DOCSLIB.ORG

Reduced USP39 Expression Inhibits Malignant Proliferation of Medullary Thyroid Carcinoma in Vitro Yong An†, Shuwen Yang†, Kai Guo, Ben Ma and Yu Wang*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Reduced USP39 Expression Inhibits Malignant Proliferation of Medullary Thyroid Carcinoma in Vitro Yong An†, Shuwen Yang†, Kai Guo, Ben Ma and Yu Wang* An et al. World Journal of Surgical Oncology (2015) 13:255 DOI 10.1186/s12957-015-0669-4 WORLD JOURNAL OF SURGICAL ONCOLOGY RESEARCH ARTICLE Open Access Reduced USP39 expression inhibits malignant proliferation of medullary thyroid carcinoma in vitro Yong An†, Shuwen Yang†, Kai Guo, Ben Ma and Yu Wang* Abstract Background: Medullary thyroid carcinoma (MTC) constitutes approximately 5 % of all thyroid cancers and carries a worse prognosis than other differentiated thyroid cancers. Targeted therapies are being investigated for systemic treatment of MTC. Ubiquitin-specific peptidase 39 (USP39) functions in pre-mRNA splicing as a component of the U4/U6-U5 tri-snRNP and also participates in spindle checkpoint and cytokinesis. In this study, we aimed to evaluate the potential role in MTC. Methods: We used lentivirus-delivered short hairpin RNA (shRNA) to silence USP39 expression in one MTC cell line TT. USP39 expression was detected by qPCR and Western blot. For functional analysis, MTT assay was performed to evaluate the proliferation activity, and FACS was used to assess the cell distribution in the cell cycle. Moreover, the expressions of cell cycle-related proteins were examined by Western blot. Results: Both two shRNA sequences against USP39 could efficiently reduce its expression in TT cells. Knockdown of USP39 significantly decreased cell proliferation and caused cell cycle arrest at G2/M phase. Moreover, G2/M phase-associated proteins, Cyclin B1 and CDK1, were obviously down-regulated in TT cells after USP39 silencing. Conclusions: Therefore, knockdown of USP39 is likely to provide a novel alternative to targeted therapy of MTC and deserves further investigation. Keywords: Medullary thyroid carcinoma, Ubiquitin-specific peptidase 39, shRNA, Targeted therapy Background of the multiple endocrine neoplasia syndrome type 2 Medullary thyroid carcinoma (MTC) accounts for 5–10 % (MEN2, MEN2A, or MEN2B). Patients with newly di- of all thyroid cancers and carries a worse prognosis than agnosed disease are treated with surgery. A common other differentiated thyroid cancers with an overall discovery in MTCs that is diagnosed late is lymph 10-year survival rate of 75–85 % [1, 2]. MTC is a node metastasis in the upper mediastinum and neck. neuroendocrine tumor originating from the parafolli- Metastases occur in ~70 % of patients with MTC cular C cells of the thyroid gland [3]. Calcitonin and who have a palpable thyroid nodule (>1.0 cm diameter) carcinoembryonic antigen are useful blood markers [7]. At this stage of the disease, patients cannot undergo andareoftenusedinpatient’s follow-up. Although surgical resection and biochemical “cure” rates drop to the majority of MTC cases are sporadic, approximately ≤30 % [8, 9]. Therefore, systemic radiation and chemo- 20 % are hereditary because of a germline mutation therapy therapy are not believed to represent important or in the rearranged during transfection proto-oncogene useful options for most patients with MTC. (RET) [4–6]. Hereditary MTC can present in isolation Ubiquitin-specific peptidase 39 (USP39) contains a (familial medullary thyroid cancer (FMTC)) or as part central zinc finger and two ubiquitin C-terminal hydro- lase (UCH) domains. Interestingly, USP39 does not have * Correspondence: [email protected] ubiquitin-specific peptidase activity but plays an essen- †Equal contributors Department of Head & Neck Surgery, Fudan University