Srebp2 and Reverb-Alpha Regulation of Human Cyp8b1

Home , CYP8B1, Farnesoid X receptor

SREBP2 AND REVERB-ALPHA REGULATION OF HUMAN CYP8B1

A thesis submitted

to Kent State University in partial

fulfillment of the requirements for the

Degree of Master of Sciences

Hailin Feng

December, 2009

Thesis written by

Hailin Feng

B.S. Guangzhou University, 1992

M.S. Guangzhou Medical College, 1995

M.S. Kent State University, 2009

Approved by

______, Advisor Dr. John Y. Chiang ______, Director, School of Biomedical Science Dr. Robert V. Dorman ______, Dean, College of Arts and Sciences Dr. John R.D. Stalvey

TABLE OF CONTENTS

LIST OF FIGURES………………………………………………………………….vi

ACKNOWLEGEMENTS……………………………………………………………viii

CHAPTER

I INTRODUCTION…………………………………………………………….1

1. Bile Acids………………………………………………………………..…2

1.1 Structure and function……………………………………………………..2

1.2 Synthesis pathways and enzymes………………………………………….5

1.2.1 Classic pathway………………………………………………………….5

1.2.2 Acidic pathway………………………………………………………….6

1.3 Regulation of bile acid synthesis…………………………………………..7

1.3.1 Cholesterol homeostasis…………………………………………………7

1.3.2 Enterohepatic circulation of bile………………………………………..10

2. Nuclear Hormone Receptor…………………………………………….…..10

2.1 Structure………………………………………………………………...... 10

2.2 Response elements………………………………………………………..15

2.3 Ligands……………………………………………………………….…...16

3. Hormone Receptors Related to Bile Acid Synthesis………………….……16

3.1 Hepatocyte nuclear factor 4α (HNF4α, NR2A1)……………………..…..16

3.2 Farnesoid receptor (FXR, NR1H4)……………………………………….17 iii

3.3 Human α-fetoprotein transcription factor (CPF, NR5A2)………………..18

3.4 Reverb-α (NR1D1) …………………………………………………….....19

3.5 Small heterodimer partner (SHP, NR2A1)……………………………..…21

4. Transcription factors, co-activator and corepressor related to bile acid

synthesis……………………………………………………………………....22

4.1 Sterol regulatory element binding proteins (SREBPs)……………………22

4.2 Peroxisome proliferator-activated receptor-γ co-activator-1α

(PGC-1α)………………………………………………………………….…..24

4.3 Member of PAS super family 3 (BMAL, or MOP3)……………………...27

4.4 N-COR/histone deacetylase 3 corepressor (N-COR3)…………………....28

5. Regulation of CYP8B1 Expression…………………………………………28

6. Hypothesis, Specific aims, Approaches and Significance…………………..33

II Materials and Methods…………………………………………………….…..37

1. Cell Culture………………………………………………………………....37

1.1 Human hepatoma cell line culture…………………………………………37

1.2 Primary human hepatocyte culture………………………………………..38

2. Plasmids DNA Preparation…………………………………………………38

2.1 Large scale DNA preparation………………………………………….….38

2.2 Small scale DNA preparation……………………………………………..39

3. Preparation of Competent Cells…………………………………………….40

4. Bacterial Cell Transformation…………………………………………..….41

5. Transient Transfection Assay……………………………………...………..41

5.1) Luciferase assay…………………………………………………………..42

5.2) β-Galactosidase activity assay………………………………………..…..42

6. Mammalian One-Hybrid Assay………………………………………….…43

7. Site-Directed Mutagenesis………………………………………………….44

8. Quantitative Teal-Time PCR……………………………………………….44

8.1) RNA isolation…………………………………………………………….44

8.2) Reverse transcription PCR……………………………………………….45

8.3 Rea-Time PCR……………………………………………………...……..46

III Results…………………………………………………………………….…..48

IV Discussion………………………………………………………………….…74

APPENDIX ABBREVIATIONS……………………………………………….……79

REFERENCES………………………………………………………………….……84

LIST OF FIGURES

Figure 1. Chemical structure of cholesterol and bile acids………………………..……..3

Figure 2.Major pathways of bile acid synthesis…………………………………….…...9

Figure 3. Enter hepatic circulation of bile acid salts……………………………….……11

Figure 4. General structure of nuclear hormone receptors and types of hormone response element (HRE)………………………………………………………………….….……13

Figure 5. Model of SREBPs regulating genes related to cholesterol homeostasis….…..25

Figure 6. The partial nucleotide sequences of 5’-flanking region of the human

CYP8B1…………………………………………………………………………..…….31

Figure7. Effects of SREBP2 on human CYP8B1 reporter activity………………...…..50

Figure 8. Mapping the response element of SREBP2 on the human CYP8B1 gene…..52

Figure9. Effect of HNF4α and CPF binding site mutation on the SREBP2 inhibitory effect on human CYP8B1 luciferase reporter activity…………………………...……..54

Figure10. Mammalian one-hybrid assay………………………………………..………56

Figure11 SREBP2 influences the co-activation effect of HNF4α and PGC-1α on human

CYP8B1 reporter activity……………………………………………………..………...60

Figure.12 Dose-dependent effects of REVERB-α on human CYP8B1 reporter………62

Figure. 13 Mapping the response element……………………………………..….……64 vi

Figure. 14 Effect of Reverb-α binding site mutation on human CYP8B1 luciferase reporter activity………………………………………………………..…………….…..66

Figure. 15. Effects of hemin on human CYP8B1 reporter activity in HepG2 cells….....68

Figure. 16. Time course of hemin effects on human CYP8B1 mRNA level…………...70

Figure.17. Human CYP8B1 mRNA level after depleting heme with succinylacetone…72

vii

ACKNOWLEGEMENTS

I would like to thank my advisor Dr. John Y. Chiang, for his great guiding, valuable advice and strong support. I also thank my committee members: Dr. Hardwick and Dr.

