An et al. World Journal of Surgical Oncology (2015) 13:255 DOI 10.1186/s12957-015-0669-4 WORLD JOURNAL OF SURGICAL ONCOLOGY RESEARCH ARTICLE Open Access Reduced USP39 expression inhibits malignant proliferation of medullary thyroid carcinoma in vitro Yong An†, Shuwen Yang†, Kai Guo, Ben Ma and Yu Wang* Abstract Background: Medullary thyroid carcinoma (MTC) constitutes approximately 5 % of all thyroid cancers and carries a worse prognosis than other differentiated thyroid cancers. Targeted therapies are being investigated for systemic treatment of MTC. Ubiquitin-specific peptidase 39 (USP39) functions in pre-mRNA splicing as a component of the U4/U6-U5 tri-snRNP and also participates in spindle checkpoint and cytokinesis. In this study, we aimed to evaluate the potential role in MTC. Methods: We used lentivirus-delivered short hairpin RNA (shRNA) to silence USP39 expression in one MTC cell line TT. USP39 expression was detected by qPCR and Western blot. For functional analysis, MTT assay was performed to evaluate the proliferation activity, and FACS was used to assess the cell distribution in the cell cycle. Moreover, the expressions of cell cycle-related proteins were examined by Western blot. Results: Both two shRNA sequences against USP39 could efficiently reduce its expression in TT cells. Knockdown of USP39 significantly decreased cell proliferation and caused cell cycle arrest at G2/M phase. Moreover, G2/M phase-associated proteins, Cyclin B1 and CDK1, were obviously down-regulated in TT cells after USP39 silencing. Conclusions: Therefore, knockdown of USP39 is likely to provide a novel alternative to targeted therapy of MTC and deserves further investigation. Keywords: Medullary thyroid carcinoma, Ubiquitin-specific peptidase 39, shRNA, Targeted therapy Background of the multiple endocrine neoplasia syndrome type 2 Medullary thyroid carcinoma (MTC) accounts for 5–10 % (MEN2, MEN2A, or MEN2B). Patients with newly di- of all thyroid cancers and carries a worse prognosis than agnosed disease are treated with surgery. A common other differentiated thyroid cancers with an overall discovery in MTCs that is diagnosed late is lymph 10-year survival rate of 75–85 % [1, 2]. MTC is a node metastasis in the upper mediastinum and neck. neuroendocrine tumor originating from the parafolli- Metastases occur in ~70 % of patients with MTC cular C cells of the thyroid gland [3]. Calcitonin and who have a palpable thyroid nodule (>1.0 cm diameter) carcinoembryonic antigen are useful blood markers [7]. At this stage of the disease, patients cannot undergo andareoftenusedinpatient’s follow-up. Although surgical resection and biochemical “cure” rates drop to the majority of MTC cases are sporadic, approximately ≤30 % [8, 9]. Therefore, systemic radiation and chemo- 20 % are hereditary because of a germline mutation therapy therapy are not believed to represent important or in the rearranged during transfection proto-oncogene useful options for most patients with MTC. (RET) [4–6]. Hereditary MTC can present in isolation Ubiquitin-specific peptidase 39 (USP39) contains a (familial medullary thyroid cancer (FMTC)) or as part central zinc finger and two ubiquitin C-terminal hydro- lase (UCH) domains. Interestingly, USP39 does not have * Correspondence: [email protected] ubiquitin-specific peptidase activity but plays an essen- †Equal contributors Department of Head & Neck Surgery, Fudan University Shanghai Cancer tial role in pre-mRNA splicing as a component of the Center and Department of Oncology, Shanghai Medical College, Fudan U4/U6-U5 tri-snRNP, one of the building blocks of the University, 6W of No.3 Building, No.270 DongAn Road, Shanghai 200223, China © 2015 An et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. An et al. World Journal of Surgical Oncology (2015) 13:255 Page 2 of 6 spliceosome [10]. Its N-terminal domain is rich in argi- Cell culture nines, serines, and glutamic acids and resembles the RS Human MTC cells TT and human embryonic kidney domain of serine/arginine (SR)-related proteins, which is cells 293T were purchased from the Cell Bank of Chin- essential to recruit the tri-snRNP to the prespliceosome ese Academy of Science (Shanghai, China). TT cells were [11]. USP39 has been implicated in the assembly of the maintained in F-12K medium supplemented with 10 % mature spliceosome complex [12]. USP39 is also re- FBS. Maintained in DMEM supplemented with 10 % quired to maintain mitotic spindle checkpoint integrity FBS were 293T cells. These cell