMZ medium 387 at 55◦Cwith50mMsodium pASK-mthe1194-5, respectively. Both vectors contained acetate. The cultures were filled into centrifuge tubes in an plasmid encoded ribosomal binding sites and a Strep-tag
Load more

Recommended publications
  • The Genome Characteristics and Predicted Function of Methyl-Group Oxidation Pathway in the Obligate Aceticlastic Methanogens, Methanosaeta Spp
    The Genome Characteristics and Predicted Function of Methyl-Group Oxidation Pathway in the Obligate Aceticlastic Methanogens, Methanosaeta spp. Jinxing Zhu1,2, Huajun Zheng3, Guomin Ai1, Guishan Zhang1, Di Liu4, Xiaoli Liu1, Xiuzhu Dong1* 1 State Key Laboratory of Microbial Resources, Institute of Microbiology, Chinese Academy of Sciences, Beijing, People’s Republic of China, 2 Graduate School, Chinese Academy of Sciences, Beijing, People’s Republic of China, 3 Shanghai-MOST Key Laboratory of Health and Disease Genomics, Chinese National Human Genome Center at Shanghai, Shanghai, People’s Republic of China, 4 Information center, Institute of Microbiology, Chinese Academy of Sciences, Beijing, People’s Republic of China Abstract In this work, we report the complete genome sequence of an obligate aceticlastic methanogen, Methanosaeta harundinacea 6Ac. Genome comparison indicated that the three cultured Methanosaeta spp., M. thermophila, M. concilii and M. harundinacea 6Ac, each carry an entire suite of genes encoding the proteins involved in the methyl-group oxidation pathway, a pathway whose function is not well documented in the obligately aceticlastic methanogens. Phylogenetic analysis showed that the methyl-group oxidation-involving proteins, Fwd, Mtd, Mch, and Mer from Methanosaeta strains cluster with the methylotrophic methanogens, and were not closely related to those from the hydrogenotrophic methanogens. Quantitative PCR detected the expression of all genes for this pathway, albeit ten times lower than the genes for aceticlastic methanogenesis in strain 6Ac. Western blots also revealed the expression of fwd and mch, genes involved in methyl-group oxidation. Moreover, 13C-labeling experiments suggested that the Methanosaeta strains might use the pathway as a methyl oxidation shunt during the aceticlastic metabolism.
    [Show full text]
  • Acetogenesis in the Energy-Starved Deep Biosphere – a Paradox?
    HYPOTHESIS AND THEORY ARTICLE published: 13 January 2012 doi: 10.3389/fmicb.2011.00284 Acetogenesis in the energy-starved deep biosphere – a paradox? Mark Alexander Lever* Department of Bioscience, Center for Geomicrobiology, Aarhus University, Aarhus, Denmark Edited by: Under anoxic conditions in sediments, acetogens are often thought to be outcompeted Andreas Teske, University of North by microorganisms performing energetically more favorable metabolic pathways, such as Carolina at Chapel Hill, USA sulfate reduction or methanogenesis. Recent evidence from deep subseafloor sediments Reviewed by: Matthew Schrenk, East Carolina suggesting acetogenesis in the presence of sulfate reduction and methanogenesis has University, USA called this notion into question, however. Here I argue that acetogens can successfully Aharon Oren, The Hebrew University coexist with sulfate reducers and methanogens for multiple reasons. These include (1) of Jerusalem, Israel substantial energy yields from most acetogenesis reactions across the wide range of *Correspondence: conditions encountered in the subseafloor, (2) wide substrate spectra that enable niche Mark Alexander Lever , Department of Bioscience, Center for differentiation by use of different substrates and/or pooling of energy from a broad range Geomicrobiology, Aarhus University, of energy substrates, (3) reduced energetic cost of biosynthesis among acetogens due Ny Munkegade 114, bng 1535-1540, to use of the reductive acetyl CoA pathway for both energy production and biosynthesis DK-8000 Århus C, Denmark. coupled with the ability to use many organic precursors to produce the key intermediate e-mail: [email protected] acetyl CoA. This leads to the general conclusion that, beside Gibbs free energy yields, variables such as metabolic strategy and energetic cost of biosynthesis need to be taken into account to understand microbial survival in the energy-depleted deep biosphere.
