Comparative Analysis of the Structure and Function of Adenovirus Virus-Associated Rnas

Comparative Analysis of the Structure and Function of Adenovirus Virus-Associated RNAs

YULIANG MA' 2 AND MICHAEL B. MATHEWSI* Cold Spring Harbor Laboratory, P.O. Box 100, Cold Spring Harbor, New York 11724,' and Molecular Microbiology Program, State University of New York, Stony Brook, New York 117942 Received 10 June 1993/Accepted 7 August 1993

The protein kinase DAI is an important component of the interferon-induced cellular defense mechanism. In cells infected by adenovirus type 2 (Ad2), activation of the kinase is prevented by the synthesis of a small, highly ordered virus-associated (VA) RNA, VA RNA,. The inhibitory function of this RNA depends on its structure, which has been partially elucidated by a combination of mutagenesis and RNase sensitivity analysis. To gain further insight into the structure and function of this regulatory RNA, we have compared the primary sequences, secondary structures, and functions of seven VA RNA species from five human and animal adenoviruses. The sequences exhibit variable degrees of homology, with a particularly close relationship between the VA RNA,, species of Ad2 and Ad7 and notably divergent sequence for the avian (CELO) virus VA RNA. Apart from two pairs of mutually complementary tetranucleotides which are highly conserved, homologies are limited to transcription signals located within the RNA sequence and at its termini. Secondary structure analysis indicated that all seven RNAs conform to the model in which VA RNA possesses three main structural regions, a terminal stem, an apical stem-loop, and a central domain, although these elements vary in size and other details. The apical stem is implicated in binding to DAI, and the central domain is essential for inhibition of DAI activation. One of the pairs of conserved tetranucleotides (CCGG:C/UCGG) provides further evidence for the existence of the apical stem, but the other conserved pair (GGGU:ACCC) strongly suggests a revised structure for the central domain. In two functional assays conducted in vivo, the VA RNA, species of Ad2 and Ad7 were the most active, their corresponding VA RNA,, species displayed little activity, and the single VA RNAs of Adl2 and simian adenovirus type 7 exhibited intermediate activity. Correlation of the structural and functional data suggests that the VA RNA,, species adopt a structure different from those of the other VA RNA species and may play a different role in the life cycle of the virus.

The virus-associated (VA) RNA, of adenovirus type 2 (Ad2) Ad2 VA RNA, is a short ('-160 nucleotides), unmodified, is a positive regulator of virus multiplication which acts at the nonpolyadenylated transcript which is synthesized by RNA translational level to neutralize an interferon-induced cellular polymerase III (Pol ITT) and accumulates to high levels in the defense mechanism (reviewed by Mathews and Shenk [51]). cytoplasm at late times of infection. Several lines of evidence The defense mechanism involves a protein kinase known as indicate that it is a highly ordered molecule and that its DAI, the double-stranded RNA (dsRNA)-activated inhibitor function is closely associated with its secondary and tertiary of protein synthesis, also referred to as PKR, P1, and p68. structure. Nuclease sensitivity analysis revealed three main Infection with a mutant virus, AdS d1331, defective in produc- structural features (Fig. IA): a terminal stem, an apical ing VA RNA,, leads to the phosphorylation by DAI of the stem-loop, and a central domain (19, 53). Mutagenic studies translational initiation factor eIF-2 on its oX subunit. This confirmed the existence of the apical stem-loop and suggested results in the entrapment of a second initiation factor (GEF or that it is required for efficient binding to DAI, while a correctly eIF-2B) and the consequent blockade of protein synthesis in structured central domain is necessary for inhibition of DAI the infected cell (60, 79). DAI appears to be activated by activation (52, 53, 55, 61). As a means to identify structural dsRNA produced by symmetrical transcription of the viral features and functional elements, these approaches suffer from genome at late times in virus infection (46). Synthesis of the some limitations, however; for example, some regions of the enzyme is induced by interferon, and many viruses have molecule are not susceptible to probing by nucleases, and of its developed the means to circumvent the consequences mutations may disrupt the overall structure of a compact RNA VA activation (reviewed by Sonenberg [74] and Mathews [49]). molecule rather than simply changing its sequence or altering binds to RNA, expressed by wild-type adenovirus DAI (20, 27, local base pairing. The limitations are well illustrated in the 35, 40) and prevents it from being activated (37, 60), thereby case of the central domain of Ad2 VA RNA,, which remains ensuring that viral polypeptide synthesis proceeds unimpeded. poorly understood. Thus, alternative secondary structures for VA RNA, may also contribute to the selective translation of the central domain have been proposed (19, 53, 61), and there to cellular the host shutoff viral mRNAs relative mRNAs, is disagreement as to the effects of mutations in the central occurs at late times of infection and phenomenon that (48, 59), domain on the ability of VA RNA to bind to DAI (11, 22, 52). of cotransfected in transient assays, it increases the expression The phylogenetic approach offers an alternative way to study plasmids (36, 76). These effects are both mediated, at least in the relationship between RNA structure and function and has part, by the interaction of VA RNA, with DAI (2). been successfully applied to complex RNA molecules such as 16S rRNA (29, 82) and RNase P RNA (8). This method relies on comparisons among a cohort of functionally and evolution- * Corresponding author. arily related molecules from different organisms to reveal 6605 6606 MA AND MATHEWS J. VIROL.

Apical Stem-loop

U-A G-C140 G- C 4o 15G A 15G A 171j-A TU-A G- C G-C C-G C-G C-G C- G OU G Terminal Stem IoUC. G U- G U G C-G C-G U-A U-A C- Gso C- Gio A C A C C- GS C G; G- C G-C Ge U Ge U 5'PG- CCUUUn 5P G-CCUUUn FIG. 1. Secondary structure models for Ad2 VA RNAs. (A) The original model structure for Ad2 VA RNA, (53), showing the three principal regions of the molecule. (B) Revised Ad2 VA RNA, structure proposed on the basis of the work described here, especially the postulated GGGU:ACCC pairing (highlighted in stippled boxes). Cleavage sites for single-strand-specific nucleases and nuclease VI are marked with filled and open arrowheads, respectively. Large arrowheads, pronounced cleavages; small arrowheads, weak cleavages. conserved features of primary sequence and higher-order upstream of the gene for VA RNA,, and is separated from it structure, through, for example, compensating base changes. by a spacer of about 100 nucleotides (1, 50). A similar Nearly 50 human adenoviruses have been isolated and classi- organization seems to exist in Ad7, a representative of group B fied into six groups, A to F, on the basis of biological, of the human adenoviruses (15, 58), but the group A virus serological, and biochemical criteria (30). In addition, several Adl2 and simian adenovirus type 7 (SA7) apparently contain adenoviruses that infect animals are known. Although most only a single VA RNA gene at this locus (16, 42, 69). Chicken work has been done on the group C human viruses, Ad2 and adenovirus type I (also known as CELO virus) carries a gene AdS, VA RNAs have also been identified in some other encoding two shorter VA RNAs which are overlapping tran- adenoviruses. Moreover, in addition to the major species, VA scripts from a single gene (41). Unlike the mammalian genes, RNA,, Ad2 encodes a second species, VA RNA,J (1, 47, 50), however, the avian VA RNA gene is located at 90 map units which is transcribed at a slower rate (73), accumulates to a and is transcribed in the leftward direction. Nevertheless, lesser extent (47, 62), and seems to be less effective than VA CELO virus VA RNA appears to function like Ad2 VA RNAJ, RNA, in suppressing DAI activation (6). Both VA RNA genes albeit considerably less efficiently (41). Thus, VA RNA genes are located in the vicinity of map unit 30 on the Ad2 genome are carried by all the adenovirus serotypes examined, although and, like the major late transcription unit, are transcribed in they differ in number, sequence, location, and possibly func- the rightward direction (47). The gene for VA RNA, is tion. VC)L. 67, 19t93 VA RNA STRUCTURE-FUNCTION COMPARISONS 6607

VA RNA X VA RNA / 52,55K Ad2 %- b-~ -L. - - Yh am__ TaA B - Msc E Apa pTP VA RNA I VA RNA 1i 52,55K Ad7 iIm 6~~~~~~~~~~-~ 1I p- Fsp Adl 2 B.gill

52,55K VA RNA SA7 l~~~~~~~= Xbav B _aApa pTP

VA RNAs CELO Fok -"S Kpn

0 50 100 150 200 250 300 350 400 450 500 550 600 650 700 800 900 1000 (nts)

FIG. 2. VA RNA genes. Depicted are the VA RNA genes (solid arrows) of three human adenoviruses (Ad2, Ad7, and Ad12), a simian adenovirus (SA7), and an avian adenovirus (CELO virus). The individual genes were subcloned into pUCl 18 or pUCl 19 vector at the restriction sites denoted with standard three-letter abbreviations to give plasmids that could be transcribed with RNA Pol III. The coding regions of the terminal protein precursor (pTP) and the L1-52,55K protein which flank the mammalian adenovirus VA RNAs are shown as open arrows. The single-letter abbreviations (B, BamHI; E, EagI; S, BspEI) in the middle of the VA RNA genes stand for the sites which were linked to the SP6 promoter in the constructs used to make antisense probes.