Shanghai Cancer tial role in pre-mRNA splicing as a component of the Center and Department of Oncology, Shanghai Medical College, Fudan U4/U6-U5 tri-snRNP, one of the building blocks of the University, 6W of No.3 Building, No.270 DongAn Road, Shanghai 200223, China © 2015 An et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. An et al. World Journal of Surgical Oncology (2015) 13:255 Page 2 of 6 spliceosome [10]. Its N-terminal domain is rich in argi- Cell culture nines, serines, and glutamic acids and resembles the RS Human MTC cells TT and human embryonic kidney domain of serine/arginine (SR)-related proteins, which is cells 293T were purchased from the Cell Bank of Chin- essential to recruit the tri-snRNP to the prespliceosome ese Academy of Science (Shanghai, China). TT cells were [11]. USP39 has been implicated in the assembly of the maintained in F-12K medium supplemented with 10 % mature spliceosome complex [12]. USP39 is also re- FBS. Maintained in DMEM supplemented with 10 % quired to maintain mitotic spindle checkpoint integrity FBS were 293T cells. These cell lines were cultured at and support successful cytokinesis, probably through 37 °C in humidified atmosphere of 5 % CO2. splicing of Aurora B and other mRNAs that are essential for proper spindle checkpoint function [13]. Depletion Lentivirus-delivered short hairpin RNA transduction of USP39 by RNAi induced massive polypoidization in Two shRNA sequences targeting human USP39 gene U2OS cells, possibly a result of defective chromosome (NCBI accession number: NM_001256725.1) were 5′- segregation and cytokinesis, suggesting USP39 as a key GATTTGGAAGAGGCGAGATAACTCGAGTTATCTCG regulator of mitosis. Recently, some studies have re- CCTCTTCCAAATCTTTTT-3′ (S1) and 5′-CCTTCCA ported the role of USP39 in cancer cell growth. Wang GACAACTATGAGATCTCGAGATCTCATAGTTGTC et al. demonstrated that USP39 is expressed at a higher TGGAAGGTTTTT-3′ (S2), which were subjected to level in breast cancer and regulates cell growth and sur- BLAST analysis against the human genome database vival [14]. Wen et al. demonstrated that the overexpres- to eliminate cross-silence phenomena with nontarget sion of USP39 could enhance the proliferation of prostate genes. A scrambled fragment (5′-GCGGAGGGTTTG cancer cells, suggesting that USP39 may also play a role in AAAGAATATCTCGAGATATTCTTTCAAACCCTCC prostate cancer development [15]. However, the involve- GCTTTTTT-3′)thathasnosignificanthomology ment of USP39 in MTC remains unclear. with mouse or human gene sequences was used as a The aim of this study was to explore the potential role negative control. The shRNAs were cloned into the of USP39 in MTC cell growth. We carried out loss-of- pFH-L vector by use of NheI/PacI restriction sites, function analysis in one human MTC cell line TT using which was then transfected into 293T cells with packaging lentivirus-delivered short hairpin RNA (shRNA) target- vectors (pVSVG-I and pCMVΔR8.92) using Lipofecta- ing USP39. After USP39 silencing, cell proliferation was mine 2000 according to the manufacturer’s instructions. suppressed and cell cycle was arrested at G2/M phase. The supernatant was collected 48 h later, centrifuged Therefore, the inhibition of USP39 by shRNA might be a (4000 g, 4 °C, 10 min) to remove cell debris, filtered potential therapeutic method in MTC. through 0.45-μm cellulose acetate filters, and then con- centrated again (4000 g, 4 °C, 15 min). TT cells were dis- Methods pensed into 6-well plates at a density of 150,000 cells per Materials well and transduced with shRNA-expressing lentivirus F-12K medium was obtained from Gibco (Carlsbad, CA, (shCon or shUSP39(S1)/(S2)) at a multiplicity of infection USA, cat no.21127022). DMEM was obtained from (MOI) of 60. The lentiviral vectors expressed green