    [Show full text]
  • Acetate Metabolism in Methanothrix Soehngenii
    ACETATE METABOLISM IN METHANOTHRIX SOEHNGENII CENTRALE LANDBOUWCATALOGUS 0000 0456 8685 Promotor: Dr. A.J . B. Zehnder, hoogleraar in de microbiologic Co-promotor: Dr. Ir. A.J . M. Stams universitair docent bij devakgroe p microbiologic M. S. M. Jetten Acetate metabolism in Methanothrix soehngenii Proefschrift ter verkrijging van de graad van doctor in de landbouw- en milieuwetenschappen op gezag van de rector magnificus, Dr. H. C. van der Plas, in het openbaar te verdedigen op vrijdag 20 december 1991 des namiddags te vier uur in de aula van de Landbouwuniversiteit te Wageningen. LAIN'DBOUWUNIVEuSIXED I WAGEMNGEN Dit promotie onderzoek werd uitgevoerd binnen het Innovatief Onderzoeks Pro- gramma biotechnologie (IOP-b) en begeleid door de Programma Commissie Industriele Biotechnologie van het Ministerie van Economische Zaken. De afronding van de promotie werd tevens mogelijk gemaakt door bijdrages van het LEB Fonds, de Landbouwuniversiteit en de vakgroep Microbiologic X N0l70't >V6> Stellingen 1. Het meten van complexe enzymreacties in cel-vrije extracten levert meer interpretatieproblemen, dan uitkomsten op. Fisher, R. and Thauer, R.K. (1988) Methanogenesis from acetate in cell extracts ofMethano- sarc'ma barken.Arch . Microbiol. 151, 459-465. 2. De bevinding van Fiala en Stetter, dat Pyrococcus furiosus alleen H2 en C02 als eindprodukten maakt, berust op onzorgvuldige analyse metho- den. Fiala, G. and Stetter, K.O (1986) Pyrococcus furiosus sp. nov. represents a novel genus of marine heterotrophic archaebacteria growing optimally at 100°C. Arch. Microbiol. 145, 56-61. 3. Het "herontdekken" van het gave=1.87 signaal in EPR spectra van het CO dehydrogenase van Clostridium thermoaceticum door Lindahl et.
    [Show full text]
  • International Code of Nomenclature of Prokaryotes
    2019, volume 69, issue 1A, pages S1–S111 International Code of Nomenclature of Prokaryotes Prokaryotic Code (2008 Revision) Charles T. Parker1, Brian J. Tindall2 and George M. Garrity3 (Editors) 1NamesforLife, LLC (East Lansing, Michigan, United States) 2Leibniz-Institut DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany) 3Michigan State University (East Lansing, Michigan, United States) Corresponding Author: George M. Garrity ([email protected]) Table of Contents 1. Foreword to the First Edition S1–S1 2. Preface to the First Edition S2–S2 3. Preface to the 1975 Edition S3–S4 4. Preface to the 1990 Edition S5–S6 5. Preface to the Current Edition S7–S8 6. Memorial to Professor R. E. Buchanan S9–S12 7. Chapter 1. General Considerations S13–S14 8. Chapter 2. Principles S15–S16 9. Chapter 3. Rules of Nomenclature with Recommendations S17–S40 10. Chapter 4. Advisory Notes S41–S42 11. References S43–S44 12. Appendix 1. Codes of Nomenclature S45–S48 13. Appendix 2. Approved Lists of Bacterial Names S49–S49 14. Appendix 3. Published Sources for Names of Prokaryotic, Algal, Protozoal, Fungal, and Viral Taxa S50–S51 15. Appendix 4. Conserved and Rejected Names of Prokaryotic Taxa S52–S57 16. Appendix 5. Opinions Relating to the Nomenclature of Prokaryotes S58–S77 17. Appendix 6. Published Sources for Recommended Minimal Descriptions S78–S78 18. Appendix 7. Publication of a New Name S79–S80 19. Appendix 8. Preparation of a Request for an Opinion S81–S81 20. Appendix 9. Orthography S82–S89 21. Appendix 10. Infrasubspecific Subdivisions S90–S91 22. Appendix 11. The Provisional Status of Candidatus S92–S93 23.
