Signature Redacted Angela M

Environmental remediation and biofuel production through nanoparticle stimulation of MASSACHUSETTS INSTITUTE yeast OF TECHNOLOGY 03 2019 by JUL Shalmalee Pandit LIBRARIES ARCHIVES B.S. Bioengineering The University of California, Berkeley (2015)

Submitted to the Department of Biological Engineering in Partial Fulfillment of the Requirements for the Degree of

Master of Science in Biological Engineering at the Massachusetts Institute of Technology

June 2019

Certified.....Signature redacted Angela M. Belcher Professor, Department of Biological Engineering Thesis Supervisor Signature redacted Accepted by ...... Forest White Chair, Department Committee on Graduate Students 77 Massachusetts Avenue Cambridge, MA 02139 MITLibraries http'l'ibraries.mitedu/ask

DISCLAIMER NOTICE

Due to the condition of the original material, there are unavoidable flaws in this reproduction. We have made every effort possible to provide you with the best copy available.

Thank you.

The images contained In this document are of the best quality available. Environmental remediation and biofuel production through nanoparticle stimulation of yeast

Shalmalee Pandit

Submitted to the Department of Biological Engineering On May 23, 2019 in Partial Fulfillment of the Requirements for the Degree of Master of Science in Biological Engineering Abstract Artificially photosynthetic systems aim to store solar energy and chemically reduce carbon dioxide. These systems have been developed in order to use light to drive processes for carbon fixation into biomass and/or liquid fuels. We have developed a hybrid-biological system that manages both genetically controlled generation of products along with the photoactivability of a semiconductor system. We show an increase in the production of ethanol, a common biofuel, through the electron transfer stimulated by biologically produced cadmium sulfide nanoparticles and light. This work provides a basis on which to improve the production of many metabolites and products through endogenously produced nanoparticles.

Thesis Supervisor: Angela M. Belcher Title: Professor, Department of Biological Engineering

2 Contents

1 Chapter 1 Introduction ...... 7 1.1 Environmental and health effects due to cadmium ...... 7 1.1.1 Environmental cleanup of cadmiumc.a...... 7 1.1.2 Current methods of cadmium ion removal...... 7 1.2 Current state of biofuel production ...... 9 1.2.1 Drivers of biofuel production ...... 9 1.2.2 Biofuel production to date... --...... 9 1.2.3 Key issues and considerations for biofuel production ...... 10 2 Chapter 2 Characterization of yeast-hybrid system ...... 11 2.1 Design of yeast-inorganic hybrid system ...... 11 2.2 Visual characterization of system...... 12 2.2.1 Transmission electron microscopy (TEM) images of system ...... 13 2.2.2 Elemental mapping analysis .--..... - ...... -- ...... 14 2.3 Experimental design to use hybrid system ...... 17 2.4 Transcriptomic characterization of system...... 18 2.4.1 Principal component analysis of RNA sequencing data...... 18 2.4.2 Gene expression fold change induced by cadmium treatment ..... 19 2.4.3 Gene expression fold change induced by light treatment...... 20 2.5 Experimental Methods...... 21 2.5.1 Yeast strain and culture ...... 21 2.5.2 Light experiments...... 22 2.5.3 Transmission electron microscopy (TEM)...... 22 2.5.4 RNA sequencing and analysis ...... 23 3 Chapter 3 Further characterization and effects of transcriptomic changes on metabolite production ...... -...... --...... 24 3.1 Further characterization through gene set enrichment analysis (GSEA)... 24 3.2 Intracellular ATP levels in yeast strains ...... 26 3.3 Intracellular glucose levels in yeast strains ...... -...... 27

3 3.4 Intracellular NAD+ and NADH Concentration...... 28 3.5 Discussion, conclusions, and future work ...... 30 3.6 Experim ental M ethods...... 31 3.6.1 Gene set enrichment analysis (GSEA) ...... 31 3.6.2 Yeast lysate preparation ...... 31 3.6.3 Measuring intracellular ATP concentration ...... 31 3.6.4 Measuring intracellular glucose concentration ...... 31 3.6.5 Measuring intracellular NAD+ and NADH ...... 31 4 Chapter 4 Producing biofuel using hybrid-biological system...... 32 4.1 Potential mechanistic explanation to produce biofuel (ethanol)...... 32 4.2 Measuring intracellular ethanol concentration...... 32 4.3 Implementing and characterizing the mutation in another yeast strain .... 33 4.3.1 Visual characterization of Y567 AMet17 ...... 33 4.3.2 Elemental m apping analysis ...... 35 4.3.3 Measuring intracellular ATP concentration ...... 38 4.3.4 Measuring the NAD+/NADH ratio ...... 39 4.4 Intracellular ethanol concentration in Y567 AMet17 strain ...... 40 4.5 Discussion, conclusions, and future work ...... 41 4.6 Experim ental M ethods...... 42 4.6.1 Yeast strain and culture methods...... 42 4.6.2 Knocking out M et17 in Y567 ...... 42 4.6.3 Measuring intracellular ethanol concentration...... 42 B ibliography ...... 43 Acknowledgements ...... 48

4 List of Figures

Figure 2-1 Yeast-hybrid biological system. a. Schematic of yeast-hybrid system. Knocking out a pathway in thiol production lead to an increase in hydrogen sulfide production. This hydrogen sulfide is shuttled out of the cell. b. When the yeast cells are treated with cadmium ions, cadmium sulfide nanoparticles are precipitated on the yeast's cell surface. The CdS nanoparticles excite at UV wavelengths...... 12 Figure 2-2 Wild-type yeast treated with cadmium ions display no CdS nanoparticles in the cell surface...... 13 Figure 2-3 Mutated yeast (AMet17) when treated with cadmium, precipitate CdS nanoparticles on the cell surface...... 14 Figure 2-4 CdS nanoparticles displayed on the yeast cell surface...... 15 Figure 2-5 Elemental mapping analysis of cadmium on TEM image...... 15 Figure 2-6 Elemental mapping analysis of sulfur on TEM image...... 16 Figure 2-7 Elemental analysis displaying both cadmium (red) and sulfur (blue) superim posed on the TEM im age...... 17 Figure 2-8 Experimental conditions for light and dark experiments...... 18 Figure 2-9 PCA plot displaying RNA Sequencing data...... 19 Figure 2-10 Log fold change volcano plot depicting the effects of the cadmium sulfide nanoparticles on the transcriptome of the yeast-hybrid system...... 20 Figure 2-11 Log fold change volcano plot depicting the effects of the light treatment on the transcriptome of the yeast-hybrid system...... 21 Figure 3-1 Gene set enrichment analysis of protein coding genes involved in ATP production and synthesis due to the presence of light. The p-value is less than 0.05. Random walk is displayed as well...... 25 Figure 3-2 Gene set enrichment analysis of genes involved in glycolysis due to the presence of cadmium sulfide nanoparticles on the yeast's cell surface. The p-value is less than 0.05. Random walk is also displayed...... 26 Figure 3-3 ATP concentration in various yeast strains. ATP concentration was calculated per cell. Yellow plots indicate light treatment...... 27 Figure 3-4 Intracellular glucose concentration displayed in various yeast strains. Yellow bars indicate light treatm ent...... 28 Figure 3-5 Total NAD+ and NADH in wild type and mutant strains, exposed to cadm ium and light...... - ...... 29 Figure 3-6 The NAD+ to NADH ratio in various yeast strains: wild type and mutant strains...... 30 Figure 4-1 Proposed potential mechanism of electron donation from CdS nanoparticle into NAD+/NADH redox cycle for ethanol production...... 32 Figure 4-2 Ethanol concentration in various yeast strains, wild type and AMet17 treated with cadm ium and light...... 33

