DOCSLIB.ORG

Transcription, Translation & Protein Synthesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transcription, Translation & Protein Synthesis Transcription, Translation & Protein Synthesis Do you remember what proteins are made of ? • Hundreds of Amino Acids link together to make one Protein • There are 20 types of amino acids, some we can make, and some we can’t • There are infinite combinations of amino acids • Can be hundreds or thousands monomers long These long chains are called polypeptide chains Protein Synthesis • Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. • However: – DNA is only found in the nucleus – Proteins are only made outside the nucleus – in the cytoplasm. • Houston, we have a problem. Protein Synthesis • How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? • A molecular cousin of DNA – RNA – is used to carry these messages. Ribonucleic Acids (RNA) • The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). • There are three types of RNA: 1. mRNA – carries a message from the DNA to the cytoplasm 2. tRNA – transports amino acids to the mRNA to make a protein 3. rRNA – make up ribosomes, which make protein. Ribonucleic Acids (RNA) • RNA is almost exactly like DNA, except: – Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) – Contains uracil instead of thymine. – RNA is single-stranded, not double-stranded (usually…) Ribonucleic Acids (RNA) Protein Synthesis • Occurs in TWO steps: 1.Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA 2.Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA. The Central Dogma . This order of events is called the central dogma of molecular biology: R E N DNA RNA P O T I Step One: Transcription 1. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. 2. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? 3. New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand. Step One: Transcription . Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashani mat/molgenetics/transcription.swf . Watch the more complex animation! . http://www- class.unl.edu/biochem/gp2/m_biology/animat ion/gene/gene_a2.html Step One: Transcription . Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT Step One: Transcription . Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA Step 1½: RNA Editing • An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. • An mRNA sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon. Step 1½: RNA Editing DNA transcription pre-RNA (in nucleus) exon 1 interon exon 2 interon exon 3 RNA editing interon interon RNA (in cytoplasm) exon 1 exon 2 exon 3 Step Two: Translation “to decode or decipher the meaning of” • Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence. • How does the mRNA sequence translate into an amino acid sequence? Step Two: Translation . Problem: – There are 20 different amino acids. – There are 4 RNA bases. A T C G phe ile val pro ala his asn asp cys arg leu met ser thr tyr gln lys glu trp gly Step Two: Translation . Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashani mat/molgenetics/translation.swf . Watch the more complex animation! . http://www- class.unl.edu/biochem/gp2/m_biology/animat ion/gene/gene_a3.html Step Two: Translation 1. So how do you exactly go about determining what protein your cells are going to make? 2. FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ? The Genetic Code Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met ? The Genetic Code Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met arg thr asp arg ser asp ??? The Genetic Code Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met met thr asp arg ser asp STOP RECAP: 1. DNA is transcribed into mRNA in the nucleus. 2. The mRNA leaves the nucleus and enters the cytoplasm. 3. The protein is translated from the mRNA sequence using tRNA and amino acids. .
Load more

Recommended publications
  • Gene Therapy Glossary of Terms
    GENE THERAPY GLOSSARY OF TERMS A • Phase 3: A phase of research to describe clinical trials • Allele: one of two or more alternative forms of a gene that that gather more information about a drug’s safety and arise by mutation and are found at the same place on a effectiveness by studying different populations and chromosome. different dosages and by using the drug in combination • Adeno-Associated Virus: A single stranded DNA virus that has with other drugs. These studies typically involve more not been found to cause disease in humans. This type of virus participants.7 is the most frequently used in gene therapy.1 • Phase 4: A phase of research to describe clinical trials • Adenovirus: A member of a family of viruses that can cause occurring after FDA has approved a drug for marketing. infections in the respiratory tract, eye, and gastrointestinal They include post market requirement and commitment tract. studies that are required of or agreed to by the study • Adeno-Associated Virus Vector: Adeno viruses used as sponsor. These trials gather additional information about a vehicles for genes, whose core genetic material has been drug’s safety, efficacy, or optimal use.8 removed and replaced by the FVIII- or FIX-gene • Codon: a sequence of three nucleotides in DNA or RNA • Amino Acids: building block of a protein that gives instructions to add a specific amino acid to an • Antibody: a protein produced by immune cells called B-cells elongating protein in response to a foreign molecule; acts by binding to the • CRISPR: a family of DNA sequences that can be cleaved by molecule and often making it inactive or targeting it for specific enzymes, and therefore serve as a guide to cut out destruction and insert genes.