We have taken a comparative approach to investigate the Mutant virus Ad5 d1331 (79) and wild-type Ad2 were grown in relationship between the structure and function of adenovirus HeLa cells. VA RNA genes were subcloned from the following VA RNAs. This study was conducted in three stages. First, we original plasmids: Ad2 VA RNA, from pMHVA (53), Ad2 VA confirmed the existence and localization of the seven VA RNAII from pD* (18), Ad7 VA RNA, and VA RNA,, from RNAs encoded by five adenoviruses, defined their termini, and pJB757B and pJB575C, respectively (15), Adl2 VA RNA from compared their primary sequences. Then we determined their pl2VA7 (69), CELO virus VA RNA from pC-va (41), and SA7 secondary structures and searched for conserved features. VA RNA from pSA7-va (42). Finally, using two different assays, we examined their ability to Subcloning of VA RNA genes. To generate constructs which substitute for Ad2 VA RNAI in preventing DAI activation and yield VA RNA when transcribed by RNA Pol III (Pol III correlated these findings with the structural data. The results constructs), individual VA RNA genes and their surrounding revealed marked structural and functional differences among sequences were excised at convenient restriction sites (Fig. 2) the VA RNA species examined, but with the exception of and inserted into plasmid pUC118 or pUC119. To generate CELO virus VA RNA, which is anomalous, all VA RNAs constructs analogous to pT7 VA2I (54) which can serve as studied conformed to a structure consisting of a terminal stem, templates for VA RNA synthesis by T7 RNA polymerase (T7 an apical stem-loop, and a central domain. Despite extensive constructs), pairs of primers were designed for polymerase variations in sequence, especially in the central domain, the chain reaction amplification of each VA RNA coding se- two existence of pairs of strikingly conserved and mutually quence. The upstream primers contained the T7 promoter complementary tetranucleotides was detected. One pair sup- immediately upstream of the VA RNA transcription start sites. the structure for Ad2 VA in ports proposed secondary RNA, The downstream primer was such that three A residues were the stem, but the occurrence of the second pair leads to apical introduced on the sense strand following the four T residues a revision of the model in the central domain region. The most corresponding to the 3' end of the RNA, thereby creating a highly active species (Ad2 and Ad7 VA and the species RNA,) DraI site for easy of runoff transcripts. The primers and SA7 VA share the generation of moderate activity (Adl2 RNA) XbaI and HindlIl to facilitate clon- in the central domain, which carried sites, respectively, potential for specific base pairing chain reaction into the differs from that found in the weakly active species (Ad2 and ing of the polymerase fragments and 19. To make constructs Ad7 VA RNA,,). These findings strengthen the view that equivalent sites of pUCI 18 pUCI which can generate RNA complementary to VA RNAs as structural features play a more important role in VA RNA probes (probe constructs), an SP6 promoter was function than the primary sequence does and suggest that the hybridization inserted into the T7 constructs, allowing for transcription in VA RNA,, species may subserve a different function. the opposite direction. The SP6 promoter fragment was sub- stituted between the HindIll site downstream of the VA RNA MATERIALS AND METHODS gene and a unique internal restriction site. The internal sites Cells and viruses. Monolayer cultures of human 293 cells were as follows (Fig. 2): BamHI for Ad2 VA RNA,, Adl2 VA (26) and HeLa cells (ATCC CCL 2) were grown in Dulbecco's RNA, and SA7 VA RNA; EagI for Ad2 VA RNA,,, Ad7 VA modified Eagle medium plus 10% fetal calf serum, supple- RNA,, and Ad7 VA RNA,,; and BspEI for CELO virus VA mented with 100 [ig of streptomycin and penicillin per ml. RNA. The fragment containing the SP6 promoter was excised 6608 MA AND MATHEWS J. VIROL. from plasmid pGEM-1 by digestion with NaeI and a suitable used as a probe. Hybridization was performed overnight at enzyme cutting in the polylinker region; when needed, an EagI 65°C, and filters were washed with three changes of 0.2 x SSC linker was added to the polylinker sequence. (1 x SSC is 0.15 M NaCl plus 0.015 M sodium citrate)-O.1% Synthesis and end labeling of VA RNA. Transcriptions in SDS at 68°C. VA RNAs transcribed by T7 RNA polymerase vitro with T7 RNA polymerase and RNA Pol III were con- from the T7 constructs were purified by gel filtration through a ducted as described previously (52, 54). RNA was labeled at its Sephadex G-50 spun column and used as a standard for the 5' end with [-y-32P]ATP (ICN Radiochemicals, Inc.) or at its 3' efficiency of transfer and hybridization. end with [32P]pCp (ICN Radiochemicals) as described previ- Transient expression enhancement assay. Human 293 cells ously (14, 65). All RNAs were purified by electrophoresis were cotransfected with 1 ,ug of the chloramphenicol acetyl- through 5% polyacrylamide-8 M urea gels after heating in transferase (CAT) expression plasmid p,BCAT-6.5 (77) to- 40% formamide. Labeled RNA was detected by autoradiogra- gether with a VA RNA Pol III construct. At 48 h posttrans- phy and eluted from the excised gel slice by mixing for 1 h at fection, the cells were labeled for 1 h with 200 ,uCi of room temperature with 400 RI of STE (0.15 M NaCl, 10 mM [35S]methionine (ICN Radiochemicals) per plate in 1 ml of Tris-HCl, 1 mM EDTA [pH 7.4]) in the presence of 50 ,ug of methionine-free medium. Cells were lysed by three freeze- calf liver tRNA and 400 ,ul of Tris-saturated phenol. thaw cycles in 0.25 M Tris (pH 8.0). The cytoplasmic extract Sequence analysis. To determine the 5'-terminal nucleo- was adjusted to 0.14 M NaCl-15 mM MgCl2-0.5% Nonidet tides of the VA RNAs, 5'-end-labeled RNA produced by Pol P-40, and equal radioactive counts of the labeled protein III transcription was completely digested by incubation with extract were immunoprecipitated with polyclonal antibody RNase P1 (70), and the radioactive 5' nucleoside monophos- directed against CAT (5 Prime-3 Prime, Inc.) as described phates were identified by electrophoresis on Whatman P-450 previously (18). Immune complexes were recovered on protein paper (3). The 5'-terminal sequences were determined by A-Sepharose beads (Pharmacia, Inc.) and separated in a 15% partial digestion with RNase T, or U2 (13). Digestion products polyacrylamide-SDS gel. Labeled CAT protein was quantified were resolved by electrophoresis in a 25% polyacrylamide-8 M with a Fuji Bio-imaging analyzer. Suitable dilutions of the urea gel, and the positions of G and A residues were read cytoplasmic extract were also assayed for CAT activity by using sequentially from the first nucleotide to approximately nucle- [I4C]chloramphenicol (3,000 mCi/mmol; ICN Radiochemicals) otide 35 in comparison with an alkali ladder prepared from the (25). After thin-layer chromatography, CAT activity was quan- same RNA. tified by using an AMBIS Radioisotope Scanning System II. Secondary structure analysis. Nuclease sensitivity analysis was conducted as described previously (53), using RNA syn- RESULTS thesized by T7 RNA polymerase from the T7 constructs, and labeled at either its 5' or 3' end. The Macintosh computer Characterization of VA RNA genes. In addition to the group program MulFold (23) with the Zuker and Jaeger algorithm C viruses, Ad2 and AdS, several other adenoviruses have been (34, 84) was used to derive possible pairing schemes. Nucle- shown to encode VA RNAs, but relatively little is known of otides that were sensitive to single-strand-specific nucleases their properties. Human Adl2 (a member of group A) pro- were entered as B, D, H, and V, representing unpaired A, C, duces VA RNA in infected cells (16), and its gene has been G, and U residues, respectively, to ensure that they were not tentatively located by DNA sequencing (69). Nuclei from base paired by the folding program. The most stable predicted Ad7-infected cells also synthesize a discrete VA RNA which structure and several suboptimal structures were examined. has been partially characterized by RNA fingerprinting (58), The program LoopDLoop (24) was used to display the struc- but sequence analysis around map unit 30 suggested the tures. RNA sequence alignments were made on the Intellige- existence of two VA RNA genes in this group B adenovirus netics Suite program Genalign (72). (15). Viral DNA isolated from two nonhuman adenoviruses, Translation rescue assay. The d1331 rescue assay (42) was SA7 and CELO virus, encode VA RNAs which can be performed as previously described (53). For transfection, 5 or synthesized by Pol III in vitro. The SA7 and CELO virus VA 10 ,ug of a plasmid construct containing a VA RNA gene was RNA genes have been mapped by the nuclease protection dissolved in 250 IlI of 0.25 M calcium chloride and mixed with technique, and they have been shown to substitute partially for an equal volume of 2 x N-2-hydroxyethylpiperazine-N'-2- Ad2 VA RNA, in a functional assay (41, 42). Thus, neither the ethanesulfonic acid (HEPES)-buffered saline (81) and then Ad7 nor Adl2 VA RNAs have been shown to prevent DAI dripped into a 6- or 9-cm dish of human 293 cells at about 60% activation, and the SA7 and CELO virus VA RNAs have not confluency. A glycerol shock was given at 6 h posttransfection, been detected in vivo. Moreover, although base-pairing algo- and the cells were infected at 24 h with Ad5 d1331 (79) at a rithms predict that these species should be able to form stable multiplicity of 10 PFU per cell. At 48 h posttransfection, the secondary structures, no experimental evidence for the struc- cells were pulse-labeled with [35S]methionine (200 ,uCi/6-cm tures exists, and experience with Ad2 VA RNA, indicates that plate; ICN Radiochemicals) for 1 h before harvesting. Cells the molecule may not adopt the most stable predicted struc- were washed in ice-cold phosphate-buffered saline and lysed by ture. suspension in A buffer (10 mM Tris-HCl [pH 7.5], 140 mM To elucidate the relationship between the structure and NaCl, 1.5 mM MgCl2, 0.5% Nonidet P-40) for 2 min and function of the VA RNAs, we investigated these VA RNAs in freeze-thawing once. Nuclei were removed by centrifugation, detail. To characterize individual RNAs, we first subcloned and the cytoplasmic extract was analyzed by electrophoresis in viral fragments into pUC118 or pUC119 such that each a 15% polyacrylamide-sodium dodecyl sulfate (SDS) gel. RNA plasmid was expected to contain a single VA RNA gene (Fig. equivalent to 5% of the cells in a plate was examined by 2). Transcription of the cloned viral DNA segments in a 293 Northern (RNA) blot analysis. RNA was separated in a 1% cell extract possessing Pol III activity confirmed that Ad7, like agarose gel, transferred to nitrocellulose filters (65), and UV Ad2, has two VA RNA genes, whereas Adl2, SA7, and CELO cross-linked at 120 mJ/cm2 in a Spectrolinker apparatus. virus each have only one VA RNA gene (Fig. 3). No VA RNA Antisense RNA complementary to the 5' half of each VA was generated from the fragment located immediately to the RNA was labeled in T7 RNA polymerase reactions, purified by right of the Adl2 VA RNA gene (data not shown), consistent gel filtration through a Sephadex G-50 spun column (65), and with sequence data suggesting the absence of a VA RNA,, VOL. 67, 1993 VA RNA STRUCTURE-FUNCTION COMPARISONS 6609