5 Figure 4-3 Y567 yeast treated with cadmium ions display no CdS nanoparticles in the cell surface...... 34 Figure 4-4 Mutated Y567 (AMet17) when treated with cadmium, precipitated CdS nanoparticles on the cell surface...... 35 Figure 4-5 CdS nanoparticles displayed on the yeast cell surface...... 36 Figure 4-6 Elemental mapping analysis of cadmium on TEM image...... 37 Figure 4-7 Elemental mapping analysis of sulfur on TEM image...... 37 Figure 4-8 Elemental analysis displaying both cadmium (red) and sulfur (blue) superim posed on the TEM im age ...... 38 Figure 4-9 ATP concentration of Y567 strains, light and cadmium treatments are display ed ...... 39 Figure 4-10 NAD+ to NADH ratio in Y567 strains, both with and without the mutation, cadmium treatment and light exposure...... 40 Figure 4-11 Ethanol concentration in various yeast strains, Y567 and Y567AMet17 treated with cadm ium and light ...... 41

6 1 Introduction 1.1 Environmental and health effects due to cadmium 1.1.1 Environmental cleanup of cadmium

Cadmium is a heavy metal with high toxicity'. It can be toxic at low exposure levels and can have both acute and chronic effects on health and environment 2. When it is released to the environment, as it is relatively soluble in water compared to other heavy metals, it can stay in circulation and is bioavailable2 . Chronic cadmium exposure can produce a range of acute and chronic effects in humansL2 . When it accumulates in the human body, it is sequestered in the kidneys-. The current body of knowledge indicates that kidney damage (renal tubular damage) is a critical health effect. Another effect of cadmium exposure is on disturbances of calcium metabolism, hypercalciuria, and the formation of kidney stones3,4 . High exposure has also shown to lead to lung cancer and prostate cancera. The major issues related to cadmium are the following: 1) The atmospheric deposition of cadmium seems to be correlated to increase of cadmium in agricultural top soil. This can in turn be reflected in human food consumption. The main sources of atmospheric emission include, but are not limited to, non-ferrous metal production, the combustion of coal, and the incineration of waste5 .

2) The levels of cadmium may exceed background levels in the marine environment. This can cause serious effects on marine animals, including birds and mammals.

3) Cadmium is stockpiled in landfills and other deposits. This can be released to the environment in the future7 .

The environmental impact of cadmium and its high toxicity requires an effort for minimizing cadmium release into the environment as well as sequestering cadmium for environmental remediation. 1.1.2 Current methods of cadmium ion removal

7 Current environmental remediation methods of cadmium include chemical precipitation, solvent extraction, ion exchange, membrane separation, and biological adsorption 7 .

1.1.2.1 Chemical precipitation

Chemical precipitation is one of the methods for the removal of metal hydroxides, carbonates, or sulfides8. It is relatively low cost and simplistic in its precipitation method9 . Cadmium can be precipitated using magnesium, lime, and barium acetate. Zinc powder has also been used to cement cadmiums. Though the precipitation method is simple, the low cost method's applicability and practicality at low concentrations is challenging 8-10 .

1.1.2.2 Solvent extraction

Solvent extraction has also been used in recovering or separating metal ions from aqueous solutions to purify the solutionul-1 3. Various solvents have been reported from sulfate solutions that have been diluted in kerosene to remove cadmium12. This approach requires a large amount of toxic solvent to be extracted, which has to in turn be replenished, which makes this is a costly method".

1.1.2.3 Ion exchange

In ion-exchange, a chemical reaction emerges from contact between an insoluble electrolyte and an electrolyte in solution 14. The ion-exchange between a heavy metal such as cadmium and hydrogen ions can be carried out. The separation process, though, requires expensive equipment and high operational costs as a result of using chemicals for regeneration' 1 8 .

1.1.2.4 Membrane separation

A liquid membrane process incorporates a dispersed emulsion of an aqueous internal phase in a continuous external phase and includes an organic membrane'1 21. Various kinds of membrane processes have been used to remove cadmium from aqueous solutions. These include liquid membranes, hollow-fiber supported liquid membranes, and emulsion liquid membranes1 9. However, these membrane separation technologies show limitations in polluting the waters caused by the organic and inorganic substances. They also present a reduced durability and instability of the membranes under salty or acidic conditions 20 .

1.1.2.5 Biological adsorption

The use of waste from agriculture for the removal of cadmium has also been studied. Spent grain, tree ferns, and carbon produced form different sources

8 including almond shells, has been researched2 2. The adsorption of these materials is due to the binding of functional groups, such as hydroxyl, carbonyl, sulfate, and phosphate. Surfactants produced from microbes have also been used. The advantage of using biologically derived surfactants is the reduced toxicity and increased biodegradability when compared to synthetic surfactants2324. An anionic rhamnolipid surfactant that is produced by Pseudomonas aeruginosahas been used to promote the degradation of hydrocarbons with low solubility to remove cadmium from the soil 2 4 . A natural biopolymer, chitosan, has been used to coat perlite beads for cadmium adsorption 25-28. Chitosan is a biodegradable, biocompatible, hydrophilic, and non- toxic material that is able to bind metal to form complexes. The selectivity and low concentration sensitivity render this method difficult to scale 2 7 . Various biological organisms have been explored for the uptake and remediation of cadmium from the environment. Microorganisms, fungi, and seaweed have been used to remove cadmium 2 9-a1 . In this study, the use of yeast to remove cadmium from its environment has been explored. 1.2 Current state of biofuel production

Biofuels have been used to increase energy self-sufficiency. Recently, biomass based liquid fuels have become the focus to reduce vehicle emissions while increasing sustainability 2. Since the year 2000, the global supply of biofuel has increased by 8%33. The rise in biofuel supply is in part due to the policies enacted around sustainability as well as concerns surrounding natural gas and oil prices. 1.2.1 Drivers of biofuel production

Industries such as aviation, marine transport, and freight, biofuels are a practical and low carbon emission alternative to the traditionally used fossil fuel. 1.2.2 Biofuel production to date

1.2.2.1 Lignocellulose

Lignocellulose is derived from non-edible crops3 4. This has the advantage of limiting related emissions. This feedstock can be obtained from various sources, including trees, switchgrass. agricultural crop resides, such as rice straw and wheat strawan. Depending on the source of the feedstock, the land used to cultivate can be bioavailable. A challenge to this process is producing the fuel in a cost-effective mannera5 . The process involves breaking down the fibrous plant walls into sugars -

9 which is a costly stepa). After the sugars are formed, they are fermented to produce ethanolaV.

1.2.2.2 Algae

Algae has high oil content, limited waste streams, and minimal land requirements 38 . Water is required for algal growth 9 . Cultivation and recovery of algae vary with little research done on energy and environmental effects 4 0. Data collection has been limited to date, so the uncertainty of use of algae to produce biofuels is high, especially in regards to the environmental impacts 41 .

1.2.2.3 Corn

Corn is a food staple that can be grown in a wide variety of climates including tropical to temperate 4 -44. It is sensitive to frost45 4 . Fertilizer and pesticides are necessary for growing this crop. For feedstock and ethanol production, the water needs are relatively low based on the amount of the ethanol produced 47. The USA is the world leader is using corn to produce ethanol 44 .

1.2.2.4 Sugar crops

Sugarcane has become a large player in providing feedstock for ethanol production35 . It is a basic food crop that is grown in tropical climates and can have multiple harvests tied to one planting. Sugarcane is generally grown in deep soil, using fertilizers that are high in nitrogen and potassium, and low in phosphorous4s. This crop requires a constant supply of water throughout the growing season'5 . Sorghum is an annual grass crop that is mainly produced in the USA, Nigeria, and 4 50 India l'50 . The variety of sorghum used as feedstock is high in sugar content . It grows in tropical, sub-tropical, and temperate regions. It is more versatile than sugarcane and requires less water as well as shallower soil 50 . Relative to sugarcane, sweet sorghum is drought resistant and has a shorter growth cycle of four months. As it is comprised of 70% water, it can be processed quickly after harvest 49 . 1.2.3 Key issues and considerations for biofuel production

1.2.3.1 Food as fuel debate

The competition between fertile land for the production of biofuels or the production of food has been a topic of debate5 51-3. The concern mainly centers two points. One is around how biofuels impact food prices, which would disproportionately affect those who are low income5 l. The second point of concern is around how the land use of fuel-based crops would displace the land used for food crops (or lead to land appropriation)5a.

