UNIVERSITY OF CINCINNATI
Date: 13-Aug-2010
I, Srdjan Maksimovic , hereby submit this original work as part of the requirements for the degree of: Doctor of Philosophy in Biological Sciences It is entitled: Unusual eye design: The compound-lens eyes of Strepsiptera and the
scanning eyes of Sunburst Diving Beetle larvae
Student Signature: Srdjan Maksimovic
This work and its defense approved by: Committee Chair: Elke Buschbeck, PhD Elke Buschbeck, PhD
9/28/2010 1,046 Unusual eye design: The compound-lens eyes of Strepsiptera and the scanning eyes of Sunburst Diving Beetle larvae
A dissertation submitted to the
Division of Research and Advanced Studies of the University of Cincinnati
In partial fulfillment of the requirements for the degree of Doctorate of Philosophy (Ph.D.)
In the department of Biological Sciences of the College of Arts and Sciences
2010
by
Srdjan Maksimovic
B.S., University of Belgrade, 2001
Committee Chair: Elke K. Buschbeck, Ph.D. Abstract
The majority of investigated eyes describe specific variations of known eye types.
But the eyes of two different insects, the compound-lens eyes of Strepsiptera and the scanning eyes of dytiscid diving beetle larvae, do not follow known design principles.
Most adult insects possess a pair of large compound eyes, often occupying significant portion of their head. Compound eyes are typically composed of hundreds to thousands of ommatidia, each containing 8-10 photoreceptors. For the most part the receptors within each ommatidium act as a single sampling unit, averaging light intensities within all of them. Males of the insect order Strepsiptera are different: their eyes are composed of a smaller number of relatively large units (eyelets), each with an extended retina with often more than one hundred photoreceptors. In the strepsipteran species, Xenos peckii, each eye has about 50 eyelets. By using a behavioral paradigm based on the optomotor response, I have provided evidence that the eyelets in Xenos peckii eyes are image forming units. Each eyelet could sample up to 13 points, as opposed to one sampling point in an ommatidium. This unusual design has already inspired engineers to apply it into artificial optical solutions, such as a compact infra-red camera. Like strepsipteran eyes, the principal eyes of the Sunburst Diving Beetle (Thermonectus marmoratus) larvae are among the most bizarre in the animal kingdom. There are three different larval instars, all of which bear six eyes (stemmata) on each side of their head. The two frontal pairs, known as the principal eyes, are used to scan potential prey prior to capture. The principal eyes form long tubes, have bifocal lenses and are characterized by at least two one-dimensional retinas at their ends: a deep distal retina closer to the lens, and a proximal retina that lies directly underneath. The distal retina expresses long-wavelength
iii opsin (TmLW) mRNA, whereas the proximal retina expresses ultraviolet opsin (TmUV II) mRNA. In contrast to third instars, the proximal retina of first instars shows a weak expression of the TmUV I mRNA limited only to its dorsal half. Third instars lack expression of TmUV I mRNA in their proximal retina. By using intracellular recordings from photoreceptor cells in third instars, I have shown that the distal retina has maximum sensitivity in green (LW), approximately 520-540 nm with an addition of a smaller peak in ultra-violet (UV), around 340-360 nm. The proximal retina is UV-sensitive with peak absorbance at 374 nm. This arrangement, to my knowledge, is the first example of a tiered system with the LW-sensitive cells distal to the UV-sensitive cells. Perhaps this unusual spectral arrangement creates a novel contrast enhancement mechanism. It is still unknown if these animals are capable of color and polarization sensitivity, and both of these visual modalities, including monochromatic vision, can be affected by the strange placement of the distal and proximal retina. Additional optical, physiological and behavioral studies will be necessary to answer these questions.
iv Copyright and reproduction
Articles in JEB are published under an exclusive, worldwide licence granted to the publisher by the authors, who retain copyright. Authors remain the owners of the copyright to the article and retain the following non-exclusive rights (for further details, please refer to the licence agreement that accompanies article proofs):
(1) authors may reproduce the article, in whole or in part, in any printed book
(including thesis) of which they are author;
(2) authors and any academic institution where they are employed may reproduce the article, in whole or in part, for the purpose of teaching students;
(3) authors may post a copy of the article on their website, provided that it has already been published by the journal and is linked to the journal’s website at http://jeb.biologists.org;
(4) authors may use data contained in the article in other works they create;
The Journal of Experimental Biology
The Company of Biologists Limited,
Bidder Building,
140 Cowley Rd,
Cambridge, CB4 0DL, UK
Tel: +44 1223 425525
Fax: +44 1223 423520
v Acknowledgements
There are many people, without whom, this research would not be possible. First, I would like to thank my research advisor, Dr. Elke Buschbeck, who has been a wonderful and understanding mentor. Many thanks for her generous support and interest in my work, yet hands-off approach to overseeing my research. With her friendship and accessibility to her students, she serves as an example of a great advisor. I also would like to thank my committee members: Dr. John Layne, for helping me with the complex computational world of visual processing; Dr. Tiffany Cook, for introducing me to the remarkable molecular techniques used in vision science; Drs. Bruce Jayne and Ali Minai, who paid critical attention and helped me determine the course of my research.
Special thanks to Dr. Stephanie Rollmann for letting me use her lab and equipment, and for her help and advice whenever I needed one. I also would like to thank Drs. Ilya
Vilinsky and Edwin Griff , for showing a deep interest and understanding of my research.
My thanks also extend to people who have become my friends and colleagues as we worked side by side, trying to make the best of our time. Special thanks go to Nadine
Stecher, Premraj Rajkumar, Annette Stowsser, Sri Pratima Nandamuri, Shannon Werner,
Jessie Ebie, Karunyakanth Mandapaka and many others who made graduate school more interesting and at times very amusing.
My deepest love and appreciation go to my parents, Slavko and Cvijeta
Maksimovic, and my brother, Dejan, for their infinite love and support. Without them I would not be the person I am today.
vi Most of all, I would like to thank my wife, Irena, from the bottom of my heart for all her patience and support. She is my best friend and has been for the past 15 years.
Thank you for all your love, support and encouragement.
vii Table of Contents
Introduction……….…………………………………….…………………………………1 References…………………………………………………………………………………6
Chapter 1 Behavioral evidence for within-eyelet resolution in twisted-winged insects (Strepsiptera)
Abstract…………………………………………………………………………………..10 Introduction………………………………………………………………………………11 Materials and methods……………………………………………………………….…..16 Animals…………………………………………………………………………….16 Histology and Scanning electron microscopy (SEM)……………………………...16 Experimental setup…………………………………………………………………17 Quantifying the optomotor response……………………………………...... 19 EMD model………………………………………………………………………...20 Results……………………………………………………………………………………24 Discussion………………………………………………………………………………..28 Acknowledgements………………………………………………………………………38 References………………………………………………………………………………..38
Chapter 2 Spatial distribution of opsin encoding mRNAs in the tiered larval retinas of the Sunburst Diving Beetle Thermonectus marmoratus (Coleoptera: Dytiscidae)
Abstract…………………………………………………………………………………..43 Introduction………………………………………………………………………………44 Materials and methods…………………………………………………………………...49 Animals……………………………………………………………………….……49 mRNA extraction, cDNA synthesis, PCR, and cloning……………………….…...49 Sequencing and phylogenetic analysis……………………………………….…….51 Histology, environmental scanning electron microscopy (ESEM)………….……..52 Single fluorescence in situ hybridization…………………………………….…….52 Double chromogenic in situ hybridization…………………………………………55 Results……………………………………………………………………………………56 Opsin sequences and phylogenetic analysis……………………………………….56 Spatial expression of TmLW, TmUV I and TmUV II mRNAs...…………………59 Opsin mRNA expression in the distal and proximal retinas of Eyes 1 & 2....….....59 Opsin mRNA expression in the E1 medial retina.…………………………………62 Opsin mRNA expression in Eyes 3 – 6……………………………………………64 Opsin mRNA expression in the eye patch…………………………………………66 Discussion………………………………………………………………………………..66 Distribution of opsin mRNAs in the larval eyes of Thermonectus marmoratus…...66 Comparison of T. marmoratus opsin subclasses with those of other invertebrates..68 Presence of two UV-sensitive opsins in T. marmoratus…………………………...72 Functional implications…………………………………………………………….73
viii Acknowledgements………………………………………………………………………75 References………………………………………………………………………………..76
Chapter 3 The spectral sensitivity of the principal eyes of the Sunburst Diving Beetle Thermonectus marmoratus (Coleoptera: Dytiscidae) larva
Abstract…………………………………………………………………………………..84 Introduction………………………………………………………………………………86 Materials and methods…………………………………………………………………...90 Animals…………………………………………………………………………….90 Fluorescence in situ hybridization…………………………………………………91 Electrophysiology………………………………………………………………….91 Animal preparation, intracellular recordings, and neurobiotin iontophoresis.91 Monochromatic stimulation………………………………………………….92 Histology…………………………………………………………………………...94 Ethyl Gallate staining………………………………………………………...94 Neurobiotin tracing…………………………………………………………..95 Results……………………………………………………………………………………95 Fluorescence in situ hybridization…………………………………………………97 Spectral Sensitivities……………………………………………………………….97 Proximal retina……………………………………………………………….97 Distal retina…………………………………………………………………101 Discussion………………………………………………………………………………102 UV sensitivity of the proximal retina……………………………………………..104 LW sensitivity of the distal retina………………………………………………...107 Functional implications…………………………………………………………...108 Acknowledgements……………………………………………………………………..110 References………………………………………………………………………………110
Conclusion……………………………………………………………………………...114 References………………………………………………………………………………116
ix Introduction
What is common for an eye, a camera, and a telescope is that they all need light in order to function. Hence, it is not a coincidence that the design of a camera or a telescope resembles that of an eye. Such designs have to follow the same set of optical rules. The difference is that cameras and telescopes are designed by us, but eyes have evolved over long periods of time spanning millions of years. It is not surprising that the same basic designs are also found in phylogenetically distant taxa, generally resulting from convergent evolution (Land and Nilsson, 2002). The majority of newly investigated eyes describe specific variations of known eye types, usually optimized for specific tasks.
Only rarely is an eye discovered that diverges fundamentally from basic eye types, yet such exceptions can lead to exciting new discoveries and advancements within vision research. In this context, it appears that the eyes of two different insects: the twisted- wing insects (Strepsiptera) and the larvae of the Sunburst Diving Beetle Thermonectus marmoratus, do not follow known design principles.
Most adult insects possess a pair of large compound eyes, often occupying significant portion of their head. Compound eyes are typically composed of hundreds to thousands of ommatidia, each containing 8-10 photoreceptors. The receptors within each ommatidium often act as a single sampling unit, averaging light intensities within all of them. Males of the insect order Strepsiptera are different: their eyes are composed of a smaller number of relatively large units (eyelets), each with an extended retina with often more than one hundred receptor cells (Buschbeck et al., 2003). This morphological design gives the possibility to combine visual principles from compound as well as single-lens eyes within one visual system (Buschbeck et al., 1999; Buschbeck et al., 2003;
1 Maksimovic et al., 2007). Each eyelet has the potential to function as a small, single-lens unit with multiple sampling points within it. In Xenos peckii, the strepsipteran species on which I focus in Chapter 1, on average each eye has only about 50 eyelets. One of the problems with this design is that, after passing through a lens, an image gets inverted.
Therefore, the many minute images need to be re-inverted by an appropriate neural mechanism before they are combined. Indeed, Buschbeck et al. (1999) discovered that underneath each eyelet in X. peckii there’s an appropriate axonal crossing-over, the optic chiasm, which re-inverts partial images before they are joined to create a single erect image. On the other hand, Pix et al. (2000), studied the behavior of the optomotor response of another species of Strepsiptera, Xenos vesparum, and concluded that strepsipteran eyes, although anatomically different, function in the same way as any other compound eye. At least for the behavior they studied. If this is true for other behaviors as well, why should an eye with this design exist at all? Why have an eyelet organization that can support partial image formation, but not use it? I address these questions in
Chapter 1 and in contrast to Pix et al. (2000) conclusions, I provide evidence that these eyes do form many minute images in accordance with their anatomy. In fact, each eyelet of X. peckii forms a partial image composed of up to 13 sampling points, indicating that these eyes indeed, straddle the gap between compound and single-lens eyes.
Like strepsipteran eyes, the principal eyes of the Sunburst Diving Beetle larvae
(Thermonectus marmoratus) are among the most bizarre and strangely organized eyes in the animal kingdom. They possess a highly unusual functional organization suggesting that they might be capable of very complex visual tasks that other known eyes are not.
The Sunburst Diving Beetle larvae have six pairs of eyes, but the largest two pairs are
2 known as the principal eyes and they share many anatomical characteristics (Maksimovic et al., 2009; Mandapaka et al., 2006). Both eyes are tubular (in contrast to typical spherical eye design), point directly forward (as opposed to sideways as do the other four pairs of eyes) and upward at an angle of about 35o and are important for visually guided prey capture (Buschbeck et al., 2007). Two morphological features of these tubular eyes make them strikingly different from other eyes. First, instead of a single sheet of photoreceptor cells, light passes through a stack of photoreceptors which are oriented perpendicular to the direction of the light (distal retina). This is unlike the structure of any known eye as the photoreceptors are in general aligned with the light axis. Deeper in the eye are the receptor cells, which are parallel to the direction of the incoming light
(proximal retina). The ultrastructural organization of these deeper photoreceptors suggests that they might be sensitive to polarized light (Stecher et al., 2010). Both of the retinas have extremely narrow visual fields that extend only in the horizontal plane. The larvae perform vertical head scanning movements to increase the narrow visual fields.
Behavioral experiments have revealed that the principal eyes are used to scan potential prey prior to capture (Buschbeck et al., 2007). It appears that the success of this predatory behavior lies in different but coordinated tasks of the two retinas. Examples of eyes with multiple, sequentially-arranged retinas have been described in other animals, such as the antero-median eyes of jumping spiders. These eyes have a four-tiered retina, which has been hypothesized to be used to compensate for lens chromatic aberration
(Blest et al., 1981; Land, 1969). However, for this mechanism to work, photoreceptor tiers closer to the lens must be sensitive to shorter wavelengths while deeper photoreceptor layers would be excited by longer wavelengths. In Chapter 2, I discuss this
3 hypothesis and provide evidence that, in contrast to the chromatic aberration compensation mechanism, the arrangement of retinas in the principal eyes of T. marmoratus larvae follows the opposite pattern, with long-wavelength (LW) sensitive distal retina and ultra-violet (UV) sensitive proximal retina. So far, this is the only example of a tiered system with LW-sensitive photoreceptor cells in the distal region.
What is the function of this unusual spectral arrangement? Could it be that the distal retina acts as a contrast filter for the proximal retina by potentially sharpening the absorbance spectrum of the proximal retina? Absorbance of LW-sensitive opsins is characterized by a small sensitivity in the UV region (Govardovskii et al., 2000; Stavenga et al., 1993). Therefore, the distal retina can modify the UV light which has to pass through the distal retina in order to reach the proximal retina. Thus, the distal retina can also affect the absorbance curve of the proximal retina. Further discussion of this possibility is stated in Chapter 3. Irrespective to this question, any lens with a single focal plane would be unable to sharply focus any object at a given distance onto both retinas. However, Stowasser et al. (2010) recently discovered that these eyes operate with bifocal lenses that can project two separate images of the same object onto the two retinas, allowing each eye to function as "two eyes in one". Since the two images tend to move towards each other (and deeper into the retina, crossing the 12-15 layers of the distal retina) as the viewed object comes closer, this information could also potentially be used for distance estimation. The novel mechanism for distance perception, as well as the mechanism of how these bifocal lenses produce multiple images, could potentially lead to powerful new technologies.
4 Hence, the study of invertebrate vision can not only be informative for fundamental research, but also be of significant interest for the biomedical and engineering community. For example, in recognition of his outstanding contributions concerning the physiological and chemical visual processes in the eye (Barlow, 1986), one of which was the discovery of lateral inhibition in Limulus compound eye (Hartline et al., 1956), Haldan Keffer Hartline received the Nobel Prize in medicine in 1967. In addition, the ability of insects to navigate with great ease and accuracy using a limited computing power has inspired scientists to construct insect based motion detection models. Besides that, the motion-detection neurons are some of the largest cells in insect visual systems and are easy to observe (Ma and Krings, 2009). Thus, the motion detection of insect eyes and their applications to bio-inspired robot sensors have made enormous progress in recent years. Some of the examples are the Lobula Giant
Movement Detector (LGMD) for collision detection based on locust eyes (Blanchard et al., 2000) and flying motion detectors (Franceschini et al., 1992).
Using biology as inspiration, today’s cutting-edge optical technologies could progress by leaps if scientists and engineers could better imitate insect eyes that have evolved over millions of years. Many scientists have studied insect eyes, and some of those studies are centuries old, dating back to 1695 and the work of Antoni van
Leeuwenhoek, which happened to be the first person to look through the optical array of an insect eye. In the past scientists and engineers did not have the tools and technology to make the artificial eye structures. Today we have the tools, so that great breakthroughs and advancements in vision science can readily be used to enhance video technology, surveillance and navigation systems and even aid us in fighting blinding human diseases.
5 References
Barlow, R. B. (1986). From string galvanometer to computer - Hartline, Haldan,
Keffer (1903-1983). Trends Neurosci 9, 552-555.
Blanchard, M., Rind, F. C. and Verschure, P. (2000). Collision avoidance using a model of the locust LGMD neuron. Robot Auton Syst 30, 17-38.
Blest, A. D., Hardie, R. C., McIntyre, P. and Williams, D. S. (1981). The spectral sensitivities of identified receptors and the function of retinal tiering in the principal eyes of a jumping spider. J Comp Physiol A 145, 227-239.
Buschbeck, E., Ehmer, B. and Hoy, R. (1999). Chunk versus point sampling:
Visual imaging in a small insect. Science 286, 1178-1180.
Buschbeck, E., Sbita, S. and Morgan, R. (2007). Scanning behavior by larvae of the predacious diving beetle, Thermonectus marmoratus (Coleoptera: Dytiscidae) enlarges visual field prior to prey capture. J Comp Physiol A 193, 973-982.
Buschbeck, E. K., Ehmer, B. and Hoy, R. R. (2003). The unusual visual system of the Strepsiptera: external eye and neuropils. J Comp Physiol A 189, 617-630.
Buschbeck, E. K., Sbita, S. J. and Morgan, R. C. (2007b). Scanning behavior by larvae of the predacious diving beetle, Thermonectus marmoratus (Coleoptera :
Dytiscidae) enlarges visual field prior to prey capture. J Comp Physiol A 193, 973-982.
Franceschini, N., Pichon, J. M., Blanes, C. and Brady, J. M. (1992). From insect vision to robot vision. Philos T Roy Soc B 337, 283-294.
Govardovskii, V. I., Fyhrquist, N., Reuter, T., Kuzmin, D. G. and Donner, K.
(2000). In search of the visual pigment template. Visual Neurosci 17, 509-528.
6 Hartline, H. K., Wagner, H. G. and Ratliff, F. (1956). Inhibition in the eye of
Limulus. J Gen Physiol 39, 651-73.
Land, M. F. (1969). Structure of the retinae of the principal eyes of jumping spiders (Salticidae: Dendryphantinae) in relation to visual optics. J Exp Biol 51, 443-470.
Land, M. F. and Nilsson, D. E. (2002). Animal Eyes. Oxford: Oxford University
Press.
Ma, Z. S. and Krings, A. W. (2009). Insect sensory systems inspired computing and communications. Ad Hoc Networks 7, 742-755.
Maksimovic, S., Cook, T. A. and Buschbeck, E. K. (2009). Spatial distribution of opsin-encoding mRNAs in the tiered larval retinas of the sunburst diving beetle
Thermonectus marmoratus (Coleoptera: Dytiscidae). J Exp Biol 212, 3781-3794.
Maksimovic, S., Layne, J. E. and Buschbeck, E. K. (2007). Behavioral evidence for within-eyelet resolution in twisted-winged insects (Strepsiptera). JExpBiol
210, 2819-2828.
Mandapaka, K., Morgan, R. C. and Buschbeck, E. K. (2006). Twenty eight retinas but only twelve eyes; An anatomical analysis of the larval visual system of the diving beetle Thermonectus marmoratus (Dytiscidae; Coleoptera). J Comp Neurol 497,
166-181.
Pix, W., Zanker, J. M. and Zeil, J. (2000). The optomotor response and spatial resolution of the visual system in male Xenos vesparum (Strepsiptera). JExpBiol203,
3397-3409.
7 Stavenga, D. G., Smits, R. P. and Hoenders, B. J. (1993). Simple exponential functions describing the absorbance bands of visual pigment spectra. Vision Res 33,
1011-7.
Stecher, N., Morgan, R. C. and Buschbeck, E. K. (2010). Retinal ultrastructure may mediate polarization sensitivity in larvae of the Sunburst diving beetle,
Thermonectus marmoratus (Coleoptera: Dytiscidae). . Zoomorphology in press.
Stowasser, A., Rapaport, A., Layne, J. E., Morgan, R. C. and Buschbeck, E. K.
(2010). Biological bifocal lenses with image separation. Curr Biol in press.