Lee for their generous and critical comments on my thesis. I am grateful to all the members in Dr. Chiang’s lab for their help.

viii

CHARPTER I

INTRODUCTION

Cholesterol is the precursor molecule of primary bile acids including chenodeoxycholic acid (CDCA) and cholic acid (CA). Several enzymes are involved in the synthesis of primary bile acids. For example, cholesterol 7alpha-hydroxylase (CYP7A1) is the rate- limiting enzyme in classic bile acid biosynthesis. Sterol 12-hydroxylase (CYP8B1) is a liver specific enzyme that catalyzes the synthesis of CA. Importantly, CYP8B1 determines the ratio of CA to CDCA in bile. Since CA is more hydrophilic than CDCA,

CYP8B1 may determine the hydrophobicity of the bile acid pool, which in turn regulates bile acid synthesis [1]. In addition, CYP8B1 is crucial for cholesterol absorption in the intestine; therefore, this enzyme is important for cholesterol homeostasis [2, 3]. The expression of CYP8B1 is regulated by bile acids, cholesterol, insulin and diurnal rhythm, mainly at the gene transcriptional levels [3-6]. In animal models, transcription factors, such as FXR, HNF4α, SREBPs, FTF, clock gene DBP, have been identified to be involved in the transcriptional regulation of CYP8B1 gene expression [7-10]. But in human liver cell, it is not known whether CYP8B1 is transcriptionally regulated by

SREBPs and clock gene Reverb-α. The objective of this study is to identify whether human CYP8B1 promoter activity can be regulated by SREBP2 and Reverb-α, and to reveal the possible mechanisms underlying the transcriptional regulation of human

CYP8B1. The significance of this project is to provide important clues for the treatment of metabolism disease related to CYP8B1 activity, especially in cholesterol metabolism disease in human.

1. Bile Acids

1.1 Structure and function

Bile acids are the end products of cholesterol catabolism in the liver. Their common structure includes a saturated sterol nucleus and an aliphatic side chain. Bile acids are planar amphipaths. They are rigid molecules with a hydrophilic side and hydrophobic side (Fig. 1). In human, bile acids usually are classified into primary and secondary bile acids. In the human liver, cholesterol is converted into primary bile acid: cholic acid (CA) and chenodeoxycholic acid (CDCA). While CA has 3 hydroxyl groups (3α, 7α and 12α),

CDCA only has two hydroxyl groups (3α, 7α). Accordingly, CA is more hydrophilic than

CDCA. In the intestine, bacteria enzymes remove the hydroxyl group from the position 7 of the sterol, which converts the CA and CDCA into deoxycholic acid (DCA) and lithocholic acid (LCA), respectively. The amphipathic structure of bile acids makes them as excellent detergents for lipid absorption and transportation. Therefore, bile acids act as physiological detergent to solubilize many lipids. In physiology conditions, bile acids are present as sodium salts, and are conjugated with taurine or glycine [11-13, 126-127].

Fig. 1

Fig. 1. Chemical structure of cholesterol and bile acids. In the human liver, cholesterol is converted into two major primary bile acids: cholic acid and chenodeoxycholic acid; in intestine, cholic acid and chenodeoxycholic acid are converted into secondary bile acids: deoxycholica acid and lithocholic acid, respectively.

1.2 Synthesis pathways and enzymes

In the liver, there are two major bile acid synthesis pathways. One is the “classic or neutral pathway”; another is “acidic or alternative pathway” [11-14]. The conversion of cholesterol to bile acids includes about 15 steps (Fig. 2). Briefly, the ring structure of cholesterol is hydroxylated and oxidized by multiple steps, and the side chain is shortened. These complicate chemical reactions involve different enzymes that are located in endoplasmic reticulum, mitochondria, cytosol and peroxisome of the cell. In the classic pathway, cholesterol 7α-hydroxylase (CYP7A1) is the rate-limiting enzyme located in the microsome of the liver cell. However, the acidic pathway is initiated by mitochondrial sterol 27-hydroxylase (CYP27A1). The classic pathway produces about

80% of bile acids in human body. In contrast, less than 18% of bile acids in the liver are produced through the acidic pathways.