10 The use of land also provides a concern for crop based biofuel sustainability. As the global population level continues to rise, the expansion of land usage to be used for food, societal expansion, and biofuels is a question5 1 .

1.2.3.2 Emissions

Emissions from biofuels has been a point of debate"' 56. The complex and highly sensitive methods reflected in literature on biofuels provides competing views on biofuel sustainabilityn5.56. Some data display that biofuels greenhouse gas emissions can be worse than those attributed to gasoline in terms of climate effects. Other reports have also reported a reduction in greenhouse gas emissions 56.

1.2.3.3 Water

As is similar to the question of land use for cultivating crops for the production of biofuels, water is also a heavily required input1,5 8. While roughly 70% of the world's freshwater is used for agriculture, many countries are already experiencing water scarcity and drought,-. The production of biofuels from crop feedstock can use a hefty amount of available freshwatera5 . Assuming that the agriculture will intensify with the increase of fertilizer to produce crops, the production of crops for biofuel feedstock could exacerbate water scarcity problems. While there are some methods of producing biofuels, such as using switchgrass as feedstock, that alleviate this burden, not all crops are as sustainable59 ,60 .

Rising energy demands coupled with water limitations leave a lot of questions and uncertainty surrounding the sustainability of crop based feedstock for biofuel productionn".

1.2.3.4 Biological diversity

Land conversion and the use of land for biofuels can also affect the biological diversity of plants, which is integral in environmental sustainability 61 . Clearing forests and other land for use of cultivating crops can eliminate or disrupt the natural habitats for many species 62 . 2 Characterization of yeast-hybrid system 2.1 Design of yeast-inorganic hybrid system

11 Artificially photosynthetic systems aim to chemically reduce carbon dioxide63 . These processes can be imitated by hybrid inorganic-biological systems that have been developed to use light as a stimulus to drive product formation from carbon based molecules into liquid fuels64-6 9 . We have developed an inorganic-biological hybrid system that takes an input of waste in order to drive product formation. a

Metl7' KanMX

DMeti? .KanMX

Yeast ceW

UV wavelength lUgbt H2A

Cds Genetical engineeedCelts S. Ceresee Met17

0* 0

cadmfim cadmium

A yeast hybrid system involving cadmium sulfide nanoparticles was developed (Figure 2-1). Knocking out a gene involved in thiol synthesis, Met17, increased the production of hydrogen sulfide (Sun, G., et al. Nature Sustainability. Under Review). The resultant strain was S. cerevisiae: S288C, W303a AMetl7::KanMX (AMet17).Exposure to cadmium causes these sulfur producing yeast cells to precipitate biosynthesized CdS nanoparticles trapped in the cell wall. 2.2 Visual characterization of system In order to visually characterize the system, transmission electron microscopy (TEM) was performed on the AMet17 and W303a (wild-type) strains.

12 2.2.1 Transmission electron microscopy (TEM) images of system

3F19-13 2 ni

Figure 2-2 Wild-type yeast treated with cadmnium ions display no (AS nanoparticles in the cell surface.

13 ~19.15200 wn Figure 2-3 Mutated yeast (AMetl7) when treated with cadmium, precipitate CdS nanoparticles on the cell surface.

TEM images display the CdS nanoparticles trapped in the yeast cell wall (Figure 2-2, Figure 2-3). 2.2.2 Elemental mapping analysis Elemental mapping analysis was done to interrogate the elemental content of the nanoparticles displayed on the yeast.

14 Figure 2-4 CdS nanoparticles displayed on the yeast cell surface.

Elemental mapping was performed on yeast samples that were not sectioned in order to view the surface of the yeast (Figure 2-4).

Cd La1 0 I hMx21414A

Figure 2-5 Elemental mapping analysis of cadmium on TEM! image.

15 SKai 0

Figure 2-6 Elemental mapping analysis of sulfur on TEM image.

Elemental mapping analysis of the transmission electron microscopy (TEM) image shows the presence of cadmium (Figure 2-5) and sulfur (Figure 2-6) on the cell wall in the sample.

16 Mix

Figure 2-7 Elemental analysis displaying both cadmium (red) and sulfur (blue) superimposed on the TEM image. Measuring both elements simultaneously, we find that the cadmium and sulfur maps point to the localization of the cadmium sulfide nanoparticles on the yeast's surface (Figure 2-7). 2.3 Experimental design to use hybrid system In order to test the effects of each condition, the Met17 deletion (mutation), light, and cadmium, each effect was tested separately and in tandem with the others.

17 Light

CdS W~id ype Mutant naopartices W303a W3034a AMet17 KanMX (Met17)

Wa Aw - 7

Figure 2-8 Experimental conditions for light and dark experiments.

Light and dark experiments were performed on wild-type and AMet17, as well as samples with and without cadmium treatment (Figure 2-8). 2.4 Transcriptomic characterization of system

In order to characterize the effects of CdS production and ultraviolet (UV) light treatment on the wild-type (W303a) and mutant (AMet17) strains, we performed RNA Sequencing. The samples tested were W303a Cd + light, W303a + light, W303a + Cd, W303a as well as the AMet17 counterparts. 2.4.1 Principal component analysis of RNA sequencing data Clustering the samples according to expression allowed for viewing the causes for the changes in gene expression. Through clustering and differential gene expression analysis, we found that the AMet17 mutation produced the largest transcriptomic changes.

18 15 AMet17 AMet17 Cd

10 W303a :3 5

W303a Cd 4 W303. Cd light >-5, W303ctlight -10 AMet17 Cd light AMet17 light -15 -20 -10 0 10 20 Variance with Mutation

Figure 2-9 PCA plot displaying RNA Sequencing data.

The W303a samples cluster together. The light treated W303a samples cluster closely together, and the W303a samples not treated with light cluster together suggesting a baseline difference in gene expression due to the treatment of UV light (Figure 2-9). This behavior is paralleled in the AMet17 samples. The principal component analysis identifies where the data have the most spread. It captures 48% of the variance due to the mutation and 15% of the variance due to light treatment. The highest variance is seen between AMet17 samples treated with and without light. 2.4.2 Gene expression fold change induced by cadmium treatment

In order to characterize the effects of light and Cd treatments separately, differential gene expression (DGE) analysis was performed. W303a samples were tested against each other, AMet17 samples were tested against each other, and AMet17 samples were tested and benchmarked against their W303a counterparts (Figure 2-8). To characterize the effects of the CdS nanoparticles and the light on the AMet17 strain, differential gene expression (DGE) analysis was performed. The AMet17 Cd+light treated samples were tested against the AMet17 light treated samples in order to pinpoint the effects of the CdS nanoparticles on gene expression in the hybrid system.

19 5

4,$

5.5

IL* 30

030

-1,5 O 45 0 05 1 1.5 2

-Wt17+ Lg Cd w Mt7+7 Lig~ S- gim:. 2 Fold Change

Figure 2-10 Log fold change volcano plot depicting the effects of the cadmium sulfide nanoparticles on the transcriptome of the yeast-hybrid system. DGE analysis revealed that the effects of the CdS nanoparticles on yeast showed an increase in transcripts with a nicotinamide adenine dinucleotide (NAD+) dependency (Figure 2-10). Genes such as HST1, a NAD+ dependent histone deacetylase, was found upregulated only in the AMet17 Cd+light treated sample. 2.4.3 Gene expression fold change induced by light treatment In order to characterize the effects of light and Cd treatments separately, differential gene expression (DGE) analysis was performed. W303a samples were tested against each other, AMet17 samples were tested against each other, and AMet17 samples were tested and benchmarked against their W303a counterparts (Figure 2-8).

