Subcellular Localization of the HSP70-Homolog Encoded by Beet Yellows Closterovirus

Virology 260, 173–181 (1999) Article ID viro.1999.9807, available online at http://www.idealibrary.com on

Vicente Medina,* Valery V. Peremyslov,† Yuka Hagiwara,† and Valerian V. Dolja†,‡,1

*Department de Producio Vegetal I Ciencia Forestal, Universitat de Lleida, Avenida Alcalde Rovira Roure 177, 25198 Lleida, Spain; and †Department of Botany and Plant Pathology and ‡Center for Gene Research and Biotechnology, Oregon State University, Corvallis, Oregon 97331 Received March 12, 1999; returned to author for revision April 11, 1999; accepted May 12, 1999

Closteroviridae is the only viral family coding for a homolog of HSP70 (HSP70h). Polyclonal antiserum to recombinant beet yellows closterovirus (BYV) HSP70h was generated and used for immunogold labeling of the leaf samples derived from the infected Nicotiana benthamiana plants. Ultrastructural analysis revealed the preferential accumulation of BYV in phloem, although occasional infection of the leaf mesophyll cells was also observed. The strongest HSP70h-specific labeling was associated with virion aggregates and vesicles harboring scattered virions. HSP70h was also observed in close proximity of plasmodesmata and inside the plasmodesmatal channels. The possible role of the BYV HSP70h in RNA encapsidation was tested in tobacco protoplasts. A BYV mutant possessing an inactivated HSP70h gene exhibited no detectable encapsidation defects. Collectively, the obtained results suggested that closteroviral HSP70h escorts the virions to their destinations inside the infected cells and possibly participates in the intercellular translocation of BYV. © 1999 Academic Press

INTRODUCTION lov et al., 1998). Other possibilities included involvement of the HSP70h in viral translocation from cell to The proteins from the HSP70 family of molecular cell (Karasev et al., 1992; Agranovsky et al., 1998), chaperones are conserved among unicellular and mul- systemic transport, assembly of the filamentous viri- ticellular organisms (Tatusov et al., 1997; Chervitz et ons, or transmission of virus by insects (Tian et al., al., 1998; Guy and Li, 1998). Many DNA and RNA 1999). viruses of bacteria, plants, and animals recruit cell HSP70s at various stages of the life cycle (e.g., Mace- Knowledge of intracellular localization provides impor- jak and Sarnow, 1992; Jindal and Young, 1992; Cripe et tant clues as to the functions of the viral proteins and al., 1995) or regulate expression of the nuclear HSP70 mechanisms of their interaction with cell components genes (Phillips et al., 1991; Wainberg et al., 1997). In (for recent examples, see Rodriguez-Cerezo et al., 1997; particular, a plant potyvirus specifically induces tran- Schaad et al., 1997; Ward et al., 1997; Medina et al., 1998; scription of one of the host HSP70 genes in cells that Heinlein et al., 1998). The ultrastructure of the BYV-in- support active viral replication (Aranda et al., 1996). fected cells and tissues of Beta vulgaris and Tetragonia However, viral-encoded HSP70 homologs (HSP70h) expansa has been examined extensively to reveal pref- are found only among the plant closteroviruses. The erential association of virus with the phloem and its presence of the HSP70h gene in all members of the ability to exit into mesophyll cells late in infection (Esau, diverse family Closteroviridae (Agranovsky et al., 1991; 1960a, 1960b; Esau and Hoefert, 1971a, 1971b, 1971c). Pappu et al., 1994; Klaassen et al., 1995; Karasev et al., These and following studies described the cytopathology 1996; Tian et al., 1996; Jelkmann et al., 1997; Ling et al., of closterovirus infection, with the formation of cytoplas- 1998; Zhu et al., 1998; D’Ann Rochon, personal com- mic vesicles containing virions as its most striking fea- munication) suggests that this gene was acquired by ture (Lesemann, 1988). This early work, however, did not the common ancestor of closteroviruses via recombi- address the distribution of closterovirus proteins in in- nation with the cell mRNA (Dolja et al., 1994b). It was fected cells. demonstrated recently that although HSP70h of beet Here we report the subcellular localization of the yellows closterovirus (BYV) is expressed early in in- BYV HSP70h in Nicotiana benthamiana. It was found fection (unpublished results), it is not required for that HSP70h is associated with the virions present in amplification of the viral positive-strand RNA genome cytoplasm, in the nucleus, and in the vicinity of plas- or for transcription of the subgenomic RNAs (Peremys- modesmata. In addition, HSP70h was observed inside the plasmodesmata. Based on these results, we suggest that HSP70h accompanies virions and probably 1 To whom reprint requests should be addressed. Fax: (541) 737- targets them to plasmodesmata for translocation into 3573. E-mail: [email protected]. adjacent cells.