< g~ < > <. A D r 'a -V Bv c- 2 k < < < < < f 'f

-, 2 - 'l-i___ mm I

a :1|! Ir G low B 2 3 rT A 2.5 r 2.4 - - -MM -1JT- %- 22 2 _ Gi CELO VA - Long C .- 2.1 2.2 -UA G No - Sr.o,

12a2:4 5 6 7 FIG. 3. Transcription of subcloned VA RNA genes in vitro with -u RNA Pol III. RNA synthesized from 1 ,ug of each VA RNA gene clone (Pol III constructs) in the presence of [a-32P]UTP was resolved in an 8% polyacrylamide sequencing gel containing 7 M urea and detected by autoradiography. The CELO virus VA RNA gene (lane 6) produces A a short transcript and a long transcript, as marked.

species in this serotype (69). For all of the mammalian viruses, _ -35 sequence analysis demonstrated that the VA RNA genes are FIG. 4. Determination of the 5' end of VA RNA species. (A) Ad7 located on the 1 strand of the genome, closely flanked by the VA RNA, was synthesized in vitro by Pol III, 5' end labeled, and second coding exon of the terminal protein precursor (pTP) resolved in an 8% sequence gel yielding three bands. (B) Each band and the L1-52,55-kDa (52,55K) protein-coding exon (Fig. 2). was eluted separately and fractionated further in a second gel. (C) CELO virus, however, has its single VA RNA gene located on Individual bands 2.1 and 2.2 from the secondary separation gel were the r strand of the genome and yields two VA RNAs because eluted for 5'-end determination by RNase PI digestion and paper of inefficient 3'-end formation at the proximal termination site electrophoresis. (D) Partial sequence of eluted 2.2 RNA was deter- (41, 44). Apart from a single assignment (nucleotide 30 of Ad7 mined by limited digestion with RNase T, or U2 (as marked) and gel VA which is A rather than G as our results electrophoresis with a partial alkaline hydrolysate of the same RNA RNA,, published), (Alk.) (D). Band 2.1 contained a mixture of RNA species with confirm the mapping and sequence data reported by others 5'-terminal A and G residues, while band 2.2 started with a unique G (15, 41, 42, 69). To ensure that the Ad7 discrepancy was not residue. The position of this G was identified in panel D. In all cases, due to a cloning artifact, we reconfirmed the A residue by detection was by autoradiography. direct analysis of viral DNA. Next, we needed to define the precise termini of the RNA molecules. When examined by high-resolution gel electrophoresis, each VA RNA separated into a series of closely analysis of 5'-end-labeled RNAs synthesized in the Pol III spaced bands, as exemplified in Fig. 4A by Ad7 VA RNA,. transcription system and those of the SA7 and CELO virus Earlier work had indicated that the heterogeneity of Ad2 VA species, which had been located approximately by S1 nuclease RNA, is due to alternative 5' ends (9, 78, 80) and to an uneven protection analysis (41, 42), were confirmed by size compari- 3' end comprising a variable number of U residues (10). To sons in polyacrylamide gels. define the start sites precisely, VA RNA synthesized in vitro by On the basis of these findings, we constructed vectors Pol III was 32p labeled at its 5' end, and individual species were permitting the synthesis of large quantities of each VA RNA isolated by electrophoresis through two consecutive gels (Fig. with authentic termini. Each VA RNA gene was recloned with 4A and B). The nature of the 5'-end nucleotide was deter- its major G start adjacent to the T7 promoter and its 3' end mined by paper electrophoresis after complete digestion with adjacent to a DraI site such that runoff transcription terminates RNase PI (Fig. 4C), and the 5'-end sequence was determined at this site, leaving three or four 3'-terminal U residues on the by partial digestion with RNase T, or U2 followed by gel RNA. To improve the synthesis of CELO virus VA RNA, its A electrophoresis (Fig. 4D). The results of these analyses are start was converted into a G start in the T7 vector (56). All of summarized in Fig. 5. Apart from Ad2 VA RNA,,, which has these vectors produced copious quantities of RNA under the a unique 5' end, the mammalian VA RNAs all have multiple conditions described previously for the Ad2 VA RNA, vector 5'-end sequences with G as the major start and minor starts at (54). nearby A or G residues. CELO virus VA RNA, exceptionally, Primary sequence alignment. Because functionally impor- begins with an A or C residue. We also determined that all of tant signals are often conserved in evolution, we studied the the VA RNAs terminate with a run of U residues. The 3' ends phylogenetic relationships among these VA RNAs by comput- of the Ad7 and Adl2 VA RNAs were defined by sequence er-assisted and manual sequence alignment. From previous 6610 MA AND MATHEWS J. VIROL.

V v RNA or its interaction with DAI. As can be seen from the Ad2 VAI 5' AGCCTGTAAGCGGGCACT 3 sequence alignment displayed in Fig. 6, CELO virus VA RNA V is distinctly different from the other VA RNAs, sharing Ad2 VAII 5' AAGCATTAAGTGGCTCGC 3' homology only within the transcriptional B-box region located vVv v about 50 nucleotides from the 5' terminus. The mammalian Ad7 VAI 5S GCGATGAGCGGCTCGA 3' virus species exhibit some homology in their 5' sections and vY near their 3' ends but are quite divergent in other regions, Ad7 VAII 5' GGGCCGTGAGTGGCTCGC 3' especially in the region corresponding to the central domain of vy Ad2 VA RNA,. Detailed examination revealed the existence Ad12 VA 5' AGTCGGTAAGCGACTCCC 3' of four highly conserved tetranucleotides, however. Although V they are short, they are particularly noteworthy because they SA7 VA 5 GAGGCGTCACCGACTCCT 3' constitute two mutually complementary pairs which are likely VY to contribute to higher-order structure as discussed below. CELO VAs 5 CCTAGCGGATCAGATCG 3' The 5' part of the six mammalian virus VA RNAs contains FIG. 5. Start sites of RNA Pol III transcripts of VA RNA genes. homology in the region of the internal control sequences, the The major termini are marked with solid arrowheads. Secondary and A and B boxes, which have been experimentally defined for tertiary 5' ends are marked with large and small open arrowheads, Ad2 VA RNA, (17, 28, 71, 83). Homology with the tRNA respectively. B-box consensus sequence is good in all cases, supporting the conclusion that the B box is more important than the A box (83). With the exception of CELO virus VA RNA, the work (21, 71, 83), we had anticipated that the transcriptional sequences surrounding the B box are also homologous. Ad2 A- and B-box sequences comprising the internally located Pol VA RNA,, Ad7 VA RNA, Ad1 2 VA RNA, and SA7 VA RNA III promoter would be conserved; other common sequences display a weakly homologous A-box region, although its place- might represent features important for the structure of the ment between the start site and B box is variable, but Ad2 VA