    [Show full text]
  • COMMENTARY Does Transcription by RNA Polymerase Play a Direct Role in the Initiation of Replication?
    Journal of Cell Science 107, 1381-1387 (1994) 1381 Printed in Great Britain © The Company of Biologists Limited 1994 COMMENTARY Does transcription by RNA polymerase play a direct role in the initiation of replication? A. Bassim Hassan* and Peter R. Cook† CRC Nuclear Structure and Function Research Group, Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford, UK *Present address: Addenbrooke’s NHS Trust, Hills Rd, Cambridge CB2 2QQ, UK †Author for correspondence SUMMARY RNA polymerases have been implicated in the initiation of replication in bacteria. The conflicting evidence for a role in initiation in eukaryotes is reviewed. Key words: cell cycle, initiation, origin, replication, transcription PRIMERS AND PRIMASES complex becomes exclusively involved in the synthesis of Okazaki fragments on the lagging strand. A critical step in this DNA polymerases cannot initiate the synthesis of new DNA process is the unwinding of the duplex. chains, they can only elongate pre-existing primers. The opposite polarities of the two strands of the double helix coupled with the 5′r3′ polarity of the polymerase means that RNA POLYMERASES AND THE INITIATION OF replication occurs relatively continuously on one (leading) REPLICATION IN BACTERIA strand and discontinuously on the other (lagging) strand. The continuous strand probably needs to be primed once, usually The first evidence of a role for RNA polymerase came from at an origin. Nature has found many different ways of doing the demonstration that the initiation of replication in this, including the use of RNA primers made by an RNA poly- Escherichia coli was sensitive to rifampicin, an inhibitor of merase (e.g.
    [Show full text]
  • Non-Coding Transcription Influences the Replication Initiation Program Through Chromatin Regulation
    Downloaded from genome.cshlp.org on October 9, 2021 - Published by Cold Spring Harbor Laboratory Press Non-coding transcription influences the replication initiation program through chromatin regulation Julien Soudet1*, Jatinder Kaur Gill1 and Françoise Stutz1*. 1Dept. of Cell Biology, University of Geneva, Switzerland. *Correspondence: [email protected], [email protected] Keywords (10 words): non-coding RNA, non-coding transcription, histone modifications, nucleosomes, replication timing, replication initiation, yeast 1 Downloaded from genome.cshlp.org on October 9, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT In Eukaryotic organisms, replication initiation follows a temporal program. Among the parameters that regulate this program in Saccharomyces cerevisiae, chromatin structure has been at the center of attention without considering the contribution of transcription. Here, we revisit the replication initiation program in the light of widespread genomic non-coding transcription. We find that non-coding RNA transcription termination in the vicinity of ARS (Autonomously Replicating Sequences) shields replication initiation from transcriptional readthrough. Consistently, high natural nascent transcription correlates with low ARS efficiency and late replication timing. High readthrough transcription is also linked to increased nucleosome occupancy and high levels of H3K36me3. Moreover, forcing ARS readthrough transcription promotes these chromatin features. Finally, replication initiation defects induced by increased transcriptional readthrough are partially rescued in the absence of H3K36 methylation. Altogether, these observations indicate that natural non-coding transcription into ARS influences replication initiation through chromatin regulation. 2 Downloaded from genome.cshlp.org on October 9, 2021 - Published by Cold Spring Harbor Laboratory Press INTRODUCTION DNA replication is a fundamental process occurring in all living organisms and ensuring accurate duplication of the genome.