    [Show full text]
  • Evaluation of Acidogenesis Products' Effect on Biogas Production
    Detman et al. Biotechnol Biofuels (2021) 14:125 https://doi.org/10.1186/s13068-021-01968-0 Biotechnology for Biofuels RESEARCH Open Access Evaluation of acidogenesis products’ efect on biogas production performed with metagenomics and isotopic approaches Anna Detman1, Michał Bucha1,2, Laura Treu3, Aleksandra Chojnacka1,4, Łukasz Pleśniak1,5, Agnieszka Salamon6, Ewa Łupikasza2, Robert Gromadka1, Jan Gawor1, Agnieszka Gromadka1, Wojciech Drzewicki5, Marta Jakubiak5, Marek Janiga7, Irena Matyasik7, Mieczysław K. Błaszczyk4, Mariusz Orion Jędrysek5, Stefano Campanaro3* and Anna Sikora1* Abstract Background: During the acetogenic step of anaerobic digestion, the products of acidogenesis are oxidized to substrates for methanogenesis: hydrogen, carbon dioxide and acetate. Acetogenesis and methanogenesis are highly interconnected processes due to the syntrophic associations between acetogenic bacteria and hydrogenotrophic methanogens, allowing the whole process to become thermodynamically favorable. The aim of this study is to deter- mine the infuence of the dominant acidic products on the metabolic pathways of methane formation and to fnd a core microbiome and substrate-specifc species in a mixed biogas-producing system. Results: Four methane-producing microbial communities were fed with artifcial media having one dominant component, respectively, lactate, butyrate, propionate and acetate, for 896 days in 3.5-L Up-fow Anaerobic Sludge Blanket (UASB) bioreactors. All the microbial communities showed moderately diferent methane production and utilization of the substrates. Analyses of stable carbon isotope composition of the fermentation gas and the substrates 13 13 showed diferences in average values of δ C(CH4) and δ C(CO2) revealing that acetate and lactate strongly favored the acetotrophic pathway, while butyrate and propionate favored the hydrogenotrophic pathway of methane forma- tion.
    [Show full text]
  • Taxonomy and Ecology of Methanogens
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Horizon / Pleins textes FEMS Microbiology Reviews 87 (1990) 297-308 297 Pubfished by Elsevier FEMSRE 00180 Taxonomy and ecology of methanogens J.L. Garcia Laboratoire de Microbiologie ORSTOM, Université de Provence, Marseille, France Key words: Methanogens; Archaebacteria; Taxonomy; Ecology 1. INTRODUCTION methane from CO2 using alcohols as hydrogen donors; 2-propanol is oxidized to acetone, and More fhan nine reviews on taxonomy of 2-butanol to 2-butanone. Carbon monoxide may methanogens have been published during the last also be converted into methane; most hydro- decade [l-91, after the discovery of the unique genotrophic species (60%) will also use formate. biochemical and genetic properties of these Some aceticlastic species are incapable of oxidiz- organisms led to the concept of Archaebacteria at ing H,. The aceticlastic species of the genus the end of the seventies. Moreover, important Methanosurcina are the most metabolically diverse economic factors have ,placed these bacteria in the methanogens, whereas the obligate aceticlastic limelight [5], including the need to develop alter- Methanosaeta (Methanothrix) can use only acetate. native forms of energy, xenobiotic pollution con- The taxonomy of the methanogenic bacteria trol, the enhancement of meat yields in the cattle has been extensively revised in the light of new industry, the distinction between biological and information based on comparative studies of 16 S thermocatalytic petroleum generation, and the rRNA oligonucleotide sequences, membrane lipid global distribution of methane in the earth's atmo- composition, and antigenic fingerprinting data. sphere. The phenotypic characteristics often do not pro- vide a sufficient means of distinguishing among taxa or determining the phylogenetic position of a 2.