FIG. 1. Cytopathology of a BYV-infected phloem companion cell. (A) Transverse section of a minor vein from young N. benthamiana leaf. The cell types are designated as S (sieve elements), CC (companion cells), PP (phloem parenchyma), BS (bundle sheath), and T (tracheary elements). The rectangle marks the area shown in B. (B) A region in companion cell containing abundant BYV-induced vesicles (Ve) and virion aggregates (V). Ch, chloroplast. Bar in A, 7.3 ␮m; in B, 0.91 ␮m.

RESULTS strictly limited to, the phloem, a pattern previously described for sugar beet (Esau, 1960a, 1960b) and T. ex- Histological distribution of BYV in the leaves of pansa (Esau and Hoefert, 1971a, 1971b). Nicotiana benthamiana

Although N. benthamiana is known to be one of the Colocalization of the HSP70h with BYV virions most permissive hosts for plant viruses, it has not been previously reported as a BYV host. We found that N. The IGL analysis of HSP70h distribution in BYV-in- benthamiana was readily infected by BYV after aphid- fected cells revealed that the most conspicuous associ- assisted transmission or mechanical inoculation, exhib- ation of gold particles was with masses of virions (Figs. iting vein clearing, leaf deformation, and eventually sys- 3A and 3B). To test this apparent colocalization of the temic necrosis and plant death (data not shown). Elec- virions and HSP70h, serial sections of the same infected tron microscopic (EM) examination of the vascular cell were subjected to IGL using anti-HSP70h or anti-CP bundles in infected leaves revealed formation of charac- serum. The highest density of gold particles was ob- teristic virus-induced vesicles (Fig. 1). The cytosol of a served in similar locations on both images (cf. Figs. 3C companion cell shown in Fig. 1B is packed by the vesi- and 3D). The relatively low overall density of HSP70h- cles intermingled with scattered filamentous virions and specific IGL can be attributed to the down-regulation of virion aggregates. Immunogold labeling (IGL) using an- the HSP70h production resulting in ϳ100-fold difference tiserum to BYV capsid protein (CP) resulted in specific in expression levels of the CP and HSP70h (unpublished association of gold particles with virions but not with the observation). thicker filaments presumably formed by the phloem pro- Further support for the association between HSP70h tein (Pp in Fig. 2A). In addition to their most consistent and virions was obtained using statistical analysis of the presence in the phloem companion and parenchyma distribution of gold particles in various areas of the cells, vesicles and virions were also observed in the infected and noninfected cells (Table 1). As expected, mesophyll cells (Fig. 2B). These results demonstrated application of IGL with anti-CP serum revealed the high- that in N. benthamiana BYV was associated with, but not est specific labeling of virion masses and virions scat- SUBCELLULAR LOCALIZATION OF VIRAL HSP70 175

FIG. 2. Immunogold labeling of BYV-infected cells using anticapsid protein serum. (A) Companion cell (bottom left) showing strong labeling of virion masses (V) and virions scattered in cytoplasm. Note that the fibrous material in the center presumably formed by the phloem protein (Pp) is not labeled. CW, cell wall between companion and bundle sheath (top right) cells. N, nucleus; M, mitochondrion; Ch, chloroplast. (B) Mesophyll cell showing labeled virion masses and vesicles (Ve). The size of gold microspheres is 30 nm. Bar in A, 1.5 ␮m; in B, 2.3 ␮m.

