MRPL55 (NM 181456) Human Untagged Clone – SC107281
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
(BPA) Exposure Biomarkers in Ovarian Cancer
Journal of Clinical Medicine Article Identification of Potential Bisphenol A (BPA) Exposure Biomarkers in Ovarian Cancer Aeman Zahra 1, Qiduo Dong 1, Marcia Hall 1,2 , Jeyarooban Jeyaneethi 1, Elisabete Silva 1, Emmanouil Karteris 1,* and Cristina Sisu 1,* 1 Biosciences, College of Health, Medicine and Life Sciences, Brunel University London, Uxbridge UB8 3PH, UK; [email protected] (A.Z.); [email protected] (Q.D.); [email protected] (M.H.); [email protected] (J.J.); [email protected] (E.S.) 2 Mount Vernon Cancer Centre, Northwood HA6 2RN, UK * Correspondence: [email protected] (E.K.); [email protected] (C.S.) Abstract: Endocrine-disrupting chemicals (EDCs) can exert multiple deleterious effects and have been implicated in carcinogenesis. The xenoestrogen Bisphenol A (BPA) that is found in various consumer products has been involved in the dysregulation of numerous signalling pathways. In this paper, we present the analysis of a set of 94 genes that have been shown to be dysregulated in presence of BPA in ovarian cancer cell lines since we hypothesised that these genes might be of biomarker potential. This study sought to identify biomarkers of disease and biomarkers of disease- associated exposure. In silico analyses took place using gene expression data extracted from The Cancer Genome Atlas (TCGA) and the Genotype-Tissue Expression (GTEx) databases. Differential expression was further validated at protein level using immunohistochemistry on an ovarian cancer tissue microarray. We found that 14 out of 94 genes are solely dysregulated in the presence of BPA, while the remaining 80 genes are already dysregulated (p-value < 0.05) in their expression pattern Citation: Zahra, A.; Dong, Q.; Hall, as a consequence of the disease. -
Plasma Fatty Acid Ratios Affect Blood Gene Expression Profiles - a Cross-Sectional Study of the Norwegian Women and Cancer Post-Genome Cohort
Plasma Fatty Acid Ratios Affect Blood Gene Expression Profiles - A Cross-Sectional Study of the Norwegian Women and Cancer Post-Genome Cohort Karina Standahl Olsen1*, Christopher Fenton2, Livar Frøyland3, Marit Waaseth4, Ruth H. Paulssen2, Eiliv Lund1 1 Department of Community Medicine, University of Tromsø, Tromsø, Norway, 2 Department of Clinical Medicine, University of Tromsø, Tromsø, Norway, 3 National Institute of Nutrition and Seafood Research (NIFES), Bergen, Norway, 4 Department of Pharmacy, University of Tromsø, Tromsø, Norway Abstract High blood concentrations of n-6 fatty acids (FAs) relative to n-3 FAs may lead to a ‘‘physiological switch’’ towards permanent low-grade inflammation, potentially influencing the onset of cardiovascular and inflammatory diseases, as well as cancer. To explore the potential effects of FA ratios prior to disease onset, we measured blood gene expression profiles and plasma FA ratios (linoleic acid/alpha-linolenic acid, LA/ALA; arachidonic acid/eicosapentaenoic acid, AA/EPA; and total n-6/n-3) in a cross-section of middle-aged Norwegian women (n = 227). After arranging samples from the highest values to the lowest for all three FA ratios (LA/ALA, AA/EPA and total n-6/n-3), the highest and lowest deciles of samples were compared. Differences in gene expression profiles were assessed by single-gene and pathway-level analyses. The LA/ALA ratio had the largest impact on gene expression profiles, with 135 differentially expressed genes, followed by the total n-6/ n-3 ratio (125 genes) and the AA/EPA ratio (72 genes). All FA ratios were associated with genes related to immune processes, with a tendency for increased pro-inflammatory signaling in the highest FA ratio deciles. -
Noncoding Rnas As Novel Pancreatic Cancer Targets
NONCODING RNAS AS NOVEL PANCREATIC CANCER TARGETS by Amy Makler A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Science In Partial Fulfillment of the Requirements for the Degree of Master of Science Florida Atlantic University Boca Raton, FL August 2018 Copyright 2018 by Amy Makler ii ACKNOWLEDGEMENTS I would first like to thank Dr. Narayanan for his continuous support, constant encouragement, and his gentle, but sometimes critical, guidance throughout the past two years of my master’s education. His faith in my abilities and his belief in my future success ensured I continue down this path of research. Working in Dr. Narayanan’s lab has truly been an unforgettable