DOCSLIB.ORG

Discovery of Recombinases Enables Genome Mining of Cryptic Biosynthetic Gene Clusters in Burkholderiales Species

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Discovery of Recombinases Enables Genome Mining of Cryptic Biosynthetic Gene Clusters in Burkholderiales Species Discovery of recombinases enables genome mining of cryptic biosynthetic gene clusters in Burkholderiales species Xue Wanga,1, Haibo Zhoua,1, Hanna Chena,b,1, Xiaoshu Jinga, Wentao Zhenga, Ruijuan Lia, Tao Suna, Jiaqi Liua, Jun Fua, Liujie Huoa, Yue-zhong Lia, Yuemao Shena, Xiaoming Dingc, Rolf Müllerd, Xiaoying Biana,2, and Youming Zhanga,2 aShandong University-Helmholtz Institute of Biotechnology, State Key Laboratory of Microbial Technology, School of Life Sciences, Shandong University, 266237 Qingdao, China; bHunan Provincial Key Laboratory for Microbial Molecular Biology, State Key Laboratory of Development Biology of Freshwater Fish, College of Life Science, Hunan Normal University, Changsha 410081, People’s Republic of China; cCollaborative Innovation Center for Genetics and Development, State Key Laboratory of Genetic Engineering, Department of Microbiology, School of Life Sciences, Fudan University, 200433 Shanghai, China; and dDepartment of Microbial Natural Products, Helmholtz Institute for Pharmaceutical Research, Helmholtz Centre for Infection Research and Saarland University, 66123 Saarbrücken, Germany Edited by Jerrold Meinwald, Cornell University, Ithaca, NY, and approved March 28, 2018 (received for review December 1, 2017) Bacterial genomes encode numerous cryptic biosynthetic gene RecE/RecT from Rac prophage, encoded in the E. coli chromosome clusters (BGCs) that represent a largely untapped source of drugs (10–13). Full-length RecE and RecT mediate linear−linear ho- or pesticides. Mining of the cryptic products is limited by the mologous recombination (LLHR), which can be used to directly unavailability of streamlined genetic tools in native producers. clone large DNA regions from genomic DNA into E. coli ex- Precise genome engineering using bacteriophage recombinases is pression vectors (14), while Redα and Redβ promote homolo- particularly useful for genome mining. However, recombinases gous recombination between linear and circular DNA molecule are usually host-specific. The genome-guided discovery of novel [linear plus circular homologous recombination (LCHR)]. In recombinases and their transient expression could boost cryptic addition, Redαβ recombineering is particularly relevant to bacterial BGC mining. Herein, we reported a genetic system employing Red genome engineering for genome mining, because the linear targeting recombinases from Burkholderiales strain DSM 7029 for efficient DNA carrying short homology regions (conveniently generated by MICROBIOLOGY genome engineering in several Burkholderiales species that currently PCR) is sufficient for gene modification, and dedicated targeting lack effective genetic tools. Using specialized recombinases-assisted plasmids are not required, unlike in single- or double-crossover in situ insertion of functional promoters, we successfully mined five mutagenesis (15). The Redαβ system from E. coli has been directly cryptic nonribosomal peptide synthetase/polyketide synthase BGCs, applied to several closely related Gram-negative bacteria for genome two of which were silent. Two classes of lipopeptides, glidopeptins engineering, e.g., Salmonella enterica (16), Klebsiella pneumo- and rhizomides, were identified through extensive spectroscopic niae (17), Agrobacterium tumefaciens (18), Pantoea ananatis characterization. This recombinase expression strategy offers utility (19), and naturally transformable Burkholderia species (20, 21). CHEMISTRY within other bacteria species, allowing bioprospecting for potentially scalable discovery of novel metabolites with attractive bioactivities. Significance recombinases | genome mining | Burkholderiales | lipopeptide | natural product Natural products biosynthesized by cryptic gene clusters rep- resent a largely untapped source for drug discovery. However, mining of these products by promoter engineering is restricted acteria represent an important source of medicines and by the lack of streamlined genetic tools, especially in nonmodel pesticides (1, 2). Current genome sequencing projects have B biosynthetic