    [Show full text]
  • Changes in Microbial Communities and Associated Water and Gas Geochemistry Across a Sulfate Gradient in Coal Beds: Powder River Basin, USA
    Changes in microbial communities and associated water and gas geochemistry across a sulfate gradient in coal beds: Powder River Basin, USA Authors: Hannah D. Schweitzer, Daniel Ritter, Jennifer McIntosh, Elliott Barnhart, Alfred B. Cunningham, David Vinson, William Orem, and Matthew W. Fields NOTICE: this is the author’s version of a work that was accepted for publication in Geochimica et Cosmochimica Acta. Changes resulting from the publishing process, such as peer review, editing, corrections, structural formatting, and other quality control mechanisms may not be reflected in this document. Changes may have been made to this work since it was submitted for publication. A definitive version was subsequently published in Geochimica et Cosmochimica Acta, VOL# 245, (January 2019), DOI# 10.1016/j.gca.2018.11.009. Schweitzer, Hannah D., Daniel Ritter, Jennifer McIntosh, Elliott Barnhart, Alfred B. Cunningham, David Vinson, William Orem, and Matthew W. Fields, “Changes in microbial communities and associated water and gas geochemistry across redox gradients in coal beds: Powder River Basin, US,” Geochimica et Cosmochimica Acta, January 2019, 245: 495-513. doi: 10.1016/ j.gca.2018.11.009 Made available through Montana State University’s ScholarWorks scholarworks.montana.edu *Manuscript Title: Changes in microbial communities and associated water and gas geochemistry across a sulfate gradient in coal beds: Powder River Basin, USA Authors: Hannah Schweitzer1,2,3, Daniel Ritter4, Jennifer McIntosh4, Elliott Barnhart5,3, Al B. Cunningham2,3, David Vinson6, William Orem7, and Matthew Fields1,2,3,* Affiliations: 1Department of Microbiology and Immunology, Montana State University, Bozeman, MT, 59717, USA 2Center for Biofilm Engineering, Montana State University, Bozeman, MT, 59717, USA 3Energy Research Institute, Montana State University, Bozeman, MT, 59717, USA 4Department of Hydrology and Atmospheric Sciences, University of Arizona, Tucson, Arizona 85721, USA 5U.S.
    [Show full text]
  • Methanothrix Soehngenii and Rejection of Methanothrix Concilii As a Synonym of Methanothrix Soehngenii
    INTERNATIONAL JOURNALOF SYSTEMATIC BACTERIOLOGY,Jan. 1988, p. 30-36 Vol. 38, No. 1 0020-7713/881010030-07$02.00/0 Copyright 0 1988, International Union of Microbiological Societies Description of a New Strain of Methanothrix soehngenii and Rejection of Methanothrix concilii as a Synonym of Methanothrix soehngenii JEAN PIERRE TOUZEL,l* GERARD PRENSIER,, JEAN LOUIS ROUSTAN ,l ISABELLE THOMAS,l HENRI CHARLES DUBOURGUIER,l AND GUY ALBAGNAC' Institut National de la Recherche Agronomique, Station de Technologie Alimentaire,' and lnstitut National de la Santt et de la Recherche MPdicale, Unite' 42,2B.P. 39, F-59651 Villeneuve d'Ascq Ce'dex, France A new mesophilic strain of Methanothrix, strain FE, was highly purified from the sludge of an anaerobic digester after enrichment on sodium acetate and is described. Strain FE was compared with other strains of Methanothrix, Methanothrix soehngenii strain OpfikonT (= DSM 2139T) (T = type strain) and Methanothrix concilii strain GP6T (= DSM 3671T). The differences within the strains were mainly related to their requirement for yeast extract. The three strains were found to be similar in their deoxyribonucleic acid guanine-plus-cytosinecontents (50.2 to 52.6 mol %) and showed 100 % deoxyribonucleic acid-deoxyribonucleic acid homology. For these reasons we propose to recognize synonymy, reject the name Methanothrix concilii Patel 1985, 35223, and assign this organism to the species Methanothrix soehngenii Huser, Wuhrmann and Zehnder 1983, 33:439. Methanothrix soehngenii was first isolated by serial dilu- The sterile media were inoculated with 2% (vol/vol) portions tion from a continuous culture on acetate starting from of previous cultures. anaerobically digested sludge in Switzerland (17, 40; B.