1.2.1 Classic pathway

As illustrated in Fig. 2, rate-limiting enzyme CYP7A1 converts cholesterol into 7α hydroxycholesterol. Then, 3β-hydroxy-27-steroid dehydrogenase (3β-HSD), an isomerase in microsome, catalyzes 7α-hydroxycholesterol into 7α-hydroxy-4-cholesten-

3-one. Subsequently, 7α-hydroxy-4-cholesten-3-one is hydroxylated at C-12 position by microsomal P450 enzyme CYP8B1, to form 7α, 12α-dihydroxy-4-cholesten-3-one. This intermediate can then be reduced by cytosolic enzymes 4-3-oxosteroid-5-reductase

(AKR1D1) and 3-hydroxysteroid dehydrogenase (AKR1C4) to form 5β-cholestan-3α, 7α,

12α triol. Mitochondrial sterol 27-hydroxylase then oxidizes the steroid side-chain of 5β-

cholestan-3α, 7α, 12α triol to form 3α, 7α, 12α-trihydroxy-5β-cholestanoic acid. The intermediate is cleavage in peroxisome and finally synthesis CA [11]. As a side reaction,

7α-hydroxy-4- cholesten-3-one can remain unhyroxylated at the C-12 position, but converted by cytoplasm enzymes 4-3-oxosteriod-5-reductase (AKR1D1) and 3- hydroxysteriod dehydrogenase (AKR1C4) to form 5β-cholestan-3α, 7α, diol, which is further converted to 3α, 7α-dihydroxy-5β-cholestanic acid by CYP27A1 in the mitochondrial. Further it is converted into CDCA by side-chain cleavage in peroxisome.

Apparently, 7α-hydroxy-4-cholesten-3-one is the precursor of CA to CDCA. It has been shown that CYP8B1 regulates the ratio of CA and CDCA [1]. Therefore, CYP8B1 determines the hydrophobicity of the bile acids pool in human [15].

1.2.2 Acidic pathway (Alternative pathway)

In human, less than 20% of bile acid is synthesis through this pathway [16]. CDCA is the major product of the alternative pathways. CYP27A, the rate-limiting enzyme of this pathway, hydroxylates cholesterol at C-27 to form 27-hydroxycholesterol, and then oxidizes it into 3β-hydroxy-5-cholestenoic acid [17]. These two intermediates are converted to 7α, 27-dihydroxycholesterol and 3α, 7α-dihydroxy-5-cholestenoic acid by oxysterol 7α-hydroxylase (CYP7B1), respectively. Other enzymes involved in acidic pathway are still not well clarified. Because liver is the only organ that contains the whole set of bile acid synthesis enzymes, the intermediates, which are produced by

CYP27A and CYP7B1 in the peripheral tissues, need to be transported to the liver to synthesis bile acids. Acidic pathway becomes to be a major bile acids synthesis pathway in patients with liver diseases.

1.3 Regulation of bile acid synthesis

Since bile acids play an important role in dietary lipids uptake and cholesterol elimination, tightly regulation of bile acids synthesis is necessary for keeping the cholesterol and lipid homeostasis. Whereas bile acids may inhibit their synthesis, cholesterol (as the precursor of bile) may stimulate bile acid synthesis.

1.3.1 Cholesterol homeostasis

Cholesterol exerts multiple biological functions. For example, it is essential for the integrity of cellular membrane. Also, it is the precursor of bile acids and steroid hormone.

However, high level of cholesterol in liver cell may be toxic, and high level of cholesterol in serum may induce atherosclerosis [18, 19]. Therefore, cholesterol homeostasis is not only related to bile acid synthesis, but also involved in many pathological metabolic pathways. For example, in plasma buildup levels of cholesterol and related lipids circulating are important predictive tools to gauge risk of cardiac events [20]. Cholesterol is a lipid in circulation; it requires a transport vesicle to shield it from the plasma.

Cholesterol and lipids may be transported by micelle-like proteins and lipids through the vascular system. Among them, high density lipoprotein (HDL) particles promote vascular health by extracting cholesterol from tissue and delivering it back to liver. On the contrary, low-density lipoproteins (LDLs) are the classic antagonists of the circulatory system due to their propensity to bind to connective tissue in the intimal sub-layer of arteries [21]. Once delivered to the liver via HDL, the cholesterol will be converted by

CYP7A1 into bile acids. Transcriptional activity of CYP7A1 decides the efficacy of the cholesterol catabolic pathway, and is critical to hepatic cholesterol homeostasis [22]. For

example, the hepatic cholesterol content increases two folds in patients with deficit

CYP7A1 (homozygous deletion mutation of CYP7A1). Thus, these patients may develop hyperlipidemia, premature coronary, peripheral vascular disease and premature gallstones

[23]. In order to balance the cholesterol levels in the liver, cholesterol homeostasis is maintained by complex input and output pathways. The input of cholesterol into liver is mainly mediated through four pathways: 1) de novo synthesis of cholesterol, derived from acetyl CoA by 3-hydroxy-3-methyl glutaryl-CoA reductase (HMG-CoA reductase) in the liver. 2) cholesterol absorption from diet, during which chylomicron remnants transport cholesterol into the liver. 3) low-density lipoprotein (LDL) particles may uptake cholesterol by means of endocytosis through LDL receptor. 4) reverse transportation of cholesterol by high density lipoprotein (HDL) to transport cholesterol from peripheral tissues into the liver. Three pathways are involved in the output of cholesterol from the liver: 1) free cholesterol in the liver may be converted into cholesterol ester by hepatic

Acyl-CoA-cholesterol acyltransferase (ACAT2) and assembled into very low density lipoprotein (VLDL). VLDL particles are further converted into intermediary density lipoprotein (IDL) and LDL, which are uptaken through LDL receptors and LDR receptor related proteins located in peripheral tissue. 2) some of cholesterol may be converted into bile acids. Bile acids are secreted into the intestine and reabsorbed into liver via the transporter sodium taurocholate cotransporting polypeptide (NTCP). 3) free cholesterol may be excreted into the bile and lost in the feces. Thus, 50% of cholesterol is converted into bile acid in the liver, and 40% cholesterol is transported into bile with the flow of bile and phospholipids; 10% of total cholesterol is used for synthesis of steroid hormone.