A box B box Ad2VAI 1 GaacacuCUCCGUGGUcUGf-GUAuAAAuUCcICAAGGGSAuCAUgGCG qacgAICCggGGWCGAA 1111111111 Ilil1111 11 111111 111 111 11 11111111 Adl2VA 1 GACUC CCUWJCCGUGGUUUGGUGGA AAAGUCaCAAC,=ACCAUaGCG aGGAACLC 11111 11111 1111 11 III 1111111 III 11111111111111111 I. SA7VA 1 GACUC CuCUCCGUaGCUW GGGGG uuAgGUCGCAA2QG1jCGGUZGCGG GGAACcK A I II1111 lII 11 111111 11 1111 111 1111 11111111111 Ad7VAI 1 GGCUCG aCUCCGUgGCCUGGGGG AAcguGaAc2Q2UGGGUcGCGGU GuACcff C 111111 I l I Il I ll 11 11 11111111111 Ad7VAII 1 GGCUCGC gCCCGUAGuCUGGAG aaUcAgUcGCcA22IgUGcGUuGCGGUaugCCCKU 1111111 11 1111111111 11111111 11 111111111111 Ad2VAII 1 GGCUCGCuCCCUGUAG CcGGAGgguUauuUucCaA2GGIUG aguCGcaggaCCcr U 11111 CELOVA 1 aagaucgaCagUGUAG C

Ad2VAI 67 cCcGGAc ccguccgccgugaucCAuGcGguuacCgccCGCGU 1 1111111 11 11 11111 Adl2VA 66 MGZaGGAUCCG C uaugaGCaCAaGuGaggcgCuugCGCGU 11111 1111111 11 SA7VA 66 ~CCGGAUCCG CCACUCccGacgCGGC ggccCCGCG uCCac I II I I HIIII 1111 11111 Ad7VAI 62 GuCCaaAgCUAAGCaaucaCACUC GgAU GCrCGG agCCGCGgCuAaCGuGGuaUIWGGC IIIII III I I1 111i11I1 11 11 11111 Ad7VAII 65 G c CUAAGC gcggCUC GuAC CGG uUuCCGCGACaAgCGa]GGUUGGCagC III 1111111 11 1111 11II11111 I Ad2VAII 64 G uCUC GgGECCGGACUgCgGCGA aCGgGGGUUUG CcUC 111111 11 CELOVA 18 ucagcCguaaGagcGE ACU uGcacuiccgaggUC

Ad2VAI 114 gucGA&=aGguguGcgaCguCAG ACA acgGgGGAGcgCuccUUuu 111111 III III 1iii 11 Adl2VA 108 uGA,&=gGccaaGGAcCCCCAG ACACGGAGaGGAG UC UUUU il 1 11111 1111111 li1 11 1111 SA7VA 109 gacgCGcgcAcCCcaaAUACGGAGgGGAG UC UUUU 1111111111 11 I 11 1111111 111 11 1111 Ad7VAI 121 UaUCCcGuCuCGL=AGCCG ACGaaUAUCCAGggUACGGAGuaGAG UCgUUUU 1III 1111111 11 1 11111 11111 III 1 1111 IAd7VAI I 119 CCaGUCAUuUCCAAG5;CCGCCAGCCG AC UUCUCCAGuuUACGGGAgCGAG CCCUUUU 11 11111 Illlllllill 11 111111 IAid2VAII 105 CCCGUCAU gCAAGACCCGCuuGC aaA uUcCUCCgGAAACaGGGA CGAGCCCCUUUU III 11111111 IIII 11 CELOVA 55 CCC agaucGAAACuGGG uacuGCCgaUcUU

FIG. 6. Primary sequence alignment for the VA RNAs. Sequences were aligned by using the Genalign program (IntelliGenetics Suite). Homologous nucleotides are in uppercase and linked together with vertical lines. The A-box and B-box internal transcription elements of Ad2 VA RNA, and the homologous regions in other VA RNAs are underlined. The tetranucleotide sequences CCGG and C/UCGG which are common to all the apical stem-loop structures are boxed. The tetranucleotides GGGU and ACCC which are common to the central domains are in boldface and underlined. V()L. 67, 1993 VA RNA STRUCTURE-FUNCTION COMPARISONS 6611

RNAH,, Ad7 VA RNA,,, and CELO virus VA RNA do not and stacked regions. Nucleases T,, U2, and Bcare site specific, have any obvious A-box sequence homology. Within about 24 cleaving after G, A, and pyrimidine residues, respectively, nucleotides downstream from the B box, the mammalian virus allowing the cut sites to be located precisely on the primary VA RNAs contain a sequence that reads CCGG or UCGG sequence. and is able to pair with the sequence CCGG located immedi- When the sequences of the six mammalian virus VA RNAs ately upstream of the B box. These tetranucleotide sequences, were aligned according to the nuclease sensitivity data, their which are boxed in Fig. 6, form part of the apical stem (see structural uniformity was clearly evident (Fig. 7). The apical below). Possibly by chance, similar sequences occur in the stemrloop and terminal stem are well-conserved structures: in reverse order in CELO virus VA RNA and also seem to pair both cases, sequence variations on one side of the stem are with one another. compensated for on the other side in such a way as to maintain Toward the 3' end of the molecule there is a considerable base pairing. Whereas the length of the terminal stem is fairly amount of patchy homology. Since the termination of Pol III constant (except in CELO virus VA RNA, in which it is transcription requires only a run of T residues in the sense shorter), the length of the apical stem and size of its loop vary strand (7), this homology presumably reflects some require- considerably (Fig. 7). With the exception of CELO virus VA ments for function(s) other than termination. Indeed, the RNA, the apical stem-loop includes the B box; it is GC rich covariation of the 3'-end sequence with that of the 5' end and displays some sequence conservation as discussed above. suggests that all VA RNAs maintain 5':3'-end base pairing to In particular, a CCGG sequence in the 5' flank of the stem form the terminal stem structure (see below). Thus, conserva- pairs with a C/UCGG sequence in its 3' flank. The central tion at the 3' end of the molecule may be secondary to domain is characterized by alternating regions of sensitivity conservation at its 5' end. and resistance to single-strand-specific nucleases and by the Sequence conservation is weak in the rest of the molecule, invariable presence of the ACCC sequence. This tetranucle- which includes the central domain of Ad2 VA RNAP, and little otide is relatively insensitive to digestion by single-strand- base pairing is evident in this region. However, the tetranucle- specific nucleases and is always flanked by regions which are otide sequence ACCC is present toward the 3' end of all six sensitive to such nucleases, suggesting that it may participate in mammalian virus VA RNAs, suggesting that it may be involved base pairing. As mentioned above, on the 5' side of the in the formation of higher-order structure or in sequence- molecule in the vicinity of nucleotide 35, the complementary specific interactions with DAI. Strikingly, the sequence sequence GGGU is invariably present (except in CELO virus GGGU, which in principle could base pair with the ACCC VA RNA). This tetranucleotide is also relatively resistant to sequence, occurs between the A and B boxes of all six VA digestion by single-strand-specific nucleases, except in Ad7 VA RNAs. These sequences, which are shown in boldface and are RNA,,, in which it is weakly cut. However, in both VA RNA,, underlined in Fig. 6, probably contribute to the structure of the species, there is a second GGGU sequence in the 3' part of the central domain and to the overall conformation of the mole- central domain (Fig. 7); this second GGGU sequence is not cule as discussed below. sensitive to single-strand-specific nucleases in either VA The alignment (Fig. 6), especially in the central third of the RNA,, species and could provide an alternative pairing for the molecule, suggests that these six VA RNAs can be divided into ACCC sequence. Thus, it seems that GGGU:ACCC pairing is two families. One family comprises Ad2 VA RNA,, Adl2 VA an important determinant of VA RNA secondary structure RNA, and SA7 VA RNA, which share a common sequence and that the two VA RNA,, species are structurally distinct in immediately downstream of the B box. A second family the central domain, although other features of the mammalian contains Ad7 VA RNA,, Ad7 VA RNA,,, and Ad2 VA RNA,, virus VA RNAs are universal. and is distinguished by homology slightly further downstream, Assays of VA RNA function. To evaluate the significance of in the vicinity of the central domain. Within the second family, these structural variations and to understand the relationship the two VA RNA,, species are highly homologous to each between VA RNA structure and function, we compared the other. This is remarkable because deletion of Ad2 VA RNA,, abilities of the several species to substitute for Ad2 VA RNA, has no detectable effect on virus growth in tissue culture (4, in two functional assays. The first assay measures the ability of 79). If it were also dispensable under the conditions of natural the RNA to rescue protein synthesis in cells infected with the infections, the VA RNA,, species would be expected to be VA RNA,-negative mutant virus Ad5 d1331 (42, 52, 53, 79). prone to an accumulation of mutations. Equally surprisingly, The second assay is a transient expression enhancement assay Ad7 VA RNA, is more homologous to Ad2 VA RNA,, and that is based on the observation that cotransfection of the Ad2 Ad7 VA RNA,, than to Ad2 VA RNA,. Examination of the VA RNA, gene with a CAT reporter plasmid results in homology scores (not shown) confirms that the two sets of increased CAT enzyme expression (41, 42, 61, 76). Both of RNA species are linked by a close relationship between SA7 these assays reflect the regulation of DAI activation by VA VA RNA and Ad7 VA RNA,. On this basis, the six sequences RNA (2, 51, 59), but there may be a secondary effect on seem to form a continuum, in which some pairs are more mRNA levels in the cotransfection assay (75, 77). homologous than others. Although the level of rescue by transfected VA RNA structure Direct of Ad2 and plasmid is low compared with infection with wild-type adeno- Secondary comparison. analysis cells take Ad5 VA RNA,, as well as computer-assisted predictions of all virus, presumably because only a fraction of the up the VA indicates the presence of extensive secondary the plasmid, several of the VA RNAs rescued protein synthesis RNAs, to that of structure. Since the function of Ad2 VA RNA, is intimately in d1331-infected cells with an efficiency comparable with its structure 22, 52-54, it Ad2 VA RNA, (Fig. 8A). Rescue by Ad7 VA RNA, was bound up secondary (19, 61), that seemed likely that a comparison of the RNAs at this level slightly higher than that by Ad2 VA RNA,, and by Adl2 features of functional VA RNA and SA7 VA RNA was somewhat lower. The other might reveal conserved importance. virus VA we used the nuclease to Ad2 VA RNA,,, Ad7 VA RNA,,, and CELO Accordingly, sensitivity technique species, blot the structures of these VA RNAs. Each RNA RNA, displayed little or no activity. Northern analysis probe secondary for virus VA RNA was labeled at either its 5' or 3' end and was then partially showed that all the RNAs except CELO digested with single-strand-specific nucleases (RNases T1, U2, and Ad2 VA RNA,, accumulated to approximately the same RNA levels were at least Bc, and T,) or with RNase V,, which cuts in double-stranded extent (Fig. 8B). CELO virus VA 6612 MA AND MATHEWS J. VIROL.