tered among vesicles in the cytoplasm. Some CP label- vicinity of the plasmodesmata (Fig. 4C). Examination of ing was observed in the nuclei and chloroplasts but not infected cells using the CP-specific IGL revealed only in mitochondria or cell walls (Table 1). Application of the marginal levels of labeling of plasmodesmatal channels HSP70h-specific IGL revealed a very similar pattern of (1.06 Ϯ 1.66 and 0.8 Ϯ 1.23 for 10 and 30 nm gold, distribution that was reproduced using two sizes of gold respectively). Given the much higher overall abundance particles: 30 and 10 nm (Table 1). Similar analysis of of the CP compared with that of HSP70h, these results noninfected cells revealed very low background, demon- suggest that HSP70h is a resident plasmodesmatal pro- strating the specificity of the labeling. Taken together, tein, whereas association of the CP and/or virions with these results clearly indicate that the virions and HSP70h intercellular channels is only weak or transient. colocalize in BYV-infected cells of N. benthamiana. RNA encapsidation analysis using the HSP70h- Relation of the HSP70h and virions to plasmodesmata deficient BYV mutant Inspection of the HSP70h-specific IGL images re- Colocalization of HSP70h and virions could be inter- vealed consistent labeling of the intercellular plasmod- preted as indication of an HSP70h role in virion assem- esmatal channels (Figs. 4A and 4B). Analysis of 30 plas- bly. To test this possibility, we used a mutant in which the modesmata found in infected cells yielded a mean of start codon in the ORF encoding HSP70h has been 2.6 Ϯ 2.3 gold particles per plasmodesma. If only the replaced with AUA, resulting in a complete block of plasmodesmata showing at least one gold particle were HSP70h synthesis (Peremyslov et al., 1998; and data not considered (n ϭ 20), the level of labeling was as high as shown). The full-length cDNA clone of BYV harboring this 3.7 Ϯ 2.0. Analysis of noninfected cells revealed only mutation was designated pBYV-No-HSP70h. The compe- negligible background labeling (0.1 Ϯ 0.3 gold particles tence of this mutant in RNA encapsidation was tested per plasmodesma). using transfection of the corresponding RNA transcripts Virion-like filaments were frequently found in the close into tobacco protoplasts. The transcripts of the nonmu- 176 MEDINA ET AL.

FIG. 3. Immunogold labeling of BYV-infected cells using anti-HSP70h serum (A–C) or anticapsid protein serum (D). Specific labeling of the virion aggregates is shown in A and B. C and D represent ultrathin sections of the same cell labeled using anti-HSP70h serum (C) or anticapsid protein serum (D). Strongest labeling of the areas containing virions is obvious in both panels. The size of gold microspheres is 30 nm in A and B and 10 nm in C and D. Bar in A, 0.51 ␮m; in B, 0.84 ␮m; in C and D, 0.58 ␮m. tant variant pBYV-NA (Peremyslov et al., 1998) were used genome. This approach revealed protection of the all as a positive control. The recombinant variant in which three regions in the wild-type BYV variant. As expected, six BYV genes including those encoding major and minor none of these regions was protected in BYV-GUS-p21 CPs were replaced with the GUS reporter (pBYV-GUS- variant lacking CP genes (Fig. 5). In an additional positive p21) was used as an assembly-deficient negative con- control, the RNA preparations isolated before treatment trol. were successfully amplified for each BYV variant by us- Analysis of RNA encapsidation was conducted using a ing each of the three primer sets (Fig. 5A and data not modified RT-PCR-based approach (Wu and Shaw, 1996). shown). Extracts of protoplasts harvested at 4 days post-trans- The apparent level of RNA protection in No-HSP70h fection were incubated in the presence of endogenous variant was indistinguishable from that observed in the RNases resulting in digestion of the uncoated RNA, nonmutant BYV (Fig. 5). This result suggested that whereas the encapsidated RNA remained protected. The HSP70h is not required for encapsidation of viral RNA. RNA was isolated and analyzed via RT-PCR using three The IGL-EM analysis also confirmed the presence of sets of primers designed for amplification of the 5Ј- virions in extracts of protoplasts transfected using the terminal, internal, and 3Ј-terminal regions of the BYV wild-type and No-HSP70h BYV variants (not shown). SUBCELLULAR LOCALIZATION OF VIRAL HSP70 177

TABLE 1 Number of 30- or 10-nm Gold Particles Present in Different Regions of BYV-Infected Companion and Phloem Parenchyma Cells Probed with Antisera to BYV CP or HSP70h and Compared with Similar Regions of Noninfected Cells (in Parentheses)

CP Antiserum HSP70h Antiserum

30 nm 10 nm 30 nm 10 nm

Virion aggregates 31.9 Ϯ 9.0a 52.5 Ϯ 12.3 7.1 Ϯ 2.2 8.6 Ϯ 1.7 Vesicles 19.0 Ϯ 4.8 37.1 Ϯ 7.1 5.6 Ϯ 3.6 7.7 Ϯ 2.2 Nuclei 5.5 Ϯ 1.6 (0.2 Ϯ 0.4) 8.0 Ϯ 3.4 (0.3 Ϯ 0.6) 3.1 Ϯ 1.5 (0.3 Ϯ 0.6) 3.6 Ϯ 1.7 (0.1 Ϯ 0.3) Chloroplasts 2.4 Ϯ 1.9 (0.2 Ϯ 0.4) 3.7 Ϯ 1.7 (0.2 Ϯ 0.4) 1.0 Ϯ 1.0 (0.2 Ϯ 0.4) 1.1 Ϯ 1.2 (0.4 Ϯ 0.9) Mitochondria 0.2 Ϯ 0.4 (0.2 Ϯ 0.4) 0.8 Ϯ 1.3 (0.1 Ϯ 0.3) 0.0 Ϯ 0.0 (0.2 Ϯ 0.4) 0.3 Ϯ 0.4 (0.1 Ϯ 0.3) Cell walls 0.3 Ϯ 0.4 (0.1 Ϯ 0.3) 0.7 Ϯ 0.8 (0.3 Ϯ 0.6) 0.3 Ϯ 0.4 (0.1 Ϯ 0.3) 0.6 Ϯ 1.0 (0.2 Ϯ 0.6)