fluor- Hyclone (Logan, UT, USA, cat no.SH30243.01B+). Fetal escence protein (GFP), which allowed for measurement of bovine serum (FBS) was obtained from Biowest (Loire infection efficiency in transduced cells. Valley, France, cat no.S1810). Lipofectamine 2000 and TRIzol® Reagent were purchased from Invitrogen (Carlsbad, Quantitative real-time PCR analysis CA, USA). M-MLV Reverse Transcriptase was purchased TT cells were harvested after lentivirus transduction for from Promega (Madison, WI, USA). All other chemicals 5 days. Total cellular RNA was extracted using Trizol re- were obtained from Sigma-Aldrich (St. Louis, MO, USA). agent and reversely transcribed to cDNA by M-MLV re- The lentiviral vector (pFH-L) and packaging vectors verse transcriptase according to the manufacturer’s (pVSVG-I and pCMVΔR8.92) were purchased from instructions. qPCR products were detected with SYBR Shanghai Hollybio (Shanghai, China). The antibodies used Green on BioRad Connect Real-Time PCR platform. were as follows: rabbit anti-USP39 antibody (1:1000 qPCR procedure was denatured at 95 °C for 1 min, 40 cy- dilution; Proteintech Group, Inc., cat no.23865-1-AP), p- cles of denaturation at 95 °C for 5 s, and extension at CDC2/CDK1(Tyr15) antibody (1:1000 dilution; Cell Signal- 60 °C for 20 s. β-actin gene was amplified as internal ing Technology, cat no.9111), mouse anti-CDC2/CDK1 control. Relative quantitation was analyzed by taking the antibody (1:1000 dilution; Cell Signaling Technology, cat difference ΔC(T) between the C(T) of β-actin and C(T) −ΔΔ no.9116), rabbit anti-GAPDH antibody (1:100,000 dilution; of target gene and computing 2 C(T). The following Proteintech Group, Inc., cat no.10494-1-AP), and horse- primers were used: USP39, 5′-GCCAGCAGAAGAAAAA radish peroxidase-conjugated goat anti-rabbit (1:5000 dilu-
Load more

Recommended publications
  • Bovine NK-Lysin: Copy Number Variation and PNAS PLUS Functional Diversification
    Bovine NK-lysin: Copy number variation and PNAS PLUS functional diversification Junfeng Chena, John Huddlestonb,c, Reuben M. Buckleyd, Maika Maligb, Sara D. Lawhona, Loren C. Skowe, Mi Ok Leea, Evan E. Eichlerb,c, Leif Anderssone,f,g, and James E. Womacka,1 aDepartment of Veterinary Pathobiology, College of Veterinary Medicine, Texas A&M University, College Station, TX 77843; bDepartment of Genome Sciences, University of Washington, Seattle, WA 98195; cHoward Hughes Medical Institute, University of Washington, Seattle, WA 98195; dSchool of Biological Sciences, University of Adelaide, Adelaide 5005, Australia; eDepartment of Veterinary Integrative Biosciences, College of Veterinary Medicine, Texas A&M University, College Station, TX 77843; fDepartment of Medical Biochemistry and Microbiology, Uppsala University, Uppsala, SE 75123, Sweden; and gDepartment of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, Uppsala, SE 75007, Sweden Contributed by James E. Womack, November 20, 2015 (sent for review November 5, 2015; reviewed by Denis M. Larkin and Harris A. Lewin) NK-lysin is an antimicrobial peptide and effector protein in the host compared with humans and mice. These include genes coding innate immune system. It is coded by a single gene in humans and AMPs such as the cathelicidins and β-defensins, members of most other mammalian species. In this study, we provide evidence the IFN gene family, C-type lysozyme, and lipopolysaccharide- for the existence of four NK-lysin genes in a repetitive region on binding protein (ULBP) (23–28). Expansion of these gene fam- cattle chromosome 11. The NK2A, NK2B,andNK2C genes are tan- ilies potentially can give rise to new functional paralogs with demly arrayed as three copies in ∼30–35-kb segments, located implications in the unique gastric physiology of ruminants or in 41.8 kb upstream of NK1.