A box CD Ad2VAI Adl2VA SA7VA Ad7VAI Ad7VAII Ad2VAII Terminal Stem

B box UCAUGGCGGACGAL,2GGL22 5GAUfCfzQCCGUCCGCCGUGA CCGGUU1AIA=ACCG CCGGUUGlh2=G CCGGUUCGAGUCCAAAGG ^SADC@CUCGGAUG CCGGUUCGAGCCUBhWGGGCUCGUA,UQC2Q CGOUUCGEWGGG-C-G Apical Stem-loop

CD UCCAUGCGGU@ UC$ , ^ CGACGUCWII CWGGAUCCGCUAUGAGCACAAGUs GCUUGCGCGUWCAbCCG G CCGGAUCCGCCACUCCCGACGCGGCGGCCCCGCGUCCACGACCCCmCC GCCGAGACQAGCCGC CCGGAGCCGCG C E UZ[ MCCCGUCUCGACCC CCGGUUUCCGCGACAAGCGA§fiQUUGCA GC-C-G CAUUUCCAAGA=CCGOCAGCCGAC CCGGACUGCGGCGAACGG§gQOUULCUCCCCGU %QAChg,saEEmmM: Terminal Stem FIG. 7. Alignment of VA RNA sequences according to their secondary structures. The principal features of the secondary structures of the six mammalian VA RNAs, identified by nuclease sensitivity analysis, were aligned by hand. The top and bottom blocks display the 5' and 3' ends of the molecule, respectively. The central part displays the apical stem-loop structure. Regions sensitive to single-strand-specific nucleases are lightly shaded. Regions forming the terminal stem are more darkly shaded. The conserved GGGU and ACCC tetranucleotides discussed in the text are shown in boldface and are underlined. The A and B boxes and central domain (CD) of Ad2 VA RNA, are also marked.

10-fold lower than those of the other RNAs. It was not possible herpesvirus papio (32), but apparently not from other herpes- to measure Ad2 VA RNA,, accumulation in this experiment viruses. These RNAs are all highly structured, with a terminal because it is produced during d1331 infection and is therefore stem composed of base-paired 5'- and 3-terminal sequences present in every culture regardless of the plasmid transfected. together with a number of additional stems and loops. Evi- Thus, from this assay, we conclude that Ad2 VA RNA, and dence offering various degrees of proof implicates them all as Ad7 VA RNA, function efficiently, Adl2 VA RNA and SA7 RNA effectors designed to subvert a host antiviral defense VA RNA function rather less well, and Ad7 VA RNA,, mechanism, although this conclusion has been questioned for functions poorly if at all. The activities of the other two species, the Epstein-Barr virus-encoded RNAs (EBERs) (reviewed by CELO virus VA RNA and Ad2 VA RNA,,, cannot be assessed Clemens [12] and Mathews [49]). This antiviral mechanism for certain in this assay. involves an interferon-induced protein kinase, DAI, that shuts The CAT expression assay (Fig. 9) has the advantage that it down protein synthesis in infected cells when activated by is more quantitative and allows estimation of Ad2 VA RNA,, extended dsRNA, presumably of viral origin. Synthetic RNA accumulation. We measured CAT enzyme levels (Fig. 9A) and duplexes, less than about 30 bp in length (45, 57) are able to also the synthesis of CAT protein by immunoprecipitation block DAI activation, but mutagenic studies of adenovirus VA (Fig. 9A and B). Both sets of data indicated that the VA RNA, RNA have indicated that the natural effector acts in a more species of Ad2 and Ad7 enhanced CAT expression equally, subtle way, dependent on a higher-order structure present in while the corresponding VA RNA,, species and CELO VA its central domain. The comparative analysis reported here RNA worked poorly. The single VA RNA species of Adl 2 and sheds light on the function, structure, and origin of the VA SA7 gave intermediate levels of activity. As in the d/331 rescue RNAs and has led to a new model for the Ad2 VA RNA, assay, RNA analysis indicated that the variations among the structure (Fig. 1 B). This model incorporates all of the currently mammalian VA RNAs in the ability to enhance CAT expres- available data but still lacks fine definition in the central sion were not due to differences in VA RNA accumulation domain. (Fig. 9C). In this case, Ad2 VA RNAI1 could be measured, and Structure of the VA RNAs. Of the three main regions of VA the results demonstrated that this species functions poorly. RNA structure, the terminal stem is the best conserved. Its Once again, CELO virus VA RNA failed to accumulate to length varies slightly among the seven VA RNAs studied, but similar levels, however, and this failure may, in part, explain its its largely base-paired structure is maintained despite sequence failure to increase gene expression. changes on each strand because of the compensating nature of the nucleotide substitutions. DISCUSSION The apical stem is also clearly recognizable in all VA RNA species studied here, although it is less well conserved than the Small RNAs are transcribed by RNA Pol III from the terminal stem and is very short in CELO virus VA RNA. With genomes of all adenoviruses studied to date, and also from the this exception, all of the apical stems possess a CCGG se- genomes of Epstein-Barr virus (43, 64) and its close relative quence upstream of the B box which can pair with the VOL. 67, 1993 VA RNA STRUCTURE-FUNCTION COMPARISONS 6613

A of the sequences involved. The sequence and pattern of 331 nuclease digestion allow few possibilities for Watson-Crick base pairing, implying that this region does not form a regular

z double helix. Rather, it would seem that this region, which is z n: T- c CE 5 critical for VA RNA function (19, 22, 52, 53, 61), adopts a \EC 5 (71 > >3 Nl- Nl- higher-order structure as a result of different kinds of interac- r r 'a 'a ' cc c: < < < Lbu tions. It is difficult to infer these interactions unambiguously 1--7 r-- - N--7 from the nuclease sensitivity patterns, as several secondary structure models are compatible with the data (61), but a critical insight into the central domain structure has emerged from the comparative study. Near the center of this region is an