a Number of gold particles per square unit (ϳ0.75 ␮m2) Ϯ standard deviation. For each presented region, 20 areas were included in the analysis.

DISCUSSION ons was further supported by copurification of this non- structural protein with virions of lettuce infectious yel- Our study of the distribution of BYV in the infected lows closterovirus (Tian et al., 1999) and BYV (T. Tian, leaves of N. benthamiana demonstrated strong affinity of B. W. Falk, V.V.P., and V.V.D., unpublished data). Colocal- the virus for phloem and only limited spread into adja- ization of HSP70h with virions could indicate that cent mesophyll cells. The infected cells exhibited forma- HSP70h functions in RNA encapsidation. This hypothesis tion of vesicles characteristic of closterovirus infections was tested using an HSP70h-deficient BYV mutant. Be- (Lesemann, 1988). Phloem tropism, subcellular localiza- cause no defects in protection of the terminal and inter- tion, and cytopathology of BYV in a newly described host nal regions of the mutant RNA from RNase degradation N. benthamiana are in remarkable agreement with the were revealed using RT-PCR analysis, we concluded that early work on BYV in sugar beet and T. expansa (Esau, HSP70h is not essential for RNA encapsidation. How- 1960a, 1960b; Esau and Hoefert, 1971a, 1971b, 1971c). ever, we cannot exclude a possible role of HSP70h in the These authors observed BYV-like particles among the assembly of unusual BYV virions possessing a short “tail” vesicles, in the nuclei, and in loose association with the (Agranovsky et al., 1995), for we did not examine the chloroplasts but not in the mitochondria. We confirmed architectural details of the virions formed by the HSP70h- this pattern of subcellular localization of virions using deficient mutant. specific antiserum and IGL. Targeting of a viral protein to plasmodesmata is gen- In addition, our observations revealed the presence of erally considered as indication of its role in cell-to-cell virions in close proximity to plasmodesmata. However, movement (Lucas, 1995; Carrington et al., 1996). Accord- weak CP-specific labeling of the plasmodesmatal chan- ingly, our finding of HSP70h in association with plasmod- nels suggested that if the virions are involved in the virus esmata suggests its involvement in the intercellular traf- spread from cell to cell, their transit is quite rapid. Evi- ficking of BYV. Because HSP70h is also associated with dently, more research is required to identify the actual the virions, we hypothesize that this member of the transported form of BYV. The cell-to-cell movement of HSP70 family of molecular chaperones acts via binding potexviruses (Chapman et al., 1992; Santa Cruz et al., the virions and escorting them toward (through) the plas- 1998) and potyviruses (Dolja et al., 1994a, 1995; Rodri- modesmata. guez-Cerezo et al., 1997; Roberts et al., 1998) does re- quire CP and possibly virion formation. The virions of potexviruses and potyviruses possess a filamentous MATERIALS AND METHODS morphology similar to that of closteroviruses, although Generation of the HSP70h-specific antiserum the length of their virions is only ϳ500–750 nm compared with ϳ1250 nm for BYV. It cannot be excluded, however, Antiserum specific for BYV HSP70h was obtained by that intercellular translocation of filamentous viruses fol- injecting rabbits with recombinant, histidine-tagged pro- lows a disassembly–reassembly mode, as recently protein encompassing the C-terminal domain of the posed for an icosahedral cucumber mosaic virus (Black- HSP70h. This ϳ23-kDa domain was chosen for its low man et al., 1998). level of similarity with cellular HSP70s (Agranovsky et al., Examination of the subcellular distribution of BYV 1991); utilization of the more conserved N-terminal do- HSP70h revealed colocalization of this protein with the main could result in cross-reactivity of the serum with virions. Physical association between HSP70h and viri- host proteins. The corresponding region of the BYV ORF 178 MEDINA ET AL.