8 Chapter 1
Behavioral evidence for within-eyelet resolution in twisted-winged insects
(Strepsiptera)
Srdjan Maksimovic, John E. Layne and Elke K. Buschbeck*
Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 45221-0006,
USA
* Author for correspondence (e-mail: [email protected])
Journal of Experimental Biology 210, 2819-2828 (2007)
Published by The Company of Biologists 2007 doi: 10.1242/jeb.004697
9 Abstract
Compound eyes are typically composed of hundreds to thousands of ommatidia, each containing 8-10 receptors. The maximal spatial frequency at which a compound eye can sample the environment is determined by the inter-ommatidial angle. Males of the insect order Strepsiptera are different: their eyes are composed of a smaller number of relatively large units (eyelets), each with an extended retina. Building on a study of
Xenos vesparum, we use a behavioral paradigm based on the optomotor response to investigate the possibility that the eyelets of the Strepsiptera Xenos peckii are image forming units. From anatomical evidence, we hypothesize that spatial sampling in the strepsipteran eye is determined not only by the interactions of widely-spaced photoreceptors in different eyelets, but also by the angular separation between groups of closely-spaced photoreceptors within eyelets. We compared X. peckii’s optomotor response with the predictions of an elementary motion detector (EMD) model consisting of two distinctly different sampling bases. The best match between our empirical results and the model shows that the optomotor response in X. peckii males is determined by both the small (intra-eyelet) and large (possibly inter-eyelet) separations. Our results indicate that the X. peckii eye has sampling bases around 10° and 20°, and that each eyelet could be composed of up to 13 sampling points, which is consistent with previous anatomical findings. This study is the first to use the EMD model explicitly to investigate the possibility that strepsipteran eyes combine motion detection features from both camera and compound eyes.
10 Introduction
Due to the diversity of insects and crustaceans, the most common types of eyes are
compound eyes. Among insects there is one small group of “odd” insects called
Strepsiptera (twisted-wing insects) that have eyes that are fundamentally different from
other compound eyes (Kinzelbach, 1967; 1971; Kritsky et al., 1977; MacCarthy, 1991;
Wachmann, 1972; Buschbeck et al., 1999; Pix et al., 2000), and may represent an
intermediate form between camera eyes and compound eyes. While compound eyes are
usually composed of thousands of ommatidia, each of which effectively samples no more
than one point in space (Nilsson, 1989), Strepsiptera have relatively few shallow, camera-
type eyelets, each with an extensive underlying retina (Strohm, 1910; Rösch 1913; Paulus
1979) . This unique arrangement raises the possibility that the animal can resolve
multiple image points with each eyelet (Buschbeck et al., 1999; Buschbeck et al., 2003).
In this study we use an approach similar to that of Pix et al. (Pix et al., 2000) who studied
Xenos vesparum, to assess the visual resolution of a closely related species, X. peckii.
We compare our behavioral results to a motion detection model that allows sampling bases (the angular separation of input elements) to differ for elementary motion detectors
(EMD) that are situated within eyelets, and those that are between eyelets. Our data and model suggests that image resolution within eyelets indeed is the case for the motion detection pathway, and that each eyelet resolves about 13 points.
The Strepsiptera are a peculiar parasitic insect order that differs in many ways from other insects (Proffitt, 2005). Extreme sexual dimorphism in some instances makes it impossible to fully describe the life cycle of some species. Their phylogenetic position remains unresolved, partly because molecular analyses are controversial as Strepsiptera
11 have an unusually small genome (Johnston et al., 2004). Xenos peckii, a parasite of the paper wasp Polistes fuscatus, are in most places rare, even if hosts are abundant, though in some areas the infestation rates of Polistes wasps by Xenos can be up to 60% (Hughes et al., 2003). Adult males are slightly more than 3mm long and unable to feed. Their mature life only lasts a few hours, during which they are devoted to finding a mate.
Females remain within the wasp’s body for their entire life, and only protrude through the wasp cuticle to mate with the male outside. Not surprisingly, only males have eyes, and on average each eye has only about 50 lenses, in contrast to the slightly smaller but much better known fly Drosophila melanogaster, which has around 700 facets per eye. The average lens in X. peckii )
15 D. melanogaster lenses (Buschbeck et al., 2003).
The difference between Strepsiptera and more typical insects is even more pronounced in histological cross-sections of the eyes. While compound eyes like those of
Drosophila are organized into a series of ommatidial units having a peripheral lens, crystalline cone, support cells and usually 8-10 receptor cells (Fig. 1.1A), cross-sections of X. peckii eyes show that beneath each biconvex lens lies a shallow, extended retina with more that 100 receptor cells (Fig. 1.1B; Buschbeck et al., 2003). Pix et al. (Pix et al.,
2000) cleverly exploited the phenomenon of geometric interference to determine the spatial wavelength at which spatial aliasing caused a moving grating to reverse apparent direction. According to sampling theory this wavelength is equal to one-half the effective sampling interval of the visual system. By modeling the optomotor behavior of Xenos vesparum, they showed that its eyes sampled the grating with a spatial interval corresponding to the angular separation between eyelets, casting doubt on the notion that
12 points within an eyelet are processed for motion detection. In their modeling approach
Pix et al. (Pix et al., 2000) incorporated considerable variance around the mean sampling base (separation between input channels) in order to fit their empirical data, particularly the lack of a reversal of the response at small spatial wavelength. Their assumption of variance is well supported by the highly irregular lens array of male Strepsiptera, and the inevitable variability in the way the vertical edges of the visual stimulus project onto the array of receptors.
Fig. 1.1. Comparison of eye anatomy of Drosophila melanogaster (A) and Xenos peckii (B). The retina of D. melanogaster is composed of hundreds of long, narrow ommatidia, each containing 8 receptor cells. In X. peckii an extended, cup-shaped retina lies beneath each of the large lenses. (C) Two principal sampling eyelets (left). Scale bars, !)"
13 In the current study we build upon the work of Pix et al. (Pix et al., 2000) by expanding their model, and making empirical measurements with Xenos peckii. Our motivations for repeating – with modifications – their study are the following:
1. The anatomical organization of strepsipteran eyes suggests there could be two principal sampling bases; (a) the angular separation of clusters of receptor cells within eyelets and (b) potentially the separation of receptors in different eyelets (Fig. 1.1C). We expanded the model introduced by Pix et al.(Pix et al., 2000) to explicitly include these two disparate sampling bases (one small and one large) while maintaining the possibility for variation within each of them.
2. Our study is on Xenos peckii, which has fewer and larger eyelets than Xenos vesparum. This should make it easer to detect within-eyelet resolution if it is present.
3. In contrast to the behavioral response of X. vesparum (Pix et al., 2000), our preliminary studies on X. peckii found evidence for spatial aliasing. Therefore our behavioral results are more similar to those of other insects, and perhaps somewhat easier to interpret.
4. Finally, because the shape of the behavioral response curve near the zero crossing is particularly critical, we tested these spatial wavelengths (between 15-24º) at finer intervals.
Detailed explanations of the optomotor response can be found elsewhere (e.g., Pix et al., 2000), so here we provide only a basic summary. The optomotor response is a stereotyped behavior comprising whole-body rotations that allow flying insects to maintain course by compensating for involuntary deviations from the original flight path
(Srinivasan et al., 1999), or of head rotations that reduce rotational image velocity across
14 the retina (Land, 1999). This response can be elicited with a patterned grating that is
moved around a tethered insect. A left or rightward image shift across the retina causes
the insect to make compensatory head movements in the same direction to minimize the
relative motion between the eyes and visual scene. In order to explain the underlying
mechanisms of this behavior, the phenomenological motion vision model known as the
“correlation model” has been developed and widely accepted. The simplest
representation of this model that will signal motion in a directionally selective way has to
have at least two input channels, the signals from which must be transmitted with
different velocities or delays, and the subsequent interaction between which must be
nonlinear (for review see Borst and Egelhaaf, 1989; 1993; Egelhaaf and Borst, 1993).
The network known as the “elementary motion detector” (EMD) consists of two such
subunits in mirror symmetry and sharing two input channels, and works on a delay-and-
compare mechanism. The moving stimulus activates the two input channels in
succession; in one subunit the signal from the first channel is delayed and then compared
with the signal from the second channel in a multiplicative fashion (nonlinear interaction),
while in the other subunit the second signal is delayed relative to the first. Subtracting
the output signals of the subunits leads to a response that is directionally selective: the subunit in which the first channel is delayed relative to the second indicates the direction of the stimulus (at least relative to this two-point sample). EMD models of the correlation type have been used to explain motion detection in both invertebrates and vertebrates, (Borst and Egelhaaf, 1989) and they allow the estimation of the parameters that determine the animal’s response to moving stimuli such as moving patterned gratings.
By adjusting the parameters so that the EMD model response matches the animal’s
15 optomotor response, one can determine the sampling base ( - angular separation) between input channels and acceptance angle (- of input channels.
Materials and methods
Animals
During summer 2004 and 2005 Polistes fuscatus F infected with fertilized Xenos peckii females were collected in the vicinity of Cincinnati, OH, USA. A number of
Polistes fuscatus nests were also collected and kept in the laboratory on honey, water and freshly killed crickets. As soon as the fertilized X. peckii females started producing first instar larvae, the P. fuscatus nests were manually infested with first instar parasites.
Obtaining sufficient numbers of live Strepsiptera is difficult and time consuming, so this approach is necessary to get a sufficient number of X. peckii males. After a few weeks adult wasps carrying pupa of X. peckii males were separated from the rest of the wasps and frequently monitored for the emergence of adult X. peckii males. One challenge when working with male X. peckii is that, under laboratory conditions, they only live for
2-6h. Therefore it is critical to start behavioral tests within 30 minutes of emergence. In order to be able to do so, late pupa were kept in the dark throughout the night and early morning of the final days of pupal development. Emergence of adults was triggered by exposure to bright light.
Histology and Scanning electron microscopy (SEM)
Histological sections were prepared using a minor modification of that described elsewhere (Strausfeld and Seyan, 1985). Insects were anesthetized by chilling,
16 decapitated and part of the head cuticle was removed. Heads were fixed in 4% paraformaldehyde solution (EM grade; Electron Microscopy Sciences, Fort Washington,
PA, USA) in Sorensen’s phosphate buffer pH 7.4 (Electron Microscopy Sciences, Fort
Washington, PA, USA). After several washes in buffer, heads were transferred into 1%
Osmium tetroxide (OsO4) solution (Electron Microscopy Sciences, Fort Washington, PA,
USA) in distilled water for 1 hr. on ice followed by 1 hr. at 20o C. Tissue was washed several times in distilled water and finally treated with saturated ethyl gallate (1 hr. at 0°
C and 1 hr. at 20° C). After staining, the heads were dehydrated, embedded in Ultra-Low
Viscosity Embedding Media (Polysciences, Warrington, PA, USA) and serially sectioned at 8 µm. For SEM whole animals were dried, mounted, gold-coated and viewed with a
Philips SEM 505 microscope.
Experimental Setup
After emergence X. peckii males were anesthetized by cooling and tethered by their dorsal metathorax to a thin wire using Elmer’s multi - purpose glue. All body parts were free to move, while the thorax remained in a fixed position at the center of a white cylinder (diameter 16 cm, height 18.5 cm). During experiments insects intermittently engaged in flight behavior, and frequently moved their legs. A computer-animated pattern of vertical black and white stripes was projected onto the inner surface of the cylinder using, “Vision egg” freeware (http://www.visionegg.org/) and a projector with a wide-angle lens (NEC VT 47 with Mercury optics super wide 0.45x AF high definition digital lens with macro; see Fig. 1.2). Direct exposure of the insect to the projector light was prevented with a small disk of green paper. The pattern contrast was m = (I1-
17 I2)/(I1+I2) = 0.52, where I1 and I2 are light intensity values of the white and black stripes respectively. Twelve different gratings, with spatial wavelengths of 10º, 15º, 18º,
20º, 24º, 30º, 36º, 45º, 60º, 72º, 90º, 120º, were rotated in the insects’ yaw plane. The apparent width of the stripes decreases with the cosine of viewing elevation. At the upper and lower edges of the drum, which each were approximately 49º from the midline, apparent stripe width was %66 of that at eye-level. The insects’ responses were recorded by a camera JAI CV S3200 (JAI A.S., Copenhagen, Denmark) with a Navitar zoom 7000 lens (Navitar Inc., Rochester, NY, USA) mounted above the cylinder. Angular velocity and spatial wavelength of the gratings co-varied so that their ratio, i.e. temporal
Fig. 1.2. Schematic of experimental setup. A computer generated stimulus was projected into a white cylinder, at the center of which an insect was mounted. Behavioral responses were recorded with a video camera for frame-by-frame analysis (inset). The animal’s head deflection was measured as the angle between a line through the centers of both eyes (transverse axis of the head (c) and the transverse axis of the body (b). Longitudinal body axis (a) was used to determine the transverse axis of the body (b).
18 frequency, was kept constant at 2 Hz, which is close to the optimum identified by Pix et al. (Pix et al., 2000) for Xenos vesparum.
D. melanogaster males were tested in the same experimental setup, but with spatial wavelengths of 5º, 6º, 10º, 15º, 20º, and 30 º. It has been shown that D. melanogaster has its optimal response at temporal frequency of 1.3 Hz (Buchner, 1976). Thus, in our experiments with Drosophila temporal frequency was held constant at 1.3 Hz.
Quantifying the optomotor response
In both species the magnitude of head deflection was used to quantify the optomotor response; this was measured from video frames using “ImageJ” software (NIH,
Bethesda, MD, USA). Head deflection was defined as the angle between a line through the centers of both eyes (transverse axis of the head) and the transverse axis of the body
(Fig. 1.2 inset). The eyes are the darkest part of the insects’ anatomy, and so could be isolated as separate objects by thresholding the image; a line through the x, y coordinates of their centers was then used to compute angular deflections of the head on each frame.
Head movements in the same direction as pattern rotation (clockwise or counter- clockwise) were designated positive, and those opposing the direction of the pattern were negative.
For each spatial wavelength, moving stimuli of five seconds duration were presented five times each in the clockwise and counter-clockwise directions. Direction alternated between successive presentations with 1.5 second intervals of no stimulation.
The onset phase of the response lasted less than two seconds, and so head deflection measurements are taken from the last three seconds – the equilibrium phase – of each
19 trial. Head deflection was determined for every third frame (i.e., 10 fps), resulting in 30 measurements for each of 10 trials (5 times for each direction), giving 300 measurements per individual per spatial wavelength. The mean of these 300 measurements, combining clockwise and counter - clockwise responses, was recorded as the magnitude of the response to a given spatial wavelength.
EMD model
Head deflection magnitudes were modeled as the output of correlation-type elementary movement detectors (EMDs) using equation 1, taken from Pix et al. (Pix et al.,
2000). When stimulated with a sinusoidal grating the equilibrium phase of the response
$% % * (% and thre
%-width of the angular sensitivity function of the input
-"
1 1 R sinarctan2 / sin2 / 2 2 (1) 1 2 / 1 /
Here we summarize the details of equation 1, previously described by Pix et al.
)!!!*+ ")!!!", % %- 2
% % %- 2/*0("
Therefore temporal frequency was held constant throughout the experiments. The first
20 1 term in equation 1, 2 is the amplitude factor of the first order low-pass 1 2 / filter in the EMD. The second term,sinarctan2 / , sets the EMD to an optimal temporal frequency.
The third, so-called ‘interference term’,sin2 / , modulates the response based on the relation between the spatial pattern properties and of the detector sampling base.
, the most important parameter in our investigation. In biological visual systems the sampling base can be the angular spacing of individual photoreceptors, groups of photoreceptors or ommatidial units, and it determines the spatial resolution of the motion detection system (Borst and Egelhaaf, 1989). T (
- )1 2 3454"6
)7(7) opposite the direction of their actual motion, and the optomotor response occurs in the direction opposite that of the stimulus, due to aliasing (Götz, 1964). In this way the spatial wavelength at which the optomotor response changes from moving with, to moving against, the direction of the stimulus rotation indicates the spatial resolution of the motion detection system.
1 The last term 2 modulates the response as a spatial low-pass filter, 1 / depending on the relation betw -
%- 30("* +
Gaussian curve and the width of this curve at half its greatest magnitude is the acceptance
21 -1 1979; Smakman et al., 1984). Photoreceptors spatially integrate the luminance distribution within their visual field, acting as spatial low–pass filters. As a
- %- 30(7730- % visual system with near-% %- 30- highly attenuated (Buchner, 1976; Land and Nilsson, 2002). Therefore, the size of the acceptance angle sets the cut-%%%- 30-% highest spatial frequency that can be transmitted through the optics with some detectable contrast present in the image. Since the model output is dimensionless, we have expressed both the empirical and model response amplitudes as a fraction of the maximum "8 % %
% - zero.
It should be noted that equation 1 was actually developed to predict the response of an EMD to sinusoidal intensity gratings. However, in our study we used square-wave gratings. It is not clear what effect is brought about by the additional harmonics in the square wave, but we suspect it is minor, based on how well our model matches the predictable behavior of Drosophila (see Results section).
Equation 1 models EMDs with a single sampling base, but as stated in the introduction we hypothesize that in X. peckii there are two sampling bases, and so our model sums the output of two principal EMDs. Furthermore, due to variability in the geometry of the array, some pairs of receptor neighbors – input elements to the EMD – would be successively stimulated by the moving edges with a shorter interval than other pairs, and so a range of different effective sampling bases could be reflected in the
22 optomotor behavior. Therefore, as in the model of Pix et al. (Pix et al., 2000), the two principal sampling bases in our model each have variability around a mean: they were the weighted sums of at least three small and three large sampling bases, both assumed to be
normally distributed and equally spaced within the intervals x 1sd (for the small 1 1
base) and x 1sd (for the large base), and weighted according to their respective 2 2 normal distributions. The standard deviations (sd) were always less than half of the mean sampling base. Initial optimization was done with three small and three large sampling bases, and the number of bases was increased until the value being optimized (the summed absolute difference between model and data) fell below an arbitrarily small threshold. After summation within the two principal bases, the smaller one was weighted with bias B, to allow for the possibility of a stronger contribution from one of the bases as in Drosophila (Buchner, 1976), and the two were summed and normalized to give the final output.
The values of - B were optimized with Matlab’s fminsearch function (The Mathworks, Natick, MA) to produce the best fit between the model and the empirical measurements of the insects’ optomotor response. Due to trapping by local minima, optimization algorithms may produce different results from different initial parameters (‘trapping effect’).
Thus, we ran the above optimization 1000 times, with initial values drawn from
uniform random distributions having the following overlapping ranges: x = 1-27°, 1
x = 13-40° -/9-25° (for Strepsiptera), and x = 1-10°, x = 5-15°, and 2 1 2
-/!"3-10° (for Drosophila). In both cases initial sd1 and sd2 were one-half the initial sampling bases, and B was between 0.5-3.0. In this way we objectively optimized the six
23 relevant parameters: mean small and large sampling bases ( x and x ), their standard 1 2
deviations (sd1 and sd2), a bias (B -"
Results
Since the functional characteristics of the Drosophila visual system have been
known for a long time, we used it to test the validity of our experimental protocol and
EMD model. Fig. 1.3A shows optomotor responses of D. melanogaster evoked by six
spatial wavelengths. Head rotations with the direction of the pattern are clearly visible
for spatial wavelengths of 15º, 20º and 30º, and a negative response indicates aliasing at a
spatial wavelength of 6º. Responses to spatial wavelengths of 5º and 10º are very weak,
barely deviating from 0º for the entire five second stimulation. Note that at the onset of
each response the head was generally turned in the opposite direction, still somewhat
locked into position from the previous stimulus presentation. The length of the onset
phase (the time period that precedes a stable response) varies somewhat for different
spatial wavelengths but generally lasts less than 2 seconds, so only the last three seconds were used for analysis.
In Fig. 1.3B mean responses are plotted together with standard errors of the mean
(s.e.m.)",+ (/)!º, where mean head deflection reaches about 5º. As mentioned above, at a spatial wavelength of 10º hardly any response is observed, and at 6º the response is strongly opposed to the direction of the stimulus,
- )
10º. As with Strepsiptera, the optimization of the model had two principal sampling bases. However, in the best fit for our experimental data (Fig. 1.3B black curve) the two
24 sampling bases converged toward nearly identical values. Each principal base was composed of the minimum three bases with means of 4.8º and 4.9°, s.d. ± 0.1 for both of them, a bias of 0.98, and an acceptance angle of 7º. These are in good agreement with reported values % D. melanogaster (around 5º; Buchner, 1976; Land and Nilsson,
)!!) - 9" º to 7º with adaptation state; Buchner, 1976). We were therefore confident that our behavioral protocol and model could be profitably applied to
Fig 1.3. Drosophila optomotor behavior. (A) Average response of eight (except for 5º where N= 4) individuals to six different spatial wavelengths. Positive values indicate head deflections with the direction of the pattern, and negative values indicate deflections in the reverse direction. (B) For each wavelength the cumulative, normalized, mean of the last three seconds is indicated by a dot with standard error bars. The solid line is the best-fitting EMD model, with mean sampling bases of 4.8 and 4.9 with standard deviations of ± 0.1, and an acceptance angle of 7º. Numbers indicate sample sizes for each spatial wavelength.
25 the Strepsiptera motion detection system. We note that the repeated optimization did not
always produce these values, which is an important point that will be addressed in the
Discussion section.