gene cluster (BGC)-rich bacteria. Here, we describe revealed a large number of biosynthetic gene clusters (BGCs), the discovery of a pair of bacteriophage recombinases and but their natural products have not yet been identified (3–5). The application of recombinase-assisted promoter engineering to enzymes encoded by these unexploited biosynthetic genes may rapidly identify and activate several cryptic biosynthetic gene synthesize metabolites that could serve as a reservoir of novel clusters in two Burkholderiales strains that currently lack ef- scaffolds for drug screening (6). Two major genome mining fective genetic tools. Construction of an efficient genome en- strategies, featuring homologous and heterologous expression, gineering platform in a natural product producer expedites were employed to mine cryptic BGCs (7). Homologous expres- mining of cryptic BGCs in their native backgrounds, and host sion in the native producers ensures proper substrates, precur- melioration for yield or structure optimization. This strategy sors, cofactors, and accessory factors for biosynthesis, which enables potentially scalable discovery of novel metabolites could maximize generation of cryptic BGC biosynthesis prod- with intriguing bioactivities from many other bacteria. ucts. However, this strategy requires efficient genetic manipu- lation tools in the producers to meet the demand of high- Author contributions: X.B. and Y.Z. designed research; X.W., H.Z., H.C., X.J., W.Z., T.S., and throughput genome mining in the postgenomic era. Recently, J.L. performed research; R.L. and J.F. contributed new reagents/analytic tools; X.W., H.Z., H.C., L.H., Y.-z.L., Y.S., X.D., R.M., X.B., and Y.Z. analyzed data; and X.W., H.Z., H.C., X.B., yeast homologous recombination and CRISPR-Cas9 strategies and Y.Z. wrote the paper. were harnessed to activate silent BGCs by promoter engineering The authors declare no conflict of interest. in metagenomic DNA and natural product proficient strepto- This article is a PNAS Direct Submission. mycetes, respectively (8, 9). However, in other natural product This open access article is distributed under Creative Commons Attribution-NonCommercial- producers, such as bacilli, Burkholderiales, myxobacteria, and NoDerivatives License 4.0 (CC BY-NC-ND). cyanobacteria, scalable and efficient genome manipulation is still 1X.W., H.Z., and H.C. contributed equally to this work. a frustrating challenge. 2To whom correspondence may be addressed. Email: [email protected] or Red/ET recombineering is an in vivo homologous recombination- [email protected]. based genetic engineering method employed primarily in Escherichia This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. coli by using short homology arms (∼50 bp) based on the expression of 1073/pnas.1720941115/-/DCSupplemental. either Redα/Redβ from the Red operon of λ phage or the analogous www.pnas.org/cgi/doi/10.1073/pnas.1720941115 PNAS Latest Articles | 1of9 Downloaded by guest on September 23, 2021 However, it is not functional in other Burkholderiales strains (20, recombinases were also applied to other Burkholderiales strains 21). In more distant species, host-specific Redαβ or RecET ho- that currently lack effective genetic tools and native Redαβ homo- molog systems are mandatory (22–29). logs, which resulted in the successful identification of two cryptic The order Burkholderiales belongs to β-Proteobacteria and NRPS BGCs. Two of five identified BGCs were silent (i.e., products includes several pathogenic bacteria and several environmental not detectable by liquid chromatography-mass spectrometry (LC- species. A number of Burkholderiales genomes contain plentiful MS) analysis in their native hosts under the given conditions). In putative natural product BGCs (4, 5, 30, 31). The proportion of addition, two classes of lipopeptides, glidopeptins and rhizomides, polyketide synthases (PKSs) and nonribosomal peptide synthe- were identified from DSM 7029 and Paraburkholderia rhizoxinica tases (NRPSs) in Burkholderia genomes is second only to that of HKI 454 (36), respectively. actinobacteria and is higher than that of bacilli, cyanobacteria, and myxobacteria (32). Burkholderia species also exhibit great Results biosynthetic potential for production of siderophores and lip- Host-Specific Phage-Derived Recombinase Pairs in Burkholderiales. It