    [Show full text]
  • Comparative Analysis of the Ubiquitin-Proteasome System in Homo Sapiens and Saccharomyces Cerevisiae
    Comparative Analysis of the Ubiquitin-proteasome system in Homo sapiens and Saccharomyces cerevisiae Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Universität zu Köln vorgelegt von Hartmut Scheel aus Rheinbach Köln, 2005 Berichterstatter: Prof. Dr. R. Jürgen Dohmen Prof. Dr. Thomas Langer Dr. Kay Hofmann Tag der mündlichen Prüfung: 18.07.2005 Zusammenfassung I Zusammenfassung Das Ubiquitin-Proteasom System (UPS) stellt den wichtigsten Abbauweg für intrazelluläre Proteine in eukaryotischen Zellen dar. Das abzubauende Protein wird zunächst über eine Enzym-Kaskade mit einer kovalent gebundenen Ubiquitinkette markiert. Anschließend wird das konjugierte Substrat vom Proteasom erkannt und proteolytisch gespalten. Ubiquitin besitzt eine Reihe von Homologen, die ebenfalls posttranslational an Proteine gekoppelt werden können, wie z.B. SUMO und NEDD8. Die hierbei verwendeten Aktivierungs- und Konjugations-Kaskaden sind vollständig analog zu der des Ubiquitin- Systems. Es ist charakteristisch für das UPS, daß sich die Vielzahl der daran beteiligten Proteine aus nur wenigen Proteinfamilien rekrutiert, die durch gemeinsame, funktionale Homologiedomänen gekennzeichnet sind. Einige dieser funktionalen Domänen sind auch in den Modifikations-Systemen der Ubiquitin-Homologen zu finden, jedoch verfügen diese Systeme zusätzlich über spezifische Domänentypen. Homologiedomänen lassen sich als mathematische Modelle in Form von Domänen- deskriptoren (Profile) beschreiben. Diese Deskriptoren können wiederum dazu verwendet werden, mit Hilfe geeigneter Verfahren eine gegebene Proteinsequenz auf das Vorliegen von entsprechenden Homologiedomänen zu untersuchen. Da die im UPS involvierten Homologie- domänen fast ausschließlich auf dieses System und seine Analoga beschränkt sind, können domänen-spezifische Profile zur Katalogisierung der UPS-relevanten Proteine einer Spezies verwendet werden. Auf dieser Basis können dann die entsprechenden UPS-Repertoires verschiedener Spezies miteinander verglichen werden.
    [Show full text]
  • Transcriptional Landscape of Pulmonary Lymphatic Endothelial Cells During Fetal Gestation
    RESEARCH ARTICLE Transcriptional landscape of pulmonary lymphatic endothelial cells during fetal gestation 1,2 3 1 1,4 Timothy A. Norman, Jr.ID *, Adam C. Gower , Felicia Chen , Alan Fine 1 Pulmonary Center, Boston University School of Medicine, Boston, Massachusetts, United States of America, 2 Pathology & Laboratory Medicine, Boston University School of Medicine, Boston, Massachusetts, United States of America, 3 Clinical and Translational Science Institute, Boston University School of Medicine, Boston, Massachusetts, United States of America, 4 Boston Veteran's Hospital, West Roxbury, a1111111111 Massachusetts, United States of America a1111111111 a1111111111 * [email protected] a1111111111 a1111111111 Abstract The genetic programs responsible for pulmonary lymphatic maturation prior to birth are not known. To address this gap in knowledge, we developed a novel cell sorting strategy to col- OPEN ACCESS lect fetal pulmonary lymphatic endothelial cells (PLECs) for global transcriptional profiling. Citation: Norman TA, Jr., Gower AC, Chen F, Fine A We identified PLECs based on their unique cell surface immunophenotype (CD31+/Vegfr3 (2019) Transcriptional landscape of pulmonary lymphatic endothelial cells during fetal gestation. +/Lyve1+/Pdpn+) and isolated them from murine lungs during late gestation (E16.5, E17.5, PLoS ONE 14(5): e0216795. https://doi.org/ E18.5). Gene expression profiling was performed using whole-genome microarrays, and 10.1371/journal.pone.0216795 1,281 genes were significantly differentially expressed with respect to time (FDR q < 0.05) Editor: Vladimir V. Kalinichenko, Cincinnati and grouped into six clusters. Two clusters containing a total of 493 genes strongly upregu- Children's Hospital Medical Center, UNITED lated at E18.5 were significantly enriched in genes with functional annotations correspond- STATES ing to innate immune response, positive regulation of angiogenesis, complement & Received: October 19, 2018 coagulation cascade, ECM/cell-adhesion, and lipid metabolism.