Fig. 2

From Dr. John Y.L. Chiang‟s article in Endocrine Reviews 24(4):443-463. 2000

About 95% of the bile acids are reabsorbed into the terminal ileum and transported back to the liver via portal circulation. Only 5% of bile acids are eliminated through the feces and is compensated by de novo synthesis [12].

1.3.2) Enterohepatic circulation of bile

In the liver, bile acids are conjugated with taurine or glycine and excreted into bile and stored in the gallbladder. With the contraction of gallbladder after the meal, bile acids are secreted into the duodenum for the absorption of lipid and lipid soluble substances. About

95% of bile acids are reabsorbed by the enterocytes and transported back to the liver through the portal blood [24, 25]. This process is called “enterohepatic circulation” of bile acids (Fig. 3). The bile acids returned to the liver may inhibit the bile acid synthesis, presumably through SHP-dependent and SHP-independent mechanisms. The molecular mechanisms of bile acids feedback inhibition may be related to the transcriptional regulation of bile acid synthesis enzymes by nuclear receptors.

2. Nuclear hormone receptor

Nuclear hormone receptors (NRs) are a class of transcription factors that are activated by hormone signals, and bind specific response elements on the target gene promoter, and regulate the transcription activity of target genes [13, 26].

2.1 Structure

The NRs generally have six domains to conduct their different functions (Fig. 4). The N- terminal is the variable ligand-independent activation function-1(AF-1or A/B) region, which has weak action but has synergetic effects with AF-2 domain. The region

Fig. 3

Fig. 3. Enterohepatic circulation of bile salts. Bile acids are produced in the liver from cholesterol and stored in the gallblader. After each meal, they will be secreted into intestine and help the absrobsion of lipid. Most of the bile acids will be reabsorbed at the ileum and the portal blood. Only 5% of bile acid will be lost through colon as feces.

Fig. 4

N-terminal C-terminal Domain Domain

AF-1 DBD Hinge LBD AF-2

A/B C D E F

Palindromic repeat AGAACA n TGTTCT n=3 GR–GR PR–PR AR–AR MR–MR

Direct repeat AGGTCA n AGGTCA n=1-5 RXR-RXR -PPAR -VDR -LXR -RAR

Everted repeat TGAACT n AGGTCA n=x RXR-PXR

Inverted repeat AGGTCA n TCAACT n=x FXR-RXR

Monomeric site xxx-ATTGCA Reverb

Fig. 4. General structure of nuclear hormone receptors and types of hormone response element (HRE). The typical architecture of nuclear receptors has six domains

(A-F). The specificity of NRs is mainly determined by HRE and the space (n) between each hexameric half-site. GR-glucocorticoid receptor, PR-progesterone receptor, AR- androgen receptor and MR-mineral corticoid receptor, all are homodimers. Except RXR- retinoid acid receptor, PPAR-perixosome proliferation activation receptor, VDR-vitamin

D receptor, LXR-Liver X receptor, RAR-retinoic acid receptor, PXR-pregnane X receptor, FXR-farnesoid X receptor, all are heterdimers with RXR. Reverb is a monomer, xxx indicate 5‟ up-stream of Reverb binding site, A/T rich region.

following the AF-1 is the highly conserved DNA-binding domain (DBD). This region contains two zinc fingers, which bind to a specific DNA sequence, i.e. hormone response elements (HRE), on the regulated gene. A variable hinge region is located between DBD and ligand binding domain (LBD). The specific ligand binds to the LBD and allows the homo and/or heterodimerization of NRs. Also, LBD can bind co-activator or corepressor of NRs. The LBD contains the activation function 2 (AF-2) whose action is dependent on the presence of bound ligand. The C-terminal domains of NRs are variable in different

NRs [13, 27].

2.2 Response elements

A hormone response element (HRE) is a short nucleotide sequence within the promoter of a gene that is able to bind a specific hormone receptor complex and regulates gene transcription. A typical HRE has two consensus hexameric half-sites, and the specific

DNA sequence can be recognized by specific NR because of that the binding activity of the NR is significantly increased. In addition, the number of base pairs between two half- sites and the orientation of the two half-sites may also contribute to the specificity of the

NR in regulation of certain genes. The two half-site may be orientation as direct repeats

(DR), inverted repeats (IR), everted repeats (ER) [28]. However, some NRs, such as

Reverb and human FTF-CPF bind to HRE as a monomer. The consensus DNA binding sites for NRs are illustrated in Fig. 4.

2.3 Ligands

The typical model of steroid hormone receptors in activation of gene transcription is through its specific hormone ligand binding. Upon the ligand binding NR is dissociated from heat shock protein and is translocated from cytosol into the nucleus. NR is bound to specific HER in the target gene promoter. Bile acids and oxysterols are ligands of FXR and LXR, respectively. The NRs without known ligands are termed “orphan receptors”

[29]. HNF4, FTF or CPF and SHP are the examples of orphan receptors. Although

Reverb-α has been defined previously as an orphan receptor, recent studies have revealed that heme might be its ligand [30]. Therefore, nuclear hormone receptors of transcription factors actually include an extended group of “orphan” receptors, in addition to receptors for classical hormones, such as retinoid, vitamin D and thyroid hormone (T3) [31].