opeptides (31). Thus, Burkholderiales species have emerged as a had been shown that the Redαβ or RecET recombinases from new source of natural products with a plethora of BGCs still E. coli could not be applied to nonnaturally transformable Bur- cryptic or silent (31–34). To access these BGCs, it is urgent to kholderia strains (21). This study also confirmed that Redαβ was invent Burkholderiales specific homologous expression systems, not functional in the Burkholderiales strain DSM 7029 (Fig. 2). particularly, novel Red/ET recombinases from Burkholderiales BlastP analysis using the amino acid sequences from E. coli Redαβ strains for efficient genome engineering. or RecET as queries revealed 7 Redαβ-like and 10 RecET-like This study invented a workflow for the discovery of novel recombinase pairs in ∼1,000 Burkholderiales strains (most of which recombinases and the associated transient expression system to belong to Burkholderia and Paraburkholderia genera) (SI Appendix, facilitate in situ promoter insertion for cryptic BGC mining (Fig. Table S1). A Redαβ-like operon in DSM 7029 contains
Load more

Recommended publications
  • Multilayered Horizontal Operon Transfers from Bacteria Reconstruct a Thiamine Salvage Pathway in Yeasts
    Multilayered horizontal operon transfers from bacteria reconstruct a thiamine salvage pathway in yeasts Carla Gonçalvesa and Paula Gonçalvesa,1 aApplied Molecular Biosciences Unit-UCIBIO, Departamento de Ciências da Vida, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica, Portugal Edited by Edward F. DeLong, University of Hawaii at Manoa, Honolulu, HI, and approved September 22, 2019 (received for review June 14, 2019) Horizontal acquisition of bacterial genes is presently recognized as nisms presumed to have facilitated a transition from bacterial an important contribution to the adaptation and evolution of operon transcription to eukaryotic-style gene expression were eukaryotic genomes. However, the mechanisms underlying ex- proposed, such as gene fusion giving rise to multifunctional pro- pression and consequent selection and fixation of the prokaryotic teins (6, 23, 24), increase in intergenic distances between genes to genes in the new eukaryotic setting are largely unknown. Here we generate room for eukaryotic promoters, and independent tran- show that genes composing the pathway for the synthesis of the scription producing mRNAs with poly(A) tails have been dem- essential vitamin B1 (thiamine) were lost in an ancestor of a yeast onstrated (22). In the best documented study, which concerns a lineage, the Wickerhamiella/Starmerella (W/S) clade, known to bacterial siderophore biosynthesis operon acquired by yeasts be- harbor an unusually large number of genes of alien origin. The longing to the Wickerhamiella/Starmerella (W/S) clade, the bacte- thiamine pathway was subsequently reassembled, at least twice, rial genes acquired as an operon were shown to be functional (22). by multiple HGT events from different bacterial donors involving Thiamine, commonly known as vitamin B1, is essential for all both single genes and entire operons.
    [Show full text]
  • Response of Heterotrophic Stream Biofilm Communities to a Gradient of Resources
    The following supplement accompanies the article Response of heterotrophic stream biofilm communities to a gradient of resources D. J. Van Horn1,*, R. L. Sinsabaugh1, C. D. Takacs-Vesbach1, K. R. Mitchell1,2, C. N. Dahm1 1Department of Biology, University of New Mexico, Albuquerque, New Mexico 87131, USA 2Present address: Department of Microbiology & Immunology, University of British Columbia Life Sciences Centre, Vancouver BC V6T 1Z3, Canada *Email: [email protected] Aquatic Microbial Ecology 64:149–161 (2011) Table S1. Representative sequences for each OTU, associated GenBank accession numbers, and taxonomic classifications with bootstrap values (in parentheses), generated in mothur using 14956 reference sequences from the SILVA data base Treatment Accession Sequence name SILVA taxonomy classification number Control JF695047 BF8FCONT18Fa04.b1 Bacteria(100);Proteobacteria(100);Gammaproteobacteria(100);Pseudomonadales(100);Pseudomonadaceae(100);Cellvibrio(100);unclassified; Control JF695049 BF8FCONT18Fa12.b1 Bacteria(100);Proteobacteria(100);Alphaproteobacteria(100);Rhizobiales(100);Methylocystaceae(100);uncultured(100);unclassified; Control JF695054 BF8FCONT18Fc01.b1 Bacteria(100);Planctomycetes(100);Planctomycetacia(100);Planctomycetales(100);Planctomycetaceae(100);Isosphaera(50);unclassified; Control JF695056 BF8FCONT18Fc04.b1 Bacteria(100);Proteobacteria(100);Gammaproteobacteria(100);Xanthomonadales(100);Xanthomonadaceae(100);uncultured(64);unclassified; Control JF695057 BF8FCONT18Fc06.b1 Bacteria(100);Proteobacteria(100);Betaproteobacteria(100);Burkholderiales(100);Comamonadaceae(100);Ideonella(54);unclassified;