FIG. 4. Immunogold labeling of plasmodesmata using anti-HSP70h serum (A–C) or anticapsid protein serum (D). Presence of the gold particles in the plasmodesmatal channels is evident in A and B. C shows virion-like filaments attached to the neck of a plasmodesma. No capsid protein-specific labeling is present in plasmodesmal channel seen in the bottom right corner in D. The size of gold microspheres is 10 nm in A and B, and 30 nm in C and D. Bar in A and B, 0.24 ␮m; in C and D, 1.0 ␮m. encoding HSP70h was PCR amplified using the previ- mM IPTG. Because the recombinant protein was insolu- ously described plasmid r2 (Agranovsky et al., 1991) as a ble, it was affinity-purified under denaturing conditions template and oligonucleotide primers 5ЈPCR-C65-Nde using Ni2ϩ-NTA-agarose (Qiagen) essentially as recom- and 3ЈPCR-65-Stu (Table 2). These primers harbored mended by the manufacturer. The protein eluted from the recognition sites for restriction endonucleases NdeI and resin was separated by 12% SDS–PAGE; the correspond- StuI, respectively. The resulting PCR product was treated ing band was visualized by soaking the gel in 100 mM with NdeI and StuI and cloned into appropriately di- KCl for 10 min, excised, and submitted for the generation gested expression vector pPROEX-1 (GIBCO BRL). The of rabbit antiserum to Cocalico Biologicals, Inc. (Reams- resulting plasmid pPro-C23 was transformed into Esch- town, PA). erichia coli strain BL21(DE3), and the overexpression of The resulting antiserum was tested at 250-fold dilution the histidine-tagged protein was induced by addition of 1 by immunoblot analysis of leaf extracts from healthy and SUBCELLULAR LOCALIZATION OF VIRAL HSP70 179

No-HSP70h) have been described (Peremyslov et al., 1998). To engineer the recombinant variant pBYV-GUS- p21, the DNA fragment from open reading frame (ORF) 2 start codon to BamHI site at nucleotide (nt) 13392 was deleted and another DNA fragment from the start of ORF 6totheHpaI site at nt 14407 was replaced by the ␤-glucuronidase (GUS) ORF. As a result, BYV ORFs from 2 to 7 were deleted, whereas GUS was expressed under control of the ORF 6 (CP) promoter. Because this mutant amplified its RNA to a level similar to that of the wild-type FIG. 5. RT-PCR analysis of virion assembly in protoplasts. The prod- while producing no CP (data not shown), it was used as ucts of RT-PCR amplification were separated in a 2% agarose gel. a negative control in encapsidation analyses. Lanes 1–3 represent the analysis of the RNAs derived from the proto- The in vitro transcription of cDNA clones and transfec- plasts transfected using pBYV-GUS-p21 transcripts (negative control), tion of tobacco protoplasts (ϳ4 ϫ 10 6 cells per transfec- wild-type pBYV-NA transcripts (positive control), and pBYV-NoHSP70h tion) were conducted as described by Peremyslov et al. transcripts, respectively. (A) RT-PCR analysis of RNAs isolated without incubation of protoplast extracts at 37°C. (B–D) similar analysis of the (1998) and by Dolja et al. (1997), respectively. Three RNAs after incubation at 37°C. The primer pairs used for RT-PCR fourths of the cells were harvested at 4 days post-trans- analysis were specific for the 5Ј-terminal (A and B), internal (C), and fection, subjected to one cycle of freezing-thawing in Ј 3 -terminal (D) regions. M, size markers; the lengths of selected DNA liquid nitrogen, and resuspended in 400 ␮l of the buffer fragments in base pairs are shown. (50 mM Tris⅐HCl, pH 8.0, 1.5% Triton X-100) containing 2 U of DNase I (Promega). In general accord with the procedure developed by Wu and Shaw (1996), the ex- BYV-infected plants of N. benthamiana and was found to tracts were incubated for 1.5 h at 37°C to degrade the react specifically with the expected viral protein of ϳ65 uncoated RNAs using endogenous plant RNases. The kDa (not shown). DNase I was included to ensure degradation of the residual plasmid DNA present in transcription mixtures. Plant inoculation and electron microscopy After the treatment, RNA was isolated using TRIZOL N. benthamiana plants were inoculated using aphids reagent (GIBCO BRL). The remaining one fourth of the Myzus persicae, which were fed overnight on the de- cells were used to obtain RNA preparations without prior tached leaves of Tetragonia expansa infected by the treatment at 37°C. Californian isolate of BYV (Peremyslov et al., 1998) before RT-PCR analysis of the treated and nontreated RNAs transfer onto healthy host plants. The first symptoms of was conducted as described (Dolja et al., 1997). The infection (vein clearing) appeared in the third week posti- pairs of oligonucleotide primers used to amplify the 5Ј- noculation. The newly formed leaves of infected plants terminal, internal, and 3Ј-terminal parts of the BYV ge- showing no symptoms or very mild initial symptoms nome were 5ЈBYV and 900Sph, 1a-2-5 and 1a-2-3, and were collected during the fourth week postinoculation. p21-Nco and NOApa, respectively (Table 2). The ex- Preparation of the leaves for ultrathin sectioning was pected sizes of the amplification products were 930 bp conducted as described (Medina et al., 1998) using stan- for the 5Ј region, 750 bp for the central region that dard double fixation with glutaraldehyde and osmium encompassed BYV nt from 3460 to 4210, and 700 bp for tetroxide and embedding with Araldite. Alternatively, cold the 3Ј region. embedding with Lowicryl HM20 was done after single fixation with glutaraldehyde to preserve antigenicity for subsequent IGL. Ultrathin sections (60–90 nm) were TABLE 2 stained with uranyl acetate and lead citrate on Formvar- carbon covered grids (200 mesh) and analyzed by TEM. Synthetic Oligonucleotides Used in The Study The IGL was conducted as described (Medina et al., Oligonucleotide Nucelotide sequencea (5Ј-3Ј) 1998) using 30- or 10-nm gold microspheres and antisera to BYV CP (a generous gift of Bryce Falk, University of 5ЈPCR-C65-Nde GCCATATGTTGTTGGTTGACT California, Davis) or to HSP70h at 1:1000 or 1:200 dilu- 3ЈPCR-65-Stu GTAGGCCTCAGACATCAAGTT tion, respectively. 5ЈBYV GTTTTTAACCATCCTTCTACTAGAC 900SPH GTTGCATGCTTTATTTATCTTCCG 1a-2-5 GCGGATCCTTGAGCTCCGTTC Analysis of BYV assembly in tobacco protoplasts 1a-2-3 GCATGCATCCCGTGTTCGCCC Generation of the full-length BYV cDNA clone pBYV-NA p21-Nco GCCCATGGAGTTTTTCTTTAATGAC NOApa TTCCCGGGCGGCCCTTATTTTTTC and its mutant derivative harboring a replacement of the start codon in the ORF encoding HSP70h with ATA (pBYV- a Underlined nucleotides represent restriction endonuclease sites. 180 MEDINA ET AL.