    [Show full text]
  • 19758 USP39 Antibody
    Revision 1 C 0 2 - t USP39 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] 8 Support: 877-678-TECH (8324) 5 7 Web: [email protected] 9 www.cellsignal.com 1 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB H M R Mk Endogenous 65 Rabbit Q53GS9 10713 Product Usage Information 7. Lin, Z. et al. (2016) Mol Cell Biochem 422, 97-107. 8. Wang, X. et al. (2016) Mol Med Rep 14, 301-6. Application Dilution 9. Liu, S. et al. (2015) Oncol Rep 33, 2477-83. 10. Zhao, Y. et al. (2016) Tumour Biol 37, 13167-76. Western Blotting 1:1000 11. Yuan, X. et al. (2015) Oncol Rep 34, 823-32. 12. Pan, Z. et al. (2015) Biol Res 48, 18. Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity USP39 Antibody recognizes endogenous levels of total USP39 protein. Species Reactivity: Human, Mouse, Rat, Monkey Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Val88 of human USP39 protein. Antibodies are purified by protein A and peptide affinity chromatography. Background Ubiquitin specific protease 39 (USP39) is a 65 kDa protein that plays an important role in pre-mRNA splicing, as well as mitotic spindle formation. It displays significant homology with ubiquitin C-terminal hydrolase proteins (UCHs), containing both an N-terminal zinc finger domain as well as UCH-1 and UCH-2-like domains also observed in the UCH2 family of proteins (1).
    [Show full text]
  • Supplementary Table 1 Double Treatment Vs Single Treatment
    Supplementary table 1 Double treatment vs single treatment Probe ID Symbol Gene name P value Fold change TC0500007292.hg.1 NIM1K NIM1 serine/threonine protein kinase 1.05E-04 5.02 HTA2-neg-47424007_st NA NA 3.44E-03 4.11 HTA2-pos-3475282_st NA NA 3.30E-03 3.24 TC0X00007013.hg.1 MPC1L mitochondrial pyruvate carrier 1-like 5.22E-03 3.21 TC0200010447.hg.1 CASP8 caspase 8, apoptosis-related cysteine peptidase 3.54E-03 2.46 TC0400008390.hg.1 LRIT3 leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 1.86E-03 2.41 TC1700011905.hg.1 DNAH17 dynein, axonemal, heavy chain 17 1.81E-04 2.40 TC0600012064.hg.1 GCM1 glial cells missing homolog 1 (Drosophila) 2.81E-03 2.39 TC0100015789.hg.1 POGZ Transcript Identified by AceView, Entrez Gene ID(s) 23126 3.64E-04 2.38 TC1300010039.hg.1 NEK5 NIMA-related kinase 5 3.39E-03 2.36 TC0900008222.hg.1 STX17 syntaxin 17 1.08E-03 2.29 TC1700012355.hg.1 KRBA2 KRAB-A domain containing 2 5.98E-03 2.28 HTA2-neg-47424044_st NA NA 5.94E-03 2.24 HTA2-neg-47424360_st NA NA 2.12E-03 2.22 TC0800010802.hg.1 C8orf89 chromosome 8 open reading frame 89 6.51E-04 2.20 TC1500010745.hg.1 POLR2M polymerase (RNA) II (DNA directed) polypeptide M 5.19E-03 2.20 TC1500007409.hg.1 GCNT3 glucosaminyl (N-acetyl) transferase 3, mucin type 6.48E-03 2.17 TC2200007132.hg.1 RFPL3 ret finger protein-like 3 5.91E-05 2.17 HTA2-neg-47424024_st NA NA 2.45E-03 2.16 TC0200010474.hg.1 KIAA2012 KIAA2012 5.20E-03 2.16 TC1100007216.hg.1 PRRG4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane) 7.43E-03 2.15 TC0400012977.hg.1 SH3D19
    [Show full text]
  • The Neurodegenerative Diseases ALS and SMA Are Linked at The