    [Show full text]
  • Microbial Community Response to Heavy and Light Crude Oil in the Great Lakes
    Microbial Community Response to Heavy and Light Crude Oil in the Great Lakes Stephen Techtmann 10/24/19 Microbial Sensors Techtmann Lab @ MTU Investigating the applications of environmental microbial communities Hydraulic Fracturing Related Antibiotic Resistance Oil Bioremediation Techtmann Lab @ MTU Overview • Background on oil biodegradation • Microbial response to light and heavy crude oil in the Great Lakes • Machine learning for prediction of contamination in the Great Lakes. Oil Spills Deepwater Horizon Enbridge Line 6B Deepwater Horizon Oil Spill • 4,1000,000 bbl of oil released • Light Sweet Crude oil released • April 20, 2010 • 1101.7 miles of shoreline oiled Atlas and Hazen 2011 Enbridge Line 6B Spill – Marshall MI • 20,082 bbl of oil released • Diluted Bitumen • July 26, 2010 • 70 miles of shoreline oiled https://www.mlive.com/news/kalamazoo/2010/07/state_of_emergency_declared_as.html Oil Transmissions Pipelines in the Great Lakes Region Line 5: • 645 miles from Superior WI to Sarnia Ontario • 540,000 barrels per day • Light crude and natural gas liquids (NGLs) Crude oil Oil types and API Gravity Microbes and Biotechnology (Bioremediation) Low cost input Microbe High value output Decreased Cost Contaminant Increased Efficiency Carbon dioxide or non- toxic daughter products Carbon dioxide Microbial Biomass Petroleum Microbe Daughter Products Water Microbial Ecology and Biotechnology Low cost input Microbe High value output Decreased Cost/Increased Efficiency Complex input Input A Microbe Microbe Output A Input B Microbe Output
    [Show full text]
  • Rational Construction of Genome-Reduced Burkholderiales Chassis Facilitates Efficient Heterologous Production of Natural Products from Proteobacteria
    ARTICLE https://doi.org/10.1038/s41467-021-24645-0 OPEN Rational construction of genome-reduced Burkholderiales chassis facilitates efficient heterologous production of natural products from proteobacteria Jiaqi Liu1, Haibo Zhou1, Zhiyu Yang1, Xue Wang1, Hanna Chen1, Lin Zhong1, Wentao Zheng1, Weijing Niu1, Sen Wang2, Xiangmei Ren2, Guannan Zhong1, Yan Wang3, Xiaoming Ding4, Rolf Müller 5, Youming Zhang1 & ✉ Xiaoying Bian 1 1234567890():,; Heterologous expression of biosynthetic gene clusters (BGCs) avails yield improvements and mining of natural products, but it is limited by lacking of more efficient Gram-negative chassis. The proteobacterium Schlegelella brevitalea DSM 7029 exhibits potential for het- erologous BGC expression, but its cells undergo early autolysis, hindering further applica- tions. Herein, we rationally construct DC and DT series genome-reduced S. brevitalea mutants by sequential deletions of endogenous BGCs and the nonessential genomic regions, respectively. The DC5 to DC7 mutants affect growth, while the DT series mutants show improved growth characteristics with alleviated cell autolysis. The yield improvements of six proteobacterial natural products and successful identification of chitinimides from Chit- inimonas koreensis via heterologous expression in DT mutants demonstrate their superiority to wild-type DSM 7029 and two commonly used Gram-negative chassis Escherichia coli and Pseudomonas putida. Our study expands the panel of Gram-negative chassis and facilitates the discovery of natural products by heterologous expression. 1 Helmholtz International Lab for Anti-Infectives, Shandong University-Helmholtz Institute of Biotechnology, State Key Laboratory of Microbial Technology, Shandong University, Qingdao, Shandong, China. 2 Core Facilities for Life and Environmental Sciences, Shandong University, Qingdao, Shandong, China. 3 College of Marine Life Sciences, and Institute of Evolution & Marine Biodiversity, Ocean University of China, Qingdao, China.