    [Show full text]
  • Ch 7 -Brock Information Flow in Biological Systems
    Systems Microbiology Monday Oct 2 - Ch 7 -Brock Information flow in biological systems •• DNADNA replicationreplication •• TranscriptionTranscription •• TranslationTranslation Central Dogma DNA Replication Transcription Images removed due to copyright restrictions. RNA Reverse Transcription Translation Protein Flow of information replication DNA → DNA transcription ↓ RNA translation ↓ protein 5' end ring numbering system for -P-O-C deoxyribose 5’ -C O O 4’ 1’ P O- O 3’ 2’ C ssDNA 3’ end HO In a nucleotide, e.g., adenosine monophosphate (AMP), the base is bonded to a ribose sugar, which has a phosphate in ester linkage to the 5' hydroxyl. NH NH NH2 2 2 adenine N N N N N N N N N N N N H −2 HO O3P O CH CH 5' 2 O 2 O 4' H H 1' H H ribose H 3' 2' H H H OH OH OH OH adenine adenosine adenosine monophosphate (AMP) Nucleic acids have a NH2 backbone of adenine N N alternating Pi & ribose moieties. N NH − N 2 Phosphodiester 5' end O cytosine − 5' O P O CH N linkages form as the 2 O 4' 1' O H H ribose 5' phosphate of one N O H 3' 2' H nucleotide forms an O OH − 5' ester link with the 3' O P O CH 2 O OH of the adjacent O H H ribose nucleotide. H 3' H O OH − O P O (etc) nucleic acid 3' end O H N H O N Guanine Cytosine N H N N N N O H N Backbone Backbone Hydrogen H bond H O H N CH3 N Thymine N H N N Adenine N N Hydrogen O bond Backbone Backbone Figure by MIT OCW.
    [Show full text]
  • DNA : TACGCGTATACCGACATT Transcription Will Make Mrna From
    Transcription and Translation Practice: Name _____________________________________ Background: • DNA controls our traits • DNA is found in the nucleus of our cells • Our traits are controlled by proteins • DNA is the instructions to make proteins • Proteins are made in ribosomes (outside the nucleus) • Proteins are made of amino acids Transcription makes RNA from DNA • RNA is complementary to DNA • RNA can leave the nucleus (DNA cannot) Translation makes proteins using RNA • Takes place at the ribosome • mRNA is “read” to put together a protein from amino acids Example: Beyonce has brown eyes. Her eyes look brown because her DNA codes for a brown pigment in the cells of her eyes. This is the gene that codes for brown eyes. DNA : T A C G C G T A T A C C G A C A T T Transcription will make mRNA from DNA mRNA: A U G C G C _________________________ Transcription will join amino acids to make the protein Rules for Transcription: Methionine - Arginine - ____________________________________ Base of DNA → Base in mRNA A → U Rules of Translation: C → G Three letters of mRNA = a codon G → C A codon “codes” for an amino acid We use the “Genetic Code” to determine the amino acids T → A RNA contains Uracil instead of Thymine The complete chain of amino acids will complete the protein that will give Beyonce her brown eyes. If you have brown eyes you have the same protein. If you have blue or green eyes your DNA sequence is a little different which will make the amino acid sequence (protein) a little different.
    [Show full text]
  • Transcription Study Guide This Study Guide Is a Written Version of the Material You Have Seen Presented in the Transcription Unit
    Transcription Study Guide This study guide is a written version of the material you have seen presented in the transcription unit. The cell’s DNA contains the instructions for carrying out the work of the cell. These instructions are used by the cell’s protein-making machinery to create proteins. If the cell’s DNA were directly read by the protein-making machinery, however, it could be damaged and the process would be slow and cumbersome. The cell avoids this problem by copying genetic information from its DNA into an intermediate called messenger RNA (mRNA). It is this mRNA that is read by the cell’s protein-making machinery. This process is called transcription. Components In this section you will be introduced to the components involved in the process of RNA synthesis, called transcription. This process requires an enzyme that uses many nucleotide bases to copy the instructions present in DNA into an intermediate messenger RNA molecule. RNA What is RNA? · Like DNA, RNA is a polymer made up of nucleotides. · Unlike DNA, which is composed of two strands of nucleotides twisted together, RNA is single-stranded. It can also sometimes fold into complex three-dimensional structures. · RNA contains the same nucleotides as DNA, with the substitution of uraciluridine (U) for thymidine (T). · RNA is chemically different from DNA so that the cell can easily tell the two apart. · In this animation, you will see one type of RNA, messenger RNA, being put together. · There are three types of RNA: mRNA, which you will read more about; tRNA, which is used in the translation process, and rRNA, which acts as a structural element in the ribosome (a translation component).