    Nucleic Acids Research, 2019 1 doi: 10.1093/nar/gky1093 The neurodegenerative diseases ALS and SMA are linked at the molecular level via the ASC-1 complex Downloaded from https://academic.oup.com/nar/advance-article-abstract/doi/10.1093/nar/gky1093/5162471 by [email protected] on 06 November 2018 Binkai Chi, Jeremy D. O’Connell, Alexander D. Iocolano, Jordan A. Coady, Yong Yu, Jaya Gangopadhyay, Steven P. Gygi and Robin Reed* Department of Cell Biology, Harvard Medical School, 240 Longwood Ave. Boston MA 02115, USA Received July 17, 2018; Revised October 16, 2018; Editorial Decision October 18, 2018; Accepted October 19, 2018 ABSTRACT Fused in Sarcoma (FUS) and TAR DNA Binding Protein (TARDBP) (9–13). FUS is one of the three members of Understanding the molecular pathways disrupted in the structurally related FET (FUS, EWSR1 and TAF15) motor neuron diseases is urgently needed. Here, we family of RNA/DNA binding proteins (14). In addition to employed CRISPR knockout (KO) to investigate the the RNA/DNA binding domains, the FET proteins also functions of four ALS-causative RNA/DNA binding contain low-complexity domains, and these domains are proteins (FUS, EWSR1, TAF15 and MATR3) within the thought to be involved in ALS pathogenesis (5,15). In light RNAP II/U1 snRNP machinery. We found that each of of the discovery that mutations in FUS are ALS-causative, these structurally related proteins has distinct roles several groups carried out studies to determine whether the with FUS KO resulting in loss of U1 snRNP and the other two members of the FET family, TATA-Box Bind- SMN complex, EWSR1 KO causing dissociation of ing Protein Associated Factor 15 (TAF15) and EWS RNA the tRNA ligase complex, and TAF15 KO resulting in Binding Protein 1 (EWSR1), have a role in ALS.
    [Show full text]
  • Mutation Discovery in Mice by Whole Exome Sequencing
    Fairfield et al. Genome Biology 2011, 12:R86 http://genomebiology.com/2011/12/9/R86 METHOD Open Access Mutation discovery in mice by whole exome sequencing Heather Fairfield1, Griffith J Gilbert1, Mary Barter1, Rebecca R Corrigan2, Michelle Curtain1, Yueming Ding3, Mark D’Ascenzo4, Daniel J Gerhardt4, Chao He5, Wenhui Huang6, Todd Richmond4, Lucy Rowe1, Frank J Probst2, David E Bergstrom1, Stephen A Murray1, Carol Bult1, Joel Richardson1, Benjamin T Kile7, Ivo Gut8, Jorg Hager8, Snaevar Sigurdsson9, Evan Mauceli9, Federica Di Palma9, Kerstin Lindblad-Toh9, Michael L Cunningham10, Timothy C Cox10, Monica J Justice2, Mona S Spector5, Scott W Lowe5, Thomas Albert4, Leah Rae Donahue1, Jeffrey Jeddeloh4, Jay Shendure10 and Laura G Reinholdt1* Abstract We report the development and optimization of reagents for in-solution, hybridization-based capture of the mouse exome. By validating this approach in a multiple inbred strains and in novel mutant strains, we show that whole exome sequencing is a robust approach for discovery of putative mutations, irrespective of strain background. We found strong candidate mutations for the majority of mutant exomes sequenced, including new models of orofacial clefting, urogenital dysmorphology, kyphosis and autoimmune hepatitis. Background burdensome and expensive for many laboratories. Targeted Phenotype-driven approaches in model organisms, includ- sequencing approaches are less expensive and the data are ing spontaneous mutation discovery, standard N-ethyl-N- accordingly more manageable, but this technique requires nitrosourea (ENU) mutagenesis screens, sensitized screens substantial genetic mapping and the design and purchase and modifier screens, are established approaches in func- of custom capture tools (that is, arrays or probe pools) [4].