    [Show full text]
  • Ice-Nucleating Particles Impact the Severity of Precipitations in West Texas
    Ice-nucleating particles impact the severity of precipitations in West Texas Hemanth S. K. Vepuri1,*, Cheyanne A. Rodriguez1, Dimitri G. Georgakopoulos4, Dustin Hume2, James Webb2, Greg D. Mayer3, and Naruki Hiranuma1,* 5 1Department of Life, Earth and Environmental Sciences, West Texas A&M University, Canyon, TX, USA 2Office of Information Technology, West Texas A&M University, Canyon, TX, USA 3Department of Environmental Toxicology, Texas Tech University, Lubbock, TX, USA 4Department of Crop Science, Agricultural University of Athens, Athens, Greece 10 *Corresponding authors: [email protected] and [email protected] Supplemental Information 15 S1. Precipitation and Particulate Matter Properties S1.1 Precipitation Categorization In this study, we have segregated our precipitation samples into four different categories, such as (1) snows, (2) hails/thunderstorms, (3) long-lasted rains, and (4) weak rains. For this categorization, we have considered both our observation-based as well as the disdrometer-assigned National Weather Service (NWS) 20 code. Initially, the precipitation samples had been assigned one of the four categories based on our manual observation. In the next step, we have used each NWS code and its occurrence in each precipitation sample to finalize the precipitation category. During this step, a precipitation sample was categorized into snow, only when we identified a snow type NWS code (Snow: S-, S, S+ and/or Snow Grains: SG). Likewise, a precipitation sample was categorized into hail/thunderstorm, only when the cumulative sum of NWS codes for hail was 25 counted more than five times (i.e., A + SP ≥ 5; where A and SP are the codes for soft hail and hail, respectively).
    [Show full text]
  • Lifestyle Preferences Drive the Structure and Diversity of Bacterial and Archaeal Communities in a Small Riverine Reservoir
    www.nature.com/scientificreports OPEN Lifestyle preferences drive the structure and diversity of bacterial and archaeal communities in a small riverine reservoir Carles Borrego1,2, Sergi Sabater1,3* & Lorenzo Proia1,4 Spatial heterogeneity along river networks is interrupted by dams, afecting the transport, processing, and storage of organic matter, as well as the distribution of biota. We here investigated the structure of planktonic (free-living, FL), particle-attached (PA) and sediment-associated (SD) bacterial and archaeal communities within a small reservoir. We combined targeted-amplicon sequencing of bacterial and archaeal 16S rRNA genes in the DNA and RNA community fractions from FL, PA and SD, followed by imputed functional metagenomics, in order to unveil diferences in their potential metabolic capabilities within the reservoir (tail, mid, and dam sections) and lifestyles (FL, PA, SD). Both bacterial and archaeal communities were structured according to their life-style preferences rather than to their location in the reservoir. Bacterial communities were richer and more diverse when attached to particles or inhabiting the sediment, while Archaea showed an opposing trend. Diferences between PA and FL bacterial communities were consistent at functional level, the PA community showing higher potential capacity to degrade complex carbohydrates, aromatic compounds, and proteinaceous materials. Our results stressed that particle-attached prokaryotes were phylogenetically and metabolically distinct from their free-living counterparts, and that performed as hotspots for organic matter processing within the small reservoir. Spatial heterogeneity of river networks results from the sequence of lotic segments—which promote the transport and quick transformation of materials—and lentic segments such as large pools and wetlands—which mostly contribute to the process and storage of organic matter 1,2.