ACKNOWLEDGMENTS Esau, K., and Hoefert, L. L. (1971b). Cytology of beet yellows virus infection in Tetragonia. II. Vascular elements in infected leaf. Proto- We thank Theo Dreher, William Dawson, and Bryce Falk for helpful plasma 72, 459–476. discussions and critical reading of the manuscript, and we are grateful Esau, K., and Hoefert, L. L. (1971c). Cytology of beet yellows virus to Bryce Falk and D’Ann Rochon for sharing their results before publi- infection in Tetragonia. III. Conformations of virus in infected cells. cation. This work was supported by grants from the National Institutes Protoplasma 73, 51–65. of Health (R1-GM53190B) and from the U.S. Department of Agriculture Heinlein, M., Padgett, H. S., Gens, J. S., Pickard, B. G., Casper, S. J., Epel, (NRICGP 97-35303-4515) to V.V.D. B. L., and Beachy, R. N. (1998). Changing patterns of localization of the tobacco mosaic virus movement protein and replicase to the REFERENCES endoplasmic reticulum and microtubules during infection. Plant Cell Agranovsky, A. A., Boyko, V. P., Karasev, A. V., Koonin, E. V., and Dolja, 10, 1107–1120. V. V. (1991). Putative 65 kDa protein of beet yellows closterovirus is a Jelkman, W., Fechtner, B., and Agranovsky, A. A. (1997). Complete homologue of HSP70 heat shock proteins. J. Mol. Biol. 217, 603–610. genome structure and phylogenetic analysis of little cherry virus, a Agranovsky, A. A., Folimonov, A. S., Folimonova, S. Y., Morozov, S. Y., mealybug-transmitted closterovirus. J. Gen. Virol. 78, 2067–2071. Schieman, J., Leseman, D., and Atabekov, J. G. (1998). Beet yellows Jindal, S., and Young, R. A. (1992). Vaccinia virus infection induces a closterovirus HSP70-like protein mediates the cell-to-cell movement stress response that leads to association of Hsp70 with viral pro- of a potexvirus transport-deficient mutant and a hordeivirus-based teins. J. Virol. 66, 5357–5362. chimeric virus. J. Gen. Virol. 79, 889–895. Karasev, A. V., Kashina, A. S., Gelfand, V. I., and Dolja, V. V. (1992). Agranovsky, A. A., Lesemann, D. E., Maiss, E., Hull, R., and Atabekov, HSP70-related 65K protein of beet yellows virus is a microtubule- J. G. (1995). “Rattlesnake” structure of a filamentous plant RNA virus binding protein. FEBS Lett. 304, 12–14. built of two capsid proteins. Proc. Natl. Acad. Sci. USA 92, 2470– Karasev, A. V., Nikolaeva, O. V., Mushegian, A. R., Lee, R. F., and 2473. Dawson, W. O. (1996). Organization of the 3Ј-terminal half of beet Aranda, M. A., Escaler, M., Wang, D., and Maule, A. J. (1996). Induction yellow stunt virus genome and implications for the evolution of of HSP70 and polyubiquitin expression associated with plant virus closteroviruses. Virology 221, 199–207. replication. Proc. Natl. Acad. Sci. USA 93, 15289–15293. Klaassen, V. A., Boeshore, M., Koonin, E. V., Tian, T., and Falk, B. W. Blackman, L. M., Boevnik, P., Santa Cruz, S., Palukaitis, P., and Oparka, (1995). Genome structure and phylogenetic analysis of lettuce infec- K. J. (1998). The movement protein of cucumber mosaic virus traffics tious yellows virus, a whitefly transmitted, bipartite closterovirus. into sieve elements in minor veins of Nicotiana clevelandii. Plant Cell Virology 208, 99–110. 10, 525–537. Lesemann., D.-E. (1988). Cytopathology. In “The Plant Viruses, Vol. 4, Carrington, J. C., Kasschau, K. D., Mahajan, S. K., and Schaad, M. C. The Filamentous Plant Viruses” (R. G. Milne, Ed.), pp. 179–235. (1996). Cell-to-cell and long-distance transport of viruses in plants. Plenum, New York. Plant Cell 8, 1669–1681. Ling, K.-S., Zhu, H.-Y., Drong, R. F., Slightom, J. L., McFerson, J. R., and Chapman, S., Hills, G., Watts, J., and Baulcombe, D. (1992). Mutational Gonsalves, D. (1998). Nucleotide sequence of the 3Ј-terminal two- analysis of the coat protein gene of potato virus X: Effects on virion thirds of the grapevine leafroll-associated virus-3 genome reveals a morphology and viral pathogenicity. Virology 191, 223–230. typical monopartite closterovirus. J. Gen. Virol. 