    [Show full text]
  • Hydrogenotrophic Activity of Strain RWL1 Similar to Methanothrix Soehngenii
    Madras Agric. J., 2019; doi:10.29321/MAJ 2019.000310 RESEARCH ARTICLE Hydrogenotrophic activity of strain RWL1 similar to Methanothrix soehngenii 1 1 2 1,3 Godwin Blesy , Danenjeyan Balachandar , Kamaludeen Sara Parwin Banu and Subburamu Karthikeyan 1Department of Agricultural Microbiology, Tamil Nadu Agricultural University, Coimbatore - 641 003. 2Department of Environmental Science, Tamil Nadu Agricultural University, Coimbatore - 641 003. 3Department of Renewable Energy Engineering, AEC & RI, Tamil Nadu Agricultural University, Coimbatore - 641 003. ABSTRACT Methanogens are strictly anaerobic organisms that produce methane. Based on the nature of substrate utilization, they are classified into acetoclastic, Received : 07th November, 2019 hydrogenotrophic, and methylotrophic methanogens. Methanothrix Revised : 12th November, 2019 soehngenii is a methanogen believed to be acetoclastic. A strain RWL1, similar to M. soehngenii with hydrogenotrophic activity, has been isolated, Accepted : 13th November, 2019 characterized and identified based on 16S rRNA sequencing. The strain RWL1 utilizes H2+CO2 (4:1) and has recorded methane production of 74.82%, thereby opening a new gate for substrate diversity studies. This study reveals the hydrogenotrophic nature of strain RWL1 clustered with M. soehngenii. Keywords: Anaerobe, methanogen, aceticlastic, hydrogenotrophic, substrate. INTRODUCTION Coimbatore (11°.005’13” N, 76°.93’045” E) under anoxic condition. Isolation was done by Hungate’s Carbon sequestration is an essential roll tube technique using Modified Hungate’s phenomenon for ecological balance. Life on medium (Hungate, 1969) and incubated for 15 earth is impossible without this phenomenon days in an anaerobic jar (Hi media laboratories) of (Marris, 2006). Methanogenesis is one such 3.5 litres capacity. The anaerobic condition inside process exhibited by a special group of organisms the jar has been maintained by anaerobic gaspak called methanogens.
    [Show full text]
  • Low Substrate Loading Limits Methanogenesis and Leads to High Coulombic Efficiency in Bioelectrochemical Systems
    microorganisms Opinion Low Substrate Loading Limits Methanogenesis and Leads to High Coulombic Efficiency in Bioelectrochemical Systems Tom H. J. A. Sleutels 1,*,†, Sam D. Molenaar 1,2,†, Annemiek Ter Heijne 2 and Cees J. N. Buisman 1,2 Received: 30 October 2015; Accepted: 28 December 2015; Published: 5 January 2016 Academic Editor: Willy Verstraete 1 Wetsus, European Centre of Excellence for Sustainable Water Technology, Oostergoweg 9, P.O. Box 1113, Leeuwarden 8911 MA, The Netherlands; [email protected] (S.D.M.); [email protected] (C.J.N.B.) 2 Sub-Department of Environmental Technology, Wageningen University, Bornse Weilanden 9, P.O. Box 17, Wageningen 6700 AA, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +31-582-843-000 † These authors contributed equally to this work. Abstract: A crucial aspect for the application of bioelectrochemical systems (BESs) as a wastewater treatment technology is the efficient oxidation of complex substrates by the bioanode, which is reflected in high Coulombic efficiency (CE). To achieve high CE, it is essential to give a competitive advantage to electrogens over methanogens. Factors that affect CE in bioanodes are, amongst others, the type of wastewater, anode potential, substrate concentration and pH. In this paper, we focus on acetate as a substrate and analyze the competition between methanogens and electrogens from a thermodynamic and kinetic point of view. We reviewed experimental data from earlier studies and propose that low substrate loading in combination with a sufficiently high anode overpotential plays a key-role in achieving high CE. Low substrate loading is a proven strategy against methanogenic activity in large-scale reactors for sulfate reduction.