The general shapes of X. peckii responses to twelve spatial wavelengths are
comparable to those of Drosophila (Fig. 1.4A). As in Drosophila, the length of the onset
phase varied with the spatial wavelength, but was concluded in less than two seconds. A
negative response indicating spatial aliasing, although not as strong as in Drosophila, is
evident at 15º. Close examination of the responses of three different animals reveals a
feature that will prove important for our analysis: although the details of the curves vary somewhat, each is characterized by a small, local maximum around 18-24º (Fig. 1.4B, arrow). This feature is present in all individuals for which these wavelengths were measured. The pooled responses of 23-25 animals show a maximum at a spatial wavelength of 90º, at which head deflection was more than 10º, and a reversal in the direction of head rotation at a wavelength of 15º (Fig. 1.4C). The small plateau between
18º and 24º is where individual local maxima have nearly been averaged out. We believe that the presence of these local maxima around 20º indicates that the strepsipteran optomotor response is based on one small and one large principal sampling base (see below).The model (red line) that best fit our empirical data resulted in nine sampling bases with a mean of 10.2º, nine with a mean of 21.3º, standard deviations of 3.7º for both, bias of 2.1 and an acceptance angle of 37º (Fig. 1.5A,C). To illustrate the modeling procedure, these nine individual responses for the small and large sampling bases were weighted according to their respective normal distributions, and summed to give one curve for small and one for large (Fig. 1.5B,D). Curves like these would be expected if
26 Fig. 1.4. Xenos peckii optomotor behavior. (A) Average responses of all tested individuals to 12 different spatial wavelengths. As in Fig. 1.3, positive values indicate head movements following the direction of the pattern, and negative values indicate head movements in reverse direction. (B) Examples of three normalized, average responses of the last three seconds to each wavelength. Although details of the curves vary, each of them is characterized by a local maximum between 18-24 º (arrow). (C) For each wavelength the cumulative normalized response of the last 3 s of all individuals is indicated by a circle ± s.e.m. The numbers of individuals that were tested for each of the points are indicated.
27 motion detectors integrated only a small or large sampling base (with variability), respectively. The small sampling base curve was weighted by B, and the two curves were summed to give the final model output (Fig. 1.5E). For comparison with the behavioral data, the model response amplitude (R) was normalized to the maximum response (Rmax) (Fig. 1.5F).
It is noteworthy that although the EMD model was based on several variables, the outcome was only truly sensitive to changes in sampling base. Large changes in acceptance angle produced only minor shifts in the response peak (Fig. 1.6A), only really affecting the amplitude of the negative (aliasing) response. As the acceptance angle increased the amplitude of the negative response of the curve decreased. The time
%% % %% e of the
EMD response. Fig 1.6B illustrates three responses that had different amplitudes as a result of three different time constants, but this effect was eliminated after the responses were normalized (Fig 1.6C). The overall fit of the model was also relatively insensitive to the bias. However, only a bias around 2 closely fit the critical wavelength between 18 and 24º.
Discussion
The optomotor response of Xenos peckii was best fit by an EMD model that combined two distinctly different sampling bases: one of approximately 10º and the other around 21º. As evidence for this, we show that the specific shape of the behavioral response curve, particularly the local maximum around a spatial wavelength of 20º, cannot be fit with a motion detection model with one principal sampling base (see Fig.
28 Fig. 1.5. The EMD model for Xenos peckii. (A) Nine small sampling bases were calculated and summed into a single curve, (B), which would be the response curve if only the smaller principal sampling base and its variation were present. (C) Similarly nine larger sampling bases were calculated and summed into the curve in (D). (E) For the final model output the two curves illustrated in B and D were combined by multiplying the intra-eyelet response by the bias value (2.1). (F) The normalized version of the response (solid line) is used to illustrate the close fit of experimental data (circles).
29 1.3B, 1.5A-D). This notion is further supported by the 1000 pseudo-randomized optimizations. A histogram shows that the most common outcome for X. peckii was one base around 10-13° and one around 20-22° (Fig. 1.7A,B). The smaller peaks near 20° in
Fig. 1.7A and near 10° in Fig. 1.7B resulted from the optimization process reversing the two bases, because of the overlapping ranges of initial states. The rare instances (~50) in which both bases occurred in one of these peaks were characterized by poor fits to the data. This result for X. peckii was corroborated by the identical process carried out on
Drosophila. The most common outcome in this case was a base at 5°, and a second base at either 10° or 15° (Fig 1.7C, D); all peaks are predictably sharper than those for X. peckii. While it may appear that the larger sampling bases in both X. peckii and
Drosophila were harmonic artifacts of the smallest base (after all, the stimulus and model were based on sinusoids), this cannot be the case – there are no peaks above 20-22° for X. peckii nor above 15° for Drosophila. Indeed, the outcome for Drosophila is well- supported by Buchner’s (Buchner, 1976) finding that pairs of EMD input elements may span one or even two rows of ommatidia, and in fact our results support one of Buchner’s two candidate models for how this is done (Fig. 11C in Buchner, 1976).
We think that the presence of two sampling bases may have resulted from integrating simple eyes into the framework of a compound eye. While the geometry and results clearly point to a smaller sampling base within individual camera-type eyelets, the composition of the larger sampling base is less straightforward. It may be based on pairs of input elements from different eyelets, pairs of EMD input elements that skip nearest neighbors within single eyelets, or a combination of both. In the following section we
30 Fig. 1.6. The EMD model for Xenos peckii is relatively insensitive to the acceptance angle (-) and independent of the time constant (). (A) Response curves between - 10° and 60° result in similar fits of the experimental data, except for the degree of aliasing, which is strongest for the smallest values. (B) Eqn 1 is used to illustrate that the time constant () affects only the amplitude of the calculated response. Three different time constants result in curves with different amplitudes. However, results are independent of , as curves are normalized to the maximum response (C).
31 present two alternative possibilities for how the large sampling base could result from input elements of different eyelets.
The first possibility is that EMDs are situated between each sampling unit of one eyelet and its corresponding sampling unit in the neighboring eyelet, as illustrated in Fig.
1.8B. The average larger sampling base in X. peckii around 21º (Fig 1.7B) is narrower than the average anatomical separation between two neighboring eyelets, around 27º
(Buschbeck et al., 2003). This disparity may have to do with the relationship between
Fig. 1.7. Sampling bases resulting from 1000 optimizations. Initial states were drawn
from uniform random distributions between x = 1-27°, x = 13-40° -/9- 1 2
25° for X. peckii (A,B), and between x = 1-10°, x = 5-15° -/!"3-10° for 1 2 Drosophila (C,D). In both cases sd1 and sd2 were one-half the initial sampling bases. Gray scale is proportional to f, the sum of the absolute difference between empirical data and model, darkest bars indicating best fit (see key in A).
32 inter-receptor angle and sampling base. Compound eyes typically are composed of a hexagonal array of facets. Depending on the orientation of the array, the effective horizontal sampling base does not correspond to the angle between neighboring
3 1 ommatidia, but to or of that value (Fig 1.8A). The sampling base of X. vesparum 2 2 was estimated to be 9°, or precisely one-half the anatomical inter-eyelet separation of 18°
(Pix et al., 2000). This is consistent with a hexagonal array in the “standing” orientation.
The large sampling base of X. peckii, on the other hand, is more consistent with an array
27 4 3 in the “lying” orientation, i.e. 23.4 . If this angle is twice the smaller (intra- 2 eyelet) base, EMDs composed of all corresponding visual units in neighboring eyelets would give a larger sampling base close to what we observe (Fig. 1.8B). Because eyelets are arranged irregularly, some groups of neighboring eyelets are more or less hexagonally arranged, whether standing or lying, but many are not (Fig 1.8C). Given this mixed geometry it is not surprising that the apparent sampling base does not exactly match the standing or lying array (see Fig. 1.7B, 1.8A), the precision found in X. vesparum notwithstanding. This geometrically simple and elegant solution could have evolved if single ommatidia in the ancestral compound eye turned into eyelets by increasing the number of receptor cells. The neuroanatomical implication of such an organization is that extensive collateral projections within the optic lobes would be necessary to accommodate anatomically distant input channels.
The alternative possibility is that inter-eyelet EMDs are only present near the edges of neighboring eyelets. In this scenario only those units of adjacent eyelets that sample neighboring visual fields would be connected. This can be best illustrated schematically
33 Fig. 1.8. Geometrical interpretations of sampling bases. (A) Geometry of standing and lying hexagonal arrays. (B) Hypothetical organization of sampling units in three neighboring eyelets. The retina of one eyelet has up to 4 sampling units in the horizontal plane, subsuming a total of about 30-35º. The smaller sampling base around 10° occurs within an eyelet, for instance between units 1-2, 2-3, 3-4 in the middle eyelet. One possibility for the larger sampling base around 20º is, that neighboring eyelets span, for instance between units 1-1, 2-2, etc. (C) Irregularities in the organization of eyelets indicated by the number of nearest neighbors for several specific eyelets. (D) A horizontal section of X. peckii illustrates an alternative explanation for the larger sampling base, connecting only nearest optical neighbors. The angles of two such connections are indicated. Variation results because some eyelets lie in the same horizontal plane as their neighbors, such as those in which the same number of sampling units are visible (their optical axes in 2D indicated with straight lines), while other neighbors lie outside the horizontal plane, such as those in which different numbers of units are visible. Scale bars, !)"
34 on a histological section, such as in Fig. 1.8D. In this example, the third eyelet from the left is sectioned through its periphery. Here only a small piece of retina is visible, which could correspond to a single sampling unit. Within this horizontal section, the next eyelet to the right is slightly off axis as well, perhaps allowing for the presence of three neighboring sampling units. In this plane, the angle between the optically nearest sampling units of these two eyelets then would be 23º (Fig. 1.8D). The angle between the optically nearest sampling units between the fourth and fifth eyelet would be 18º. The large sampling base in this scenario results from the average of such connections. This solution is geometrically complex and it is difficult to gauge specifically how sampling bases are distributed. However, this is the organization that would require fewest modifications within neuropils, and could have evolved through the coalescence of clusters of ancestral omatidia. At the neuroanatomical level inhomogeneities are expected, but no extensive collateral projections would be required. Future anatomical investigations could provide evidence for either of the two scenarios.
Considering that motion detection within eyelets theoretically could have evolved de novo, it is possible that it could follow a mechanism other than the correlation EMD model that otherwise is widely accepted in insects. Specifically, motion detection might operate by the gradient model proposed by Srinivasan (Srinivasan and Zhang, 1997) to explain how honey bees use image speed to center their flight path within a tunnel, even though correlation models best explain their optomotor behavior (Srinivasan et al., 1993).
Buchner (1984) showed that gradient models are expected to result in very different response curves from those of correlation models, if the temporal frequency is held constant over a range of special wavelengths (compare Buchner’s Fig 11c and g). Based
35 on our experimental results, which generally follow the sinusoidal shape of correlation type motion detectors, it seems likely that both, intra- and inter-eyelet EMDs are based on correlation-type motion detection. However, without detailed modeling, it is difficult to predict what the response would be if the two motion detection mechanisms were combined. Considering our findings, it is noteworthy that, according to Buchner (1984), both models predict identical zero crossings, and so either model would support processing within eyelets.
Our estimated acceptance angle of 37º is relatively large compared to other insects
(Land, 1997). Previous measurements of X. peckii eyes show that the angular width of a whole eyelet retina (projected through the nodal point of the lens) is about 33º
(Buschbeck et al., 2003). Considering our current results, however, it is unlikely that the whole retina acts as an input element. The EMD model is relatively insensitive to the magnitude of the acceptance angle (see Fig. 1.6A) – the standard deviation of 1000 optimized values was 36° – and this should be verified using more direct means.
There are important differences between the results for X. peckii and those for X. vesparum. The latter did not exhibit the reversed optomotor turning that indicates spatial aliasing, and Pix et al. (Pix et al., 2000) attribute this primarily to an irregular sampling array. Indeed, the reversal in turning direction is lost even in a very regular lens array like that of Drosophila when the stimulus grating is not aligned perpendicular to the principal EMD orientation (Buchner, 1976); such misalignment is surely the case over much of the strepsipteran eye, and so this conclusion is reasonable. Also, X. vesparum did not produce a local response maximum at ~20°. While these differences in performance may indicate different motion-detection systems, alternative explanations
36 include the difference in wavelength intervals tested in the critical region, the larger eyelets of X. pekii with their greater number of receptor cells, the difference in sampling sizes (the smallest being 23 rather than 3), and most importantly the fact that our model was predicated on two distinct sampling bases rather than one.
Based on our results, we propose that at its widest extent the retina of one eyelet has four sampling units in the horizontal plane (4 sampling units separated by 10º gives a total extent of 30º; see Fig. 1.8B). Assuming a symmetrical, round retina, one eyelet can have up to 13 points of resolu 4L2). This value falls well within the 6-35 points previously estimated from histological sections (Buschbeck et al., 2003). Since each eyelet has around 100 receptor cells (Buschbeck et al., 2003), and each EMD input element is formed by approximately eight receptor cells. This is an intriguing parallel with the ommatidia of typical compound eyes, in which the signals from 8-10 photoreceptors are also pooled, and even with the neural superposition compound eyes of flies such as Drosophila, in which eight photoreceptors from seven different ommatidia sample each point in space. Since an abundance of photoreceptor cells is costly
(Laughlin et al., 1998) it may be that natural selection produces the minimum number of receptors necessary to adequately sample each point in the visual field; if this is the case, in compound eyes the minimum number is approximately eight. Since vision has several modalities (detection of color, brightness, motion, etc.) and the optomotor response is exclusively based on motion detection, our conclusions refer to the motion detection system specifically. It is possible that some of the photoreceptors primarily serve other visual tasks, possibly even utilizing visual pathways with different spatial resolution.
37 Acknowledgements
We thank Sarah Sbita for technical assistance, Irena Nikcevic and Ilya Vilinsky for helpful discussions and Nadine Stecher for comments on the manuscript. This work has been supported by a Wieman-Wendell fellowship to SM and by the NSF (IBN-0423963 and IOB-0545978).
References
Borst, A. and Egelhaaf, M. (1989). Principles of motion detection. Trends
Neurosci. 12, 297-306.
Borst, A. and Egelhaaf, M. (1993). Detecting visual motion: Theory and models.
In Visual Motion and its Role in the Stabilization of Gaze (ed. F. A. Miles and J.
Wallman), pp. 3-27. Amsterdam, London: Elsevier.
Buchner, E. (1976). Elementary movement detectors in an insect visual system.
Biol. Cybern. 24, 85-101.
Buchner, E. (1984). Behavioural analysis of spatial vision in insects. In
Photoreception and Vision in Invertebrates, (ed. M. A. Ali), pp. 561-621. New York:
Plenum.
Buschbeck, E. K., Ehmer, B., Hoy, R. R. (1999). Chunk versus point sampling:
Visual imaging in a small insect. Science 286, 1178-1180.
Buschbeck, E. K., Ehmer, B., Hoy, R. R. (2003). The unusual visual system of the Strepsiptera: external eye and neuropils. J. Comp. Phys. A 189, 617-630.
Egelhaaf, M. and Borst, A. (1993). Movement detection in arthropods. In Visual Motion and its Role in the Stabilization of Gaze (ed. F. A. Miles and J. Wallman), pp. 53- 77. Amsterdam, London: Elsevier.
38 Götz, K. G. (1964). Optomotorische Untersuchungen des visuellen Systems einiger Augenmutanten der Fruchtfliege Drosophila. Kybernetik 2, 77-92.
Hughes, D. P., Beani, L., Turillazzi, S. and Kathirithamby, J. (2003). Prevalence of the parasite Strepsiptera in Polistes as detected by dissection of immatures. Insectes
Sociaux 50, 62-68.
Johnston, J. S., Ross, L. D., Beani, L., Hughes, D. P. and Kathirithamby, J.
(2004). Tiny genomes and endoreduplication in Strepsiptera. Insect Molecular Biology 13,
581-585.
Kinzelbach, R. (1967). Zur Kopfmorphologie der Fächerflügler (Strepsiptera,
Insecta). Zool. Jb. Anat. 84, 559-684.
Kinzelbach, R. K. (1971). Morphologische Befunde an Fächerflüglern und ihre phylogenetische Bedeutung (Insecta: Strepsiptera). Zoologica 41, 1-256.
Kritsky, G., Wells, D.G. and Mari Mutt, J. A. (1977). Some observations on the fine-structure morphology of Xenos peckii (Coleoptera: Stylopidae). Coleop. Bull. 31,
93-96.
Land, M. F. (1997). Visual acuity in insects. Ann. Rev. Entomol. 42, 147-177
Land, M. F. (1999). Motion and vision: why animals move their eyes. J. Exp. Biol.
185, 341-352.
Land, M. F and Nilsson. D.-E. (2002). Animal eyes. Oxford University Press,
Oxford
MacCarthy, H. R. (1991). Compund eye of male Stylops pacifica (Strepsiptera;
Stylopidae). J. Entomol. Soc. B C 88, 27-31.
39 Laughlin, S. B., van Steveninck, R. R. D. and Anderson, J. C. (1998). The metabolic cost of neural information. Nature Neurosci 1, 36-41.
Nilsson, D.-E. (1989). Optics and evolution of compound eyes. In Facets of Vision
(ed. D. G. Stavenga and R. C. Hardie), pp. 30-73, Berlin: Springer.
Paulus, H. F. (1979). Eye structure and the monophyly of the Arthropoda. In
Arthropod Phylogeny, (ed. A. P. Gupta), pp. 299-384. New York: Van Nostrad Reinhold.
Pix, W., Zanker, J. M. and Zeil, J. (2000). The optomotor response and spatial resolution of the visual system in male Xenos vesparum (Strepsiptera). J. Exp. Biol. 203,
3397-3409.
Proffitt, F. (2005). Twisted parasites from "Outer Space" perplex biologists.
Science 307, 343.
Rösch, P. (1913). Beiträge zur Kenntnis der Entwicklungsgeschichte der
Strepsipteren. Z. Naturw. 50, 97–146.
Shannon, C. E. and Weaver, W. (1949). The Mathematical Theory of
Communication. Urbana: University of Illinois Press.
Smakman, J. G. J., van Hateren, J. H. and Stavenga, D. G. (1984). Angular sensitivity of blowfly photoreceptors: Intracellular measurements and wave-optical predictions. J. Comp. Physiol. A 155, 239-247.
Snyder, A. W. (1979). Physics of vision in compound eyes. In Handbook of sensory physiology. Vol. VII/6A (ed. H. Autrum), pp. 225-313.
Srinivasan, M. V., Poteser, M. and Kral, K. (1999). Motion detection in insect orientation and navigation. Vis. Res. 39, 2749-2766.
40 Srinivasan, M. V. and Zhang, S. W. (1997). Visual control of honeybee flight. In
Orientation and Communication in Arthropods, (ed. M. Lehrer), pp. 96-113. Basel /
Switzerland: Birkhäuser Verlag.
Srinivasan, M. V., Zhang, S. W. and Chandrashekara, K. (1993). Evidence for 2 distinct movement-detecting mechanisms in insect vision. Naturwissenschaften 80, 38-41.
Strausfeld, N. J. and Seyan, H. S. (1985). Convergence of visual, haltere, and prosternal inputs at neck motor neurons of Calliphora erythrocephala. Cell Tissue Res.
240, 601-615.
Strohm, K. (1910). Die zusammengesetzten Augen der Männchen von Xenos rossii.
Zool. Anz. 36, 156–159.
Wachmann, E. (1972). Fine-structure of compound eye of Stylops spec. (Insecta,
Strepsiptera). Z. Zellforsch Mik Ana. 123, 411-424.
41 Chapter 2
Spatial distribution of opsin encoding mRNAs in the tiered larval retinas
of the Sunburst Diving Beetle Thermonectus marmoratus (Coleoptera:
Dytiscidae)
Srdjan Maksimovic,1 Tiffany A. Cook2 and Elke K. Buschbeck,1*
1Department of Biological Sciences, University of Cincinnati, Cincinnati, Ohio 45221-
0006, USA
2Division of Developmental Biology and Department of Pediatric Ophthalmology,
Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio 45229, USA
* Author for correspondence (e-mail: [email protected])
Journal of Experimental Biology 212, 3781-3794 (2009)
Published by The Company of Biologists 2009 doi: 10.1242/jeb.031773
42 Abstract
Larvae of the Sunburst diving beetle, Thermonectus marmoratus, have a cluster of six stemmata (E1-6) and one eye patch on each side of the head. Each eye has two retinas: a distal retina that is closer to the lens, and a proximal retina that lies directly underneath. The distal retinas of E1 and E2 are made of a dorsal and a ventral stack of at least twelve photoreceptor layers. Could this arrangement be used to compensate for lens chromatic aberration, with shorter wavelengths detected by the distal layers and longer wavelengths by the proximal layers? To answer this question we molecularly identified opsins and their expression pattenrs in these eyes. We found three opsin-encoding genes.
The distal retinas of all six eyes express long-wavelength opsin (TmLW) mRNA, whereas the proximal retinas express ultraviolet opsin (TmUV I) mRNA. In the proximal retinas of E1 and E2, the TmUV I mRNA is expressed only in the dorsal stack. A second ultraviolet opsin, mRNA (TmUV II), is expressed in the proximal retinas of E1 and E2
(both stacks). The finding that longer-wavelength opsins are expressed distally to shorter-wavelength opsins makes it unlikely that this retinal arrangement is used to compensate for lens chromatic aberration. In addition, we also described opsin expression patterns in the medial retina of E1 and in the non-tiered retina of the lensless eye patch. To our knowledge, this is also the first report of multiple UV opsins being expressed in the same stemma.