3. Hormone receptors involved in transcriptional regulation of bile acid synthesis

3.1 Hepatocyte nuclear factor 4α (HNF4α, NR2A1)

HNF4α is orphan nuclear hormone receptor. It is highly expressed in the liver [32].

HNF4α forms a homodimer that binds to the DR1 site on its target gene. HNF4α can constitutively activate genes related to energy metabolism, xenobiotic detoxification and bile acid synthesis [33-36]. In regulation of bile acid synthesis, HNF4α binds and stimulates the activity of CYP7A1, CYP8B1 and CYP27A1. On human CYP8B1 promoter, one HNF4α binding site, which overlaps with the CPF, has been identified

[10]. The mutation of the binding sites of HNF4α on the promoter of these genes led to a significant decrease of the basal transcription levels [37-39]. HNF4α is also essential for

the early development and differentiation of the liver. Disruption of HNF4α in mice is embryonic lethal. The transcriptional activation of target genes by HNF4α is associated with the recruitment of co-activator proteins, which is able to mediate chromatin remodeling [40].

3.2 Farnesoid Receptor (FXR, NR1H4)

FXR is highly expressed in the liver, the intestine, the adrenal and kidneys [41, 42].

Usually, FXR is heterodimerized with RXR and binds to IR-1 motifs. The ligands of

FXR include farnesoids, all trans-retinoic acid, and juvenile hormone III. Bile acids, especially CDCA, have been identified as the endogenous ligands of FXR [43, 44]. FXR plays an important role in the regulation of bile acid synthesis and transportation. FXR inhibits the expression of bile acid synthesis enzymes, including CYP7A1, CYP8B1, and

CYP27, through multiple mechanisms [37, 45, 46]. However, the direct binding site of

FXR has not been found on the CYP7A. So far, two mechanisms underlying FXR- dependent inhibition have been established in CYP7A1 regulation. One mechanism is that in the liver FXR induces the expression of SHP; SHP interacts with HNF4α and competes with its co-activator PGC-1α. Another mechanism involves the intestine FXR.

FXR induces intestine hormone, fibroblast growth factor 19 (FGF19) to activate FGF receptor 4 (FGFR4) in the liver, which will then inhibit CYP7A1 expression through

MAPK/ERK1/2 signal pathway [47]. Recently, a direct binding site of FXR has been identified at the distal promoter of human CYP8B1. Treatment with an agonist of FXR,

GW4060 dramatically increases the transcriptional activity of human CYP8B1 promoter

[48]. Previous studies have identified that bile acid/FXR induces SHP to inhibit rat

CYP8B1 activity. Therefore, the bile acid-induced modulation of human CYP8B1 might be tightly regulated by the balance of FXR inhibition and stimulation, and this might be responsible for the modest bile acid response in human CYP8B1. The binding sites of

FXR have been identified on the BSEP and NTCP promoter. Through inducing BSEP to excrete bile acids from the liver or inhibiting NTCP to uptake bile acid back into the liver, FXR exerts important function in protecting liver from toxic actions of high bile acid levels [49, 50]. Moreover, FXR regulates a lot of genes and metabolism processes; for example, it is involved in the reduction of serum triglycerides and VLDL, and the enhancement of the biliary excretion of cholesterol [51, 52]. Also, FXR controls the adaptive response of the liver during the fasting-refeeding transition [53].

3.3 Human α-fetoprotein transcription factor (hFTF or CPF, NR5A2)

Human FTF belongs to the Fushi-tarazu-factor-1 (Ftz-F1) family of nuclear receptors.

The mouse homology is called liver related homology-1(LRH-1). In human, it is termed

CPF [54, 55]. FTF plays important role in the regulation of cholesterol, bile acid, and steroid hormone homeostasis. FTF is expressed in the liver, intestine and pancreas, and binds as monomer to the core DNA sequence 5‟-TCAAGGTCA-3‟. Its binding site is usually overlapping with HNF4α. FTF binding site has been identified in CYP7A1,

CYP8B1, HNF4α and SHP [55-58]; but the transcription activity of FTF on CYP7A1 or

CYP8B1 is quite weak comparing with HNF4α. Human FTF acts as a weak transcription activator to stimulate human CYP8B1 expression [10]. Due to the competition with the binding of HNF4α, bile acids induce the inhibitory effects of FTF on human CYP7A1 and rat CYP8B1 transcriptional activity. There is species difference in FTF with regard to

the regulation of bile acids synthesis enzymes. In hepatocyte-targeted LRH-1 knockout

(hepKO) mice, CYP7A1 mRNA level showed no significant change comparing with the control, but CYP8B1 mRNA level was decreased 10 folds. Thus, bile acids compositions were changed according to the decreasing CYP8B1 mRNA levels in hepKO mice [59].

These results indicate that CYP7A1 and CYP8B1 are regulated differently by LRH-1.

3.4 Reverb-α (NR1D1)

Reverb-α is originally identified as an orphan nuclear receptor. It is expressed in many tissues, such as the liver, white and brown adipose tissues, muscles and the brain [60-62].