20 10o

8 * .IW4fCn*~ dowm"WWbd no sipt ddhnodlml .uprssk * irIfc vp&~ftd

0 $$P104

70 * 0 0 0

I .0*

0 40

0 0 0~ 8 0. * 0 0% 20 0 ~2' 0 ATPTP 10 * 0 ATP2. *

0 0

45 4 35 43 -25 -2 45 -1 *O'5 0 05 1 15 2 2,5

~s7e* Ug+ C v. %seT7 * Cd efeci Sa: Log 2 PoN Chen

Figure 2-11 Log fold change volcano plot depicting the effects of the light treatment on the transcriptome of the yeast-hybrid system.

The effects of light were identified by analyzing the differential gene expression of the AMet17 Cd+light treated samples against the AMet17 Cd treated samples. An increase in transcripts involved in the electron transport chain, such as COX1 and QCR2, as well as an increase in genes involved in adenosine triphosphate (ATP) synthesis (ATP16, ATP2) were found (Figure 2-11). 2.5 Experimental Methods 2.5.1 Yeast strain and culture

Yeast strains W303a and W303a AMet17 were available in the lab. Synthetically defined dropout media (SD) was made by dissolving 1.7 g/L yeast nitrogen base without amino acid and ammonium sulfate (YNB, Fischer), 5 g/L ammonium sulfate (Sigma), 0.6 g CSM-HIS-LEU-TRP-URA powder (MP Biologicals), 20 g/L glucose (Sigma), and 10 mL/L of 10OX adenine hemisulfate stock (1 g/L, Sigma) in ddH20. 10OX stocks of amino acids were created using the following: uracil (2 g/L, Sigma),

21 histidine (5 g/L, Sigma), leucine (10 g/L, Sigma), and tryptophan (10 g/L, Sigma) were made in ddH20. They were subsequently filtered and sterilized prior to their use in supplementing cultures.

Complete synthetically defined media (CSM) was also used. It was made with the above ingredients but with 0.79 g/L CSM mix (MP Biologicals). YPD was made with 20 g/L glucose, 20 g/L peptone, and 10 g/L yeast extract. Solutions were stirred and filter sterilized through a 0.22 pm filter top (EMD). Agar plates were made by adding 20 g/L BactoAgar (Fisher) and sterilization via autoclaving before pouring. 2.5.2 Light experiments

20 mL of yeast culture was grown overnight in CSM media supplemented with all amino acids - leucine, tryptophan, uracil, and histidine. Cultures were grown at 30°C shaking at 250 rpm. Overnight cultures were diluted down after fourteen hours of growth and resuspended in fresh CSM media supplemented with amino acids to an ODsoo of 0.2/mL.

Cultures treated with cadmium ions (Cd 2+, Sigma) were then treated with 10 uM cadmium for 4 hours, shaking at 250 rpm at 30°C. After cadmium ion treatment, cultures were subjected to UV wavelength light (315 nm) for two hours. After treatment, cultures were spun down at 900xg for 4 minutes, the supernatant removed, and immediately frozen by liquid nitrogen to preserve the native state. 2.5.3 Transmission electron microscopy (TEM)

In all experiments, a non-expressing and non-treated wild-type control was used. Sample slides of spheroplasted cells were prepared using from a MIT microscopy core. Samples were resuspended in 2 mL of fixative (3% glutaraldehyde, 0.1 M NaCacod pH 7.4, 5 mM CaCl2, 5 mM MgCl2, 2.5% sucrose) for 1 hour at 300C with gentle agitation (100 rpm). Cells were spun down at 900xg for 10 minutes. For the osmium-thiocarbohydrazide-osmium staining: Cells were dispersed them embedded in a 2% ultra-low temperature agarose (made in ddH2O). They were cooled and then cut into 1 mma cubes. Cubes were fixed in 1% OS04/ 1% potassium ferrocyanide in 0.1M cacodylate/ 5mM CaCl2, pH 6.8 at room temperature for thirty minutes. Blocks were washed four times in ddH20 for 1 minute each. Blocks were then transferred to 1% thiocarbohydrazide at room temperature for 5 minutes. Blocks were washed four times in ddH20 for 15 minutes each. Block staining in uranyl acetate: Samples were dehydrated through a graded series of ethanol: 50% to 100% on ice (5 minutes per wash) then followed with 4 washes each for 10 minutes in 100% ethanol at room temperature. Blocks were then incubated for 10 minutes in 1:1 ethanol:propylene oxide. Blocks were then

22 transferred to 100% propylene oxide for five minutes each in two steps. Blocks were transferred to 1:1 propylene oxide:Epon resin overnight under a vacuum. The blocks were transferred to fresh Epon resin and incubated for five hours. The blocks were transferred to beem capsules and polymerized in fresh Spurr resin for twenty hours. They were then sectioned with a microtome. Sample slides of non-spheroplasted cells were prepared by growing the yeast overnight then treating them with 10 uM cadmium ions (Cd 2+). After cadmium treatment, cells were spun down at 900xg for 15 minutes. The supernatant media was removed and the cells were resuspended in 100 uL ddH20. 7 uL of sample was then placed on the TEM grid. The grid was dried then washed with ddH20 for two minutes.

Imaging was performed on a JEOL-2100 FEG microscope using the largest area size of the parallel illumination beam with a 100 micron condenser aperture. The microscope was operated at 200 kV with a magnification ranging from 2,000 to 600,000 for assessing the particle shape, particle size, and the atomic arrangement. The images were recorded via a Gatan 2kx2k UltraScan CCD camera. STEM imaging was performed via a high-angle annular dark field (HAADF) detector with a 0.5 nm probe size and 12 cm camera length in order to measure chemical information with energy dispersive X-ray spectroscopy (EDX). Elemental line scanning was performed using EDX via us of an 80 mm 2 X-Max detector (Oxford Instrument, UK). 2.5.4 RNA sequencing and analysis RNA extraction: Five ODooo units of cells were collected. Cells were spun down and transferred to 2 mL screw-top Eppendorf tubes. The supernatant was removed then the cells were snap-frozen using liquid nitrogen. The cells were then resuspended in 400 uL TES buffer and 0.2 mL of 400 micron silica beads (OPS Diagnostics) were added. 400 uL of acid phenol (Life Technologies) was added and the samples were left to shake at 650C for 45 minutes at 1100 rpm in a thermomixer (VWR). The samples were spun down at 14,000xg for 10 minutes. The supernatant was transferred (300 uL) was transferred to 1 mL of ice cold 100% ethanol and 40 uL of 3M sodium acetate. The samples were mixed and incubated for sixteen hours overnight at 4°C. Pellets were aspirated and dried out in a hood then resuspended in 100 uL ddH20. They were resupsended on a shaker at 370 C for thirty minutes. A Qiagen RNeasy cleanup cut was used to clean up the sample (Qiagen 74106), with an additional step added to perform an on column DNase digestion (Qiagen 79254). Samples were then eluted with 50 uL of RNase free water. Samples were then transferred to the RNASequencing facility.

23 Samples were submitted to the BioMicro Center at MIT to be sequenced. All samples were extracted in biological duplicate, and technical triplicate. The entire experiment was done twice.

RNASequencing data were aligned and summarized using STAR (version 2.5.3a), RSEM (version 1.3.0), SAMtools (version 1.3), and an ENSEMBL gene annotation of S. cerevisiae (3) was used. Differential gene expression analysis was performed with R (version 3.4.4), using DESeq (2_1.18.1). The resulting data were parsed then assembled with Tibco Spotfire Analayst (version 7.11.1). 3 Further characterization and effects of transcriptomic changes on metabolite production

Gene set enrichment analysis pointed us in the direction of further mechanistic investigation into the mechanism. To test whether or not an increase in transcriptome correlated to an increase in metabolite production, we tested intracellular metabolite concentrations. 3.1 Further characterization through gene set enrichment analysis (GSEA)

To further probe the mechanism of action, we performed gene set enrichment analysis (GSEA). GSEA rank orders genes based on signal-noise correlation with phenotype 70. GSEA elucidated significantly differentially expressed genes in gene sets of interest. Gene sets were chosen to include all genes involved in biofuel production, ATP production, electron transport chain, glycolysis, fermentation, respiration, and other metabolism related genes.