43 Introduction
Adult insects are generally characterized by compound eyes, and the vast majority of the research in the vision field has been focused on understanding the form, function and evolution of these eyes. However, certain insects are also characterized by stemmata, which are the eyes of holometabolous insect larvae. Stemmata frequently are not multifaceted like compound eyes, but vary greatly from simple photosensitive organs
(such as in many dipterans) to sophisticated camera-type eyes, such as those found in the tiger beetle Cicindela chinensis (Gilbert, 1994; Land and Nilsson, 2002; Toh and
Mizutani, 1987; Toh and Mizutani, 1994; Toh and Okamura, 2007). Despite this diversity, careful morphological studies (Paulus, 1979) as well as more recent molecular work (Buschbeck and Friedrich, 2008; Liu and Friedrich, 2004) suggest that stemmata most likely evolved from the most anterior portion of the compound eyes of their hemimetabolous ancestors.
The stemmata of the sunburst diving beetle, Termonectus marmoratus, are also highly sophisticated. Some of the T. marmoratus stemmata are particularly interesting because their anatomy suggests a highly unusual functional organization (Mandapaka et al., 2006). In this paper, we investigate the presence and spatial distribution of opsins as an important step towards shedding light on the evolution and function of these peculiar eyes. Previous anatomical studies of T. marmoratus larvae revealed that this holometabolous insect contains 6 stemmata on each side of its head, E1 – 6 (Fig.
2.1A,B). Each of these stemmata has at least two distinct, tiered regions of retinular cells that constitute a distal and proximal retina. In addition, T. marmoratus has an untiered eye patch that lacks a lens, but has a retina that is situated directly beneath the cuticle (Fig.
44 2.1A). Behavioral experiments have revealed that E1 and E2 are forward-pointing principal eyes that are used to scan potential prey prior to capture (Buschbeck et al.,
2007). E3 – 6, on the other hand, are secondary eyes that probably detect prey outside the visual field of the forward-pointing principal eyes. E1 and E2 point upward at an angle of about 35 deg. from the horizontal body plane and share many anatomical characteristics (Fig. 2.1C,D). Both are tubular in design and have a cylindrical crystalline cone-like structure underlying a large lens. The distal retina lies directly below this cone.
Viewed sagittally, the rhabdomeric portion of the distal retina has a triangular shape, and is formed by retinular cells that are oriented orthogonally to the light path (Fig. 2.1C,D; insets). This orientation is unusual for insect retinular cells which are in general aligned with the light axis. In T. marmoratus, there are at least twelve orthogonal cell layers stacked on top of each other on both the dorsal and ventral eye side, resulting in dorsal and ventral stacks, which together form the distal rhabdom (Fig. 2.1D, insets). Below the distal retina lies the proximal retina which is formed by two rows of axially oriented retinular cells (Fig. 2.1C,D). In addition, E1 has a third retina that contributes to rhabdoms that are situated along the medial side of the eye (previously described as the lateral retina) (Fig. 2.1D) (Mandapaka et al., 2006). This medial retina is absent in
E2, which is the most obvious anatomical difference between the two tubular eyes.
E3 – 6 exhibit the same orientation of their rhabdoms within their distal and proximal retinas as do E1 and E2, but these secondary eyes are more spherical than cylindrical. All secondary eyes have a similar arrangement of their retinas with distal rhabdoms situated near the middle of each eye and a cytoplasm that projects to the
45 Fig. 2.1. First instar T. marmoratus larval eyes. (A) Frontodorsal view of the larva showing the principal eyes, E1 and E2, and the eye patch (EP). (B) Left lateral view of the head showing the secondary eyes, E3 – 6, as well as the two principal eyes. (C) An ethyl gallate-stained sagittal section showing the lenses (L), crystalline cone-like structures (CC), retinular cells of the distal (DRC) and proximal retinas (PRC) with their respective rhabdoms (distal, DRh; proximal, PRh). Different retinas (retinular cells and rhabdoms) are labeled on the principal eyes (E1 and E2) and on E5. Other secondary eyes (E3, E4, and E6) have an organization similar to that of E5, but are situated outside the illustrated sectioning plane. In general, in all eyes (E1 – 6), distal retinular cells (DRC) stain darker with ethyl gallate than the proximal retinular cells (PRC). Rhabdoms also appear darker. (D) 3D reconstruction of E1 showing the lens (L), crystalline cone-like structure (CC), medial retina rhabdom (MRh), distal retina rhabdom (DRh), and the proximal retina rhabdom (PRh). Insets a and b are schematic drawings of respective sections through the distal retina (as indicated in the figure by sectional planes a and b), illustrating the orthogonal orientation of the dorsal and ventral retinular cells of the distal retina. The insets illustrate the rhabdoms (red) as well as cell bodies (green) which are not shown in the 3D reconstruction. Scale bars: < = )!!)>? 3!!)"
46 periphery on both sides of the rhabdom. Retinular cells of the proximal retinas, on the other hand, are “in axis” with the light path and lie along the back of the eyes (Fig. 2.1A, see E5). These eyes are also distributed around the animal’s head, each eye oriented at a different angle (Mandapaka et al., 2006).
All in all, T. marmoratus has at least 26 retinas, and due to its bizarre organization, this visual system differs strongly from any other known visual systems (Mandapaka et al., 2006). How can such a complicated visual system function? There are a few organizational similarities to the eyes of jumping spiders (Salticidae). In these animals, the secondary eyes are fixed and act primarily as motion detectors while their principal, antero-median (AM) eyes are used for target tracking (Land and Nilsson, 2002).
Interestingly, the AM eyes of jumping spiders have a four-tiered retina, which has been hypothesized to be used to compensate for lens chromatic aberration (Blest et al., 1981;
Land, 1969). Lens chromatic aberration results in shorter wavelengths being refracted more than longer ones. Hence, short wavelengths are in sharp focus closer to the lens than longer wavelengths. By having a tiered retina with short(er)-wavelength photoreceptors in layers closer to the lens and long(er)–wavelength receptors in the layers behind, one can compensate for lens chromatic aberration by focusing different wavelengths onto photoreceptor layers that are maximally sensitive to them. Consistent with this model, in the jumping spider Plexippus sp., the retinal layers farthest from the lens express long-wavelength sensitive (LW, or green) opsin receptors, while layers closer to the lens express ultraviolet-sensitive (UV) opsin receptors with spatial separations that approximately match the chromatic aberration of the lens (Blest et al.,
1981). Considering that the unusual visual system of T. marmoratus larvae is also
47 characterized by tiered retinas, and that the distal retinas of the principal eyes consist of many layers, the question arises as to whether specific photoreceptor subtypes could compensate for chromatic aberration in this species as well. Although this might not hold for the smaller secondary eyes, it is expected that the relatively long focal lengths of the tubular principal eyes lead to significant chromatic spread. For instance, for Musca domestica lenses, which have much smaller focal lengths of 50 – @!) %
% 993 5) % %% %
(582 nm) (McIntyre and Kirschfeld, 1982). Based on the several hundred-µm separation between the lenses and retinas of the T. marmoratus E1 and E2, we expect that the lens chromatic aberration in these eyes is substantially larger than the one for Musca domestica lenses, separating light sufficiently for different wavelengths to be simultaneously focused at least within the different layers of the distal retinas. Therefore it is important to understand the spatial expression patterns of opsins in this visual system.
We have used molecular techniques to clone, identify and investigate the spatial distribution of opsin transcripts from the first instar larvae of T. marmoratus.We describe three independent opsin-encoding genes from these animals that account for all of the previously identified retinas of these larvae. Based on gene sequence and phylogenetic analyses, two opsins are UV-sensitive, whereas one is LW-sensitive. No blue (B)-sensitive opsin was identified, similar to recent studies in the Tribolium beetle lineage (Jackowska et al., 2007). These findings are consistent with an evolutionary loss of B-sensitive opsin in this lineage. The expression patterns of the different opsin genes indicate LW-sensitive distal retinas and UV-sensitive proximal retinas in all eyes. This expression pattern does not support the possibility of a chromatic aberration
48 compensation mechanism, neither within the deep distal retinas of principal eyes nor between the distal and proximal retinas (since it is contrary to what would be expected for chromatic aberration compensation). To our knowledge, this is the first report of two
UV-sensitive opsins expressed in the same stemmata within a holometabolous insect.
Materials and Methods
Animals
Adult and larval T. marmoratus (Gray, 1832) specimens, reared in our lab throughout the year, were offspring of the beetles provided by the Insectarium of the
Cincinnati Zoo and Botanical Gardens, or from beetles collected in August 2004 near
Tucson, AZ, USA. Adults were kept in fresh water aquariums at room temperature (RT) and fed daily with freshly killed crickets. After hatching, T. marmoratus larvae were separated from adults and fed with thawed brine shrimp and live mosquito larvae before they were used in experiments. Although second and third instar larvae appear to have a similar general eye organization (data not shown), all experiments were performed on first instar larvae only.
mRNA extraction, cDNA synthesis, PCR, and cloning
Larval heads were severed from intact animals in phosphate-buffered saline (PBS, pH 7.4) and kept on dry ice until at least ten heads were collected. Total RNA was extracted from larval heads using TRI Reagent® (Applied Biosystems, Foster City, CA,
USA) according to manufacturer’s instructions and resuspended in 20 uL of H2O.
Single-stranded complementary DNA (cDNA) was synthesized from 3)A of the extracted total RNA through reverse transcription (AffinityScript Reverse Transcriptase,
49 Stratagene, La Jolla, CA, USA) with oligo-dT primers. Consensus-degenerate hybrid oligonucleotide primers (Rose et al., 1998) that correspond to highly conserved amino acid sequences in LW, UV and B wavelength sensitive invertebrate opsins were designed using the online CODEHOP program
(http://bioinformatics.weizmann.ac.il/blocks/codehop.html; Table 1). All primers were synthesized by IDT (Integrated DNA Technologies, Inc., Coralville, IA, USA). PCR reactions were performed using Taq DNA polymerase with premix, TAK_R001AM
(Takara, Otsu, Shiga, Japan). Plant RNA Isolation Aid (Applied Biosystems, Foster City,
CA, USA) was used at a dilution of 1:10 per reaction to prevent PCR inhibition by polysaccharides present from the head cuticle. A typical 25 uL reaction consisted of 2.5 uL PCR 10x buffer, 2.5 uL 25 mM MgCl2, 4 uL 10 mM dNTPs, 1 uL 100 uM forward primer, 1 uL 100 uM reverse primer, 0.25 uL Taq DNA polymerase, 0.5 uL cDNA, 2.5 uL Plant RNA Isolation Aid and 10.75 uL H2O. Samples were denatured at 94?%) minutes prior to 35 cycles of PCR (94? 3 >5@-55?C D 3 min; 72? 3 % E)?+ " PCR products of appropriate length were gel purified with the QIAquick Gel Extraction Kit (QIAGEN,
Valencia, CA, USA), subcloned into pGEM®-T Easy Vector (Promega, Madison, WI,
USA), and bidirectionally sequenced. 3’ RACE PCR reactions were performed using freshly isolated cDNA from T. marmoratus larvae synthesized with an adapted oligo dT primer [5’- GAC TCG AGT CGA CAT CGA TTT TTT TTT – 3’] and subsequently amplified with opsin-specific forward primers (Table 1) and a universal reverse primer
(from the adapted oligo dT primer: [5’- GAC TCG AGT CGA CAT CG – 3’]). 5’ RACE
PCR reactions were performed using FirstChoice® RLM-RACE kit (Applied Biosystems,
50 Foster City, CA, USA) according to manufacturer’s instructions. 5’ RACE reaction forward primers were provided in the kit and opsin-specific reverse primers were synthesized (Table 1).
Sequencing and phylogenetic analysis
Each PCR product was sequenced from at least three independent clones. Full- length opsin cDNA sequences were assembled, translated and aligned with 46 selected arthropod opsin proteins (Table 2) using Clustal W implemented in MEGA 4.0 (Tamura et al., 2007). A phylogenetic tree was constructed using the neighbor-joining algorithm
(Saitou and Nei, 1987) with Poisson correction (Zuckercandl and Pauling, 1965) and evaluated with 1000 bootstrap replicates (Felsenstein, 1985 ) as implemented in
MEGA4.0. Positions containing alignment gaps and missing data were eliminated in pairwise sequence comparisons (Pairwise deletion option).
Table 2.1. Degenerate (upper case) and specific (lower case) primers used in cloning T. marmoratus opsins. Degenerate primers were named according to the spectral class and their orientation, i.e. LWFw-long wavelength, forward; LWRv-long wavelength, reverse (see Fig. 2). The 3' RACE primers shown are all forward and the 5' RACE are all reverse.
Primers Sequence 5' > 3' Size LWFw I GAACCTGGCCTTCTCCGAYTTYNKNAT 27 LWRv I ACGTTCATCTTCTTGGCCTGYTCNYKCAT 29 LWFw II TTCGACCGGTACAACGTGATHGTNMANGG 29 LWRv II CAGGTAGGGGGTCCAGGCVAWRAACCA 27 BlFw CATGTTCATCATCAACCTGGCNATHTTYGA 30 BlRv CGAAGGAGCAGGTGGACARRWANCCYTC 28 UVFw I GAGCTGATGCACATCCCCSARCAYTGGYT 29 UVRv I CGAAGGTGTCGGTCAGGTAGTCRAANSWRCA 31 UVFw II TGGTCAAGACCCCCATCTTYAYGYAYAA 28 UVRv II CAGATGGTGATGGCGGCYTTNGCDATNC 28 3' RACE LW tgatgaccatctcgctgtggttct 24 5' RACE LW aggtctcgtagtagcagttgacg 23 3' RACE UV I cgaagcaaccagaatcaacagacc 24 5' RACE UV I tagctccgatacctgataaagagc 24 3' RACE UV II tattctgcctgctatggaagtct 23 5' RACE UV II acctcggttgaatgagttgtaga 23
51 Histology, environmental scanning electron microscopy (ESEM)
Histological sections were prepared using a protocol by Strausfeld and Seyan
(Strausfeld and Seyan, 1985) with some minor modifications. Larvae were anesthetized by chilling, decapitated, and fixed 1-2 h at RT in 4% paraformaldehyde solution
(Electron Microscopy Sciences, Fort Washington, PA, USA) in Sorensen’s phosphate buffer, pH 7.4 (Electron Microscopy Sciences, Fort Washington, PA, USA). After two
10 min washes in Sorensen’s buffer, heads were transferred into 1% osmium tetroxide
(OsO4) solution (Electron Microscopy Sciences, Fort Washington, PA, USA) in distilled water for 1 h on ice followed by 1 h at 20?", and stained with saturated ethyl gallate for 1 h at 0? 3)!?"6 were dehydrated, embedded in Ultra-Low Viscosity Embedding Medium (Polysciences,
2 *< F1< @)" For SEM, whole animals were dried, mounted, and viewed with an ESEM XL30 (FEI Company, Hillsboro, OR, USA) microscope.
Single fluorescence in situ hybridization
Larval heads were fixed in 4% phosphate-buffered (PBS, pH 7.4) paraformaldehyde with 3.6% sucrose for ~1 h at RT, washed three times for 10 min in PBS, embedded in
Neg-50 freezing medium (Thermo Scientific Inc., Waltham, MA, USA) and fast- frozen in liquid nitrogen. After 30 min equilibration at -20? 3! using a Tissue-Tek cryostat (Ames Company, Elkhard, IN, USA). In situ preparations with fluorescent staining were performed using digoxigenin labeled RNA. Antisense and sense riboprobes were generated using the SP6/T7 Transcription Kit with DIG RNA labeling mix (Roche Applied Sciences, Indianapolis, IN, USA). The riboprobes were
52 Table 2.2. Table of 46 opsin sequences used in this study for phylogenetic analysis. For opsins for which (max was not given, predictions were made based on molecular analysis. Adapted from Porter et al. (2007).
Opsin GenBank Species Taxon ( Reference class accession # max (nm) Apis mellifera Insecta U26026 540 Townson et al. (1998) Camponotus abdominalis Insecta U32502 510 Popp et al. (1996) Drosophila melanogaster Rh6 Insecta Z86118 508 Salcedo et al. (1999) Limulus polyphemus (lateral eye) Chelicerata L03781 520 Smith et al. (1993) L. polyphemus (ocelli) Chelicerata L03782 530 Manduca sexta Insecta L78080 520 White et al. (1983) Megoura viciae Insecta AF189714 LW predicted Gao et al. (2000) Neogonodactylus oerstedii Rh1 Crustacea DQ646869 489 N. oerstedii Rh2 Crustacea DQ646870 528 Cronin and Marshall, (1989) N. oerstedii Rh3 Crustacea DQ646871 522 Papilio glaucus Rh1 Insecta AF077189 LW P. glaucus Rh2 Insecta AF077190 LW predicted Briscoe (2000) P. glaucus Rh3 Insecta AF067080 P. glaucus Rh4 Insecta AF077193 Papilio xuthus Rh1 Insecta AB007423 520 P. xuthus Rh2 Insecta AB007424 520 Arikawa et al. (1987) P. xuthus Rh3 Insecta AB007425 575 Pieris rapae Insecta AB177984 540 Ichikawa and Tateda (1982) Procambarus clarkii Insecta S53494 533 Zeiger and Goldsmith (1994) Schistocerca gregaria Insecta X80072 520 Gartner and Towner (1995) Sphodromantis sp Insecta X71665 515 Rossel, (1979) Tribolium castaneum Insecta XM_968054 LW predicted Jackowska et al. (2007) Vanessa cardui Insecta AF385333 530 Briscoe et al. (2003) Calliphora vicina Rh1 Insecta M58334 490 Paul et al. (1986) D. melanogaster Rh1 Insecta K02315 478 Blue- Feiler et al. (1988) D. melanogaster Rh2 Insecta M12896 420 green Hemigrapsus sanguineus Rh1 Crustacea D50583 480 Sakamoto et al. (1996) H. sanguineus Rh2 Crustacea D50584 480 A. mellifera Insecta AF004168 439 Townson et al. (1998) D. melanogaster Rh5 Insecta U67905 437 Salcedo et al. (1999) M. sexta Insecta AD001674 450 White et al. (1983) Blue P. glaucus Rh6 Insecta AF077192 Blue predicted Briscoe (2000) P. xuthus Rh4 Insecta AB028217 460 Arikawa et al. (1987) S. gregaria Insecta X80072 430 Gartner and Towner (1995) V. cardui Insecta AF414075 470 Briscoe et al. (2003) A. mellifera Insecta AF004169 353 Townson et al. (1998) C. abdominalis Insecta AF042788 360 Smith et al. (1997) Cataglyphis bombycinus Insecta AF042787 360 D. melanogaster Rh3 Insecta M17718 345 Feiler et al. (1992) D. melanogaster Rh4 Insecta AH001040 375 UV M. sexta Insecta L78081 357 White et al. (1983) M. viciae Insecta AF189715 UV predicted Gao et al. (2000) P. glaucus Rh5 Insecta AF077191 UV predicted Briscoe (2000) P. xuthus Rh5 Insecta AB028218 360 Arikawa et al. (1987) T. castaneum Insecta XM_965251 UV predicted Jackowska et al. (2007) V. cardui Insecta AF414074 360 Briscoe et al. (2003)
53 synthesized either solely from the 3’ untranslated region (3’ UTR), or from the 3’ end of the coding sequence and the 3’ UTR (see Fig. 2.2). Tissue sections were prehybridized in
G3!!)A/slide of hybridization buffer (0.3 mol L-1 NaCl, 2.5 mmol L-1 EDTA, 20 mmol
L-1 Tris, 50% formamide, 10% dextran sulphate, 2 mg mL-1 yeast total RNA, 1x
Denhardt’s medium) (adapted from Sakamoto et al. (1996)) for ~30 min at 55 - 60?
% G)!!)A0 % %% with
!" ) A-1 of labeled riboprobes for ~16 h at 55 - 60C. Parafilm coverslips were removed from slides by soaking in 5x SSC (standard saline citrate) at 55-60?, and sections were washed three times for 20 min in 0.1x SSC at 55 - 60?"1 then washed in 1x PBS with 0.1% Triton X-100 (PBX) for 10 min at RT, blocked with
10% normal sheep serum (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA,
USA) in PBX for 1 h at RT, and incubated at 4? < -
Digoxigenin-AP (Roche Applied Sciences, Indianapolis, IN, USA) diluted 1:500 (1.5 i.u.mL-1) in blocking solution. Sections were then washed three times for 30 min in PBX at RT. Alkaline Phosphatase activity was developed using Fast Red Tablets (Roche
Applied Sciences, Indianapolis, IN, USA) according to manufacturer’s instructions.
Sections were washed again for 5 min in PBX at RT, rinsed with distilled water and mounted using Fluoromount-G (SouthernBiotech, Birmingham, AL, USA). Fluorescence images were taken using an Olympus BX51 microscope (with filter set for Texas Red) equipped with an Olympus 60806 digital camera (Olympus America Inc, Center Valley,
PA, USA), and adjusted for brightness and contrast with Adobe Photoshop CS3 (Adobe
Systems Incorporated, San Jose, CA, USA).