    [Show full text]
  • Alam, M. M. Et Al. (2019) Validation of the Protein Kinase Pfclk3 As a Multistage Cross-Species Malarial Drug Target
    Alam, M. M. et al. (2019) Validation of the protein kinase PfCLK3 as a multistage cross-species malarial drug target. Science, 365(6456), eaau1682. (doi:10.1126/science.aau1682) There may be differences between this version and the published version. You are advised to consult the publisher’s version if you wish to cite from it. http://eprints.gla.ac.uk/194352/ Deposited on: 05 September 2019 Enlighten – Research publications by members of the University of Glasgow http://eprints.gla.ac.uk Validation of the protein kinase PfCLK3 as a multi-stage cross species malarial drug target Mahmood M Alam1*, Ana Sanchez-Azqueta2*, Omar Janha2*, Erika L. Flannery3, Amit Mahindra4, Kopano Mapesa4, Aditya B. Char5, Dev Sriranganadane6, Nicolas Brancucci7, Yevgeniya Antonova-Koch3, Kathryn Crouch7, Nelson Victor Simwela7, Scott B. Millar7 Jude Akinwale7 Deborah Mitcheson9, Lev Solyakov8, Kate Dudek8, Carolyn Jones8, Cleofé Zapatero10, Christian Doerig11, Davis C. Nwakanma12, Maria Jesús Vázquez10, Gonzalo Colmenarejo13, Maria Jesús Lafuente10, Maria Luisa Leon12, Paulo H.C. Godoi6, John M. Elkins14, Andrew P. Waters7, Andrew G. Jamieson4, León Elena Fernandez Alvaro10, Lisa C. Ranford-Cartwright5, Matthias Marti7, Elizabeth A. Winzeler3, Francisco Javier Gamo10, Andrew B. Tobin2#. 1. Wellcome Centre for Integrative Parasitology and Centre for Translational Pharmacology, Institute of Infection Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK. 2. Centre for Translational Pharmacology, Institute of Molecular Cell and Systems Biology, Davidson Building, University of Glasgow, Glasgow G12 8QQ, UK. 3. Skaggs School of Pharmaceutical Sciences, UC Health Sciences Center for Immunology, Infection and Inflammation, University of California, San Diego, School of Medicine, 9500 Gilman Drive, La Jolla, CA 92093.