24 0,7

r%E 0,504- 904

0,0

Oill -t

p I 10 C ~

e Aee t4

-fljfg*tnegtelvy correta) J20 So4 LW0 1500 2.000 ,0* 3,00 3.500 4,00 4,509 5.000 Rank In Ordered Dataset I Enrichment profile - Hits - Ranking metric scoresi

Figure 3-1 Gene set enrichment analysis of protein coding genes involved in ATP production and synthesis due to the presence of light. The p-value is less than 0.05. Random walk is displayed as well

We found that light treatment produced an upregulation in protein coding genes involved in proton pumping and translation regulation, in addition to genes involved in both the mitochondrial electron transport chain and proton antiporters (Figure 3-1). Light treatment also had an effect in upregulating genes involved in protein folding, cation transport, and hydrogen ion transmembrane transport. in 04 LU

01'

-0 1

*n ateyeerrd 0.0 t~~w 5000Z00~0 %OO2$ .0035*W 4,000 4,500 3oo0 I * RaknOreerRankin rdeed)ataset I Enrichment profile - Hts ~ - Ranking metric scoresI

Figure 3-2 Gene set enrichment analysis of genes involved in glycolysis due to the presence of cadmium sulfide nanoparticles on the yeast's cell surface. The p-value is less than 0.05. Random walk is also displayed.

Cadmium treatment produced an upregulation of genes involved in translation, DNA strand elongation, proton transport V (ATPase), and vacuolar proton transport. Certain genes such as PMA1, COR1, and QCR3 are also genes involved in glycolysis and production of metabolites used in respiration or fermentation (Figure 3-2). 3.2 Intracellular ATP levels in yeast strains

As the effects of light showed an increase in genes involved in ATP production (Figure 3-1), we tested the ATP levels in yeast strains.

26 Light Experiments E Dark Experiments I

~40- I

20-

T I

0- ant1 W034~e W33a AMet7 AMet17 AMt7 AMel cd cd Cd YeastStrain

Figure 3.3 ATP concentration in various yeast strains. ATP concentration was calculated per cell, Yellow plots indicate light treatment.

ATP concentration in W303a cells was around 8.7 pM per cell, were was treated AMet17 was at 19.5 pM per cell (Figure 3-4). The increase in ATP concentration seems to correlate to the transcriptomic change involving the upregulation gene expression of protein coding genes involved in ATP synthesis caused by light treatment. 3.3 Intracellular glucose levels in yeast strains

The effects of cadmium showed an increase of genes involved in glycolysis (Figure 3-2). We hypothesized that an increase in protein coding genes related to glycolysis would increase the metabolite concentration within the cells.

27 Ught Exp-rimet 800- M Dk Expemnts so-* I T T 400- T I 1 I 300- 0

200-

100-

0- I 1T WSO03a AMOM1 AM.t17 A 7ti? 7 Cd Cd Cd Yeast Strain

Figure 3-4 Intracellular glucose concentration displayed in various yeast strains. Yellow bars indicate light treatment. To test this, we tested the intracellular glucose concentration and found an increase in concentration in strains that both precipitated CdS nanoparticles on the cell surface and were treated with light (Figure 3-4). We found a slight increase in intracellular glucose concentration in the mutant strain treated with cadmium and light. 3.4 Intracellular NAD+ and NADH Concentration As genes involved in NAD+ dependency, such as HST1, were upregulated in the presence of CdS nanoparticles, and further probing into glycolysis through GSEA supported this data, we probed further into intracellular NAD+/NADH concentration. To see whether or not an increase in protein coding transcripts with an NAD+ dependency led to an increase in NAD+/NADH concentration, we tested for the presence and concentrations in W303a and AMet17 strains (AMet17 + Cd, AMet17 + light, AMet17 + Cd + light).

28 E Light Experiments 1.0 Dark Experiments

V 0.8 z C I O0.6 0 ..---...... ---- .... .- . ------.-W303a

0.4

0.2

0 0.0 z AMet17 AMet17 AMet17 AMet17 Cd Cd Yeast Strain

Figure 3-5 Total NAD+ and NADH in wild type and mutant strains, exposed to cadmium and light. We found an increase in production of NAD+/NADH in the presence of CdS nanoparticles (Figure 3-5).

29 8I

Z6 +I

Z 4 ZOR

W303a W303a AMet1 7 AMet1 7 AMet17 AMet17 Cd Cd Cd Yeast Strain

Figure 3-6 The NAD+ to NADH ratio in various yeast strains: wild type and mutant strains. Additionally, due to the increase in transcripts with an NAD+ dependency from the CdS particle formation, we hypothesized that there would be an increase in the ratio of NAD+ to NADH. This ratio was measured in both W303a and AMet17 strains with cadmium and light treatment. We found an increase in ratio of NAD+ to NADH in mutant strains with CdS nanoparticles (Figure 3-6). 3.5 Discussion, conclusions, and future work The increase in NAD+ compared to NADH suggests a potential mechanism of action. One potential electron donation from the CdS nanoparticles could be into the fermentation redox cycle. The mechanism of action in fermentation involves glucose's conversion to pyruvate. This involves the reduction of NAD+ to NADH. The pyruvate is then converted to acetylaldehyde, followed by the conversion of acetylaldehyde to ethanol. The conversion of acetylaldehyde to ethanol requires the oxidation of NADH to NAD+. In future work the intracellular concentration levels of acetylaldehyde as well as the intracellular concentration levels of pyruvate could be tested to further probe mechanism. Additional work would involve labeling the hydrogen specifically in the redox cycle and measuring the integrated content compared to the wild-type counterpart.

30 3.6 Experimental Methods 3.6.1 Gene set enrichment analysis (GSEA) Gene sets for GSEA were procured from GO2MSIG database. All high quality GO annotations were used for Saccharomyces cerevisiae (S288c). Additional sets provided from the Amon Lab at MIT were also used. These sets are called "'GaschESRRep", "GaschESRInd", and "TransposableElements". 3.6.2 Yeast lysate preparation Yeast cells were thawed at room temperature and resuspended in 0.5 mg/mL 100T Zymolyase in 1 M Sorbital Citrate buffer at 1 mL/10 OD60o. The resuspended culture was incubated at 300 C for 1 hour. The resuspended culture was then spun down at 900xg for 15 minutes and the supernatant was removed and kept aside for further analysis. The spheroplast pellet was resuspended in 3x the volume of the spheroplast pellet in Yeast Lysis Buffer (Gold Bio, GB-178). The suspended spheroplast pellet was incubated on ice for 30 minutes. The lysed cells were centrifuged at 20,000xg for 30 minutes at 40C and the clear lysate was collected. 3.6.3 Measuring intracellular ATP concentration

ATP concentrated was measured using Promega's CellTiter-Glo Luminescent Assay (Promega G7570) on the yeast lysates. The protocol was not altered. This luminescent assay uses beetle luciferin that is catalyzed to oxyluciferin by the presence of ATP. The tested sensitivity of this assay is between 10-20 and 1011 moles of luciferase. 3.6.4 Measuring intracellular glucose concentration Intracellular glucose concentration was measured using Sigma's High Sensitivity Glucose Assay Kit (Sigma MAK-181) on the yeast lysates. Glucose concentration is determined by a coupled enzyme assay resulting in a fluorometric readout (Xex = 535 nm, ke = 587 nm) that is proportional to glucose concentration. The detection range of this assay is from 20-100 pmole/well. 3.6.5 Measuring intracellular NAD+ and NADH

Intracellular NAD+ and NADH were measured using Promega's NAD/NADH Glo Assay (Promega G9072) on the yeast lystates. This luminescent assay works by catalyzing reductase, in the presence of either the metabolite, to reduce a proluciferin reductase substrate to luciferin. The luciferin is proportional to the amount of NAD+ or NADH in the sample. This assay has a detection range of 10 nM to 400 nM.