    [Show full text]
  • Microorganisms
    microorganisms Article Butyrate Conversion by Sulfate-Reducing and Methanogenic Communities from Anoxic Sediments of Aarhus Bay, Denmark Derya Ozuolmez 1, Elisha K. Moore 2,3, Ellen C. Hopmans 2, Jaap S. Sinninghe Damsté 2,4 , Alfons J. M. Stams 1 and Caroline M. Plugge 1,* 1 Laboratory of Microbiology, Wageningen University & Research, 6708 WE Wageningen, The Netherlands; [email protected] (D.O.); [email protected] (A.J.M.S.) 2 Department of Marine Microbiology and Biogeochemistry, NIOZ Royal Netherlands Institute for Sea Research, and Utrecht University, P.O. Box 59, 1790 AB Den Burg, The Netherlands; [email protected] (E.K.M.); [email protected] (E.C.H.); [email protected] (J.S.S.D.) 3 Department of Environmental Science, Rowan University, 201 Mullica Hill Rd, Glassboro, NJ 08028, USA 4 Faculty of Geosciences, Utrecht University, P.O. Box 80.021, 3508 TA Utrecht, The Netherlands * Correspondence: [email protected]; Tel.: +31-317-483116 Received: 27 March 2020; Accepted: 19 April 2020; Published: 22 April 2020 Abstract: The conventional perception that the zone of sulfate reduction and methanogenesis are separated in high- and low-sulfate-containing marine sediments has recently been changed by studies demonstrating their co-occurrence in sediments. The presence of methanogens was linked to the presence of substrates that are not used by sulfate reducers. In the current study, we hypothesized that both groups can co-exist, consuming common substrates (H2 and/or acetate) in sediments. We enriched butyrate-degrading communities in sediment slurries originating from the sulfate, sulfate–methane transition, and methane zone of Aarhus Bay, Denmark.
    [Show full text]
  • Extracellular Electron Uptake in Methanosarcinales Is Independent of Multiheme C-Type Cytochromes Mon Oo Yee & Amelia-Elena Rotaru*
    www.nature.com/scientificreports OPEN Extracellular electron uptake in Methanosarcinales is independent of multiheme c-type cytochromes Mon Oo Yee & Amelia-Elena Rotaru* The co-occurrence of Geobacter and Methanosarcinales is often used as a proxy for the manifestation of direct interspecies electron transfer (DIET) in the environment. Here we tested eleven new co- culture combinations between methanogens and electrogens. Previously, only the most electrogenic Geobacter paired by DIET with Methanosarcinales methanogens, namely G. metallireducens and G. hydrogenophilus. Here we provide additional support, and show that fve additional Methanosarcinales paired with G. metallireducens, while a strict hydrogenotroph could not. We also show that G. hydrogenophilus, which is incapable to grow with a strict hydrogenotrophic methanogen, could pair with a strict non-hydrogenotrophic Methanosarcinales. Likewise, an electrogen outside the Geobacter cluster (Rhodoferrax ferrireducens) paired with Methanosarcinales but not with strict hydrogenotrophic methanogens. The ability to interact with electrogens appears to be conserved among Methanosarcinales, the only methanogens with c-type cytochromes, including multihemes (MHC). Nonetheless, MHC, which are often linked to extracellular electron transfer, were neither unique nor universal to Methanosarcinales and only two of seven Methanosarcinales tested had MHC. Of these two, one strain had an MHC-deletion knockout available, which we hereby show is still capable to retrieve extracellular electrons from G. metallireducens or an electrode suggesting an MHC- independent strategy for extracellular electron uptake. Direct interspecies electron transfer (DIET) was discovered in an artifcial co-culture of an ethanol-oxidizing Geobacter metallireducens with a fumarate-reducing Geobacter sulfurreducens where the possibility of hydrogen 1,2 gas (H2) or formate transfer was invalidated through genetic studies .
    [Show full text]