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • Interstitial Microduplication at 2P11.2 in a Patient With
    Jun et al. Molecular Cytogenetics 2014, 7:52 http://www.molecularcytogenetics.org/content/7/1/52 CASE REPORT Open Access Interstitial microduplication at 2p11.2 in a patient with syndromic intellectual disability: 30-year follow-up Kyung Ran Jun1, Reinhard Ullmann2, Saadullah Khan3, Lawrence C Layman4,5 and Hyung-Goo Kim4* Abstract Background: Copy number variations at 2p11.2 have been rare and to our knowledge, no abnormal phenotype with an interstitial 2p11.2 duplication has yet been reported. Here we report the first case with syndromic intellectual disability associated with microduplication at 2p11.2. Results: We revisited a white female subject with a chromosome translocation, t(8;10)(p23;q23)mat and a 10q telomeric deletion suspected by G-banding 30 years ago. This female with severe intellectual disability, no speech, facial dysmorphism, intractable epilepsy, recurrent infection, and skeletal abnormalities has been observed from the birth until her death. The karyotype analysis reconfirmed the previously reported chromosome translocation with a revision as 46,XX,t(8;10)(p23.3;q23.2)mat by adding more detail in chromosomal sub-bands. The array comparative genomic hybridization, however, did not detect the 10q terminal deletion originally reported, but instead, revealed a 390 kb duplication at 2p11.2; 46,XX,t(8;10)(p23.3;q23.2)mat.arr[hg 19] 2p11.2(85469151x2,85474356- 85864257x3,85868355x2). This duplication region was confirmed by real-time quantitative PCR and real-time reverse transcriptase quantitative PCR. Conclusions: We suggest three positional candidate genes for intellectual disability and recurrent infection based upon gene function and data from real-time reverse transcriptase quantitative PCR—VAMP8 and RNF181 for intellectual disability and CAPG for recurrent infection.
    [Show full text]
  • Genetic Architecture of Early Pre-Inflammatory Stage Transcription
    Genetic architecture of early pre-inflammatory stage transcription signatures of autoimmune diabetes in the pancreatic lymph nodes of the NOD mouse reveals significant gene enrichment on chromosomes 6 and 7. Beatrice Regnault, Evie Melanitou To cite this version: Beatrice Regnault, Evie Melanitou. Genetic architecture of early pre-inflammatory stage transcrip- tion signatures of autoimmune diabetes in the pancreatic lymph nodes of the NOD mouse reveals significant gene enrichment on chromosomes 6 and 7.. Meta Gene, Elsevier, 2015, 6, pp.96-104. 10.1016/j.mgene.2015.09.003. pasteur-01441051 HAL Id: pasteur-01441051 https://hal-pasteur.archives-ouvertes.fr/pasteur-01441051 Submitted on 19 Jan 2017 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution - NonCommercial - NoDerivatives| 4.0 International License Meta Gene 6 (2015) 96–104 Contents lists available at ScienceDirect Meta Gene Genetic architecture of early pre-inflammatory stage transcription signatures of autoimmune diabetes in the pancreatic lymph
    [Show full text]
  • Analysis of Gene Expression in a Developmental Context Emphasizes
    Open Access Research2008NaxerovaetVolume al. 9, Issue 7, Article R108 Analysis of gene expression in a developmental context emphasizes distinct biological leitmotifs in human cancers Kamila Naxerova*, Carol J Bult†, Anne Peaston†, Karen Fancher†, Barbara B Knowles†, Simon Kasif*‡ and Isaac S Kohane* Addresses: *Children's Hospital Informatics Program, Harvard-MIT Division of Health Sciences and Technology, Longwood Avenue, Boston, MA 02115, USA. †The Jackson Laboratory, Main Street, Bar Harbor, ME 04609, USA. ‡Department of Biomedical Engineering, Boston University, Cummington Street, Boston, MA 02215, USA. Correspondence: Isaac S Kohane. Email: [email protected] Published: 8 July 2008 Received: 4 March 2008 Revised: 31 May 2008 Genome Biology 2008, 9:R108 (doi:10.1186/gb-2008-9-7-r108) Accepted: 8 July 2008 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2008/9/7/R108 © 2008 Naxerova et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Development<p>Ain cancer systematic gene and expression.</p> analysis cancer signaturesof the relationship between the neoplastic and developmental transcriptome provides an outline of global trends Abstract Background: In recent years, the molecular underpinnings of the long-observed resemblance between neoplastic and immature tissue have begun to emerge. Genome-wide transcriptional profiling has revealed similar gene expression signatures in several tumor types and early developmental stages of their tissue of origin.
    [Show full text]