experience as well as a critical step in my future endeavors. I would also like to extend my gratitude to my committee members, Dr. Binninger and Dr. Jia, for their support and suggestions regarding my thesis. Their recommendations added a fresh perspective that enriched our initial hypothesis. They have been indispensable as members of my committee, and I thank them for their contributions. My parents have been integral to my successes in life and their support throughout my education has been crucial. They taught me to push through difficulties and encouraged me to pursue my interests. Thank you, mom and dad! I would like to thank my boyfriend, Joshua Disatham, for his assistance in ensuring my writing maintained a logical progression and flow as well as his unwavering support. He was my rock when the stress grew unbearable and his encouraging words kept me pushing along. -
MRPL55 (NM 181464) Human Tagged ORF Clone Lentiviral Particle Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC219724L4V MRPL55 (NM_181464) Human Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: MRPL55 (NM_181464) Human Tagged ORF Clone Lentiviral Particle Symbol: MRPL55 Synonyms: AAVG5835; L55nt; MRP-L55; PRO19675 Vector: pLenti-C-mGFP-P2A-Puro (PS100093) ACCN: NM_181464 ORF Size: 384 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(RC219724). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_181464.2, NP_852129.1 RefSeq Size: 662 bp RefSeq ORF: 387 bp Locus ID: 128308 UniProt ID: Q7Z7F7, A0A024R3U3 MW: 15.1 kDa This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 MRPL55 (NM_181464) Human Tagged ORF Clone Lentiviral Particle – RC219724L4V Gene Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. -
Influenza-Specific Effector Memory B Cells Predict Long-Lived Antibody Responses to Vaccination in Humans
bioRxiv preprint doi: https://doi.org/10.1101/643973; this version posted February 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Influenza-specific effector memory B cells predict long-lived antibody responses to vaccination in humans Anoma Nellore1, Esther Zumaquero2, Christopher D. Scharer3, Rodney G. King2, Christopher M. Tipton4, Christopher F. Fucile5, Tian Mi3, Betty Mousseau2, John E. Bradley6, Fen Zhou2, Paul A. Goepfert1, Jeremy M. Boss3, Troy D. Randall6, Ignacio Sanz4, Alexander F. Rosenberg2,5, Frances E. Lund2 1Dept. of Medicine, Division of Infectious Disease, 2Dept of Microbiology, 5Informatics Institute, 6Dept. of Medicine, Division of Clinical Immunology and Rheumatology and at The University of Alabama at Birmingham, Birmingham, AL 35294 USA 3Dept. of Microbiology and Immunology and 4Department of Medicine, Division of Rheumatology Emory University, Atlanta, GA 30322, USA Correspondence should be addressed to: Frances E. Lund, PhD Charles H. McCauley Professor and Chair Dept of Microbiology University of Alabama at Birmingham 276 BBRB Box 11 1720 2nd Avenue South Birmingham AL 35294-2170 [email protected] SHORT RUNNING TITLE: Effector memory B cell development after influenza vaccination 1 bioRxiv preprint doi: https://doi.org/10.1101/643973; this version posted February 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Seasonal influenza vaccination elicits hemagglutinin (HA)-specific CD27+ memory B cells (Bmem) that differ in expression of T-bet, BACH2 and TCF7. -
The Ribosomal Protein Genes and Minute Loci of Drosophila
Open Access Research2007MarygoldetVolume al. 8, Issue 10, Article R216 The ribosomal protein genes and Minute loci of Drosophila melanogaster Steven J Marygold*, John Roote†, Gunter Reuter‡, Andrew Lambertsson§, Michael Ashburner†, Gillian H Millburn†, Paul M Harrison¶, Zhan Yu¶, Naoya Kenmochi¥, Thomas C Kaufman#, Sally J Leevers* and Kevin R Cook# Addresses: *Growth Regulation Laboratory, Cancer Research UK London Research Institute, Lincoln's Inn Fields, London WC2A 3PX, UK. †Department of Genetics, University of Cambridge, Downing Street, Cambridge CB2 3EH, UK. ‡Institute of Genetics, Biologicum, Martin Luther University Halle-Wittenberg, Weinbergweg, Halle D-06108, Germany. §Institute of Molecular Biosciences, University of Oslo, Blindern, Olso N-0316, Norway. ¶Department of Biology, McGill University, Dr Penfield Ave, Montreal, Quebec H3A 1B1, Canada. ¥Frontier Science Research Center, University of Miyazaki, 5200 Kihara, Kiyotake, Miyazaki 889-1692, Japan. #Department of Biology, Indiana University, E. Third Street, Bloomington, IN 47405-7005, USA. Correspondence: Steven J Marygold. Email: [email protected]. Kevin R Cook. Email: [email protected] Published: 10 October 2007 Received: 17 June 2007 Revised: 10 October 2007 Genome Biology 2007, 8:R216 (doi:10.1186/gb-2007-8-10-r216) Accepted: 10 October 2007 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2007/8/10/R216 © 2007 Marygold et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. -