79, 1299–1307. Chervitz, S. A., Aravind, L., Sherlock, G., Ball, C. A., Koonin, E. V., Dwight, Lucas, W. J. (1995). Plasmodesmata: Innercellular channels for macro- S. S., Harris, M. A., Dolinski, K., Mohr, S., Smith, T., Weng, S., Cherry, molecular transport in plants. Curr. Opin. Cell Biol. 7, 673–680. J. M., and Botstein, D. (1998). Comparison of the complete protein Macejak, D. G., and Sarnow, P. (1992). Association of heat shock protein sets of worm and yeast: Orthology and divergence. Science 282, 70 with enterovirus capsid precusor P1 in infected human cells. 2022–2028. J. Virol. 66, 1520–1527. Cripe, T. P., Delos, S. E., Estes, P. A., and Garcea, R. L. (1995). In vivo and Medina, V., Tian, T., Wierzchos, J., and Falk, B. W. (1998). Specific in vitro association of hsc70 with polyomavirus capsid proteins. inclusion bodies are associated with replication of lettuce infectious J. Virol. 69, 7807–7813. yellows virus RNAs in Nicotiana benthamiana protoplasts. J. Gen. Guy, C. L., and Li, Q.-B. (1998). The organization and evolution of the Virol. 79, 2325–2329. spinach stress 70 molecular chaperone gene family. Plant Cell 10, Pappu, H. R., Karasev, A. V., Anderson, E. J., Pappu, S. S., Hilf, M. E., 539–556. Febres, V. J., Eckloff, R. M. G., McCaffery, M., Boyko, V., Govda, S., Dolja, V. V., Haldeman-Cahill, R., Montgomery, A. E., Vandenbosch, K. A., Dolja, V. V., Koonin, E. V., Gumpf, D. J., Cline K. C., Garnsey, S. M., and Carrington, J. C. (1995). Capsid protein determinants involved in Dawson, W. O., Lee, R. F., Niblett, C. L. (1994). Nucleotide sequence cell-to-cell and long distance movement of tobacco etch potyvirus. and organization of eight open reading frames of the citrus tristeza Virology 206, 1007–1016. closterovirus genome. Virology 199, 35–46. Dolja, V. V., Haldeman, R., Robertson, N., Dougherty, W. G., and Car- Peremyslov, V. V., Hagiwara, Y., and Dolja, V. V. (1998). Genes required rington, J. C. (1994a). Distinct functions of the capsid protein in for replication of the 15.5-kilobase RNA genome of a plant clostero- assembly and cell-to-cell movement of tobacco etch potyvirus in virus. J. Virol. 72, 5870–5876. plants. EMBO J. 13, 1482–1491. Phillips, B., Abravaya, K., and Morimoto, R. I. (1991). Analysis of the Dolja, V. V., Hong, J., Keller, K. E., Martin, R. R., and Peremyslov, V. V. specificity and mechanism of transcriptional activation of the human (1997). Suppression of potyvirus infection by coexpressed clostero- hsp70 gene during infection by DNA viruses. J. Virol. 65, 5680–5692. virus protein. Virology 234, 243–252. Roberts, I. M., Wang, D., Findlay, K., and Maule, A. J. (1998). Ultrastruc- Dolja, V. V., Karasev, A. V., and Koonin, E. V. (1994b). Molecular biology tural and temporal observations of the potyvirus cylindrical inclu- and evolution of closteroviruses: Sophisticated build-up of large RNA sions (CIs) show that the CI protein acts transiently in aiding virus genomes. Annu. Rev. Phytopathol. 32, 261–285. movement. Virology 245, 173–181. Esau, K. (1960a). Cytologic and histologic symptoms of beet yellows. Rodriguez-Cerezo, E., Findlay, K., Shaw, J. G., Lomonossoff, G. P., Qui, Virology 10, 73–85. S. G., Linstead, P., Shanks, M., and Risco, C. (1997). The coat and Esau, K. (1960b). The development of inclusions in sugar beets infected cylindrical inclusion proteins of a potyvirus are associated with with the beet yellows-virus. Virology 11, 317–328. connections between plant cells. Virology 236, 296–306. Esau, K., and Hoefert, L. L. (1971a). Cytology of beet yellows virus Santa Cruz, S., Roberts, A. G., Prior, D. A. M., Chapman, S., and Oparka, infection in Tetragonia. I. Parenchyma cells in infected leaf. Proto- K. J. (1998). Cell-to-cell and phloem-mediated transport of potato plasma 72, 255–273. virus X: The role of virions. Plant Cell 10, 495–510. SUBCELLULAR LOCALIZATION OF VIRAL HSP70 181