54 Double chromogenic in situ hybridization
The procedure used for double in situ hybridization was identical to the one given above for single fluorescence in situ, except for the following:
Double in situs were performed using digoxigenin and fluorescein (Fluorescein
RNA labeling mix, Roche Applied Sciences, Indianapolis, IN, USA) labeled RNA probes
Fig. 2.2. Schematic illustration of the three cloned opsin cDNAs in the T. marmoratus first instar larvae. (A) TmLW cDNA. (B) TmUV I cDNA. (C) TmUV II cDNA. Coding regions (cds) are indicated with green in A, and violet in B and C. Gray regions illustrate positions of the predicted transmembrane segments. Numbers at both ends of each cds indicate the positions of start and stop codons. Nucleotide sequences are of degenerate primers that were used to amplify the internal opsin fragments. Primer positions along with lengths of amplified fragments are also indicated, as well as the size and position of the riboprobes that were used in in situ hybridizations.
55 3) A-1 % !" ) A-1 per probe) in the hybridization buffer. After the blocking step, sections were incubated at 4? simultaneously with sheep Anti-Digoxigenin-AP and Anti-Fluorescein-POD (Roche
Applied Sciences, Indianapolis, IN, USA) diluted 1:500 (1.5 i.u.mL-1) and 1:100 (1.5 i.u.mL-1), respectively in blocking solution. Since fluorescence was not used for double in situs, the detection method was also different. Fluorescein-labeled riboprobes were identified first by detecting horseradish peroxidase activity using a DAB Substrate Kit
(Vector Laboratories, Burlingame, CA, USA), followed with a 5 min wash in PBX at RT.
Alkaline Phosphatase activity was developed second, using 1-Step NBT/BCIP plus
Suppressor (Thermo Scientific Inc., Waltham, MA, USA). Images were taken with the same equipment used for fluorescence in situs, but without fluorescence filters.
Results
Opsin sequences and phylogenetic analysis
Using degenerate PCR primers corresponding to highly conserved amino acid sequences from LW-, B-, and UV-sensitive invertebrate opsins (Table 1), we performed
RT-PCR from RNA isolated from first instar T. marmoratus larvae. Primers LWFw I +
LWRv I and LWFw II + LWRv II amplified 501 bp and 444 bp fragments, respectively, of an identical long-wavelength opsin, which we call TmLW (Fig. 2.2A, GenBank accession code: EU921225). UVFw I + UVRv I and UVFw II + UVRv II amplified 534 bp and 546 bp fragments, respectively, of a single UV-sensitive opsin encoding gene, called TmUV I (Fig. 2.2B, EU921226). BlFw + BlRv, made against conserved sequences in insect B-sensitive opsins, amplified a 347 bp fragment of a third opsin under
56 low stringency PCR conditions, which by BLAST homology, corresponds to a second
UV-wavelength-sensitive opsin, TmUV II (Fig. 2.2C, EU921227). Corresponding fragments of TmLW and TmUV I were also amplified under these conditions.
Full-length cDNAs for these three opsins were acquired using 5’ and 3’ RACE PCR, and their full-length deduced amino acid sequences were assembled (Fig. 2.3). TmLW cDNA encodes a 384 amino acid opsin, TmUV I encodes a 380 aa opsin, and TmUV II encodes a 375 aa opsin. As shown by the alignment in Fig. 2.3, TmLW, TmUV I and
TmUV II are 31.70% identical (red residues/asterisks), and the two UV opsins are
75.65% identical. Consistent with other arthropod opsins and from hydropathicity analysis, all three T. marmoratus opsin cDNAs are predicted to code for seven transmembrane segments. In addition, each opsin contains conserved amino acid residues commonly associated with insect opsins, including: (1) a Lys in the seventh transmembrane segment (Lys-333) that is the site of attachment for the Shiff’s base linkage to the retinal chromophore (black arrow) (Gartner and Towner, 1995; Townson et al., 1998; Wang et al., 1980) (Gartner and Towner, 1995; Townson et al., 1998; Wang et al., 1980), (2) two conserved Cys residues predicted to form a stabilizing disulfide linkage (Gartner and Towner, 1995; Townson et al., 1998) at positions 134 and 212, (3) an Asn residue at the N – terminus (TmUV I and TmUV II, Asn-9; TmLW, Asn-5) that represents a potential glycosylation site (Gartner and Towner, 1995; Townson et al.,
1998), and (4) two helix/loop conserved sequences (DRY, QAKKMNV) potential G – protein binding sites (Gartner and Towner, 1995; Townson et al., 1998).
To confirm Blast predictions of the spectral class of the cloned opsin cDNAs, and to examine their relationship with other known arthropod opsins, a phylogenetic tree was
57 Fig. 2.3. Amino-acid alignment in Clustal W of the three opsins cloned as cDNA from the first instar larval heads of T. marmoratus. Brackets indicate transmembrane regions predicted from hydropathicity analysis and the alignment with other opsins. Identical residues are in red (*), strongly similar ones are in green (:), weakly similar ones are in blue (.). The arrow indicates the site of the chromophore Schiff-base linkage. Conserved amino-acid residues are indicated in gray (for more details see text). The sequences have been deposited in GenBank under accession numbers EU921225 (TmLW), EU921226 (TmUV I), EU921227 (TmUV II).
58 generated based on these and 46 other known opsin amino-acid sequences. As shown in
Fig. 2.4, opsins that share similar spectral characteristics are more related to each other than opsins from different spectral classes. In our analysis, both TmUV I and TmUV II are nested within the UV branch of the tree, most closely related to the UV opsin of another beetle, Tribolium castaneum. Likewise, the long-wavelength opsin (TmLW) is grouped together with other LW opsins, again with T. castaneum LW opsin as its closest neighbor. We also noted that, as in T. castaneum (Jackowska et al., 2007), we were unable to amplify a B-sensitive opsin from T. marmoratus larvae, even under low- stringency PCR conditions, suggesting that the B family of insect opsin has commonly been lost from the Coleopteran phylogenetic branch (see Discussion).
Spatial expression of TmLW, TmUV I and TmUV II mRNAs
We next located expression of TmLW, TmUV I and TmUV II mRNAs in the first instar larvae visual system using in situ hybridization. Sense probes did not produce any apparent staining (data not shown). As summarized in Table 3, the mRNAs corresponding to the three opsin genes isolated by PCR were found in all known retinas in the head of the first instar larvae. Specific expression patterns are described below.
Opsin mRNA expression in the distal and proximal retinas of Eyes 1 & 2
As described earlier and shown in Fig. 2.5A, E1 and E2 are anatomically similar, having a characteristic tubular design with narrow distal and proximal retinas, each made of a dorsal and ventral rhabdom. E1 and E2 also exhibit very similar opsin expression patterns (see Figs 2.5 and 2.6), so in the text below, we will refer to the distal and proximal retinas from either E1 or E2 without distinction. As shown by fluorescent in situ hybridization, TmLW mRNA is expressed highly and specifically in the distal
59 Fig. 2.4. Phylogenetic reconstruction of T. marmoratus larval opsins and 46 other known arthropod opsins. For accession numbers and spectral absorbencies, see Table 2. The numbers appearing above nodes represent bootstrap percentages of 1000 replications. Spectral clades are delineated. Arrows indicate positions of the T. marmoratus larval opsins.
60 retinular cells (DRC) of the T. marmoratus principal eyes (Fig. 2.5B), while the TmUV II mRNA is restricted to the proximal retinular cells (PRC) (Fig. 2.5C). This expression pattern was confirmed with non-fluorescent chromogenic double in situ hybridizations for TmLW and TmUV II mRNAs (Fig. 2.5D-F). Higher magnification images (Fig.
2.5E,F) illustrate that the nuclei of the retinular cell bodies appear at the periphery as spherical regions of weaker staining for both, TmLW (Fig. 2.5E) and TmUV II (Fig.
2.5F) mRNAs. As expected, the rhabdomeric regions of each retina (DRh and
PRh) do not stain with any of the opsin probes, leaving translucent regions in the center.
We also stained E1 and E2 for TmUV I mRNA, and found that this gene, like
TmUV II, is expressed in the proximal retinas of the principal eyes. However, TmUV I mRNA expression is restricted to the dorsal stack of photoreceptors, whereas TmUV II mRNA is present in both the dorsal and ventral stacks (Fig. 2.6). This is apparent in
Table 2.3. Spatial expression of the three cloned opsins in the T. marmoratus larval visual system.
Eye Retina TmLW TmUV I TmUV II distal + - - 1 proximal - + + medial + + + distal + - - 2 proximal - + + distal + - - 3 proximal - + - distal + - - 4 proximal - + - distal + - - 5 proximal - + - distal + - - 6 proximal - + - Eye \++ - patch
61 sagittal (Fig. 2.6A) as well as in cross-sections (Fig. 2.6B,D) of E1 and E2. Although both UV opsins are present in the dorsal proximal retina, TmUV I mRNA expression levels appear weaker than TmUV II mRNA expression levels (compare Fig. 2.5C with
Fig. 2,6A, and Fig. 2.6B with D). This is possibly due to the fact that the probe used for detecting TmUV I mRNA is approximately half the length of the probe for TmUV II mRNA or because TmUV I mRNA is present in fewer cells or at lower levels than
TmUV II mRNA. Future protein localization studies should help to clarify this issue.
Opsin mRNA expression in the E1 medial retina
In addition to the distal and proximal retinas in both E1 and E2, E1 also has a third, narrow retina that extends along the median border of the eye tube (Fig. 2.1D). This was originally described as the lateral retina, but since the retina itself is situated along the medial side of the eye, we now refer to this retina as the medial retina. As shown in Fig.
2.7, all three opsin mRNAs are expressed in the E1 medial retina. Fig. 2.7B - E illustrate cross-sections at the approximate location of E1 that is indicated in Fig. 2.7A. As shown with fluorescent staining in Fig. 2.7B, TmLW mRNA is expressed in the most dorsal and ventral portions of the medial retina. TmUV II mRNA, on the other hand, shows a somewhat different staining pattern, being restricted to central parts of the medial retina
(Fig. 2.7C). This is more obvious in Fig. 2.7D, which shows that TmUV II mRNA is localized to the central portion of the medial retina with TmLW mRNA surrounding it from the dorso-lateral and ventro-lateral sides. TmUV I mRNA is also expressed in the medial retina and similarly to the proximal retina, its expression level appears lower than that of TmUV II mRNA expression level (Fig. 2.7E). However, in general, their expression patterns overlap. Another interesting finding from these studies
62 Fig. 2.5. Distribution of opsin mRNAs in the principal eyes as examined by in situ hybridization. In this figure all hybridizations are illustrated on sagittal sections. (A) An over-view histological section which showing the positions of the following in situ images. (B) E1, fluorescent staining of TmLW mRNA illustrating its expression in the distal retina. (C) E1, fluorescent staining of TmUV II mRNA illustrating its expression in the proximal retina. (D) E1, double chromogenic staining of TmLW (purple) TmUV II (brown) mRNAs. (E) E2, double chromogenic staining of TmLW (purple) and TmUV II (brown) mRNAs illustrating primarily the distal retina at larger magnification. (F) E2, double staining for TmLW (purple) and TmUV II (brown) mRNAs illustrating primarily the proximal retina at larger magnification. DRC, retinular cells of the distal retina; PRC, retinular cells of the proximal retina; DRh, >*$ + "1 < 3!!)>=-D, 100 )>H 6 !)"
63 is that we found that the medial retina is contiguous with the proximal retina (Fig. 2.1D), most clearly visible on sagittal sections (Fig. 2.7F). This shows that a band of TmUV II- expressing cells from the medial retina is present on the surface of the LW-expressing distal retina. It is also apparent that the peripheral TmLW-expressing portion of the medial retina arises from the distal retina (Fig. 2.7F, black arrow). This has also been confirmed with fluorescence in situ hybridization (data not shown).
Together, these studies reveal that TmUV I and TmUV II mRNAs are co-expressed in the proximal retinas of E1 and E2, as well as in the central region of the E1 medial retina. TmLW mRNA, in contrast, is highly expressed in the dorsal retinas of E1 and E2, and in the periphery of the E1 medial retina. Thus, LW and UV-sensitive opsins are distinctly separated into different regions of each eye.
Opsin mRNA expression in Eyes 3 – 6
All four secondary eyes are characterized by two retinas, distal and proximal, which in terms of their general organization, are comparable to the distal and proximal retinas of the principal eyes. The general organization of these eyes is illustrated in ethyl gallate stained section in Fig. 2.1A (see E5). As shown in Fig. 2.8, all four secondary eyes exhibit a segregation of opsins similar to the two principal eyes: TmLW mRNA is expressed in the distal retinas and TmUV I mRNA is expressed in the proximal retinas.
In contrast, TmUV II mRNA is not detected anywhere within Eyes 3-6 (data not shown).
TmLW mRNA is found in the retinular cells of the distal retina that are situated on both sides of the distal rhabdom lying beneath the lens (Fig. 2.8A,C,E,G). Fast red staining also shows strong non-specific staining of the lens that is also present in our control preparations (data not shown). As shown in Fig. 2.8B,D,F and H, TmUV I
64 mRNA is expressed in the proximal retinas of secondary eyes, generally in the back of the eyes where the proximal retinular cells are situated. It is absent from the rhabdomeric region (situated underneath the lens), as well as from the eye’s periphery where the distal
TmLW-expressing cells are located. In E3 (Fig. 2.8B) the TmUV I mRNA staining pattern separates into two relatively narrow bands (see Fig. 2.8B, inset).
Fig. 2.6. Distribution of TmUV I and TmUV II mRNAs in the proximal retina of the principal eyes as examined by in situ hybridization. A, sagittal section; B-D, cross- sections through the proximal retina (see inset in B). (A) E1, fluorescent staining of TmUV I mRNA illustrating its expression in the dorsal stack of the proximal retina. (B) E2, fluorescent staining of TmUV I mRNA of a cross-section through the proximal retina as indicated in the inset. Note that the expression is only present in the dorsal stack. (C) E2, fluorescent staining of TmUV I mRNA of a cross-section through the dorsal stack of the proximal retina in higher magnification. (D) E2, fluorescent staining of TmUV II mRNA in a cross-section through the proximal retina. Note the stronger hybridization signal of TmUV II mRNA expression compared with that of TmUV I mRNA in B and C. DRC, retinular cells of the distal retina; PRC, retinular cells of the proximal retina; DRh, distal rhabdom; PRh, proximal rhabdom; n, nuclei. Scale bars: A, B and D, 3!!)>? !)"
65 Opsin mRNA expression in the eye patch
In addition to E1 – 6 on the dorsal surface of each side of the head, a non-lens- containing eye patch is present. Fig. 2.9 illustrates that TmLW and TmUV I are expressed in the eye patch of T. marmoratus but, as in the secondary eyes, TmUV II mRNA is not expressed in this retina (data not shown). Consistent with previous transmission electron microscopy studies showing that the rhabdomeric region of the eye patch is characterized by rhabdoms that wrap around cytoplasmic regions of the retinular cells (Mandapaka et al., 2006), the rhabdomeric region of the eye patch shows some opsin mRNA staining (Fig. 2.9). One significant difference between the eye patch and the secondary eyes, however, is that TmUV I-expressing cells are interspersed at more or less regular intervals with TmLW-expressing cells (Fig. 2.9C). This is also visible in Fig.
2.9B, where the unstained regions in-between the TmUV I-positive cells presumably represent cells that express TmLW mRNA. The alternating stained and unstained regions/cells can also be seen in Fig. 2.9A, although to a lesser extent compared to Fig.
2.9B. Thus, in contrast to all other eyes of these larvae, different opsin mRNAs are expressed in neighboring cells in the eye patch, rather than being physically separated into different retinal tiers.
Discussion
Distribution of opsin mRNAs in the larval eyes of Thermonectus marmoratus
T. marmoratus larvae are characterized by six stemmata and an eye patch. Here, we cloned full-length coding sequences for three distinct opsins using mRNA from these larval heads: one long–wavelength (TmLW) and two UV-wavelength (TmUV I and
66 Fig. 2.7. Distribution of opsin mRNAs in the medial retina E1 as examined by in situ hybridization. A-E are cross-sections through E1; F is a sagittal section (see inset). (A) An over-view histological cross-section through E1 showing the position of the medial retina shown in B-E. (B) fluorescent staining of TmLW mRNA localizing its expression in the dorsal and ventral parts of the medial retina. Note the absence of signal in the central part of the medial retina. (C) fluorescent staining of TmUV II mRNA localizing its expression in the more central parts of the medial retina. (D) double chromogenic staining of TmLW (purple) and TmUV II (brown) mRNAs. Note how purple staining (TmLW mRNA) surrounds the brown staining (TmUV II mRNA) from the dorso-lateral and ventro-lateral sides. (E) fluorescent staining of TmUV I mRNA. Note that the hybridization signal covers a similar region as the expression pattern of TmUV II mRNA (see C). (F) double chromogenic staining of TmLW (purple) and TmUV II (brown) mRNAs in a sagittal section as indicated in the inset. Note the band of UV-expressing tissue (brown) extending along the margin of the distal retina. It appears that the UV-sensitive part of the medial retina is anatomically connected with the UV-sensitive proximal retina. Furthermore, the LW-sensitive part of the medial retina may be an extension of the distal retina (black arrow). ?? I"1 < 6 3!!)>=-E, 50 )"
67 TmUV II). Together, these three opsins account for all regions of the larval head for which photoreceptive cells have previously been identified based on histology
(Mandapaka et al., 2006), as illustrated schematically in Fig. 2.10. Interestingly, in all six stemmata, LW vs UV opsin mRNA expression is clearly separated, closely following morphological distinctions between different retinas. Specifically, the distal retina in all eyes exclusively expresses the TmLW mRNA, whereas the proximal retina of all eyes expresses the ultra-violet TmUV I mRNA. Moreover, we find evidence for the presence of a second UV opsin mRNA (TmUV II) that is uniquely expressed in the scanning principal eyes, E1 and E2, which are used during prey approach (Buschbeck et al.,
2007). To our knowledge, this is the first report of two UV-sensitive opsins expressed in the same stemma in a holometabolous insect. Furthermore, this distribution is in contrast to other arthropods such as jumping spiders and many crustaceans and insects (Kelber,
2006) in which short wavelength-sensitive receptors are distal to long wavelength- sensitive receptors. In fact, to our knowledge, this is the first example of a tiered system with the UV-sensitive cells in the proximal portion. Finally, we find that in the eye spot the patterns of expression of LW and UV I opsins are not spatially separate in clearly distinct regions of the retina, but rather, shows regularly spaced staining with neighboring cells frequently expressing different mRNAs.
Comparison of T. marmoratus opsin subclasses with those of other invertebrates
Although insect photoreceptors can be grouped into four distinct spectral classes with peak sensitivities in ultra-violet (UV), blue (B), blue-green (middle-wavelength,
MW) and green (LW), most insects possess only three distinct classes: UV, B and LW
(Briscoe and Chittka, 2001). However, we failed to identify a B-sensitive opsin in the T.
68 Fig. 2.8. Distribution of TmLW and TmUV I mRNAs in the secondary eyes as examined by fluorescence in situ hybridization. Staining of TmLW mRNA is illustrated in the left panels and TmUV I mRNA in the right panels. Each row is a different eye, as indicated on the left side of the figure. The terms “sagittal” and “cross” refer to the sectional plane of the head. All eyes are shown in cross-sections, except for E4 in C (sagittal) and E6 in H (sagittal). E3 - 5 have comparable arrangements of their retinas with distal retinular cells (DRC) projecting to the periphery on both sides of the rhabdoms, and proximal retinular cells (PRC) extending to the back of the eyes (see Fig. 1, E5). (A, C, E and G) TmLW mRNA is present in the lateral eye region, which is associated with the distal retina. (B, D, F and H) TmUV II mRNA is present in the back of the eyes where the proximal retinular cells are located. In E3 the signal is localized in a relatively small area covering two narrow bands. This is most apparent in the inset in B, which is a section through E3 without the lens. L, lenses. Scale bars: A-J 3!!)"
69 marmoratus larval visual system. There are several possible explanations for this lack of a B opsin. First, it is possible that the loss of the B opsin occurred during the evolution of a lineage to which T. marmoratus belongs. This is supported by the fact that the adult form of the red flour beetle, Tribolium castaneum, also appears to lack the B opsin but expresses one for UV and one for LW (Jackowska et al., 2007). Consistent with this explanation, ERG spectral sensitivity measurements in the adult eye of another beetle,
Tenebrio molitor, peak only in the UV and green ranges (Yinon, 1970). Therefore, it is
Fig. 2.9. Distribution of TmLW and TmUV I mRNAs in the eye patch retina as examined by in situ hybridization. (A) Sagittal head section illustrating the fluorescent hybridization signal for TmLW mRNA in the eye patch retina. (B) Sagittal head section illustrating the fluorescent hybridization signal for TmUV I mRNA in the eye patch retina. (C) Frontal (cross) head section illustrating chromogenic double staining for TmLW (purple) and TmUV I (brown) mRNA in the eye patch retina. Rh, r "1 < = 3!!)>? !)
70 possible that the B opsin was lost prior to the evolution of these three species of
Coleoptera.
An alternative explanation for only identifying two classes of opsins is that only the larval stemmata, but not adult T. marmoratus compound eyes, lack the B-sensitive opsin.
It is not unusual that larval stemmata express fewer receptor classes than adult compound eyes. For instance, photoreceptors in the Bolwig’s organ in Drosophila larvae only express two of the six opsin-encoding genes present in the Drosophila genome: B- sensitive Rh5 and LW-sensitive Rh6 (Malpel et al., 2002), whereas the adult compound eye expresses five of the six opsins which fall into all three clades (UV, B, and
LW). Indeed, it has been recently proposed that UV-expressing cells in the Bolwig’s organ were lost during the evolution of the Drosophila larval eyes (Friedrich, 2008).