31 4 Producing biofuel using hybrid- biological system 4.1 Potential mechanistic explanation to produce biofuel (ethanol)

In other biological hybrid systems, light harvesting semiconductor particles that were attached the surface of bacteria provided reducing agents to the metabolic processes. We hypothesized that this yeast-hybrid system could function similarly, with the excited electron from the CdS nanoparticle flowing to the metabolic process to regenerate NAD+ to NADH.

a b Cds@

\2ADP 2ATP

Glucose4 2 pyruvate '1- hv

Light k2 NAD 2 NADH

2 ethanol 2 acetaIdehyde

Figure 4-1 Proposed potential mechanism of electron donation from CdS nanoparticle into NAD+/NADH redox cycle for ethanol production. We then hypothesized that the electron donation from the CdS nanoparticle could be used for product formation. An output of the NAD+ to NADH redox cycle is ethanol, a pervasive biofuel (Figure 4-1). 4.2 Measuring intracellular ethanol concentration In order to test the hypothesis that an increase in shuttling of electrons drove an increase in production of ethanol, we tested intracellular ethanol concentration.

32 Ugh Ezxpwem..tf Oek Expmw"bt T T I I 40- T

No M Wiam- mm nii so m -0 w s**o0*A W* 2 30- 2D0- 1

10-

0- I Y567 hMet7 Met17 AMetl7 Met17 Cde Cd Vaast Strin

Figure 4-2 Ethanol concentration in various yeast strains, wild type and AMet17 treated with cadmium and light.

We compared W303(x and AMet17 strains with a strain produced in the beer industry that was engineered to have an increased production of ethanol (Y567). We found an increase of ethanol production in the AMet17 strain treated with cadmium and light (Figure 4-2). 4.3 Implementing and characterizing the mutation in another yeast strain

To see whether or not knocking out the Met17 gene would induce the same effects in another yeast strain, Met17 was knocked out in another yeast strain, Y567. Y567 has been used in the beer industry for increased ethanol production. The resultant strain's, Y567 AMetl7::KanMX (Y567 AMet17), behavior was characterized. 4.3.1 Visual characterization of Y567 AMet17

33 3-19-17 2 nm

Figure 4-3Y567 yeast treated with cadmium ions display no CdS nanoparticles in the cell surface.

34 U

Figure4-4Mutated Y567 (AMet17) when treated with cadmium, precipitated CdS nanoparticles on the cell surface. When treated with the same dose of cadmium (10 uM) as W303c AMet17, Y567 AMet17, precipitates cadmium sulfide nanoparticles on the yeast cell surface (Figure 4-3, Figure 4-4). 4.3.2 Elemental mapping analysis Elemental mapping analysis was done to measure the elemental content of the nanoparticles displayed on the yeast.

35 Figure 4-5 CdS nanopartiedes displayed on the yeast cell surface.

Elemental mapping was performed on yeast samples that were not sectioned in order to view the surface of the yeast (Figure 4-5).

36 Cd La1

I-~ w

Figure 4-6 Elemental mapping analysis of cadmium on TEM image.

S 0 ...... hft 198 ------1- Kai

W N,4 A,

Figure 4-7 Elemental mapping analysis of sulfur on TEM image.

Elemental mapping analysis of the transmission electron microscopy (TEM) image shows the presence of cadmium (Figure 4-6) and sulfur (Figure 4-7) on the cell wall in the sample.

37 ~ ~v4 '%~~.( ~ ~ ~

\~<~

* ~ ~A

Figure 4-8 Elemental analysis displaying both cadmium (red) and sulfur (blue) superimposed on the TEM image. Measuring both elements simultaneously, we find that the cadmium and sulfur maps point to the localization of the cadmium sulfide nanoparticles on the yeast's surface (Figure 4-8). 4.3.3 Measuring intracellular ATP concentration Y567 AMet17 was subjected to both light and cadmium treatment. In order to test phenotypic responses of this strain, both ATP concentration and intracellular NAD+/NADH concentration were measured.

38 Ught Experments MDark Experknents go-

70- - I e 50-

10-

Y567 Y567 Y567:Aet17 Y567::AMt17 Y567::AM 7 Y567::WAMt17 Cd Cd Cd Yeast Strain

Figure 4-9ATP concentration of Y567 strains, light and cadmium treatments are displayed.

The responses in intracellular ATP concentration of Y567 AMet17 are similar in behavior to W303 AMet17 (Figure 4-9). Y567 AMet17 has an increased ATP concentration when treated with both cadmium and light, at 78.68 pM/OD600 compared to Y567 at 14.518 pM/OD600. 4.3.4 Measuring the NAD+/NADH ratio

The NAD+/NADH ratio in the Y567 AMet17 was also measured.

39 LightExperiments m Duk Expkm nb I 426- - T Sr

2 -

a- Y567 Y567 Y567 Y567 Cd AMet17 AMet7 Cd AMt17 AMet17 Cd Yeast Strain

Figure 4-10 NAD+ to NADH ratio in Y567 strains, both with and without the mutation, cadmium treatment and light exposure.

We found an increase in NAD+ to NADH ratio in Y567 AMet17 strains treated with cadmium and light, suggesting the mutation coupled with the cadmium and light treatment was increasing the product formation of ethanol (Figure 4-10). 4.4 Intracellular ethanol concentration in Y567 AMet17 strain

We tested the Y567 AMet17 strain to see if there was an increase in ethanol production with the mutant yeast treated with cadmium and activated with light.

40 M

9Ught Expeimonts M Ok Exp~mOet*

I 0

0- I

a-,

0 memo~ MMM M- M*w ~ i ~ ~nm am MaM -W000iM UG

0- V567 Cd YU7ACy4 Y57 Attt7 Cd cd

Figure 4-11 Ethanol concentration in various yeast strains, Y567 and Y567AMet17 treated with cadmium and light We found an increase of ethanol production in the Y567 Met17 strain treated with cadmium and light (Figure 4-11). The implementation and characterization of Y567 AMet17 shows that the systemic hybrid-inorganic methodology can be implemented in other yeast strains for similar genetic and light induced control. 4.5 Discussion, conclusions, and future work Development of an in-house inorganic-biological hybrid system has the potential to enable the production of higher value products. The production of propane-1,2-diol and propane-1,3-diol, that is already found in yeast, requires the reduction of NADH to NAD+. This work provides a platform to increase the production of fragrances, drug precursors, and other biofuels already produced by yeast. While a larger scale implementation will require the optimization of larger scale cultures and illumination sources, this hybrid-biological system can be tuned to fit various needs. The versatility of this system through the biological production of nanoparticles enables tuning of the yeast strain as well as the nanoparticle's materials, size, and crystallinity. The wavelength at which to excite the CdS

41 nanoparticle can be tuned based on the size of the nanoparticle. The size of the nanoparticle can be controlled with the nutritional profile of the yeast. The genetic control of the biological production of nanoparticles can be implemented in various strains in addition to the two performed and discussed. A deeper understanding of the electron donation and transport mechanism can lead to further design improvements of the biological-hybrid system. This work provides a platform in which many tools can be tuned to enable efficient and economical production of valuable metabolites and products. 4.6 Experimental Methods 4.6.1 Yeast strain and culture methods Y567 was acquired from ATCC (ATCC 9763). It is classified as a Saccharonyces cerevisiae strain, and cultured according to the protocol described above for W303a. 4.6.2 Knocking out Met17 in Y567 Met17 was knocked out in Y567 using the following primers for producing a deletion cassette KanMX: Name Primer del-Met-17-KanTMX-fwd TCAGATACATAGATACAATTCTATTACCCCCATCCA TACAGACATGGAGGCCCAGAATA del-Met- I7-KanMX-rev AAGTAGGTTTATACATAATTTTACAACTCATTACGC ACACCAGTATAGCGACCAGCATTC seq-MET17-Kan-fwd GGTTGGCAAATGACTAATTAAG kanMX-rev CAGTATAGCGACCAGCATTC

Competent cells were created and the deletion cassette was transformed into yeast using a kit: Frozen EZ Yeast Transformation II (Zymo Research T2001). 4.6.3 Measuring intracellular ethanol concentration

Intracellular ethanol concentration was measured using Sigma's Ethanol Assay Kit (Sigma MAK-076) kit on the yeast lysates. The ethanol concentration is determined by a coupled enzyme reaction, with a detection range of 10 uMI to 10 nM per well.