Schaad, M. C., Jensen, P. E., and Carrington, J. C. (1997). Formation of partially purified virions anf the whitefly, Bemisia tabaci. J. Gen. Virol. plant RNA virus replication complexes on membranes: Role of an 80, 1111–1118. endoplasmic reticulum-targeted viral protein. EMBO J. 16, 4049– Wainberg, Z., Oliveira, M., Lerner, S., Tao, Y., and Brenner, B. G. (1997). 4059. Modulation of stress protein (hsp27 and hsp70) expression in CD4ϩ Tatusov, R. L., Koonin, E. V., and Lipman, D. J. (1997). A genomic lymphocytic cells following acute infection with human immunodefi- perspective on protein families. Science 278, 631–637. ciency virus type-1. Virology 233, 364–373. Tian, T., Klaassen, V. A., Soong, J., Wisler, G., Duffus, J. E., and Falk, B. W. Ward, B. M., Medville, R., Lazarowitz, S. G., and Turgeon, R. (1997). The (1996). Generation of cDNAs specific to lettuce infectious yellows geminivirus BL1 movement protein is associated with endoplasmic closterovirus and other whitefly-transmitted viruses by RT-PCR and reticulum-derived tubules in developing phloem cells. J. Virol. 71, degenerate oligonucleotide primers corresponding to the clostero- 3726–3733. virus gene encoding the heat shock protein 70 homolog. Phytopa- Zhu, H.-Y., Ling, K.-S., Goszczynski, D. E., McFerson, J. R., and Gon- thology 86, 1167–1173. salves, D. (1998). Nucleotide sequence and genome organization of Tian, T., Rubio, L., Yeh, H.-H., Crawford, B., and Falk, B. W. (1999). grapevine leafroll-associated virus-2 are similar to beet yellows vi- Lettuce infectious yellows virus: In vitro acquisition analysis using rus, the closterovirus type member. J. Gen. Virol. 79, 1289–1298.