    [Show full text]
  • Plant-Derived Benzoxazinoids Act As Antibiotics and Shape Bacterial Communities
    Supplemental Material for: Plant-derived benzoxazinoids act as antibiotics and shape bacterial communities Niklas Schandry, Katharina Jandrasits, Ruben Garrido-Oter, Claude Becker Contents Supplemental Tables 2 Supplemental Table 1. Phylogenetic signal lambda . .2 Supplemental Table 2. Syncom strains . .3 Supplemental Table 3. PERMANOVA . .6 Supplemental Table 4. PERMANOVA comparing only two treatments . .7 Supplemental Table 5. ANOVA: Observed taxa . .8 Supplemental Table 6. Observed diversity means and pairwise comparisons . .9 Supplemental Table 7. ANOVA: Shannon Diversity . 11 Supplemental Table 8. Shannon diversity means and pairwise comparisons . 12 Supplemental Table 9. Correlation between change in relative abundance and change in growth . 14 Figures 15 Supplemental Figure 1 . 15 Supplemental Figure 2 . 16 Supplemental Figure 3 . 17 Supplemental Figure 4 . 18 1 Supplemental Tables Supplemental Table 1. Phylogenetic signal lambda Class Order Family lambda p.value All - All All All All 0.763 0.0004 * * Gram Negative - Proteobacteria All All All 0.817 0.0017 * * Alpha All All 0 0.9998 Alpha Rhizobiales All 0 1.0000 Alpha Rhizobiales Phyllobacteriacae 0 1.0000 Alpha Rhizobiales Rhizobiacaea 0.275 0.8837 Beta All All 1.034 0.0036 * * Beta Burkholderiales All 0.147 0.6171 Beta Burkholderiales Comamonadaceae 0 1.0000 Gamma All All 1 0.0000 * * Gamma Xanthomonadales All 1 0.0001 * * Gram Positive - Actinobacteria Actinomycetia Actinomycetales All 0 1.0000 Actinomycetia Actinomycetales Intrasporangiaceae 0.98 0.2730 Actinomycetia Actinomycetales Microbacteriaceae 1.054 0.3751 Actinomycetia Actinomycetales Nocardioidaceae 0 1.0000 Actinomycetia All All 0 1.0000 Gram Positive - All All All All 0.421 0.0325 * Gram Positive - Firmicutes Bacilli All All 0 1.0000 2 Supplemental Table 2.
    [Show full text]
  • Supplementary Information the Biodiversity and Geochemistry Of
    Supplementary Information The Biodiversity and Geochemistry of Cryoconite Holes in Queen Maud Land, East Antarctica Figure S1. Principal component analysis of the bacterial OTUs. Samples cluster according to habitats. Figure S2. Principal component analysis of the eukaryotic OTUs. Samples cluster according to habitats. Figure S3. Principal component analysis of selected trace elements that cause the separation (primarily Zr, Ba and Sr). Figure S4. Partial canonical correspondence analysis of the bacterial abundances and all non-collinear environmental variables (i.e., after identification and exclusion of redundant predictor variables) and without spatial effects. Samples from Lake 3 in Utsteinen clustered with higher nitrate concentration and samples from Dubois with a higher TC abundance. Otherwise no clear trends could be observed. Table S1. Number of sequences before and after quality control for bacterial and eukaryotic sequences, respectively. 16S 18S Sample ID Before quality After quality Before quality After quality filtering filtering filtering filtering PES17_36 79285 71418 112519 112201 PES17_38 115832 111434 44238 44166 PES17_39 128336 123761 31865 31789 PES17_40 107580 104609 27128 27074 PES17_42 225182 218495 103515 103323 PES17_43 219156 213095 67378 67199 PES17_47 82531 79949 60130 59998 PES17_48 123666 120275 64459 64306 PES17_49 163446 158674 126366 126115 PES17_50 107304 104667 158362 158063 PES17_51 95033 93296 - - PES17_52 113682 110463 119486 119205 PES17_53 126238 122760 72656 72461 PES17_54 120805 117807 181725 181281 PES17_55 112134 108809 146821 146408 PES17_56 193142 187986 154063 153724 PES17_59 226518 220298 32560 32444 PES17_60 186567 182136 213031 212325 PES17_61 143702 140104 155784 155222 PES17_62 104661 102291 - - PES17_63 114068 111261 101205 100998 PES17_64 101054 98423 70930 70674 PES17_65 117504 113810 192746 192282 Total 3107426 3015821 2236967 2231258 Table S2.