.i -T ACCC sequence which is found in all mammalian virus VA RNAs examined. This tetranucleotide is conserved in relation to the pattern of nuclease-sensitive regions and, in contrast to flanking sequences, is strikingly insensitive to nucleases itself. Initial studies of Ad2 VA RNA, structure had suggested that three of these nucleotides are paired to the sequence GGU at nucleotides 99 to 101 (19, 53), but subsequent mutagenic analysis indicated that such pairing does not 2 3 4 5 6 7 occur (61). On the 8 9 10 11 12 13 14 15 16 17 18 other hand, in the 5' half of the mammalian VA RNAs is a conserved GGGU tetranucleotide which in principle could B pair with the ACCC tetranucleotide in the central domain. 2 34 5 6 7 8 9 1011 12 1314 1516 1718 These two tetranucleotide sequences are absolutely conserved in a number of additional adenovirus serotypes, and their importance is also supported by preliminary mutagenic data (44). The GGGU sequence is relatively insensitive to single- strand-specific nucleases in the Adl2 and SA7 VA RNAs and the Ad2 and Ad7 VA RNA, species, consistent with the C proposed pairing, but in Ad7 VA RNA,,, it is sensitive to 2 3 4 5 6 7 8 9 10 il 12 13 14 nuclease attack. On the other hand, the central domains of both VA RNA,, species contain a second GGGU sequence - which is resistant to attack by single-strand-specific nucleases * - MP and could pair with the ACCC tetranucleotide. Since the VA RNA,, species are relatively inactive, we propose that pairing of the ACCC tetranucleotide with the first (5'-proximal) FIG. 8. Translation rescue assays. Duplicate were 293 cell cultures GGGU sequence determines a tertiary structure that can transfected with the VA RNA genes shown and then infected with the mutant adenovirus d1331. (A) The ability of the VA RNAs to rescue inhibit DAI activation, whereas its pairing with the second translation was determined by labeling with [35S]methionine and (downstream) GGGU sequence results in a structure that is SDS-polyacrylamide gel electrophoresis. (B) The accumulation of VA poorly adapted to this function. RNAs was monitored by Northern blot assay. RNA was extracted from Relationships among the VA RNAs. The VA RNAs and equal volumes of each cell extract and resolved in a 1% agarose gel. EBERs are only distantly related in sequence, and their Blots were probed with a mixture of RNA complementary to each VA homologies are limited to transcriptionally important regions RNA except for Ad2 VA RNA,,. (C) As a control for RNA transfer (33). Likewise, CELO virus VA RNA displays only limited and detection in the blot, 20 and 100 ng of each VA RNA, synthesized homology with the other adenovirus VA RNAs. This fact, and by T7 RNA polymerase and purified by gel filtration, was loaded the placement of the CELO virus VA RNA gene on the viral separately and probed in parallel. Hybridization was detected by autoradiography. genome in a position different from that of the VA RNA genes of the mammalian adenoviruses, suggests that the CELO virus VA RNA gene and the EBERs may have evolutionary origins different from those of the mammalian VA RNA genes. sequence C/UCGG downstream to form a stably duplexed Alternatively, since CELO virus VA RNA resembles the other region near the top of the apical stem-loop. Those Ad2 VA species to some degree but is only about half their size, it is RNA, mutants which retain the ability to form this structure possible that it represents an evolutionarily earlier form which (A2dl2, d173-84, lsla, lslb, lslc, 1s2, 1s3, 1s4, and IsS) also led to the more specialized mammalian VA RNAs with the preserve the ability to bind DAI in vitro, whereas mutants that acquisition of additional sequences and development of a more cannot form this structure (lsl, d12, d13, and d14) fail to bind sophisticated central domain. (11, 17, 52, 55). Similar structures are present in the phage R17 The mammalian virus VA RNAs form a family with distinct coat protein binding site (63, 67) and the Rev response sequence similarities and genomic locations. Two of the viruses element (38, 39), suggesting that this structure may play an studied here, Ad2 and Ad7, representing adenovirus groups C important role in protein-RNA recognition. Another GC-rich and B, respectively, each carry two VA RNA genes arranged in region is found at the base of the apical stem; this paired tandem at a locus between sequences encoding the terminal region could be responsible for stabilizing the structure of the protein precursor and the 52,55K protein. Whereas Ad7 VA adjacent central domain. RNA, and VA RNA,, are highly homologous, the two Ad2 VA The central domain is characterized by a pattern of nucle- RNAs are rather divergent in sequence. Yet the VA RNA,, ase-sensitive and nuclease-resistant regions which is conserved species of Ad2 and Ad7 are highly homologous. These rela- across all of the mammalian virus VA RNA species examined tionships might indicate that VA RNA,, is a more recent despite considerable variations in the lengths and compositions evolutionary development, resulting from a duplication of a A

ID 600, 150 .C: 125 3 > 500 400 100 :~ (3 0L 300 75* Cd H 200 50 H 100. 25 C 0 0 Ad2 Ad2 Ad7 Ad7 Adl 2 CELO SA7 pUCl 19 VA RNAI VA RNABI VA RNAI VA RNAII VA RNA VA RNA VA RNA

B Ad2 Ad2 Ad7 Ad7 Adll2 CELO SA7 pUC1 19 VA RNAI VA RNAIi VA RNAI VA RNAii VA RNA VA RNA VA RNA

fl - o ^ am - -_ b m n 4 m 0i 12 m31 51

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 C 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