42 Bibliography

1. Nordic Council of Minister' Cadmium Review. (2003). 2. Fowler, B. A. Monitoring of human populations for early markers of cadmium toxicity: A review. Toxicol. App1. Pharmacol. 238, 294-300 (2009). 3. Johri, N., Jacquillet. G. & Unwin, R. Heavy metal poisoning: the effects of cadmium on the kidney. BioMetals 23, 783-792 (2010). 4. Scott, R. et al. Hypercalciuria related to cadmium exposure. Urology 11, 462-5 (1978). 5. Liang, J. et al. Atmospheric deposition of mercury and cadmium impacts on topsoil in a typical coal mine city, Lianyuan, China. Chemosphere 189, 198- 205 (2017). 6. Ray, S. Bioaccumulation of cadmium in marine organisms. Experientia. Suppl. 50, 65-75 (1986). 7. Khairy, M., El-Safty, S. A. & Shenashen, M. A. Environmental remediation and monitoring of cadmium. TrAC Trends Anal. Chem. 62, 56-68 (2014). 8. Esalah, J. 0., Weber, M. E. & Vera, J. H. Removal of lead, cadmium and zinc from aqueous solutions by precipitation with sodium Di-(n-octyl) phosphinate. Can. J. Chem. Eng. 78, 948-954 (2000). 9. Charerntanyarak, L. Heavy metals removal by chemical coagulation and precipitation. Water Sci. Technol. 39, 135-138 (1999). 10. Sasala, R. A., Bohland, J. & Smigielski, K. Physical and chemical pathways for economic recycling of cadmium telluride thin-film photovoltaic modules. in Conference Record of the Twenty Fifth IEEE PhotovoltaicSpecialists Conference - 1996 865-868 (IEEE, 1996). doi:10.1109/PVSC.1996.564265 11. Jha, M. K., Kumar, V., Jeong, J. & Lee, J. Review on solvent extraction of cadmium from various solutions. Hydrometallurgy 111-112, 1-9 (2012). 12. Kumar, V., Kumar, M., Jha, M. K., Jeong. J. & Lee, J. Solvent extraction of cadmium from sulfate solution with di-(2-ethylhexyl) phosphoric acid diluted in kerosene. Hydrometallurgy 96, 230-234 (2009). 13. Daryabor, M., Ahmadi, A. & Zilouei, H. Solvent extraction of cadmium and zinc from sulphate solutions: Comparison of mechanical agitation and ultrasonic irradiation. Ultrason. Sonochem. 34, 931-937 (2017). 14. Raamsdonk, L. M. et al. A functional genomics strategy that uses metabolome data to reveal the phenotype of silent mutations. Nat. Biotechnol. 19, 45-50 (2001).

43 15. Salmani, M. H., Davoodi, M., Ehrampoush, M. H.. Ghaneian, M. T. & Fallahzadah, M. H. Removal of cadmium (11) from simulated wastewater by ion flotation technique. IranianJ. Environ. Health Sci. Eng. 10, 16 (2013). 16. Ahmed, S., Chughtai, S. & Keane, M. A. The removal of cadmium and lead from aqueous solution by ion exchange with NaL Y zeolite. Sep. Purif. Technol. 13, 57-64 (1998). 17. Maliou, E., Malamis, M. & Sakellarides, P. 0. Lead and Cadmium Removal by Ion Exchange. Water Sci. Technol. 25, 133-138 (1992). 18. Salmani, M. H., Davoodi, M., Ehrampoush, M. H., Ghaneian, M. T. & Fallahzadah, M. H. Removal of cadmium (II) from simulated wastewater by ion flotation technique. IranianJ. Environ. Health Sci. Eng. 10, 16 (2013). 19. Jakobsen, M. R., Fritt-Rasmussen, J., Nielsen, S. & Ottosen, L. M. Electrodialytic removal of cadmium from wastewater sludge. J. Hazard. Mater. 106, 127-132 (2004). 20. Chaudhari, L. B. & Murthy, Z. V. P. Separation of Cd and Ni from multicomponent aqueous solutions by nanofiltration and characterization of membrane using IT model. J Hazard. Mater. 180, 309-315 (2010). 21. Li, Q., Liu, Q., Li, K. & Tong, S. Separation study of cadmium through an emulsion liquid membrane. Talanta 44, 657-662 (1997). 22. Ahluwalia, S. S. & Goyal, D. Microbial and plant derived biomass for removal of heavy metals from wastewater. Bioresour. Technol. 98, 2243-2257 (2007). 23. Pal, P. & Pal. A. Surfactant-modified chitosan beads for cadmium ion adsorption. Int. J. Biol. Macromol. 104, 1548-1555 (2017). 24. Chang, J.-S., Law, R. & Chang, C.-C. Biosorption of lead, copper and cadmium by biomass of Pseudomonas aeruginosa PU21. Water Res. 31, 1651-1658 (1997). 25. Jha, I. N., Iyengar, L. & Rao, A. V. S. P. Removal of Cadmium Using Chitosan. J. Environ. Eng. 114, 962-974 (1988). 26. Chaudhari, S. & Tare, V. Removal and Recovery of Heavy Metals from Simulated Wastewater Using Insoluble Starch Xanthate Process. Pract. Period. Hazardous, Toxic, Radioact. Waste Manag. 12, 170-180 (2008). 27. Bhattacharya, A. K. & Venkobachar, C. Removal of Cadmium (II) by Low Cost Adsorbents. J. Environ. Eng. 110, 110-122 (1984). 28. Rorrer, G. L., Hsien, T.-Y. & Way, J. D. Synthesis of Porous-Magnetic Chitosan Beads for Removal of Cadmium Ions from Waste Water. Ind. Eng. Chem. Res 32. (2170). 29. Kapoor, A., Viraraghavan, T. & Cullimore, D. R. Removal of heavy metals