Reverb-α binds as monomer to an specific Reverb-α response element (RevRE) consisting of a 6-bp core motif (A/G)GGTCA flanked by A/T-rich 5‟ sequence, or as a homodimer to a RevDR2 element composed of a direct repeat of the core motif spaced by two nucleotides [63, 64]. The expression of Reverb-α is extensively regulated by circadian rhythm in serum synchronized fibroblasts in vitro, as well as in the liver, the brain and white and brown adipose tissues in vivo. Thus, the nuclear receptor Reverb-α has been identified as a clock gene [61, 65-68]. It has been well documented that Reverb-

α plays as a key regulator in maintaining energy homeostasis, adipogenesis and inflammation [62, 69-71]. Recently, heme has been demonstrated as the ligand of

Reverb-α by directly binding at the ligand-binding domain of Reverb-α [30]. In rodents, bile acid synthesis displays a diurnal rhythm and Reverb-α is one of the clock genes that involved in the regulation of bile acid synthesis. The CYP7A1 expression is induced by

D-site binding protein (DBP) and Reverb-α, but inhibited by other clock genes, such as

DEC2 and E4BP4 [72]. The mechanism by which Reverb-α activates mice CYP7A1

expression might be an indirect pathway. Reverb-α directly binds at the promoters of two inhibitors of CYP7A1 (SHP and E4BP4), and suppresses the expression of these inhibitors; subsequently, it will increase the CYP7A1 expression [73]. The regulation of human CYP8B1 by Reverb-α is still not clear, although this enzyme also exhibits circadian rhythm as CYP7A1. The heme might regulate the expression of target genes of

Reverb-α, by modulating the affinity of the ligand binding domain of NRs to its corepressor NCOR. The heme is a prosthetic group that consists of an iron atom contained in the center of a protoporphyrin IX. Approximately 15% of heme synthesis occurs in the liver where heme is incorporated into a number of metabolic enzymes (e.g. p450s).

Others are synthesized in erythroid progenitors by incorporation primarily into hemoglobin [74]. The synthesis of heme occurs in both cytosol and mitochondria, and finally formed in mitochondria. In the liver, enzymes for heme biosynthesis are subject to rapid turnover and are able to respond to the changing metabolic environment. However, the synthesis in the erythroid cell is regulated primarily by the availability of iron [74].

The rate-limiting step in heme synthesis is catalyzed by two distinct aminolevulinate, delta-, synthases (ALAS), ALAS1 and ALAS2. ALAS1 is ubiquitously expressed while

ALAS2 is only expressed in erythroid progenitors. The heme synthesis pathway is initiated by forming D-Aminolevulinic acid (dALA or δALA) from the amino acid glycine and succinyl-CoA from the citric acid cycle (Krebs cycle). The rate-limiting enzyme responsible for this reaction, ALA synthase, is strictly regulated by intracellular iron levels and heme concentration [75]. Studies have shown that the PGC-1α can directly regulates the expression of ALAS1 and hence heme synthesis [76].

3.5) Small heterodimer partner (SHP, NR2A1)

Small heterodimer partner (SHP) is an unusual orphan nuclear receptor. Its structure and function are different from conventional NRs. SHP lacks a conserved DNA-binding domain, but contains a ligand binding domain and an inhibition domain that can interact with numerous NRs and enable SHP to suppress the transcription activity of multiple

NRs. Different models for SHP inhibitory effects on gene transcription have been proposed: 1) Competition with co-activator that binding to NRs. 2) Activation repression via recruitment of SHP-associate corepressor. 3) Inhibition of NR DNA binding or displacement of SHP-NR complexes from target DNA. The transcriptional activity of many transcription factors, such as FTF, RAR, CAR and HNF4α, has been reported to be suppressed by SHP [77, 78]. Since these NRs are involved in lipogenesis, metabolism of cholesterol, bile acid, xenobiotoic, and glucose, SHP plays important roles in the negative regulation of multiple pathways and target genes involved in homeostasis of bile acids.

Under conditions with high levels of bile acids, SHP inhibits enzymes involved in bile acids synthesis, including CYP7A1, CYP8B1, and CYP27A1. It has been demonstrated that SHP interacts with histone deacetylase-1(HDAC-1) and histone methyltransferase

G9a through its C- and N-terminus, respectively, which results in deacetylation and demethylation at the H3K9. The conformational change of H3K9 after deacetylation and dimethylation will facilitate the recruitment of the Swi/Snf-Brm complex on CYP7A1 promoter, and further silence the CYP7A1 gene expression [79]. On human CYP8B1 promoter, SHP inhibits CYP8B1 promoter activity by competing with the co-activator of

HNF4α, PGC-1α [10]. Moreover, SHP transcription is also tightly regulated by other

nuclear receptors, such as FTF and FXR; both of them can stimulate SHP expression

[80].