The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan
INVESTIGATION The Relationship Between Long-Range Chromatin Occupancy and Polymerization of the Drosophila ETS Family Transcriptional Repressor Yan Jemma L. Webber,*,1 Jie Zhang,*,†,1 Lauren Cote,* Pavithra Vivekanand,*,2 Xiaochun Ni,‡,§ Jie Zhou,§ Nicolas Nègre,**,3 Richard W. Carthew,†† Kevin P. White,‡,§,** and Ilaria Rebay*,†,4 *Ben May Department for Cancer Research, †Committee on Cancer Biology, ‡Department of Ecology and Evolution, §Department of Human Genetics, and **Institute for Genomics and Systems Biology, University of Chicago, Chicago, Illinois 60637, and ††Department of Molecular Biosciences, Northwestern University, Evanston, Illinois 60208 ABSTRACT ETS family transcription factors are evolutionarily conserved downstream effectors of Ras/MAPK signaling with critical roles in development and cancer. In Drosophila, the ETS repressor Yan regulates cell proliferation and differentiation in a variety of tissues; however, the mechanisms of Yan-mediated repression are not well understood and only a few direct target genes have been identified. Yan, like its human ortholog TEL1, self-associates through an N-terminal sterile a-motif (SAM), leading to speculation that Yan/TEL1 polymers may spread along chromatin to form large repressive domains. To test this hypothesis, we created a monomeric form of Yan by recombineering a point mutation that blocks SAM-mediated self-association into the yan genomic locus and compared its genome-wide chromatin occupancy profile to that of endogenous wild-type Yan. Consistent with the spreading model predictions, wild-type Yan-bound regions span multiple kilobases. Extended occupancy patterns appear most prominent at genes encoding crucial developmental regulators and signaling molecules and are highly conserved between Drosophila melanogaster and D. virilis, suggest- ing functional relevance. -
Variation in Protein Coding Genes Identifies Information Flow
bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 1 1 2 3 4 5 Variation in protein coding genes identifies information flow as a contributor to 6 animal complexity 7 8 Jack Dean, Daniela Lopes Cardoso and Colin Sharpe* 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Institute of Biological and Biomedical Sciences 25 School of Biological Science 26 University of Portsmouth, 27 Portsmouth, UK 28 PO16 7YH 29 30 * Author for correspondence 31 [email protected] 32 33 Orcid numbers: 34 DLC: 0000-0003-2683-1745 35 CS: 0000-0002-5022-0840 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Abstract bioRxiv preprint doi: https://doi.org/10.1101/679456; this version posted June 21, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Animal complexity and information flow 2 1 Across the metazoans there is a trend towards greater organismal complexity. How 2 complexity is generated, however, is uncertain. Since C.elegans and humans have 3 approximately the same number of genes, the explanation will depend on how genes are 4 used, rather than their absolute number. -
Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ...................................................... -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name mitochondrial ribosomal protein L55 Gene Symbol Mrpl55 Organism Mouse Gene Summary Description Not Available Gene Aliases 2810038N09Rik RefSeq Accession No. NC_000077.6, NT_096135.6 UniGene ID Mm.282694 Ensembl Gene ID ENSMUSG00000036860 Entrez Gene ID 67212 Assay Information Unique Assay ID qMmuCEP0057601 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSMUST00000108786, ENSMUST00000108787, ENSMUST00000045697, ENSMUST00000108785, ENSMUST00000108784 Amplicon Context Sequence CTGAACGATATAAACAGTTTTGGACCAAGACCAAGAAATAAGTCTGTCAGGGAGT TCCACCAGGGACATTTTGTAAGGATGGAGGGCATCTATCTATTTACCATACGTTC TTGAAACCATAACCACCTGTC Amplicon Length (bp) 101 Chromosome Location 11:59205767-59205897 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9998 cDNA Cq 21.33 cDNA Tm (Celsius) 80 gDNA Cq 24.89 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Mrpl55, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.