    [Show full text]
  • Consequences and Resolution of Transcription–Replication Conflicts
    life Review Consequences and Resolution of Transcription–Replication Conflicts Maxime Lalonde †, Manuel Trauner †, Marcel Werner † and Stephan Hamperl * Institute of Epigenetics and Stem Cells (IES), Helmholtz Zentrum München, 81377 Munich, Germany; [email protected] (M.L.); [email protected] (M.T.); [email protected] (M.W.) * Correspondence: [email protected] † These authors contributed equally. Abstract: Transcription–replication conflicts occur when the two critical cellular machineries respon- sible for gene expression and genome duplication collide with each other on the same genomic location. Although both prokaryotic and eukaryotic cells have evolved multiple mechanisms to coordinate these processes on individual chromosomes, it is now clear that conflicts can arise due to aberrant transcription regulation and premature proliferation, leading to DNA replication stress and genomic instability. As both are considered hallmarks of aging and human diseases such as cancer, understanding the cellular consequences of conflicts is of paramount importance. In this article, we summarize our current knowledge on where and when collisions occur and how these en- counters affect the genome and chromatin landscape of cells. Finally, we conclude with the different cellular pathways and multiple mechanisms that cells have put in place at conflict sites to ensure the resolution of conflicts and accurate genome duplication. Citation: Lalonde, M.; Trauner, M.; Keywords: transcription–replication conflicts; genomic instability; R-loops; torsional stress; common Werner, M.; Hamperl, S. fragile sites; early replicating fragile sites; replication stress; chromatin; fork reversal; MIDAS; G-MiDS Consequences and Resolution of Transcription–Replication Conflicts. Life 2021, 11, 637. https://doi.org/ 10.3390/life11070637 1.
    [Show full text]
  • How Genes Work
    Help Me Understand Genetics How Genes Work Reprinted from MedlinePlus Genetics U.S. National Library of Medicine National Institutes of Health Department of Health & Human Services Table of Contents 1 What are proteins and what do they do? 1 2 How do genes direct the production of proteins? 5 3 Can genes be turned on and off in cells? 7 4 What is epigenetics? 8 5 How do cells divide? 10 6 How do genes control the growth and division of cells? 12 7 How do geneticists indicate the location of a gene? 16 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) i How Genes Work 1 What are proteins and what do they do? Proteins are large, complex molecules that play many critical roles in the body. They do most of the work in cells and are required for the structure, function, and regulation of thebody’s tissues and organs. Proteins are made up of hundreds or thousands of smaller units called amino acids, which are attached to one another in long chains. There are 20 different types of amino acids that can be combined to make a protein. The sequence of amino acids determineseach protein’s unique 3-dimensional structure and its specific function. Aminoacids are coded by combinations of three DNA building blocks (nucleotides), determined by the sequence of genes. Proteins can be described according to their large range of functions in the body, listed inalphabetical order: Antibody. Antibodies bind to specific foreign particles, such as viruses and bacteria, to help protect the body. Example: Immunoglobulin G (IgG) (Figure 1) Enzyme.
    [Show full text]
  • Glossary of Terms
    GLOSSARY OF TERMS Table of Contents A | B | C | D | E | F | G | H | I | J | K | L | M | N | O | P | Q | R | S | T | U | V | W | X | Y | Z A Amino acids: any of a class of 20 molecules that are combined to form proteins in living things. The sequence of amino acids in a protein and hence protein function are determined by the genetic code. From http://www.geneticalliance.org.uk/glossary.htm#C • The building blocks of proteins, there are 20 different amino acids. From https://www.yourgenome.org/glossary/amino-acid Antisense: Antisense nucleotides are strings of RNA or DNA that are complementary to "sense" strands of nucleotides. They bind to and inactivate these sense strands. They have been used in research, and may become useful for therapy of certain diseases (See Gene silencing). From http://www.encyclopedia.com/topic/Antisense_DNA.aspx. Antisense and RNA interference are referred as gene knockdown technologies: the transcription of the gene is unaffected; however, gene expression, i.e. protein synthesis (translation), is lost because messenger RNA molecules become unstable or inaccessible. Furthermore, RNA interference is based on naturally occurring phenomenon known as Post-Transcriptional Gene Silencing. From http://www.ncbi.nlm.nih.gov/probe/docs/applsilencing/ B Biobank: A biobank is a large, organised collection of samples, usually human, used for research. Biobanks catalogue and store samples using genetic, clinical, and other characteristics such as age, gender, blood type, and ethnicity. Some samples are also categorised according to environmental factors, such as whether the donor had been exposed to some substance that can affect health.