lines were cultured at and support successful cytokinesis, probably through 37 °C in humidified atmosphere of 5 % CO2. splicing of Aurora B and other mRNAs that are essential for proper spindle checkpoint function [13]. Depletion Lentivirus-delivered short hairpin RNA transduction of USP39 by RNAi induced massive polypoidization in Two shRNA sequences targeting human USP39 gene U2OS cells, possibly a result of defective chromosome (NCBI accession number: NM_001256725.1) were 5′- segregation and cytokinesis, suggesting USP39 as a key GATTTGGAAGAGGCGAGATAACTCGAGTTATCTCG regulator of mitosis. Recently, some studies have re- CCTCTTCCAAATCTTTTT-3′ (S1) and 5′-CCTTCCA ported the role of USP39 in cancer cell growth. Wang GACAACTATGAGATCTCGAGATCTCATAGTTGTC et al. demonstrated that USP39 is expressed at a higher TGGAAGGTTTTT-3′ (S2), which were subjected to level in breast cancer and regulates cell growth and sur- BLAST analysis against the human genome database vival [14]. Wen et al. demonstrated that the overexpres- to eliminate cross-silence phenomena with nontarget sion of USP39 could enhance the proliferation of prostate genes. A scrambled fragment (5′-GCGGAGGGTTTG cancer cells, suggesting that USP39 may also play a role in AAAGAATATCTCGAGATATTCTTTCAAACCCTCC prostate cancer development [15]. However, the involve- GCTTTTTT-3′)thathasnosignificanthomology ment of USP39 in MTC remains unclear. with mouse or human gene sequences was used as a The aim of this study was to explore the potential role negative control. The shRNAs were cloned into the of USP39 in MTC cell growth. We carried out loss-of- pFH-L vector by use of NheI/PacI restriction sites, function analysis in one human MTC cell line TT using which was then transfected into 293T cells with packaging lentivirus-delivered short hairpin RNA (shRNA) target- vectors (pVSVG-I and pCMVΔR8.92) using Lipofecta- ing USP39. After USP39 silencing, cell proliferation was mine 2000 according to the manufacturer’s instructions. suppressed and cell cycle was arrested at G2/M phase. The supernatant was collected 48 h later, centrifuged Therefore, the inhibition of USP39 by shRNA might be a (4000 g, 4 °C, 10 min) to remove cell debris, filtered potential therapeutic method in MTC. through 0.45-μm cellulose acetate filters, and then con- centrated again (4000 g, 4 °C, 15 min). TT cells were dis- Methods pensed into 6-well plates at a density of 150,000 cells per Materials well and transduced with shRNA-expressing lentivirus F-12K medium was obtained from Gibco (Carlsbad, CA, (shCon or shUSP39(S1)/(S2)) at a multiplicity of infection USA, cat no.21127022). DMEM was obtained from (MOI) of 60. The lentiviral vectors expressed green fluor- Hyclone (Logan, UT, USA, cat no.SH30243.01B+). Fetal escence protein (GFP), which allowed for measurement of bovine serum (FBS) was obtained from Biowest (Loire infection efficiency in transduced cells. Valley, France, cat no.S1810). Lipofectamine 2000 and TRIzol® Reagent were purchased from Invitrogen (Carlsbad, Quantitative real-time PCR analysis CA, USA). M-MLV Reverse Transcriptase was purchased TT cells were harvested after lentivirus transduction for from Promega (Madison, WI, USA). All other chemicals 5 days. Total cellular RNA was extracted using Trizol re- were obtained from Sigma-Aldrich (St. Louis, MO, USA). agent and reversely transcribed to cDNA by M-MLV re- The lentiviral vector (pFH-L) and packaging vectors verse transcriptase according to the manufacturer’s (pVSVG-I and pCMVΔR8.92) were purchased from instructions. qPCR products were detected with SYBR Shanghai Hollybio (Shanghai, China). The antibodies used Green on BioRad Connect Real-Time PCR platform. were as follows: rabbit anti-USP39 antibody (1:1000 qPCR procedure was denatured at 95 °C for 1 min, 40 cy- dilution; Proteintech Group, Inc., cat no.23865-1-AP), p- cles of denaturation at 95 °C for 5 s, and extension at CDC2/CDK1(Tyr15) antibody (1:1000 dilution; Cell Signal- 60 °C for 20 s. β-actin gene was amplified as internal ing Technology, cat no.9111), mouse anti-CDC2/CDK1 control. Relative quantitation was analyzed by taking the antibody (1:1000 dilution; Cell Signaling Technology, cat difference ΔC(T) between the C(T) of β-actin and C(T) −ΔΔ no.9116), rabbit anti-GAPDH antibody (1:100,000 dilution; of target gene and computing 2 C(T). The following Proteintech Group, Inc., cat no.10494-1-AP), and horse- primers were used: USP39, 5′-GCCAGCAGAAGAAAAA radish peroxidase-conjugated goat anti-rabbit (1:5000 dilu-