4. Transcription factors, co-activator and co-repressor involved in regulation of bile acid synthesis

4.1 Sterol regulatory element binding proteins (SREBPs)

The SREBPs control cholesterol and lipid metabolism, and play critical roles in adipocyte differentiation and insulin-dependent gene expression [81, 82]. There are three different

SREBP proteins, SREBP1a, SREBP1c and SREBP2. Among these, SREBP1a and

SREBP1c, differing in the length of their N-terminal transactivation domains, originate from a single gene (human chromosomal 17p11.2). SREBP1a has longer AF1 domain, which makes it a stronger activator than SREBP1c. SREBP2 is encoded by a different gene on human chromosome 22q13. SREBPs also have different amino terminal domains that confer different functions in regulation of gene transcription. The major function of

SREBP2 is the participation in the biosynthesis of cholesterol. According to previous findings, SREBP2 might also play a role in the insulin signaling pathway [83, 84].

SREBP1a and SREBP1c are more likely to be involved in the regulation of genes involved in fatty acid biosynthesis. In addition, SREBP1c can mediate insulin signaling pathway to inhibit human CYP7A1 expression [85]. The well established cholesterol- regulated mechanism of proteolytic cleavage and activation of SREBPs is illustrated in

Fig. 5. The SREBPs are synthesized as large precursor proteins that are inserted into the endoplasmic reticulum (ER) membrane through two membrane-spanning domains. In the

ER, the C-terminus of the SREBP interacts with a protein, SCAP (SREBP-cleavage-

activating protein), which functions as the sensor of sterols. When the cell cholesterol builds up in the ER membranes, the sterol binds to SCAP, which triggers a conformational change that causes SCAP to bind to Insig. The SCAP/SREBP complex remains in the ER by binding to insulin-induced gene (Insig-1, 2a and 2b) [86]. When internal cellular sterol level is low, SCAP escorts the SREBPs from the ER to the Golgi, where they are processed by another two membrane-associated protease, the site 1 (S1P) and site 2 (S2P) proteases. Then the matured forms of SREBPs are released and translocated into the nucleus and regulate target genes, including genes synthesis and metabolism of cholesterol. Then, the transcriptional activation of genes related to cholesterol synthesis is blocked. One of the SREBPs, SREBP1c, can be activated by LRH and insulin mainly through down-regulation of the expression of Insig-2a. SREBP1c might be involved in the delayed inhibitory effects of insulin on the CYP7A1 expression caused by prolonged insulin treatment. Interestingly, the molecular mechanism of the

SREBP1C regulation of bile acid synthesis has species difference. On human CYP7A1 promoter, SREBP1c competes with HNF4α co-activator PGC-1α and inhibits CYP7A1 expression [87]; whereas on the rat CYP7A promoter, insulin activation of p38 kinase pathway results in an increase of HNF-4 alpha protein and a concomitant induction of

7alpha-hydroxylase expression [88]. When SREBP1a or SREBP1c is cotransfected with the rat CYP8B1 promoter in the HEK 293 cells, SREBP1 can strongly stimulate the

CYP8B1promter activity. However, when SREBP2 is cotransfected with the rat

CYP8B1promoter, SREBP2 can inhibit CYP8B1 promoter activity [7, 9]. SREBP also suppresses the human CYP7B1 luciferase reporter activity indirectly by interaction with

Sp1 [89]. In addition, protein SREBP2 has been reported to be able to interact with two important transcription factors of CYP8B1: HNF4α and LRH [7, 9]. In addition to the classic sterol activation of SREBP pathway, alternative mechanisms have also been reported in activation of SREBPs [90].

4.2 Peroxisome proliferator-activated receptor-γ co-activator-1α (PGC-1α)

Transcription factors have the capability to „recognize‟ specific DNA sequences, but they usually lack the enzymatic activities necessary to modify chromatin, unwind DNA, and recruit RNA polymerase II. These biochemical activities are performed by coregulators, which usually exist as multiprotein complexes in nucleus, and can be recruited to transcription factors in response to cellular signals. Among them, PGC-1α is one of the well studied co-activators, and it can increase the transcription of NRs without direct binding of the specific DNA sequence. The mechanism of the enhancement of NR transactivation might be due to the recruitment of other co-activators that have the histone acetyltransferase (HAT) activity, which is similar to steroid receptor co-activator-

1 (SRC-1) and CREB ( cAMP response element binding protein) [91]. PGC-1α is regulated by nutritional and hormonal signals as well as by circadian pacer makers [92,

93], and it integrates diverse biological processes. Studies in hepatocytes both in vitro and in vivo have demonstrated that PGC-1α is able to activate nearly all aspects of the

Fig. 5

Fig. 5. Model of SREBPs regulating genes related to cholesterol homeostasis. (A)

When cells are deprived of sterols, SCAP escorts SREBPs from the ER to Golgi through binding the COPII proteins. In the Golgi, the SREBPs are protecolytically processed to generate the bHLH-Zip domain of SREBP, which enters the nucleus and binds to a sterol response element (SRE) in the enhancer/promoter region of genes or indirectly regulates genes related to cholesterol synthesis and uptake. (B) When cellular cholesterol rises, cholesterol binding triggers a conformational change of SCAP and causes SCAP to bind to Insig. Therefore, COPII protein cannot bind to SCAP, and SCAP remains in the ER occupied by SREBPs. SREBP cannot transport in to the nucleus. SCAP: SREBP cleavage-activating protein; COPII: coat protein complex II; Insig-1: insulin-induced genes; SREBP: sterol response element binding protein-1; SRE: sterol response element;

Reg: Regulation domain; bHLH-Zip: basic- helix- loop-helix leucine zipper domain.

hepatic fasting response, including gluconeogenesis, fatty-acid β-oxidation and bile acid synthesis. It does so by coactivating key hepatic transcription factors, such as HNF4α,

GR, FOXO1, FXR and LXR, and by directly stimulating the target gene promoter [94].