Similarly, in T. marmoratus stemmata, B-opsin-expressing photoreceptors might have
Fig. 2.10. Schematic illustration of the spectral sensitivity of the entire T. marmoratus first instar larva visual system based on opsin expression patterns. Rhabdoms are shown as stripped regions. EP, eye patch; MR, medial retina.
71 been lost during the evolution of the larval eyes, or B-sensitive cells switched to UV expression. However, it is worth noting that some holometabolous insects, such as
Papilio and several other lepidopteran species, express all three spectral clades in their larval stemmata (Gilbert, 1994). We do not currently know which opsins are expressed in the compound eye of adult T. marmoratus, but additional physiological and molecular studies involving both larval and adult specimens of a variety of holometabolous insects are likely to shed light on answers to some of these questions.
Presence of two UV-sensitive opsins in T. marmoratus
To our knowledge, this is the first report of the expression of two related but similar opsins within the UV subclass being expressed in the same stemma in a holometabolous insect. Our phylogenetic analysis suggests that the two UV opsins are more closely related to each other than to any of the other UV opsins (including that of T. castaneum), raising the possibility of a relatively recent gene duplication. Interestingly, besides being expressed in the medial retina of E1, TmUV I is present in all T. marmoratus proximal retinas and the eye patch, while TmUV II is only expressed in the proximal retinas of the primary E1 and E2 eyes. In addition, within the E1 and E2 proximal retinas, the distributions of TmUV I and TmUV II are not identical (Fig. 2.6). TmUV I mRNA appears to be weakly expressed only in the dorsal stack of the proximal retinas whereas
TmUV II mRNA is strongly expressed in both stacks of the proximal retinas. Since the retinular cells in this region are densely packed, it is currently not possible to ascertain whether some cells of the dorsal stack of the proximal retinas of the principal eyes violate the “one receptor” rule in sensory neurons (Mazzoni et al., 2004; Mombaerts, 2004). Co- expression of LW and UV opsins has been revealed for another beetle, the flower
72 beetle, Tribolium castaneum, though in compound eyes (Jackowska et al., 2007). Also,
Mazzoni et al. (2008) showed that a small subset of R7 photoreceptors in the Drosophila compound eye co-expresses both UV opsins, Rh3 and Rh4. Opsin co-expression has also been reported in several butterfly species (Arikawa et al., 2003; Awata et al., 2009;
Sison-Mangus et al., 2006). However, the differences in expression patterns we observe for TmUV I and TmUV II suggest the possibility that different sized or shaped photoreceptor subpopulations are present in these retinas which are specialized for different functions. Unfortunately, our in situ preparations do not provide sufficient information to identify the individual cell populations and ascertain their opsin expression. It is also important to note that rhabdoms in this area are characterized by multiple narrow cells (Mandapaka et al., 2006), which could account for this seemingly overlapping expression.
The other retina that expresses both UV mRNAs is in the medial retina of E1 (Fig.
2.7). Here too, we cannot rule out the possibility that these two UV opsins are co- expressed in the same cells. However, the similarities we find between the proximal and medial retina may relate to their tight anatomical connection. In fact, based on opsin expression results, it appears that the central, UV-sensitive part of the medial retina represents an extension of the proximal retina of E1. This is consistent with ultrastructural data, in which rhabdoms of the central part of the medial retina and of the proximal retinas of E1 and E2, appear to be very similar (Mandapaka et al., 2006).
Functional implications
Although the over-all functional organization of T. marmoratus larval eyes is still largely unclear, certain functions are indicated by the distribution of the opsins. First, as
73 mentioned in the introduction, one reason for animals to have multiple, sequentially- arranged retinas (or multiple layers of a single retina) is to compensate for lens chromatic aberration (Blest et al., 1981; Land, 1969). However, for this mechanism to work, photoreceptor cells closer to the lens must be sensitive to more strongly refracted, shorter wavelengths while deeper photoreceptor layers would be excited by less strongly refracted, longer wavelengths. This is not the case for T. marmoratus in which all the layers of the distal retinas of the principal eyes express the same LW opsin. The implication of this finding is that the sharpest image that is sampled by the photoreceptors of this retina is influenced primarily by the distance of a viewed object, with minimal contribution of chromatic aberration. Moreover, our data suggest that the sequence of the two retinas in T. marmoratus larval eyes follows a pattern contrary to what would be expected from lens chromatic aberration, with long wavelength receptors being closer to the lens than short wavelength receptors. Therefore it is unlikely that this arrangement compensates for lens chromatic aberration. Instead, our data suggest that any lens with a single focal plane would be unable to sharply focus any object at a given distance onto both retinas.
A second functional implication of the opsin distribution is that the distal retina may filter out UV light that would otherwise excite the proximal retina. Since LW opsins typically have a !I (Stavenga et al., 1993), it is unclear how much of the UV light remains to excite the proximate retina. Typically, invertebrate rhabdomeric photoreceptors absorb ~1% of the incident light per 1 )% (Land and
Nilsson, 2002). Although it is unclear how well this value fits for the highly unusual orthogonally oriented retinular cells found in the T. marmoratus stemmata, it is expected
74 that at least half of the UV light should pass the ~50µm-thick distal retina. It also remains unclear if sufficient light is absorbed by individual layers of the distal retina for photoreceptors to function independently. Several photoreceptors may have to be pooled in order to absorb sufficient light to function. However, it is noteworthy that these larvae live in shallow water in the southwestern United States, where light levels are frequently very high.
Many of the functional aspects rest upon just which wavelengths are absorbed by each of the three opsins, which, at this point, remains unclear. Nevertheless the unusual sequence of LW-sensitive photoreceptors followed by UV-sensitive photoreceptors further supports the idea that the eyes of these highly efficient, visually guided predators function in a novel, but as yet undescribed, way.
Acknowledgements
We thank Dr Stephanie Rollmann for her advice and for allowing us to use some of her equipment. Randy Morgan provided assistance in rearing diving beetles and the
Cincinnati Zoo and Botanical Garden provided the original population of Sunburst
Diving Beetles. Drs. Ilya Vilinsky and John Layne as well as Premraj Raikumar provided helpful discussions. We also thank John Galvin for assistance with this manuscript. This material is based upon work supported by the National Science
Foundation under Grant No. 0545978 to E. K. B., and the Research to Prevent Blindness
Foundation to T. C.
75 References
Arikawa, K., Inokuma, K. and Eguchi, E. (1987). Pentachromatic visual system in a butterfly. Naturwissenschaften 74, 297-298.
Arikawa, K., Mizuno, S., Kinoshita, M. and Stavenga, D. G. (2003).
Coexpression of two visual pigments in a photoreceptor causes an abnormally broad spectral sensitivity in the eye of the butterfly Papilio xuthus. J. Neurosci. 23, 4527-4532.
Awata, H., Wakakuwa, M. and Arikawa, K. (2009). Evolution of color vision in pierid butterflies: blue opsin duplication, ommatidial heterogeneity and eye regionalization in Colias erate. J. Comp. Physiol. A 195, 401-40
Blest, A. D., Hardie, R. C., McIntyre, P. and Williams, D. S. (1981). The spectral sensitivities of identified receptors and the function of retinal tiering in the principal eyes of a jumping spider. J Comp Physiol A 145, 227-239.
Briscoe, A. D. (2000). Six opsins from the butterfly Papilio glaucus: molecular phylogenetic evidence for paralogous origins of red-sensitive visual pigments in insects. J
Mol Evol 51, 110-121.
Briscoe, A. D., Bernard, G. D., Szeto, A. S., Nagy, L. M. and White, R. H.
(2003). Not all butterfly eyes are created equal: rhodopsin absorption spectra, molecular identification, and localization of ultraviolet-, blue-, and green-sensitive rhodopsin- encoding mRNAs in the retina of Vanessa cardui. J Comp Neurol 458, 334-49.
Briscoe, A. D. and Chittka, L. (2001). The evolution of color vision in insects.
Annu Rev Entomol 46, 471-510.
76 Buschbeck, E. and Friedrich, M. (2008). Evolution of insect eyes: tales of ancient heritage, deconstruction, reconstruction, remodeling, and recycling. Evolution: Education and Outreach 1, 448-462.
Buschbeck, E., Sbita, S. and Morgan, R. (2007). Scanning behavior by larvae of the predacious diving beetle, Thermonectus marmoratus (Coleoptera: Dytiscidae) enlarges visual field prior to prey capture. J Comp Physiol A 193, 973-982.
Cronin, T. W. and Marshall, N. J. (1989). Multiple spectral classes of photoreceptors in the retinas of gonodactyloid stomatopod crustaceans. J Comp Physiol A
166, 261-275.
Feiler, R., Bjornson, R., Kirschfeld, K., Mismer, D., Rubin, G. M., Smith, D. P.,
Socolich, M. and Zuker, C. S. (1992). Ectopic expression of ultraviolet-rhodopsins in the blue photoreceptor cells of Drosophila: visual physiology and photochemistry of transgenic animals. J Neurosci 12, 3862-3868.
Feiler, R., Harris, W. A., Kirschfeld, K., Wehrhahn, C. and Zuker, C. S. (1988).
Targeted misexpression of a Drosophila opsin gene leads to altered visual function.
Nature 333, 737-741.
Felsenstein, J. (1985 ). Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783-791.
Friedrich, M. (2008). Opsins and cell fate in the Drosophila Bolwig organ: tricky lessons in homology inference. Bioessays 30, 980-93.
Gao, N., Foster, R. G. and Hardie, J. (2000). Two opsin genes from the vetch aphid, Megoura viciae. Insect Mol Biol 9, 197-202.
77 Gartner, W. and Towner, P. (1995). Invertebrate visual pigments. Photochem
Photobiol 62, 1-16.
Gilbert, C. (1994). Form and function of stemmata in larvae of holometabolous insects. Annu Rev Entomol 39, 323-349.
Ichikawa, T. and Tateda, H. (1982). Distribution of color receptors in the larval eyes of four species of lepidoptera. J Comp Physiol A 149, 317-324.
Jackowska, M., Bao, R., Liu, Z., McDonald, E., Cook, T. and Friedrich, M.
(2007). Genomic and gene regulatory signatures of cryptozoic adaptation: Loss of blue sensitive photoreceptors through expansion of long wavelength-opsin expression in the red flour beetle Tribolium castaneum. Frontiers in Zoology 4, 24.
Kelber, A. (2006). Invertebrate colour vision. In Invertebrate vision (ed. E. Warrant and D.-E. Nilsson), pp. 250-290. New York: Cambridge University Press.
Land, M. F. (1969). Structure of the retinae of the principal eyes of jumping spiders (Salticidae: Dendryphantinae) in relation to visual optics. J Exp Biol 51, 443-470.
Land, M. F. and Nilsson, D.-E. (2002). Animal eyes. New York: Oxford
University Press.
Liu, Z. and Friedrich, M. (2004). The Tribolium homologue of glass and the evolution of insect larval eyes. Dev Biol 269, 36-54.
Malpel, S., Klarsfeld, A. and Rouyer, F. (2002). Larval optic nerve and adult extra-retinal photoreceptors sequentially associate with clock neurons during Drosophila brain development. Development 129, 1443-1453.
78 Mandapaka, K., Buschbeck, E. and Morgan, R. (2006). Twenty-eight retinas but only twelve eyes: an anatomical analysis of the larval visual system of the diving beetle
Thermonectus marmoratus (Coleoptera: Dytiscidae). J Comp Neurol 497, 166-181.
Mazzoni, E. O., Celik, A., Wernet, M. F., Vasiliauskas, D., Johnston, R. J.,
Cook, T. A., Pichaud, F. and Desplan, C. (2008). Iroquois complex genes induce co- expression of rhodopsins in Drosophila. PLoS Biology 6, e97.
Mazzoni, E. O., Desplan, C. and Celik, A. (2004). 'One receptor' rules in sensory neurons. Dev Neurosci 26, 388-395.
McIntyre, P. and Kirschfeld, K. (1982). Chromatic aberration of a dipteran corneal lens. J. Comp. Physiol. A 146, 493-500.
Mombaerts, P. (2004). Odorant receptor gene choice in olfactory sensory neurons: the one receptor-one neuron hypothesis revisited. Curr Opin Neurobiol 14, 31-36.
Paul, R., Steiner, A. and Gemperlein, R. (1986). Spectral sensitivity of
Calliphora erythrocephala and other insect species studied with Fourier Interferometric
Stimulation (FIS). J Comp Physiol A 158, 669-680.
Paulus, H. F. (1979). Eye structure and the monophyly of the Arthropoda. In
Arthropod phylogeny (ed. A. P. Gupta), pp. 299-384. New York: Van Nostrad Reinhold.
Popp, M. P., Grisshammer, R., Hargrave, P. A. and Smith, W. C. (1996). Ant opsins: sequences from the Saharan silver ant and the carpenter ant. Invert Neurosci 1,
323-329.
Porter, M. L., Cronin, T. W., McClellan, D. A. and Crandall, K. A. (2007).
Molecular characterization of crustacean visual pigments and the evolution of pancrustacean opsins. Mol Biol Evol 24, 253-268.
79 Rose, T. M., Schultz, E. R., Henikoff, J. G., Pietrokovski, S., McCallum, C. M. and Henikoff, S. (1998). Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences. Nucleic Acids Res 26, 1628-35.
Rossel, S. (1979). Regional differences in photoreceptor performance in the eye of the praying mantis. J Comp Physiol A 131, 95-112.
Saitou, N. and Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4, 406-425.
Sakamoto, K., Hisatomi, O., Tokunaga, F. and Eguchi, E. (1996). Two opsins from the compound eye of the crab Hemigrapsus sanguineus. J Exp Biol 199, 441-450.
Salcedo, E., Huber, A., Henrich, S., Chadwell, L. V., Chou, W.-H., Paulsen, R. and Britt, S. G. (1999). Blue- and green-absorbing visual pigments of Drosophila: ectopic expression and physiological characterization of the R8 photoreceptor cell- specific Rh5 and Rh6 rhodopsins. J Neurosc. 19, 10716-10726.
Sison-Mangus, M. P., Bernard, G. D., Lampel, J. and Briscoe, A. D. (2006).
Beauty in the eye of the beholder: the two blue opsins of lycaenid butterflies and the opsin gene-driven evolution of sexually dimorphic eyes. J. Exp. Biol. 209, 3079-3090.
Smith, W., Ayers, D., Popp, M. and Hargrave, P. (1997). Short wavelength- sensitive opsins from the Saharan silver and carpenter ants. Invert Neurosci 3, 49-56.
Smith, W. C., Price, D. A., Greenberg, R. M. and Battelle, B. A. (1993). Opsins from the lateral eyes and ocelli of the horseshoe crab, Limulus polyphemus. Proc Natl
Acad Sci USA 90, 6150-6154.
80 Stavenga, D. G., Smits, R. P. and Hoenders, B. J. (1993). Simple exponential functions describing the absorbance bands of visual pigment spectra. Vision Res 33,
1011-1017.
Strausfeld, N. J. and Seyan, H. S. (1985). Convergence of visual, haltere, and prosternal inputs at neck motor neurons of Calliphora erythrocephala. Cell Tissue Res
240, 601-615.
Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007). MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24, 1596-
1599.
Toh, Y. and Mizutani, A. (1987). Visual-system of the tiger beetle (Cicindela chinensis) larva .1. structure. Zoological Science 4, 974-974.
Toh, Y. and Mizutani, A. (1994). Structure of the visual system of the larva of the tiger beetle (Cicindela chinensis). Cell Tissue Res 278, 125-134.
Toh, Y. and Okamura, J. Y. (2007). Morphological and optical properties of the corneal lens and retinal structure in the posterior large sternma of the tiger beetle larva.
Vision Res 47, 1756-1768.
Townson, S. M., Chang, B. S. W., Salcedo, E., Chadwell, L. V., Pierce, N. E. and Britt, S. G. (1998). Honeybee blue- and ultraviolet-sensitive opsins: cloning, heterologous expression in Drosophila, and physiological characterization. J Neurosci 18,
2412-2422.
Wang, J. K., McDowell, J. H. and Hargrave, P. A. (1980). Site of attachment of
11-cis-retinal in bovine rhodopsin. Biochemistry 19, 5111-7.
81 White, R. H., Brown, P. K., Hurley, A. K. and Bennett, R. R. (1983).
Rhodopsins, retinula cell ultrastructure, and receptor potentials in the developing pupal eye of the moth Manduca sexta. J Comp Physiol A 150, 153-163.
Yinon, U. (1970). The visual mechanisms of Tenebrio molitor: some aspects of the spectral response. J Exp Biol 53, 221-229.
Zeiger, J. and Goldsmith, T. H. (1994). Behavior of crayfish rhodopsin and metarhodopsin in digitonin: the 510 and 562 nm "visual pigments" are artifacts. Vision
Res 34, 2679-2688.
Zuckercandl, E. and Pauling, L. (1965). Evolutionary divergence and convergence in proteins. In Evolving Genes and Proteins (ed. V. Bryson and H. J. Vogel), pp. 97-165. New York: Academic Press.
82 Chapter 3
The spectral sensitivity of the principal eyes of the Sunburst Diving Beetle
Thermonectus marmoratus (Coleoptera: Dytiscidae) larva
Srdjan Maksimovic, John E. Layne and Elke K. Buschbeck*
Department of Biological Sciences, University of Cincinnati, Cincinnati, OH 45221-0006,
USA
* Author for correspondence (e-mail: [email protected])
83 Abstract
Larvae of the sunburst diving beetle, Thermonectus marmoratus, bear six eyes
(stemmata) on each side of their head. The frontal pair, known as the principal eyes, is among the most unusually built eyes in the animal kingdom. They form relatively long tubes, have bifocal lenses and are characterized by at least two one-dimensional retinas at their ends: a deep distal retina closer to the lens, and a proximal retina that lies directly underneath. A recent study revealed that in first instar larvae, the distal retina is long- wavelength (LW)-sensitive and the proximal retina is ultra-violet (UV)-sensitive. This arrangement, which is to our knowledge, the first example of a tiered system with the
LW-sensitive cells distal to the UV-sensitive cells, could establish the distal retina to act as a contrast filter for the proximal retina. If this is true, the spectral sensitivity of the proximal retina should be narrower than the absorbance curve modeled by a visual pigment template. Using cloning and in situ hybridization in third instar larvae we show that the distal retina expresses a long-wavelength sensitive opsin (TmLW) and the proximal retina an ultraviolet sensitive opsin (TmUV II). To measure spectral sensitivity of individual cells in third instars, we used intracellular recordings and neurobiotin injections. We found that cells of the proximal retina have a sensitivity that peaks in UV at 374 nm, with the spectral sensitivity curve matching well (R2 = 0.991) the predicted sensitivity of a single opsin. We furthermore succeeded in briefly recording from a few of the smaller cells in the distal retina. The spectral response curve of the distal retina shows maximum sensitivity in green with peak absorbance approximately 520-540 nm.
The curve has also a smaller peak in UV, around 340-360 nm. Although the distal retina shows sensitivity to UV, our results do not suggest that the distal retina acts as a contrast
84 filter for the proximal retina. The spectral sensitivity curve of the proximal retina is not narrow and fits very well with the predicted absorbance of a single opsin. The correlation between our data and the opsin template prediction is very strong (R2 = 0.991), indicating that the contribution of the distal retina to the sensitivity curve of the proximal retina must be small to negligible. Therefore, our results do not suggest that the distal retina acts as a contrast filter for the proximal retina.
85 Introduction
Functional investigations of the larval eyes of holometabolous insects, known as stemmata, have been dominated by research focusing on the powerful visual capabilities of compound eyes found in adults. However, recent research on insect stemmata, although scarce, suggests that the functional complexity of some larval stemmata rivals the one found in adult compound eyes (Gilbert, 1994). Indeed, many insect species have very simple larval photoreceptor organs (such as in many dipterans), but some species are characterized with very sophisticated camera-type eyes, such as those found in the tiger beetle Cincindela chinensis (Toh and Mizutani, 1987; Toh and Mizutani, 1994; Toh and
Okamura, 2007). In this context, the principal eyes of the Sunburst Diving Beetle larvae
(Thermonectus marmoratus) represent an extreme. They possess a highly unusual functional organization suggesting that they might be capable of very complex visual tasks that other known eyes are not. Only rarely is an eye discovered that diverges so much from basic eye design principles, yet such exceptions can lead to exciting new discoveries and advancements in visual science.