D 1 2 3 4 5 6 7 8 9 10 11 12 13 1415 16

FIG. 9. CAT expression assay. (A) Immunoprecipitation (IP) of [35S]methionine-labeled CAT (checkered bars) and CAT enzyme assays (stippled) were used to examine the enhancement of CAT by the cotransfected VA RNA plasmids indicated. (B) The immunoprecipitated CAT was resolved in a 15% polyacrylamide-SDS gel. The bands were quantified with Fuji Bio-imaging analyzer, and the averaged results are depicted in panel A. (C) VA RNA accumulation was measured by Northern blotting using a mixture of probes complementary to all of the VA RNAs. (D) A parallel Northern blot containing 100 and 500 ng of each VA RNA, probed as in panel C as a control for the quantitative validity of the assay. 6614 VOL. 67, 1993 VA RNA STRUCTURE-FUNCTION COMPARISONS 6615 single original VA RNA gene in the ancestor to Ad7, and that transient expression assay. Mol. Cell. Biol. 7:549-551. this second copy (VA RNA,I) was acquired by Ad2 perhaps by 3. Barrell, B. G. 1971. Fractionation and sequence analysis of recombination during a mixed infection between Ad7 and an radioactive nucleotides. Proc. Nucleic Acid Res. 2:751-779. of Ad2. Another hypothesis is that the VA 4. Bhat, R. A., P. H. Domer, and B. Thimmappaya. 1985. Structural ancestor RNA,, requirements of adenovirus VAI RNA for its translation enhance- species serves a separate function from VA RNA, and that this ment function. Mol. Cell. Biol. 5:187-196. function requires tight sequence conservation. At first sight, 5. Bhat, R. A., and B. Thimmappaya. 1983. Two small RNAs this possibility would seem less likely to be correct since both encoded by Epstein-Barr virus can functionally substitute for the Adl2 and SA7 replicate without benefit of a second VA RNA, virus-associated RNAs in the lytic growth of adenovirus 5. Proc. and the VA RNA,, gene of Ad2 is dispensable for growth in Natl. Acad. Sci. USA 80:4789-4793. tissue culture (79). It must be recognized, however, that the 6. Bhat, R. A., and B. Thimmappaya. 1985. Construction and analysis functions of the VA RNA genes in vivo have been investigated of additional adenovirus substitution mutants confirm the comple- only for the group C viruses in tissue culture cells and that mentation of VAI RNA function by two small RNAs encoded by a of different tissues for which Epstein-Barr virus. J. Virol. 56:750-756. adenoviruses grow in number 7. Bogenhagen, D. F., and D. D. Brown. 1981. Nucleotide sequences different requirements may pertain. In view of the clustering of in Xenopus 5S DNA required for transcription termination. Cell gene products serving similar functions in the adenovirus 24:261-270. genome, it would not be surprising if this hypothetical VA 8. Brown, J. W., E. S. Haas, B. D. James, D. A. Hunt, and N. R. Pace. RNA,, function lay in the realm of translational control and/or 1991. Phylogenetic analysis and evolution of RNase P RNA in host defense mechanisms. An attractive target is the 2'5'- proteobacteria. J. Bacteriol. 173:3855-3863. oligoadenylate synthetase, another interferon-induced enzyme 9. Celma, M. L., J. Pan, and S. M. Weissman. 1977. Studies of low which is also activated by dsRNA and curtails viral protein molecular weight RNA from cells infected with adenovirus 2. I. synthesis (31, 66); this possibility is currently being explored. Heterogeneity at the 5' end of VA-RNA I. J. Biol. Chem. the remaining three 252:9043-9046. Excluding the VA RNA,, species, 10. Celma, M. L., J. Pan, and S. M. Weissman. 1977. Studies of low human virus species (Ad2 VA RNA,, Ad7 VA RNA,, and molecular weight RNA from cells infected with adenovirus 2. I. Adl2 VA RNA) differ considerably from one another in The sequences at the 3' end of VA-RNA I. J. Biol. Chem. sequence, but each is more closely related to SA7 VA RNA. 252:9032-9042. This finding suggests that the major species (where there are 11. Clarke, P. A., T. Pe'ery, Y. Ma, and M. B. Mathews. Unpublished two) or the sole VA RNA species (where it is unique) of the data. mammalian viruses may derive from an ancestral adenovirus 12. Clemens, M. J. 1993. The small RNAs of Epstein-Barr virus. Mol. similar to SA7 that infected primates. It may not be a Biol. Rep. 17:81-92. coincidence that the two VA species (of Ad2 and Ad7) 13. Donis-Keller, H., A. M. Maxam, and W. Gilbert. 1977. Mapping RNA, adenines, guanines, and pyrimidines in RNA. Nucleic Acids Res. are more active in both of the functional assays used here than 4:2527-2538. is the single VA RNA species of Adl2 and SA7, while the two 14. England, T. E., and 0. C. Uhlenbeclk 1978. 3'-terminal labelling of VA RNA,, species are ineffective. If the VA RNAs subserve RNA with T4 RNA ligase. Nature (London) 275:560-561. two distinct functions with different structural and/or sequence 15. Engler, J. A., M. S. Hoppe, and M. P. van Bree. 1983. The requirements, then the single VA RNAs of Adl2 and SA7 may nucleotide sequence of the genes encoded in early region 2b of represent a compromise between the two sets of requirements, human adenovirus type 7. Gene 21:145-159. fulfilling both roles to some degree, while the VA RNA, 16. Fohring, B., A. Geis, M. Koomey, and K. J. Raska. 1979. Adeno- species are highly specialized for blocking DAI activation and virus type 12 VA RNA. Virology 95:295-302. the VA RNA,, species are specialized for the second, as yet 17. Fowlkes, D. M., and T. Shenk. 1980. Transcriptional control with this idea, VA is regions of the adenovirus VAI RNA gene. Cell 22:405-413. unidentified, function. Consistent RNA,, 18. Francoeur, A. M., and M. B. Mathews. 1982. Interaction between able to support the infection of HeLa cells to only a limited VA RNA and the lupus antigen La: formation of a ribonucleo- extent in the absence of VA RNA,, whereas VA RNA, confer protein particle in vitro. Proc. Natl. Acad. Sci. USA 79:6772-6776. ful infectivity in the absence of VA RNA,, (4, 79) because it 19. Furtado, M. R., S. Subramanian, R. A. Bhat, D. M. Fowlkes, B. completely suppresses DAI activation (60, 68). Similarly, the Safer, and B. Thimmappaya. 1989. Functional dissection of ade- EBERs display only limited ability to substitute for the VA novirus VAI RNA. J. Virol. 63:3423-3434. RNAs (5, 6). Perhaps the hypothetical second function of the 20. Galabru, J., M. G. Katze, N. Robert, and A. G. Hovanessian. 1989. adenovirus VA RNAs is the predominant function of the VA The binding of double-stranded RNA and adenovirus VAI RNA RNA,, species, EBERs, and possibly even CELO virus VA to the interferon-induced protein kinase. Eur. J. Biochem. 178: RNA. 581-589. 21. Galli, G., H. Hofstetter, and M. L. Birnstiel. 1981. Two conserved sequence blocks within eukaryotic tRNA genes are major pro- ACKNOWLEDGMENTS moter elements. Nature (London) 294:626-631. 22. Ghadge, G. D., S. Swaminathan, M. G. Katze, and B. Thimma- We thank Tsafrira Pe'ery for advice and discussions, Lisa Manche, paya. 1991. Binding of the adenovirus VAI RNA to the interferon- Ronnie Packer, Martin Stoddart, and Patty Wendel for technical help, induced 68 kDA protein kinase correlates with function. Proc. Goran Akusjarvi and Jeffrey Engler for plasmids, and Clark Tibbetts Natl. Acad. Sci. USA 88:7140-7144. for Ad7. 23. Gilbert, D. G. 1990. MulFold, a MacIntosh version of MFOLD This work was supported by grant CA13106 from the National (version 2.0) by Michael Zuker and John Jaeger for prediction of Cancer Institute. RNA secondary structure by free energy minimization, available via anonymous ftp to iubio.bio.indiana.edu. 24. Gilbert, D. G. 1990. LoopViewer, a MacIntosh program for REFERENCES visualizing RNA secondary structure. Published electronically on 1. Akusjarvi, G., M. B. Mathews, P. Andersson, B. Vennstr8m, and the Internet, available via anonymous ftp to iubio.bio.indiana.edu. U. Pettersson. 1980. Structure of genes for virus-associated RNA, 25. Gorman, C. M., L. F. Mofat, and B. H. Howard. 1982. Recombi- and RNA,, of adenovirus type 2. Proc. Nati. Acad. Sci. USA nant genomes which express chloramphenicol acetyltransferase in 77:2424-2428. mammalian cells. Mol. Cell. Biol. 2:1044-1051. 2. Akusjarvi, G., C. Svensson, and 0. Nygard. 1987. A mechanism by 26. Graham, F. L., J. Smiley, W. C. Russell, and R. Nairn. 1977. which adenovirus virus-associated RNA, controls translation in a Characteristics of a human cell line transformed by DNA from 6616 MA AND MATHEWS J. VIROL.