44 using the fungus Aspergillus niger. Bioresour. Technol. 70, 95-104 (1999). 30. Sastre de Vicente, M. E., Herrero, R., Lodeiro, P. & Cordero, B. Biosorption of Cadmium by Fucus spiralis. Environ. (hem. 1, 180 (2004). 31. Hashim, M. . & Chu, K. . Biosorption of cadmium by brown, green, and red seaweeds. Chem. Eng. J. 97, 249-255 (2004). 32. Kumar, S., Shrestha, P. & Abdul Salam, P. A review of biofuel policies in the major biofuel producing countries of ASEAN: Production, targets, policy drivers and impacts. Renew. Sustain. Energy Rev. 26, 822-836 (2013). 33. Iddrisu, I. & Bhattacharyya, S. C. Ghana's bioenergy policy: Is 20% biofuel integration achievable by 2030? Renew. Sustain. Energy Rev. 43, 32-39 (2015). 34. Lange, J.-P., van der Heide, E., van Buijtenen, J. & Price, R. Furfural-A Promising Platform for Lignocellulosic Biofuels. ChemSusChen 5, 150-166 (2012). 35. Somerville. C., Youngs. H., Taylor, C., Davis. S. C. & Long, S. P. Feedstocks for lignocellulosic biofuels. Science 329, 790-2 (2010). 36. Zeng, Y., Zhao, S., Yang, S. & Ding, S.-Y. Lignin plays a negative role in the biochemical process for producing lignocellulosic biofuels. Curr. Opin. Biotechnol. 27, 38-45 (2014). 37. Lange, J.-P. Lignocellulose conversion: an introduction to chemistry, process and economics. Biofuels, Bioprod. Biorefining 1, 39-48 (2007). 38. Demirbas, A. Use of algae as biofuel sources. Energy Convers. Manag. 51, 2738-2749 (2010). 39. Milledge, J. J. & Heaven, S. A review of the harvesting of micro-algae for biofuel production. Rev. Environ. Sci. Bio/Technology 12, 165-178 (2013). 40. Radakovits, R., Jinkerson, R. E., Darzins, A. & Posewitz, M. C. Genetic engineering of algae for enhanced biofuel production. Eukaryot. Cell 9, 486- 501 (2010). 41. Beer, L. L., Boyd, E. S., Peters, J. W. & Posewitz, M. C. Engineering algae for biohydrogen and biofuel production. Curr. Opin. Biotechnol. 20, 264-271 (2009). 42. McPhail, L. L. & Babcock, B. A. Impact of US biofuel policy on US corn and gasoline price variability. Energy 37, 505-513 (2012). 43. Landis, D. A., Gardiner M. M., van der Werf, W. & Swinton, S. M. Increasing corn for biofuel production reduces biocontrol services in agricultural landscapes. Proc. Natl. Acad. Sci. U S. A. 105, 20552-7 (2008).

45 44. Tyndall. J. C., Berg, E. J. & Colletti, J. P. Corn stover as a biofuel feedstock in Iowa's bio-economy: An Iowa farmer survey. Biomass and Bioenergy 35, 1485- 1495 (2011). 45. Lamsal, B. P. & Tyagi, R. D. Bioenergy and Biofuel from Biowastes and Biomass. (American Society of Civil Engineers, 2010). doi:10.1061/9780784410899 46. Ogoshi, R. et al. Evaluation of Cellulosic Feedstocks for Biofuel Production. in Bioenergy and Biofuel from Biowastes and Biomass 130-157 (American Society of Civil Engineers, 2010). doi:10.1061/9780784410899.ch07 47. Shrestha, P., Lamsal, B. P. & Khanal, S. K. Preprocessing of Lignocellulosic Biomass for Biofuel Production. in Bioenergy and Biofuel from Biowastes and Biomass 158-171 (American Society of Civil Engineers, 2010). doi:10.1061/9780784410899.chO8 48. Chandel, A. K., da Silva, S. S., Carvalho, W. & Singh, 0. V. Sugarcane bagasse and leaves: foreseeable biomass of biofuel and bio-products. J. Chem. Technol. Biotechnol. 87, 11-20 (2012). 49. Antonopoulou, G., Gavala, H. N., Skiadas, . V., Angelopoulos, K. & Lyberatos, G. Biofuels generation from sweet sorghum: Fermentative hydrogen production and anaerobic digestion of the remaining biomass. Bioresour. Technol. 99, 110-119 (2008). 50. Nahar, K. Sweet Sorghum: an Alternative Feedstock for Bioethanol. Official Peer Reviewed Journalof Babol Noshirvani University of Technology BUT CorrespondingAuthor: Kamrun Nahar 2, (2011). 51. Tenenbaum, D. J. Food vs. Fuel: Diversion of Crops Could Cause More Hunger. Environ. Health Perspect. 116, (2008). 52. Zhang, Z., Lohr, L., Escalante, C. & Wetzstein, M. Food versus fuel: What do prices tell us? Energy Policy 38, 445-451 (2010). 53. Lam, M. K., Tan, K. T., Lee, K. T. & Mohamed, A. R. Malaysian palm oil: Surviving the food versus fuel dispute for a sustainable future. Renew. Sustain. Energy Rev. 13, 1456-1464 (2009). 54. Hill, J. et al. Climate change and health costs of air emissions from biofuels and gasoline. Proc. Natl. Acad. Sci. U. S. A. 106, 2077-82 (2009). 55. Mullins, K. A., Griffin, W. M. & Matthews, H. S. Policy Implications of Uncertainty in Modeled Life-Cycle Greenhouse Gas Emissions of Biofuels'. Environ. Sci. Technol. 45, 132-138 (2011). 56. Plevin, R. J.. Jones, A. D., Torn, M. S., Gibbs, H. K. & Gibbs, H. K. Greenhouse Gas Emissions from Biofuels' Indirect Land Use Change Are Uncertain but May Be Much Greater than Previously Estimated. Environ.

46 Sci. Technol. 44, 8015-8021 (2010). 57. Yang, J. et al. Life-cvcle analysis on biodiesel production from microalgae: Water footprint and nutrients balance. Bioresour. Technol. 102, 159-165 (2011). 58. de Fraiture., C., Giordano. M. & Liao, Y. Biofuels and implications for agricultural water use: blue impacts of green energy. Water Policy 10, 67-81 (2008). 59. Gerbens-Leenes, W., Hoekstra, A. Y. & van der Meer, T. H. The water footprint of bioenergy. Proc. Natl. Acad. Sci. U. S. A. 106, 10219-23 (2009). 60. Tan, R. R., Foo, D. C. Y., Aviso, K. B. & Ng, D. K. S. The use of graphical pinch analysis for visualizing water footprint constraints in biofuel production. Appl. Energy 86, 605-609 (2009). 61. Cook, J. H., Beyea, J. & Keeler, K. H. POTENTIAL IMPACTS OF BIOMASS PRODUCTIONIN THE UNITED STA TES ON BIOLOGICAL DIVERSITY FurtherANNUAL REVIEWS. (1991). 62. SUTHER LAND, W. J. et al. One Hundred Questions of Importance to the Conservation of Global Biological Diversity. Conserv. Biol. 23, 557-567 (2009). 63. Blankenship, R. E. et al. Comparing photosynthetic and photovoltaic efficiencies and recognizing the potential for improvement. Science 332, 805-9 (2011). 64. Guo, J. et al. Light-driven fine chemical production in yeast biohybrids. Science 362, 813-816 (2018). 65. Sakimoto, K. K., Wong, A. B. & Yang, P. Self-photosensitization of nonphotosynthetic bacteria for solar-to-chemical production. Science 351, 74-7 (2016). 66. Gust, D., Moore, T. A. & Moore, A. L. Solar Fuels via Artificial Photosynthesis. Acc. Chem. Res. 42, 1890-1898 (2009). 67. Liu, C., Col6n, B. C., Ziesack, M., Silver, P. A. & Nocera, D. G. Water splitting- biosynthetic system with CO 2 reduction efficiencies exceeding photosynthesis. Science 352, 1210-3 (2016). 68. Liu, C. et al. Nanowire-Bacteria Hybrids for Unassisted Solar Carbon Dioxide Fixation to Value-Added Chemicals. Nano Lett. 15, 3634-3639 (2015). 69. Torella, J. P. et al. Efficient solar-to-fuels production from a hybrid microbial- water-splitting catalyst system. Proc. Natl. Acad. Sci. 112, 2337-2342 (2015). 70. Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. U. S. A. 102, 15545-50 (2005).

47 Acknowledge ments

I would like to thank the most crucial community that has made this work possible, the Belcher lab. I am grateful to my adviser, Prof. Angela Belcher, for her patient advising style and enthusiasm to brainstorm scientific ideas with me. Beyond my adviser, I would like to thank each of my colleagues for their discussions and support. Beyond the lab, I would like to thank MIT core facilities for their support, and the Biological Engineering department for providing a welcoming and friendly community. I would also like to thank the funding sources that have made this work possible, including the Bose Foundation and Shell through the MIT Energy Initiative. Finally, I would like to thank my friends and family. They have enabled and encouraged my passion for pursuing science and have supported me wholeheartedly on the way.