The sunburst diving beetle, Thermonectus marmoratus, is an aquatic beetle native to the southwest United States. They have three larval instars, all of which are visually guided predators with 12 eyes, six on each side of the head (Fig. 3.1A,B). Each of these eyes has at least two distinct, tiered regions of retinular cells that constitute a distal and proximal retina (Maksimovic et al., 2009; Mandapaka et al., 2006). Most unusual are the forward-pointing principal eyes, eye 1 (E1) and eye 2 (E2), that share many anatomical characteristics (Fig. 3.1C). Both are tubular in design and point upward at an angle of about 35° from the horizontal plane. The distal retina is situated below the cylindrical
86 crystalline cone-like structure, and is formed by retinular cells oriented orthogonally to the axis of incoming light (Fig. 3.1C,D). This is unlike the structure of any known eye as the photoreceptors are in general aligned with the light axis. Twelve or moreorthogonal cell layers stacked on top of each other on both, the dorsal and ventral eye side, together form the distal rhabdom. Below the distal retina lies the proximal retina formed of two horizontal rows of photoreceptor cells with rhabdoms that are parallel with the incoming light axis (Fig. 3.1C,D). Both of the retinas have
Fig. 3.1. Principal eyes (E1 and E2) of the third instar larvae of T. mamoratus. (A) Lateral view of the head showing all six eyes. (B) Fronto-dorsal view fo the head showing only the principal eyes, E1 and E2. (C) Sagittal section of E1 and E2. Microelectrodes were advanced through E6. Inset shows the appearance of the first instar principal eyes in the same sectional plane. Scale bars are identical, 200 µm. (D) Schematic illustration of the principal eye appearance in two different planes, a- horizontal, b-sagittal (as in C). Note the two rows of the proximal retina rhabdoms and the orthogonal distal rhabdoms (stripes). L, lens; CC, crystalline cone; DRh, distal rhabdom; DRC, distal cell bodies; PRh, proximal rhabdom; PRC, proximal cell bodies. Scale bars: A-C, 200 µm.
87 extremely narrow visual fields that extend only in the horizontal plane. The larvae perform vertical head movements to increase the narrow visual fields. Behavioral experiments have revealed that E1 and E2 are used to scan potential prey prior to capture
(Buschbeck et al., 2007). The success of this predatory behavior probably lies in different but coordinated tasks of the two retinas. A division of tasks is not unusual in visual systems, and has been found in animals with multiple eyes, such as jellyfish and spiders, where different eyes serve different tasks (Land and Nilsson, 2002; Nilsson et al.,
2005). But more importantly, task specialization can be present within a single eye, such as the specialized dorsal rim area for polarized light detection in dipterans. Even within a single ommatidium different photoreceptors can mediate different tasks. For example, in flies color vision is mediated by an ommatidium’s central pair of photoreceptors, R7 and
R8.
One of the key questions for understanding the potential task specialization of the two retinas of the principal eyes is their spectral sensitivity. Spectral sensitivity can give clues about the nature and complexity of the visual tasks performed by a certain retina. A recent ultrastructural study of the proximal retina has shown that the proximal retina has a potential for polarization sensitivity (Stecher et al., 2010). Polarization sensitivity in insects is most often mediated by UV sensitive receptor cells (Horvath and Varju, 2004).
We have recently cloned two opsins from the proximal retina of the first instar larvae and, indeed, both of these opsins are predicted to be UV sensitive (Maksimovic et al., 2009).
More interestingly, it appears that the distal retina expresses only one opsin predicted to be LW sensitive (Maksimovic et al., 2009). This arrangement, which is to our knowledge, the first example of a tiered system with the LW-sensitive cells distal to the UV-sensitive
88 cells, could establish the distal retina to act as a contrast filter for the proximal retina.
Contrast filters increase the monochromatic contrast by introducing brightness differences between colors that would ordinarily reproduce as similar shades. The absorbance of LW-sensitive opsins is characterized by two and the smaller ! band. The !
I (max M5 ! !-peak wavelength varies in general between 330 and 360 nm (Stavenga et al., 1993). Although typical absorbance of the ! band is relatively small, 1/5 to 1/4 that of (Stavenga et al., 1993), the distal retina has at least twelve photoreceptor layers stacked on top of each other.
Therefore, by absorbing in the UV range, the LW sensitive distal retina can potentially sharpen the absorbance of the UV sensitive proximal retina and increase the contrast of the image sampled by the proximal retina. All of this, of course, depends on the absorption spectrum of the two retinas, whose characterization is the main goal of this study.
We recently examined the spatial expression patterns of opsin transcripts in the first instar larvae of T. marmoratus (Maksimovic et al., 2009). We found that, in the principal eyes, the distal retina expresses one opsin, TmLW, predicted to be long-wavelength (LW) sensitive. The proximal retina, on the other hand, expresses two opsins, TmUV I and
TmUV II, predicted to be ultra-violet (UV) sensitive. In this study we examine opsin expression patterns in the principal eyes of the third instar larvae. Since the spectral sensitivity prediction is based on sequence data only, here we also use intracellular recordings from photoreceptor cells to directly measure spectral sensitivity of the distal and proximal retina of the third instar larvae principal eyes. Unlike in our previous study
89 (Maksimovic et al., 2009) where we examined opsin expression patterns in first instars, here we use third instars. Since third instars are approximately three times as big as first instars (~3 cm compared to ~1 cm, in length), handling of animals and performing intracellular recordings should be easier on third instars. Apart from the relative proportions of some of the tissues (especially the two retinas) the general anatomical organization of the principal eyes in third instars does not appear obviously different from the one in first instars (Mandapaka et al., 2006) (see Fig. 3.1C, inset). In stemmata, intracellular measurements of spectral sensitivity have been done only on several lepidopteran species. Therefore, this study would not only help us to better understand the unusual organization of the T. marmoratus larval principal eyes, but also the visual processing in insect stemmata in general.
Materials and Methods
Animals
Adult and larval T. marmoratus Gray 1832 specimens, reared in our lab throughout the year, were offspring of the beetles provided by the Insectarium of the Cincinnati Zoo and Botanical Gardens, or from beetles collected in August 2004 near Tucson, AZ, USA.
Adults were kept in fresh water aquariums at room temperature (RT) and fed daily with freshly killed crickets. After hatching, T. marmoratus first instar larvae were separated from adults and fed with live mosquito larvae and previously frozen blood worms until they developed into third instars. All experiments were performed on third instar larvae only.
90 Fluorescence in situ hybridization
In situ hybridization was performed using probes made against opsin mRNA sequences (TmLW, TmUV I and TmUV II) cloned in T. marmoratus first instar larvae
(Maksimovic et al., 2009). The procedure was identical to the one described in
Maksimovic et al. (2009), except in this study we used third instar larvae and focused only on the opsin expression patterns in the distal and proximal retina of the principal eyes, E1 and E2.
Electrophysiology
Animal preparation, intracellular recordings, and neurobiotin iontophoresis
Animals were first anesthetized by chilling on ice and then immobilized by pouring a warm 2% agarose gel over the entire animal. After hardening, agarose was removed from the front of the head and mandibles were waxed to the bottom of a plastic dish which was afterwards filled with insect ringer. Whole animal was immersed in insect ringer except the abdomen tip which is used by the animal to breathe in air. In order to reach photoreceptor cells placed deep within the head, the lens was removed from eye 6 through which the microelectrode was advanced. This allowed us to make a small opening in the head cuticle, without excessively injuring the animal. Recordings were performed inside of a Faraday cage, on the TMC 66-501 vibration isolation table
(Technical Manufacturing Corporation, Peabody, MA, USA). A silver wire that served as the reference electrode was dipped in the insect ringer. Intracellular recordings and neurobiotin injections were performed by using glass microelectrodes, 1 mm x 0.58 mm,
(A-M Systems, Inc., Sequim, WA, USA) pulled with a Sutter Instrument P-97 horizontal
91 puller (Sutter Instrument Co., Novato, CA, USA). The microelectrodes were filled with
1 % neurobiotin (Vector Laboratories, Inc., Burlingame, CA, USA) in 3M KCl, and backed up with 3M KCl separated by an air bubble. Electrode resistances varied from 60 to 130 M;when measured in insect ringer. After positioning the tip of the microelectrode in front of the opening in the head/eye 6, lights were switched off and the rest of the procedure was performed in dark, to minimize the effect of light adaptation.
Successful photoreceptor penetration was first identified by a drop in voltage potential usually to -40 to -60 mV, and then by testing the cell responsiveness to brief light flashes.
After recordings, the cells were injected iontophoretically with neurobiotin by passing depolarizing current of 2-3 nA for ~15 min. Intracellular recordings and neurobiotin iontophoresis were performed using standard electrophysiological equipment including an A-M Systems Neuroprobe amplifier 1600 (A-M Systems, Inc., Sequim, WA, USA),
Tektronix oscilloscope 5111A (Tektronix, Inc., Beaverton, OR, USA), iWorks AD board
118 (iWorks Systems, Inc., Dover, NH, USA) and A-M systems audio monitor 3300 (A-
M Systems, Inc., Sequim, WA, USA). Data were stored onto a PC computer using iWorks LabScribe software (iWorks Systems, Inc., Dover, NH, USA), and analyzed using a custom made code in MATLAB (The MathWorks, Inc., Natick, MA, USA).
Monochromatic stimulation
Monochromatic light stimuli were generated using an Oriel Apex 70525
Monochromater Illuminator with 150W Xenon arc lamp (Oriel Instruments, Stratford, CT,
USA) coupled with an Oriel Cornerstone 130 1/8 m 74000 monochromator (Oriel
Instruments, Stratford, CT, USA). Light intensity was controlled with a Newport circular
92 variable neutral density filter 50G00AV.2 (Newport Corporation, Irvine, CA, USA) mounted onto Newport NSR-12 motorized rotator stage (Newport Corporation, Irvine,
CA, USA) with a Newport NewStep Controler NSC200 (Newport Corporation, Irvine,
CA, USA) and placed behind the output slit of the monochromator. The duration of the stimulus was controlled with a Uniblitz VCM-D1 shutter (Uniblitz, Rochester, NY, USA) which was placed in front of an UV-VIS optical fiber, M: 78278 with 1mm core diameter
(Newport Corporation, Irvine, CA, USA), that led the light into the Faraday cage. Before entering the optical fiber, light was focused on the tip of the fiber using a single converging lens (f = 10 cm). The other end of the optical fiber was immersed in insect ringer and positioned 1-2 mm in front of the animal’s head/principal eyes.
To induce spectral responses we used monochromatic equiquantal light flashes ranging from 300 to 640 nm in 20 nm steps. The light intensity was measured with an
Ocean Optics USB2000+ spectrometer (Ocean Optics, Inc., Dunedin, Fl, USA). The intensity at the tip of the optical fiber was set to 6.5 x 1012 photons/cm2/s. Before the monochromatic stimulation, for each used wavelength, we determined the rotator stage positions for the neutral density filter that resulted in the light intensity mentioned above.
During intracellular recording, for each wavelength, the filter position was adjusted to maintain equiquantal flashes of light. After a successful penetration we recorded responses starting with 300 nm toward 640 nm light in 20 nm steps. To control for stability in our recording, for each cell we acquired a second set of measurements by stimulating in the opposite direction, starting with 640 nm and moving toward 300 nm.
The average of the two traces was included in further analysis. The time interval in- between the two consecutive flashes was 10 s and monochromatic flashes were 30 ms
93 long. This was the shortest stimulation that gave us approximately the same response amplitude as the ones elicited by longer stimulations, and the time interval allowed receptors to return to the baseline.
After spectral response stimulation we measured the response-stimulus intensity (V- logI) function at the peak wavelength. We recorded responses ranging from ~2 x 1011 to
~3.5 x 1014 photons/cm2/s in 0.25 log steps. Recorded responses were fitted to the
n n n hyperbolic Naka-Rushton (NR) function (Naka and Rushton, 1966), V/Vmax = I /(I + K ), where V is the response amplitude, Vmax is the maximum response amplitude, I is the stimulus intensity, K is the stimulus intensity eliciting Vmax/2, and n is the slope of the function. The best fit to the NR function was taken to extrapolate the V-logI functions for other wavelengths and to determine the spectral sensitivity as normalized reciprocals of photon numbers needed to elicit equal response amplitudes at all wavelengths. The spectral sensitivity data was fitted to the Govardovskii et al. (2000) rhodopsin absorption template, with a use of the MATLAB (The MathWorks, Inc., Natick, MA, USA) fminsearch function.
Histology
Ethyl Gallate staining
Ethyl Gallate stained sections were prepared using a protocol by Strausfeld and
Seyan (Strausfeld and Seyan, 1985) with some minor modifications, as described in
Mandapaka et al. (2006). After staining heads were dehydrated, embedded in Ultra-Low
Viscosity Embedding Medium (Polysciences, Warrington, PA, USA) and serially sectioned at 8 µm.
94 Neurobiotin tracing
After iontophoresis of neurobiotin the animals were kept for ~1 hour at 4°C to allow for tracer diffusion. The heads were cut off and fixed in 4% paraformaldehyde solution (Electron Microscopy Sciences, Hatfield, PA, USA) in 0.2 M Sorensen’s buffer
(Electron Microscopy Sciences, Hatfield, PA, USA) overnight at 4°C. After washing in
Sorensen’s buffer for at least 8 h at RT, the tissue was dehydrated through an ethanol series, washed in propylenoxide for ~15 min, and rehydrated. This latter procedure rendered the tissue more porous, allowing for a better penetration of streptavidin. The tissue was then incubated with streptavidin conjugated with Alexa Fluor 568 (Life
Technologies Corporation, Carlsbad, CA, USA) diluted 1:200 (working concentration 0.5
) 0 1 R%% 1% Triton X-100 overnight at RT. After washing with
Sorensen’s buffer overnight at RT, the decapitated heads were dehydrated, embedded in
Ultra-Low Viscosity Embedding Medium (Polysciences, Warrington, PA, USA), serially sectioned at 15 µm, and mounted using Fluoromount-G (SouthernBiotech, Birmingham,
AL, USA). Fluorescence images were taken using the Zeiss LSM 510 laser scanning confocal microscope (Carl Zeiss AG, Oberkochen, Germany), and adjusted for brightness and contrast with Adobe Photoshop CS3 (Adobe Systems Incorporated, San Jose, CA,
USA).
Results
To better understand spectral sensitivity of the principal eyes, we used RNA in situ hybridization and electrophysiological intracellular recordings. First, by performing
RNA in situ hybridization using probes made against three opsin sequences
95 Fig. 3.2. Distribution of opsin mRNAs in the principal eyes as examined by in situ hybridization. In this figure all hybridizations are illustrated on sagittal sections. (A) An over-view histological section which showing the positions of the following in situ images. (B) E2, fluorescent staining of TmLW mRNA illustrating its expression in the distal retina. (C) E1, fluorescent staining of TmLW mRNA illustrating its expression in the distal retina. (D) E2, fluorescent staining of TmUV I mRNA illustrating its expression in the proximal retina. (E) E1, fluorescent staining of TmUV I mRNA illustrating its expression in the proximal retina. DRC, retinular cells of the distal retina; PRC, retinular cells of the proximal retina; DRh, distal rhabdom; PRh, proximal rhabdom. Scale bars: A-E, 1!!)"
96 cloned in first instar larvae (TmLw, TmUV I and Tm UV II), we determined which opsins are expressed in the distal and proximal retina of the principal eyes in third instars.
Second, by using electrophysiology and intracellular recording techniques, we directly measured spectral sensitivity of photoreceptor cells from the distal and proximal retina of the third instar larvae principal eyes.
Fluorescence in situ hybridization
Out of the three opsins cloned in the T. marmoratus first instar larvae, we located expression of the two mRNAs, TmLW and TmUV II, in the distal and proximal retina of the third instar larvae principal eyes (Fig. 3.2). As shown by fluorescent in situ hybridization, the distal retina, more specifically cell bodies of the distal retina (DRC) of both principal eyes express TmLW mRNA (DRC, Fig. 3.2B,C), whereas cell bodies of the proximal retina (PRC) express TmUV II mRNA (PRC, Fig. 3.2D,E). As expected, the rhabdomeric regions of each retina (DRh and PRh) do not stain well with any of the opsin probes, leaving fairly translucent regions in the centers. We did not find signs of
TmUV I mRNA expression in neither of the two retinas in the third instar larvae principal eyes.
Spectral Sensitivities
Proximal retina
As in other invertebrates (Hardie and Raghu, 2001) the photoreceptors of the proximal retina responded with a graded depolarizing receptor potentials to light stimuli with a faster rising and a slower falling phase. This can be seen in the inset of Fig. 3.3A
97 that shows one impulse-response to a 360 nm light flash, with an amplitude of 19 mV.
The amplitude of this impulse-response is also shown in Fig. 3.3A that illustrates a typical intracellular recording which contains traces of the two spectral responses
(300>640 nm and 640>300 nm) to monochromatic stimuli and an average of the two.
The latter was used for further analysis. This cell has a peak response at 360 nm, which was the case with most of the cells of the proximal retina. Therefore, for the cells of the proximal retina, the V-logI function was measured at 360 nm. The V-logI response and the best fit to the Naka-Rushton (NR) function for this unit is shown in Fig. 3.3B. After
Fig. 3.3. Measurements of the proximal retina spectral sensitivity. (A) Traces of two spectral responses and their average recorded from one unit. Responses elicited by a series of equiquantal monochromatic flashes (6.5 x 1012 photons/cm2/s) of light in steps of 20 nm. Inset shows a waveform of a single response to a 30 ms flash of 360 nm. (B) V-logI function at 360 nm recorded from the same unit as in A with the best fit of the Naka-Rushton (NR) function. V-logI function was recorded over a range from ~2 x 1011 to ~3.5 x 1014 photons/cm2/s in 0.25 log steps. (C) Average spectral sensitivity from 12 units from the proximal retina. (D) The rhodopsin absorbance model from Govardovskii et al. (2000) (red line) gave the best fit to our data (circles) with peak absorbance at 374 nm and correlation R2 = 0.983.
98 measuring the spectral response and the V-logI function for the total of 12 cells from the proximal retina, its spectral sensitivity curve was reconstructed (Fig. 3.3C). The curve has a maximum response at 360 nm with no apparent additional peaks or shoulders. The spectral sensitivity curve was modeled with the Govardovskii et al. (2000) rhodopsin template, which was fitted to our experimental data using the MATLAB fminsearch function. For the cells of the proximal retina the model gave the peak absorbance at (max
= 374 nm with the half-width of 75 nm (Fig. 3.3D). The model correlates well with our experimental data with R2 = 0.983, although the model curve is slightly narrower
Fig.Fi 3.4.3 4 EffectEff t of f self-screening lf i addition dditi to t the th rhodopsin h d i absorbance b b template. t l t ByB including self-screening into the modeling procedure with the Govardovskii et al. (2000) rhodopsin template, a further increase in goodness of fit is seen. Adding k = 0.009 )-1 P % %% /3!!)ceptor length in third instars) broadens the template curve and improves the fit between the model and the data. The half-width increases from 75 nm without self-screening correction, to 88 nm with self-screening correction. Correspondingly, there is an increase in the correlation coefficient from R2 = 0.983 to R2 = 0.991.
99 compared to our experimental results. A further increase in goodness of fit can be achieved by adding self-screening to the opsin template (Warrant and Nilsson, 1998), which effectively broadens the sensitivity curve. This effect is more pronounced in long photoreceptors, in which the peak wavelength is completely absorbed at the distal photoreceptor end. Only non-peak wavelengths with much lower absorption rates reach the proximal photoreceptor end. This leads to a broader photoreceptor spectral sensitivity than that predicted from an opsin template. Self-screening depends on two parameters: k, the absorption coefficient, and l, the length of the photoreceptors. One of the typical values for invertebrate self-screening coefficient, k, is 0.009 )-1 (Warrant and Nilsson,
1998) and the photoreceptor length in the proximal retina of the third instar larvae
3!!)" By adding self-screening into calculation (see Warrant and Nilsson, 1998) with k = 0.009 )-1 /3!!) , which increases the fit substantially (Fig. 3.4). The half-width increases from 75 nm without self-screening correction, to 88 nm with self-screening correction.
Correspondingly, there is an increase in the correlation coefficient from R2 = 0.983 to R2
= 0.991.
Our neurobiotin staining revealed that all cells were part of the proximal retina of
E1. Although several of the neurobiotin fills stained single cells, some of the preparations labeled two or three closely grouped cells after a single neurobiotin injection.
Fig. 3.5A shows an example of a single cell filled with neurobiotin in the proximal retina of E1. On the other hand, Fig. 3.5B is an example of two stained cells, although the neurobiotin iontophoresis was performed only once, after the successful spectral sensitivity measurement from one cell.
100 Distal retina
Cells of the distal retina are smaller, and for most of our recordings we were not able to hold these cells long enough to successfully measure their spectral sensitivity.
The impulse-responses to equiquantal flashes of light were relatively smaller compared to the ones from the cells of the proximal retina. The inset in Fig. 3.6A shows one impulse-
Fig. 3.5. Cells of the proximal retina injected with neurobiotin after successful intracellular measurement. Both images (A and B) are of cross (frontal head) sections. (A) An example of a single cell filled with neurobiotin in the proximal retina of E1. (B) An example of two stained cells (black arrows) in the proximal retina of E1. The neurobiotin iontophoresis was performed only once, after successfully recording spectral sensitivity measurements from one cell. 1 < = )!)"
101 response from the distal retina cell to a 520 nm light flash that has an amplitude of 5 mV.
We successfully recorded the spectral responses from two cells. Spectral measurements revealed that both cells had peak responses in the green (LW) range. We traced one of those cells using neurobiotin to the distal retina of E1 (Fig. 3.6B). The pooled spectral response curve has two peaks, the dominant one with a maximum response at 520 nm, and the smaller one with a local maximum response at 360 nm (Fig. 3.6A). The error bars are relatively large, especially at some points, due to the small sample size. We failed to reconstruct the spectral sensitivity curve, because we were not able to hold the cells sufficiently long to record the V-logI curves. And only in two cases, we held the cells long enough to record the spectral response to all wavelengths. But based on the shape of the spectral response curve, it appears that the peak absorbance should lie in the
520-540 nm range (Fig. 3.6A).