    [Show full text]
  • The Porcine Nasal Microbiota with Particular Attention to Livestock-Associated Methicillin-Resistant Staphylococcus Aureus in Germany—A Culturomic Approach
    microorganisms Article The Porcine Nasal Microbiota with Particular Attention to Livestock-Associated Methicillin-Resistant Staphylococcus aureus in Germany—A Culturomic Approach Andreas Schlattmann 1, Knut von Lützau 1, Ursula Kaspar 1,2 and Karsten Becker 1,3,* 1 Institute of Medical Microbiology, University Hospital Münster, 48149 Münster, Germany; [email protected] (A.S.); [email protected] (K.v.L.); [email protected] (U.K.) 2 Landeszentrum Gesundheit Nordrhein-Westfalen, Fachgruppe Infektiologie und Hygiene, 44801 Bochum, Germany 3 Friedrich Loeffler-Institute of Medical Microbiology, University Medicine Greifswald, 17475 Greifswald, Germany * Correspondence: [email protected]; Tel.: +49-3834-86-5560 Received: 17 March 2020; Accepted: 2 April 2020; Published: 4 April 2020 Abstract: Livestock-associated methicillin-resistant Staphylococcus aureus (LA-MRSA) remains a serious public health threat. Porcine nasal cavities are predominant habitats of LA-MRSA. Hence, components of their microbiota might be of interest as putative antagonistically acting competitors. Here, an extensive culturomics approach has been applied including 27 healthy pigs from seven different farms; five were treated with antibiotics prior to sampling. Overall, 314 different species with standing in nomenclature and 51 isolates representing novel bacterial taxa were detected. Staphylococcus aureus was isolated from pigs on all seven farms sampled, comprising ten different spa types with t899 (n = 15, 29.4%) and t337 (n = 10, 19.6%) being most frequently isolated. Twenty-six MRSA (mostly t899) were detected on five out of the seven farms. Positive correlations between MRSA colonization and age and colonization with Streptococcus hyovaginalis, and a negative correlation between colonization with MRSA and Citrobacter spp.
    [Show full text]
  • Evolution of Methanotrophy in the Beijerinckiaceae&Mdash
    The ISME Journal (2014) 8, 369–382 & 2014 International Society for Microbial Ecology All rights reserved 1751-7362/14 www.nature.com/ismej ORIGINAL ARTICLE The (d)evolution of methanotrophy in the Beijerinckiaceae—a comparative genomics analysis Ivica Tamas1, Angela V Smirnova1, Zhiguo He1,2 and Peter F Dunfield1 1Department of Biological Sciences, University of Calgary, Calgary, Alberta, Canada and 2Department of Bioengineering, School of Minerals Processing and Bioengineering, Central South University, Changsha, Hunan, China The alphaproteobacterial family Beijerinckiaceae contains generalists that grow on a wide range of substrates, and specialists that grow only on methane and methanol. We investigated the evolution of this family by comparing the genomes of the generalist organotroph Beijerinckia indica, the facultative methanotroph Methylocella silvestris and the obligate methanotroph Methylocapsa acidiphila. Highly resolved phylogenetic construction based on universally conserved genes demonstrated that the Beijerinckiaceae forms a monophyletic cluster with the Methylocystaceae, the only other family of alphaproteobacterial methanotrophs. Phylogenetic analyses also demonstrated a vertical inheritance pattern of methanotrophy and methylotrophy genes within these families. Conversely, many lateral gene transfer (LGT) events were detected for genes encoding carbohydrate transport and metabolism, energy production and conversion, and transcriptional regulation in the genome of B. indica, suggesting that it has recently acquired these genes. A key difference between the generalist B. indica and its specialist methanotrophic relatives was an abundance of transporter elements, particularly periplasmic-binding proteins and major facilitator transporters. The most parsimonious scenario for the evolution of methanotrophy in the Alphaproteobacteria is that it occurred only once, when a methylotroph acquired methane monooxygenases (MMOs) via LGT.