    [Show full text]
  • Transcriptional Regulatory Circuits Controlling Mitochondrial Biogenesis and Function
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Transcriptional regulatory circuits controlling mitochondrial biogenesis and function Daniel P. Kelly1,3 and Richard C. Scarpulla2 1Center for Cardiovascular Research, Departments of Medicine, Molecular Biology & Pharmacology, and Pediatrics, Washington University School of Medicine, St.Louis, Missouri 63119, USA ; 2Department of Cell and Molecular Biology, Northwestern Medical School, Chicago, Illinois 60611, USA We are witnessing a period of renewed interest in the The limited coding capacity of mtDNA necessitates biology of the mitochondrion.The mitochondrion serves that nuclear genes make a major contribution to mito- a critical function in the maintenance of cellular energy chondrial metabolic systems and molecular architecture stores, thermogenesis, and apoptosis.Moreover, alter- (Garesse and Vallejo 2001).One major class of nuclear ations in mitochondrial function contribute to several genes contributes catalytic and auxiliary proteins to the inherited and acquired human diseases and the aging mitochondrial enzyme systems.For example, the major- process.This review summarizes our understanding of ity of the 100 or so subunits of the respiratory apparatus the transcriptional regulatory mechanisms involved in are nucleus-encoded.In addition, nucleus-encoded meta- the biogenesis and energy metabolic function of mito- bolic enzymes necessary for the oxidation of pyruvate, chondria in higher organisms. fatty acids (␤-oxidation
    [Show full text]
  • Questions with Answers- Replication, Transcription, & Protein Synthesis A
    Questions with Answers- Replication, Transcription, & Protein Synthesis A. DNA replication is studied in a newly discovered bacterium. It takes 30 min for the bacterium to complete a round of replication at 37oC. Autoradiography of the replicating DNA molecule shows the following structure. B III A C D A Meselson-Stahl-type experiment was also performed. The bacteria were grown for several generations in 14N-medium and then switched to 15N-medium. The DNA molecules were then analyzed. (Questions 1-7) 1._____ Which is a characteristic of Meselson-Stahl experiments? a) DNA molecules are separated based on size. b) DNA molecules reach an equilibrium position in the centrifuge tube. c) CsCl binds to the DNA and pulls it down through the solution. d) CsCl becomes separated into different bands when centrifuged. 2._____ If the mechanism of DNA replication in this bacterium were dispersive, what results would be found when the double-stranded DNA was analyzed in a CsCl gradient after two generations in 15N-medium? a) One band would be observed containing all the DNA. b) Two bands would be observed containing equal amounts of DNA. c) Two bands would be observed containing unequal amounts of DNA. d) The DNA cannot form any bands if replication is dispersive. 3._____ If the mechanism of DNA replication in this bacterium were semi-conservative, what results would be found when the double-stranded DNA was analyzed in a CsCl density gradient after three generations in 15N-medium? a) The DNA would form three bands: one with hybrid density, one with light density, and one with heavy density.
    [Show full text]
  • A Reverse Transcriptase Ribozyme Biswajit Samanta, Gerald F Joyce*
    SHORT REPORT A reverse transcriptase ribozyme Biswajit Samanta, Gerald F Joyce* The Salk Institute, La Jolla, California Abstract A highly evolved RNA polymerase ribozyme was found to also be capable of functioning as a reverse transcriptase, an activity that has never been demonstrated before for RNA. This activity is thought to have been crucial for the transition from RNA to DNA genomes during the early history of life on Earth, when it similarly could have arisen as a secondary function of an RNA-dependent RNA polymerase. The reverse transcriptase ribozyme can incorporate all four dNTPs and can generate products containing up to 32 deoxynucleotides. It is likely that this activity could be improved through evolution, ultimately enabling the synthesis of complete DNA genomes. DNA is much more stable compared to RNA and thus provides a larger and more secure repository for genetic information. DOI: https://doi.org/10.7554/eLife.31153.001 Introduction It is widely thought that RNA-based life preceded DNA- and protein-based life during the early his- tory of life on Earth (Gilbert, 1986; Joyce, 2002). Perhaps the strongest evidence in support of this hypothesis is the ribosome, present in all extant life, which is an RNA enzyme that catalyzes the RNA-instructed synthesis of polypeptides (Nissen et al., 2000). This presumed remnant of the ‘RNA world’ need not have persisted into modern biology, but would have been necessary for the inven- tion of the translation machinery. The other key transitional molecule between RNA- and DNA/pro- tein-based life is reverse transcriptase, which catalyzes the RNA-dependent polymerization of DNA and is responsible for maintaining genetic information in the more stable form of DNA.
    [Show full text]