Discussion
Our findings demonstrate that each retina has its own spectral sensitivity: a LW sensitive distal retina that is closer to the lens, and a UV sensitive proximal retina that lies directly underneath. The In situ hybridization results suggest that UV versus LW opsin mRNA expression is clearly separated, closely following morphological distinctions between different retinas. Specifically, the proximal retina in both eyes expresses the
TmUV II mRNA, whereas the distal retina of both eyes expresses the TmLW mRNA
(Fig. 3.2). These results are supported by our electrophysiological data as well. Indeed, the proximal retina absorbs FQ (max = 374 nm (Fig. 3.4) and distal
102 retina in the LW range, more precisely in the green range, approximately 520-540 nm
(Fig. 3.6A).
Fig. 3.6. Photoreceptor sensitivity of the distal retina. (A) Average spectral response from only two cells from the distal retina. The curve has two peaks: the dominant one at 520 nm and the smaller one at 360 nm. Inset shows the waveform of a single impulse-response to a 30 ms flash of a 520 nm light. (B) Cross-section through distal retina. One of the cells was traced back using neurobiotin to the distal retina of E1. Scale bar: B, 100 )"
103 UV sensitivity of the proximal retina
In situ hybridization results suggest a presence of a single UV opsin (TmUV II) in the proximal retina of the third instar larvae principal eyes (Fig 3.2D,E). We did not find presence of TmUV I mRNA expression in the principal eyes of third instars. Although
TmUV I mRNA appears weakly expressed in the dorsal half of the proximal retina of the first instar larvae principal eyes (Maksimovic et al., 2009), apparently third instars lack the TmUV I mRNA expression in their principal eyes. The presence of only TmUV II in the proximal retina is also suported by our electrophysiological data. The spectral sensitivity curve fits well with the Govardovskii et al. (2000) rhodopsin template (R2 =
0.991, n = 12) indicating that a single UV sensitive opsin with (max = 374 nm is sufficient enough to explain the spectral sensitivity curve of the proximal retina (Fig. 3.4).
The rhodopsin templates are based on the absorption of opsin molecules only and do not take into account that the photoreceptor responses can be modified by contributions of other elements that can change the absorption of light while passing the lens and other tissue of the eye, including the photoreceptors. Thus, they do not take into account the effect of self-screening as the light travels down the photoreceptor rhabdom.
As the light travels down the rhabdom, the peak wavelengths are selectively absorbed first leaving relatively less preferred wavelengths to be absorbed deeper in the rhabdom.
This phenomenon effectively broadens the absorption curve (Coates et al., 2006; Warrant and Nilsson, 1998). Hence, without the self-screening correction, the spectral sensitivity measurements for the proximal retina are wider than the model spectral sensitivity curve
(Fig. 3.3D). However, including self-screening into the rhodopsin absorbance model improves the fit. Self-screening depends on two parameters: l, the length of the
104 photoreceptor, and k, the absorption coefficient of the photoreceptors. From histology
3!!)" We do not know k for T. marmoratus third instars, however k is known for several other insects including Droneflies for which k =
!"!!4)-1 (Stavenga, 1976; Warrant and Nilsson, 1998). By using these values and adding self-screening to the rhodopsin absorbance template we have substantially improved goodness of fit. The achieved single opsin correlation is very strong (R2 =
0.991), suggesting that the absorbance curve of the proximal retina represents a contribution of a single UV opsin, TmUV II.
Although the broadening of the spectral sensitivity curve can result from the presence of additional opsins with different absorbance maxima, our results do not support this possibility. The in situ hybridization results did not reveal the presence of the second UV opsin found in first instars, TmUV I, in the proximal retina of third instars.
Even in first instars, TmUV I mRNA is weakly expressed and only in one part of the proximal retina. If third instars have even lower expression of TmUV I mRNA, that could account for the negative in situ hybridization result. But even if this is true, the contribution of the TmUV I opsin to the spectral sensitivity curve of the proximal retina would be minimal to undetectable.
The presence of a single UV opsin in the proximal retina is also consistent with the possibility of polarization sensitivity in this region (Stecher et al., 2010). Polarization sensitivity in insects is most often mediated by UV sensitive receptor cells (Horvath and
Varju, 2004). Moreover, sets of orthogonally oriented photoreceptors in polarization- sensitive eyes should have the same spectral sensitivity to avoid confusion with chromatic stimuli (Wehner and Labhart, 2006). Polarization sensitivity could
105 substantially benefit T. marmoratus larvae. One of the key benefits could be improved detection of prey (Stecher et al., 2010). However, although morphological features and spectral sensitivity suggest polarization sensitivity, at this point, it is still unclear if the larvae are in fact sensitive to the polarization of light. Additional physiological and behavioral studies would need to confirm if this actually is the case.
We recorded only from one eye, E1. This was probably the consequence of our recording technique. The microelectrodes were advanced through E6, which is located directly above the retinas of E1 and not E2 (Fig. 3.1C). But, we have no reason to believe that E2 should be any different. E1 and E2 are anatomically very similar (Fig
3.1C) and exhibit identical opsin expression patterns (Fig 3.2D,E). Some neurobiotin injections led to the labeling of more than one cell (Fig. 3.5B). There are several possible explanations for this occurrence. It is possible that at least some cells of the proximal retina are coupled through gap junctions, in which case labeling of one cell would label the whole group of coupled cells. Since the number of labeled cells per recording varied, the more probable explanation would be that the labeling of multiple cells was a recording artifact, such as leakage of the neurobiotin during a recording. It was not uncommon that few unsuccessful recording attempts preceded the successful one.
Therefore, it is possible that during a failed recording attempt sufficient amount of neurobiotin was released from the microelectrode into the cell. In either case, this does not affect our conclusion in regards to spectral sensitivity.
106 LW sensitivity of the distal retina
For the cells of the distal retina, our in situ hybridization results as well as in situ hybridization results on the first instar larvae (Maksimovic et al., 2009) suggest the presence of only one LW opsin (TmLW). This finding is also supported by our electrophysiological data, although we successfully recorded the spectral responses only from two cells that peaked in the green range. One of these cells was traced back using neurobiotin to the distal retina of E1 (Fig. 3.6B). We have no reason to believe that the second cell was from anywhere else but the distal retina of E1, because our in situ hybridization results suggest presence of LW sensitive cells only in the distal retina and every UV unit we recorded from was traced back to the proximal retina only. Since we failed to record V-logI functions for the LW sensitive cells, we did not reconstruct the spectral sensitivity curve for the distal retina. But the recorded spectral response curve clearly indicates peak sensitivity in the green region (Fig. 3.6A). The spectral response curve has two peaks, the dominant one at 520 nm, and secondary one at 360 nm. Opsin absorbance at longer wavelengths is characterized with two bands
! (Govardovskii et al., 2000; Stavenga et al., 1993). Therefore, the two peaks of the spectral response curve are probably the reminiscence of the absorbance band of the distal retina TmLW opsin. Although at this point we can not pin-point the peak absorbance wavelength of the distal retina, we can estimate that (max is in green range, around 520-540 nm. The absorbance in the UV region is more variable and thus, harder to estimate. But, based on the shape of the curve, the local peak absorbance in the
UV region could be between 340-360 nm. This is in accordance with the notion that the
!-peak wavelength varies in general between 330 and 360 nm (Stavenga et al., 1993).
107 Functional implications
While the over-all functional organization of the T. marmoratus larval principal eyes still is largely unclear, there are certain functional implications that arise from the arrangement of the distal and proximal retina and their spectral sensitivities. One reason to have multiple, sequentially-arranged retinas is to compensate for lens chromatic aberration, as it has been suggested for the antero-median eyes of jumping spiders (Blest et al., 1981; Land, 1969). However, for this mechanism to work, photoreceptor tiers closer to the lens must be sensitive to stronger refracted, shorter wavelengths while deeper photoreceptor layers would be excited by less refracted, longer wavelengths. In contrast with this model, our data suggest that the arrangement of retinas in the principal eyes of T. marmoratus larvae follows the opposite pattern, with a LW sensitive distal retina and a UV sensitive proximal retina.
Since the proximal retina can only receive light that passes through the distal retina, could it be that the distal retina serves as a contrast filter for the proximal retina? LW
(max 15 ! typically have a ! FQ (Stavenga et al., 1993).
Therefore, the LW sensitive distal retina potentially could sharpen the absorbance spectrum of the UV sensitive proximal retina and increase its imaging contrast.
Unfortunately, we failed to determine the peak sensitivities of the distal retina.
Nevertheless, we can still draw some conclusions about potential optical interactions between the two retinas. If the ! % distal retina has a substantial effect on the proximal retina, the spectral sensitivity of the proximal retina should deviate from theoretical predictions using opsin templates. P !-
LW band could skew the absorbance spectrum of the proximal retina to left or right.
108 AI %!-LW band and the UV absorbance band have the same peak absorbance, that could flatten the peak of the absorbance curve of the proximal retina. Neither is the case with the spectral sensitivity curve of the proximal retina. The spectral sensitivity
% (max = 374 nm. This value compares well with other insect UV photoreceptors, which typically have peak sensitivity around 360 nm
(Briscoe, 2008; Stavenga and Arikawa, 2006; Tovee, 1995). For instance, Drosophila melanogaster Rh4 opsin absorbs maximally at 375 nm (Feiler et al., 1992). Our results suggest that only two elements are sufficient enough to explain the spectral sensitivity curve of the proximal retina: absorbance of a single UV opsin and the self-screening effect. The correlation between our experimental data and the template curve is very strong, R2 /!"443 %!-LW band to the sensitivity curve must be small to negligible. Therefore, our results do not suggest that the distal retina acts as a contrast filter for the proximal retina.
Irrespective of the nature of the retinal arrangement in T. marmoratus principal eyes, any lens with a single focal plane would be unable to sharply focus any object at a given distance onto both retinas. However, Stowasser et al. (in press) recently discovered that these eyes operate with bifocal lenses that can project separate images of the same object onto the two retinas, allowing each eye to function as "two eyes in one". Nonetheless, the UV light has to pass through the distal retina, which can modify its intensity patterns, spectral patterns, and/or e-vector patterns. Additional optical, physiological and behavioral experiments will be necessary to establish the true function of this unusual retinal arrangement, which is, so far, the only described tiered system with LW-sensitive cells in the distal region.
109 Acknowledgements
We thank Randy Morgan for providing assistance in rearing diving beetles and the
Cincinnati Zoo and Botanical Garden for the original population of Sunburst Diving
Beetles. We also thank Shannon Werner and Nadine Stecher for assistance with animal care. This material is based upon work supported by the National Science Foundation under Grant No. 0545978 to E. K. B.
References
Blest, A. D., Hardie, R. C., McIntyre, P. and Williams, D. S. (1981). The spectral sensitivities of identified receptors and the function of retinal tiering in the principal eyes of a jumping spider. J Comp Physiol A 145, 227-239.
Briscoe, A. D. (2008). Reconstructing the ancestral butterfly eye: focus on the opsins. J Exp Biol 211, 1805-1813.
Buschbeck, E., Sbita, S. and Morgan, R. (2007). Scanning behavior by larvae of the predacious diving beetle, Thermonectus marmoratus (Coleoptera: Dytiscidae) enlarges visual field prior to prey capture. J Comp Physiol A 193, 973-982.
Coates, M. M., Garm, A., Theobald, J. C., Thompson, S. H. and Nilsson, D.-E.
(2006). The spectral sensitivity of the lens eyes of a box jellyfish, Tripedalia cystophora
(Conant). J Exp Biol 209, 3758-3765.
Feiler, R., Bjornson, R., Kirschfeld, K., Mismer, D., Rubin, G. M., Smith, D. P.,
Socolich, M. and Zuker, C. S. (1992). Ectopic expression of ultraviolet-rhodopsins in the blue photoreceptor cells of Drosophila: visual physiology and photochemistry of transgenic animals. J Neurosci 12, 3862-3868.
110 Gilbert, C. (1994). Form and Function of Stemmata in Larvae of Holometabolous
Insects. Annu Rev Entomol 39, 323-349.
Govardovskii, V. I., Fyhrquist, N., Reuter, T., Kuzmin, D. G. and Donner, K.
(2000). In search of the visual pigment template. Visual Neurosci 17, 509-528.
Hardie, R. C. and Raghu, P. (2001). Visual transduction in Drosophila. Nature
413, 186 - 193.
Horvath, G. and Varju, D. (2004). Polarized light in animal vision: Polarization patterns in nature: Springer-Verlag New York Inc.; Springer-Verlag GmbH & Co. KG.
Land, M. F. (1969). Structure of the retinae of the principal eyes of jumping spiders (Salticidae: Dendryphantinae) in relation to visual optics. J Exp Biol 51, 443-470.
Land, M. F. and Nilsson, D.-E. (2002). Animal eyes. New York: Oxford
University Press.
Maksimovic, S., Cook, T. A. and Buschbeck, E. K. (2009). Spatial distribution of opsin-encoding mRNAs in the tiered larval retinas of the sunburst diving beetle
Thermonectus marmoratus (Coleoptera: Dytiscidae). J Exp Biol 212, 3781-3794.
Mandapaka, K., Buschbeck, E. and Morgan, R. (2006). Twenty-eight retinas but only twelve eyes: An anatomical analysis of the larval visual system of the diving beetle
Thermonectus marmoratus (Coleoptera: Dytiscidae). J Comp Neurol 497, 166-181.
Naka, K. I. and Rushton, W. A. H. (1966). An attempt to analyse colour reception by electrophysiology. J Physiol-London 185, 556-&.
Nilsson, D.-E., Gislen, L., Coates, M. M., Skogh, C. and Garm, A. (2005).
Advanced optics in a jellyfish eye. Nature 435, 201-205.
111 Stavenga, D. G. (1976). Fly visual pigments difference in visual pigments of blowfly and dronefly peripheral retinula cells. J Comp Physiol 111, 137-152.
Stavenga, D. G. and Arikawa, K. (2006). Evolution of color and vision of butterflies. Arthropod Struct Dev 35, 307 - 318.
Stavenga, D. G., Smits, R. P. and Hoenders, B. J. (1993). Simple exponential functions describing the absorbance bands of visual pigment spectra. Vision Res 33,
1011-7.
Stecher, N., Morgan, R. and Buschbeck, E. (2010). Retinal ultrastructure may mediate polarization sensitivity in larvae of the Sunburst diving beetle, Thermonectus marmoratus (Coleoptera: Dytiscidae). Zoomorphology, in press.
Stowasser, A., Rapaport, A., Layne, J. E., Morgan, R. C. and Buschbeck, E.
(2010). Biological bifocal lenses with image separation. Curr Biol, in press.
Strausfeld, N. J. and Seyan, H. S. (1985). Convergence of visual, haltere, and prosternal inputs at neck motor neurons of Calliphora erythrocephala. Cell Tissue Res
240, 601-615.
Toh, Y. and Mizutani, A. (1987). Visual-system of the tiger beetle (Cicindela- chinensis) larva .1. structure. Zool Sci 4, 974-974.
Toh, Y. and Mizutani, A. (1994). Structure of the visual system of the larva of the tiger beetle (Cicindela chinensis). Cell Tissue Res 278, 125-134.
Toh, Y. and Okamura, J. Y. (2007). Morphological and optical properties of the corneal lens and retinal structure in the posterior large sternma of the tiger beetle larva.
Vision Res 47, 1756-1768.
112 Tovee, M. J. (1995). Ultra-violet photoreceptors in the animal kingdom - their distribution and function. Trends Ecol Evol 10, 455-460.
Warrant, E. J. and Nilsson, D. E. (1998). Absorption of white light in photoreceptors. Vision Res 38, 195-207.
Wehner, R. and Labhart, T. (2006). Polarization vision. In Invertebrate vision, eds. E. J. Warrant and D.-E. Nilsson), pp. 291–348. Cambridge: Cambridge University
Press.
113 Conclusion
The research presented in this dissertation was driven by a deep interest in how animals perceive the world and how their eyes function in order to meet specific animal needs. More specifically, my studies focused on the functional organization of two insect eyes: the compound lens eyes of Xenos peckii (Strepsiptera) and the scanning eyes of
Sunburst Diving Beetle larvae. These two types of eyes share qualities of strong modification when compared to those of other insects. This is probably due to visual specializations that result from the complex life cycle and evolutionary history in
Strepsiptera, as well as the accommodation to sophisticated prey capture needs in dytiscid larvae. In each case, the design of these eyes, including optics as well as the neural organization, diverges from the more typical and better understood bauplans. By having an overall understanding of how these unusual eyes function, besides extending the existing knowledge base in vision science, provides a strong potential to be used as a foundation for development of new technologies.
When it comes to sptersipteran eyes, I have provided evidence that Xenos peckii eyes combine visual principles from compound and single-lens eyes within one visual system (Maksimovic et al., 2007). In Xenos peckii on average each eye has about 50 eyelets each of which functions as a small image-forming unit. This unusual design has already inspired engineers to apply it into artificial optical solutions; for example, a research group from France made a compact infra-red camera inspired by the compound- lens eyes of Xenos peckii (Druart et al., 2009). This camera is designed to have a field of view of 30 degrees in addition to being composed of multiple telescopes/eyelets with different fields of view, as in the Xenos peckii eye. Another group from Canada
114 published a paper in which they have described the construction and operation of a compound eye sensor that imitates the strepsipteran eye design (Hornsey et al., 2004).
This sensor consists of up to 20 eyelets, each of which forms an image of approximately
150 pixels in diameter on a single CMOS image sensor. Thus, they have successfully made an electronic implementation of the strepsipteran eye for a compound-lens eye sensor for high-speed object tracking and depth perception (Hornsey et al., 2004). These are just two examples of research groups that used our findings about strepsipteran eyes as an inspiration to make new optical technologies. But, considering the fact that the description of a strepsipteran visual system is relatively recent, new implementations of this truly remarkable eye design are soon to follow.
The research currently being done on the principal eyes of dytiscid diving beetle larvae is very new and many open questions remain. Thus, to my knowledge, no one has yet tried to implement findings about these eyes into artificial optical solutions. But the potential is undoubtedly there. So far, this is the only example of a tiered system with
LW-sensitive distal photoreceptors and UV-sensitive proximal photoreceptors. Could it be that behind this unusual spectral arrangement lies a novel contrast enhancement mechanism, or something else for that matter, is yet to be determined. We still don’t know if these animals are capable of color vision, but this visual modality, including the potential polarization sensitivity (Stecher et. al., 2010) as well as the monochromatic vision, can be affected by the strange placement of the distal and proximal retina.
Additional optical, physiological and behavioral studies will be necessary to get either full or partial answers to these questions. But irrespective of these questions, (Stowasser et al., 2010) demonstrated the presence of bifocal lenses in these eyes. This is the first
115 example of truly bifocal lenses in the animal kingdom. These lenses not only focus two
different images, but they also separate images vertically, allowing for the improvement
of contrast in the first image (Stowasser et al., 2010). A mechanism that could
potentially be used in the design of intraocular lenses, for which the reduced contrast
already has been acknowledged as a major problem (Montes-Mico et al., 2004). Another
aspect of potential value for engineering is that these eyes could function as a monocular
distance sensor. Considering that the distal retina is organized into many tiers, all of
which express the same opsin (Maksimovic et al., 2009), it is possible that distance
information can be extracted from the movement of images across the distal retina as the
object distance changes. Whether this is true or not further optical and behavioral
experiments will have to be done in order to shed more light onto this question.
References
Druart, G., Guerineau, N., Haidar, R., Thetas, S., Taboury, J., Rommeluere, S.,
Primot, J. and Fendler, M. (2009). Demonstration of an infrared microcamera inspired
by Xenos peckii vision. Appl Optics 48, 3368-3374.
Hornsey, R., Thomas, P., Wong, W., Pepic, S., Yip, K. and Krishnasamy, R.
(2004). Electronic compound-eye image sensor: Construction and calibration. In Sensors
and Camera Systems for Scientific, Industrial, and Digital Photography Applications V, vol. 5301 eds. M. M. Blouke N. Sampat and R. J. Motta), pp. 13-24. Bellingham: Spie-Int
Soc Optical Engineering.
116 Maksimovic, S., Cook, T. A. and Buschbeck, E. K. (2009). Spatial distribution of opsin-encoding mRNAs in the tiered larval retinas of the sunburst diving beetle
Thermonectus marmoratus (Coleoptera: Dytiscidae). JExp Biol212, 3781-3794.
Maksimovic, S., Layne, J. E. and Buschbeck, E. K. (2007). Behavioral evidence for within-eyelet resolution in twisted-winged insects (Strepsiptera). J Exp Biol 210,
2819-2828.
Montes-Mico, R., Espana, E., Bueno, I., Charman, W. N. and Menezo, J. L.
(2004). Visual performance with multifocal intraocular lenses - Mesopic contrast sensitivity under distance and near conditions. Ophthalmology 111, 85-96.
Stecher, N., Morgan, R. C. and Buschbeck, E. K. (2010). Retinal ultrastructure may mediate polarization sensitivity in larvae of the Sunburst diving beetle,
Thermonectus marmoratus (Coleoptera: Dytiscidae). . Zoomorphology in press.
Stowasser, A., Rapaport, A., Layne, J. E., Morgan, R. C. and Buschbeck, E. K.
(2010). Biological bifocal lenses with image separation. Curr Biol in press.
117