    [Show full text]
  • Kinetics of Mercury Accumulation by Freshwater Biofilms
    Environ. Chem. 2018, 14, 458–467 © CSIRO 2017 doi:10.1071/EN17073_AC Supplementary material Kinetics of mercury accumulation by freshwater biofilms Perrine DranguetA,B Vera I. SlaveykovaA and Séverine Le FaucheurA,C AUniversity of Geneva, Faculty of Sciences, Earth and Environment Sciences, Department F.-A. Forel for Environmental and Aquatic Sciences, Environmental Biogeochemistry and Ecotoxicology, Uni Carl Vogt, 66 Bvd Carl-Vogt, CH 1211, Geneva, Switzerland. BPresent address: Département de sciences biologiques, Université de Montréal, Pavillon Marie- Victorin CP6128, Succ. Centre-Ville, Montréal, Québec H3C 3J7, Canada CCorresponding author. Email: [email protected] Table S1. Targets and sequences of the primers used to characterise the bacterial communities in biofilms using qPCR and amplicon sequencing Molecular tool Primers Target Sequence (5’-3’) References P338f GCATGGCYGYCGTCAG All bacteria [1] P518r CGACGCCATCTTCATTCACAT merAF ATTCCAGCTCCAATAGCG qPCR Hg resistance [2] merAR GACTACGATGGTATCTAATC hgcAR Hg TCCGTAGGTGAACCTGCGG [3] hgcAR methylation TCCTCCGCTTATTGATATGC Universal 1053F small subunit GCATGGCYGYCGTCAG [4] ribosomal 1319R rRNA gene CGACGCCATCTTCATTCACAT Amplicon sequencing D512F ATTCCAGCTCCAATAGCG Nuclear small ribosomal [5] subunit 18S D978R GACTACGATGGTATCTAATC Table S2. Taxonomic ranks of the major microorganisms living in both biofilms (B1 and B2), as well as the number of sequences and their abundance (%) calculated with OTUs assigned to (a) bacteria and (b) microalgae prior (T0) and after 24h (T24)
    [Show full text]
  • Skin Infection Caused by Burkholderia Thailandensis: Case Report with Review
    Journal of Microbiology and Infectious Diseases / 2016; 6 (2): 92-95 JMID doi: 10.5799/ahinjs.02.2016.02.0224 CASE REPORT Skin infection caused by Burkholderia thailandensis: Case report with review AbdelRahman Zueter1, Mahmoud Abumarzouq2, Chan Yean Yean1, Azian Harun1 1 Department of Medical Microbiology and Parasitology, School of Medical Sciences, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan, Malaysia 2 Department of Orthopedic, School of Medical Sciences, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan, Malaysia ABSTRACT Burkholderia thailandensis is genetically closed to Burkholderia pseudomallei, which causes melioidosis. The bacterium inhabits the environments of tropical regions including those in Southeast Asia and the Northern part of Australia. B. thailandensis is considered avirulent and extremely uncommon to cause disease. We report the first case of foot abscess with skin cellulitis and ankle swelling caused by B. thailandensis in Malaysia. J Microbiol Infect Dis 2016;6(2): 92-95 Key words: Burkholderia thailandensis, Skin, ST77, MLST Burkholderia thailandensis kaynaklı cilt enfeksiyonu: Derleme ile Olgu sunumu ÖZET Burkholderia thailandensis genetik olarak Burkholderia pseudomallei’ye yakın, melioidosis etkenidir. Bakteri Güneydoğu Asya’da ve Avustralya’nın kuzey kesimi de dahil olmak üzere tropik bölgelerin ortamlarında yaşar. B. thailandensis aviru- lan ve son derece nadir hastalık nedeni olarak kabul edilir. Biz, Malezya’da B. thailandensis kaynaklı ayak bileği şişliği ve selüliti olan ayak apseli ilk olguyu bildirdik. Anahtar kelimeler: Burkholderia thailandensis, cilt, ST77, MLST INTRODUCTION fever, excoriated skin, superficial skin crepitus, 2.0 X 3.0 cm ulcer and swelling pus discharge from right The Burkholderia genus belongs to the class Beta- foot heel and erythema extended to the right ankle Proteobacteria, order Burkholderiales and family that became swollen because of abscess formation.
    [Show full text]