human adenovirus type 5. J. Gen. Virol. 36:59-72. 49. Mathews, M. B. 1993. Viral evasion of cellular defense mecha- 27. Green, S. R., and M. B. Mathews. 1992. Two RNA binding motifs nisms: regulation of the protein kinase DAI by RNA effectors. in the double-stranded RNA activated protein kinase, DAI. Genes Semin. Virol. 4:247-257. Dev. 6:2478-2490. 50. Mathews, M. B., and U. Pettersson. 1978. The low molecular 28. Guilfoyle, R., and R. Weinmann. 1981. Control region for adeno- weight RNAs of adenovirus 2-infected cells. J. Mol. Biol. 119:293- virus VA RNA transcription. Proc. Natl. Acad. Sci. USA 78:3378- 328. 3382. 51. Mathews, M. B., and T. Shenk. 1991. Adenovirus virus-associated 29. Gutell, R. R., B. Weiser, C. R. Woese, and H. F. Noller. 1985. RNA and translational control. J. Virol. 65:5657-5662. Comparative anatomy of 16-S-like ribosomal RNA from E. coli. 52. Mellits, K. H., M. Kostura, and M. B. Mathews. 1990. Interaction Topography and secondary structure. Prog. Nucleic Acid Res. of adenovirus VA RNA, with the protein kinase DAI: non- Mol. Biol. 32:155-216. equivalence of binding and function. Cell 61:843-852. 30. Horwitz, M. S. 1990. Adenoviridae and their replication, p. 53. Mellits, K. H., and M. B. Mathews. 1988. Effects of mutations in 1679-1712. In B. N. Fields and D. M. Knipe (ed.), Virology. Raven stem and loop regions on the structure and function of adenovirus Press, Ltd., New York. VA RNA,. EMBO J. 7:2849-2859. 31. Hovanessian, A. G. 1991. Interferon-induced and double-stranded 54. Mellits, K. H., T. Pe'ery, L. Manche, H. D. Robertson, and M. B. RNA-activated enzymes: a specific protein kinase and 2',5'- Mathews. 1990. Removal of double-stranded contaminants from oligoadenylate synthetases. J. Immunol. 11:199-205. RNA transcripts: synthesis of adenovirus VA RNA, from a T7 32. Howe, J. G., and M. D. Shu. 1988. Isolation and characterization of vector. Nucleic Acids Res. 18:5401-5406. the genes for two small RNAs of herpesvirus papio and their 55. Mellits, K. H., T. Pe'ery, and M. B. Mathews. 1992. Structure and comparison with Epstein-Barr virus-encoded EBER RNAs. J. function of adenovirus VA RNA: role of the apical stem. J. Virol. Virol. 62:2790-2798. 66:2369-2377. 33. Howe, J. G., and M. D. Shu. 1989. Epstein-Barr virus small RNA 56. Milligan, J. F., D. R. Groebe, G. W. Witherell, and 0. C. (EBER) genes: unique transcription units that combine RNA Uhlenbeck. 1987. Oligoribonucleotide synthesis using T7 RNA polymerase II and III promoter elements. Cell 57:825-834. polymerase and synthetic DNA templates. Nucleic Acids Res. 34. Jaeger, J. A., D. H. Turner, and M. Zuker. 1989. Improved 15:8783-8798. prediction of secondary structure for RNA. Proc. Natl. Acad. Sci. 57. Minks, M. A., D. K. West, S. Benvin, and C. Baglioni. 1979. USA 86:7706-7710. Structural requirements of double-stranded RNA for the activa- 35. Katze, M. G., D. DeCorato, B. Safer, J. Galabru, and A. G. tion of 2',5'-oligo(A) polymerase and protein kinase of interferon- Hovanessian. 1987. Adenovirus VAI RNA complexes with the treated HeLa cells. J. Biol. Chem. 254:10180-10183. 68,000 Mr protein kinase to regulate its autophosphorylation and 58. Ohe, K., S. M. Weissman, and N. R. Cooke. 1969. Studies on the activity. EMBO J. 6:689-697. origin of a low molecular weight ribonucleic acid from human cells 36. Kaufman, R. J. 1984. Identification of the components necessary infected with adenoviruses. J. Biol. Chem. 244:5320-5332. for adenovirus translational control and their utilization in cDNA 59. O'Malley, R. P., R. F. Duncan, J. W. B. Hershey, and M. B. expression vectors. Proc. Natl. Acad. Sci. USA 82:689-693. Mathews. 1989. Modification of protein synthesis initiation factors 37. Kitajewski, J., R. J. Schneider, B. Safer, S. M. Munemitsu, C. E. and shut-off of host protein synthesis in adenovirus-infected cells. Samuel, B. Thimmappaya, and T. Shenk. 1986. Adenovirus VAI Virology 168:112-118. RNA antagonizes the antiviral action of interferon by preventing 60. O'Malley, R. P., T. M. Mariano, J. Siekierka, and M. B. Mathews. activation of the interferon-induced eIF-2(x kinase. Cell 45:195- 1986. A mechanism for the control of protein synthesis by 200. adenovirus VA RNA,. Cell 44:391-400. 38. Kjems, J., M. Brown, D. D. Chang, and P. A. Sharp. 1991. 61. Pe'ery, T., K. H. Mellits, and M. B. Mathews. 1993. Mutational Structural analysis of the interaction between the human immu- analysis of the central domain of adenovirus VA RNA mandates a nodeficiency virus Rev protein and the Rev response element. revision of the proposed secondary structure. J. Virol. 67:3534- Proc. Natl. Acad. Sci. USA 88:683-687. 3543. 39. Kjems, J., B. J. Calnan, A. D. Frankel, and P. A. Sharp. 1992. 62. Pettersson, U., and L. Philipson. 1975. Location of sequences on Specific binding of a basic peptide from HIV-1 rev. EMBO J. the adenovirus genome coding for the 5.5S RNA. Cell 6:1-4. 11:1119-1129. 63. Romaniuk, R. J., P. Lowary, H. N. Wu, G. Stormo, and 0. C. 40. Kostura, M., and M. B. Mathews. 1989. Purification and activation Uhlenbeck. 1987. RNA binding site of R17 coat protein. Biochem- of the double-stranded RNA-dependent eIF-2 kinase DAI. Mol. istry 26:1563-1568. Cell. Biol. 9:1576-1586. 64. Rosa, M. D., E. Gottlieb, M. R. Lerner, and J. A. Steitz. 1981. 41. Larsson, S., A. Bellett, and G. Akusjarvi. 1986. VA RNAs from Striking similarities are exhibited by two small Epstein-Barr avian and human adenoviruses: dramatic differences in length, virus-encoded ribonucleic acids and the adenovirus-associated sequence, and gene location. J. Virol. 58:600-609. ribonucleic acids VAI and VAII. Mol. Cell. Biol. 1:785-796. 42. Larsson, S., C. Svensson, and G. Akusjarvi. 1986. Characterization 65. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular of a low-molecular-weight virus-associated (VA) RNA encoded by cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labo- simian adenovirus type 7 which functionally can substitute for ratory Press, Cold Spring Harbor, N.Y. adenovirus type 5 VA RNAI. J. Virol. 60:635-644. 66. Samuel, C. E. 1991. Antiviral actions of interferon: interferon- 43. Lerner, M. R., N. C. Andrews, G. Miller, and J. A. Steitz. 1981. regulated cellular proteins and their surprisingly selective antiviral Two small RNAs encoded by Epstein-Barr virus and complexed activities. Virology 183:1-11. with protein are precipitated by antibodies from patients with 67. Schneider, D., C. Tuerk, and L. Gold. 1992. Selection of high systemic lupus erythematosus. Proc. Natl. Acad. Sci. USA 78:805- affinity RNA ligands to the bacteriophage R17 coat protein. J. 809. Mol. Biol. 228:862-869. 44. Ma, Y., and M. B. Mathews. Unpublished data. 68. Schneider, R. J., B. Safer, S. M. Munemitsu, C. E. Samuel, and T. 45. Manche, L., S. R. Green, C. Schmedt, and M. B. Mathews. 1992. Shenk. 1985. Adenovirus VAI RNA prevents phosphorylation of Interactions between double-stranded RNA regulators and the the eukaryotic initiation factor 2 alpha subunit subsequent to protein kinase DAI. Mol. Cell. Biol. 12:5238-5248. infection. Proc. Natl. Acad. Sci. USA 82:4321-4324. 46. Maran, A., and M. B. Mathews. 1988. Characterization of the 69. Shu, L. M., J. S. Hong, Y. F. Wei, and J. A. Engler. 1986. double-stranded RNA implicated in the inhibition of protein Nucleotide sequence of the genes encoded in early region 2b of synthesis in cells infected with a mutant adenovirus defective for human adenovirus type 12. Gene 46:187-195. VA RNA,. Virology 164:106-113. 70. Silberklang, M., A. M. Gillum, and U. L. RajBhandary. 1979. Use 47. Mathews, M. B. 1975. Genes for VA-RNA in adenovirus 2. Cell of in vitro 32P labeling in the sequence analysis of nonradioactive 6:223-229. tRNAs. Methods Enzymol. 59:58-109. 48. Mathews, M. B. 1990. Control of translation in adenovirus- 71. Snouwaert, J., D. Bunick, C. Hutchison, and D. M. Fowlkes. 1987. infected cells. Enzyme 44:250-264. Large numbers of random point and cluster mutations within the VOL. 67, 1993 VA RNA STRUCTURE-FUNCTION COMPARISONS 6617

adenovirus VA I gene allow characterization of sequences re- which alters initiation of transcription by RNA polymerase III on quired for efficient transcription. Nucleic Acids Res. 15:8293- the AdS chromosome. Cell 18:947-954. 8330. 79. Thimmappaya, B., C. Weinberger, R. J. Schneider, and T. Shenlk 72. Sobel, E., and H. M. Martinez. 1986. A multiple sequence 1982. Adenovirus VAI RNA is required for efficient translation of alignment program. Nucleic Acids Res. 14:363-374. viral mRNAs at late times after infection. Cell 31:543-551. 73. Soderlund, H., U. Pettersson, B. Vennstrom, L. Philipson, and 80. Vennstrom, B., U. Pettersson, and L. Philipson. 1978. Two initia- M. B. Mathews. 1976. A new species of virus-coded low molecular tion sites for adenovirus 5.5S RNA. Nucleic Acids Res. 5:195-204. weight RNA from cells infected with Ad2. Cell 7:585-593. 81. Wigler, M., R. Sweet, G. K. Sim, B. Wold, A. Pellicer, E. Lacy, T. 74. Sonenberg, N. 1990. Measures and countermeasures in the mod- Maniatis, S. Silverstein, and R. Axel. 1979. Transformation of ulation of initiation factor activities by viruses. New Biol. 2:402- mammalian cells with genes from procaryotes and eucaryotes. Cell 409. 16:777-785. 75. Striker, R., D. T. Fritz, and A. D. Levinson. 1989. Adenovirus 82. Woese, C. R., L. J. Magrum, R. Gupta, R. B. Siegel, D. A. Stahl, J. VAI-RNA regulates gene expression by controlling stability of Kop, N. Crawford, J. Brosius, R. Gutell, J. J. Hogan, and H. F. ribosome-bound RNAs. EMBO J. 8:2669-2675. Noller. 1980. Secondary structure model for bacterial 16S riboso- 76. Svensson, C., and G. Akusjarvi. 1985. Adenovirus VA RNA, mal RNA: phylogenetic, enzymatic and chemical evidence. Nu- mediates a translational stimulation which is not restricted to the cleic Acids Res. 8:2275-2293. viral mRNAs. EMBO J. 4:957-964. 83. Wu, G.-J., J. F. Railey, and R. E. Cannon. 1987. Defining the 77. Svensson, C., and G. Akusjarvi. 1990. A novel effect of adenovirus functional domains in the control region of the adenovirus type 2 VA RNA, on cytoplasmic mRNA abundance. Virology 174:613- specific VA RNA1 gene. J. Mol. Biol. 194:423-442. 617. 84. Zuker, M. 1989. On finding all suboptimal foldings of an RNA 78. Thimmappaya, B., N. Jones, and T. Shenk. 1979. A mutation molecule. Science 244:48-52.