In the bile acid synthesis, PGC-1α interacts with HNF4α to stimulate CYP7A1 gene transcription [95], while PXR can down regulate CYP7A1 by disrupting the interaction between HNF4α and PGC-1α [96].

4.3 Member of PAS super family 3 (BMAL, or MOP3)

Circadian rhythmicity is a fundamental characteristic of organisms, which ensures that vital functions occur in an appropriate and precise temporal sequence and in accordance with cyclic environmental changes. Living beings are endowed with a system of biological clocks that measure time on a 24-hr basis, termed the circadian timing system.

In mammals, the system is organized as a master clock located in the suprachiasmatic nucleus (SCN) of the hypothalamus, commanding peripheral clocks located in almost every tissue of the body. Bmal-1 is one of the clock genes (such as Clock, Per1-2, and

Cry1-20). The molecular mechanism of the circadian rhythm in mammals as other organisms followed the transcriptional positive-negative feedback loop [97, 98]. Bmal and Clock are positive elements which activate transcription factors. They both possess basic helix-loop-helix (bHLH) and PAS (Per-Arnt-Sim) domains, and form heterodimers.

Baml-1 activates the transcription of clock genes via E-box elements in the promoter regions of clock genes. Bmal-1 knockout mice have been reported to become arrhythmic under constant dark (DD) conditions [99].

4.4 Nuclear regulator co-repressor/histone deacetylase 3 corepressor (N-CoR3).

Although activation of transcription has long been recognized as an essential component of gene regulation, the fundamental role of transcription repression in gene regulation has only been revealed recently. Repressive factors use several distinct mechanisms, including competition with activator proteins for DNA binding, sequestration of activators, interacting with the core transcriptional machinery, DNA methylation and recruitment of complexes that have histone deacetylase activity. N-CoR3 is one of the corepressors whose inhibitory effect is depended on the histone deacetylases. N-CoR3 contains a conserved bipartite nuclear-receptor-interaction domain (NRID) [100], and three independent repressor domains that can actively repress a heterogeneous DNA- binding domain [101]. Since acetylation of specific lysine residues in the N-termini of histones correlates with increased transcription, therefore, histone deacetylase complexes

(HDACs) can change the conformation of the chromatin and inhibits the gene transcription. In vitro, N-CoR3 can directly interact with HDACs and form a complex

[101, 102]. It has also been implicated as a co-repressor for a variety of unrelated transcription factors, such as Pit1, Oct-1, and their functions are related to development and evolution [103]. NcoR3 has been demonstrated to be a master regulator of circadian rhythm. It is recruited by Reverb-α either on the mouse or human Bmal1 promoter and decreased histone acetylation [104].

5. Regulation of CYP8B1 Expression

CYP8B1 is a p450 enzyme that is unique for cholic acid biosynthesis in the liver. The full length of rabbit CYP8B1 cDNA has already been cloned in 1996 [105]. Later, human,

mouse, rat and pig CYP8B1 genes were cloned [106-108]. Characterization of human and mouse CYP8B1 genes structure has identified that this gene is devoid of introns. The cDNA coding region of CYP8B1 shows a high degree of homology among different species, while promoter sequence varied between individual species. The 5‟ human

CYP8B1 promoter sequence is illustrated in Fig. 6. The TATA box is located at -56 to -

51 [106]. Previous revealed that the sequences from -57 to +300 were important for basal and liver-specific human CYP8B1 promoter activities. Deletion the sequence from +248 to +300 reduced the CYP8B1 promoter activity by 75%, relative to the CYP8B1-

514/+300Luc. Deletion of the sequence from +180 to +248 further reduced the promoter activities to 10%. Sequence between +180 and +300 was important for the liver-specific transcription of the human CYP8B1, and HNF4α can strongly activation of human

CYP8B1 promoter activity [10].

Several studies have revealed the transcription factors and mechanisms related to

CYP8B1 regulation by cholesterol. It has been shown that cholesterol feeding down- regulated rat CYP8B1 expression, through a molecular mechanism related to SREBP2

[5]. On the rat CYP8B1 promoter, SREBP-2 can mediate suppression of CYP8B1 promoter activity by interference the FTF binding to the promoter [6]. On the contrary,

SREBP1 stimulates CYP8B1 expression by binding to two inverted sterol regulatory elements that are located at 300 nucleotides upstream of the transcriptional initiation site

[7]. The bile acid synthesis enzymes, such as CYP7A1and CYP8B1, are regulated by the circadian rhythm. It has been observed that the activity of rat CYP8B1 is maximum at

1:00~4:00 pm and minimum at 1:00am, while the activity peak of CYP7A1 enzyme is at

10:00pm [6]. The liver clock gene albumin D-site binding protein (DBP) can up-regulate

CYP7A1 and CYP8B. In contrary to DBP, DEC2 exerts an inhibitory effect on CYP7A and CYP8B [6]. Recently, Reverb-α has been identified as another clock gene to be involved in regulation of bile acid synthesis.

Similar to CYP7A1, CYP8B1 is negatively regulated by bile acids CA, CDCA and DCA

[5, 109]. The rat CYP8B1 promoter has a bile acid response element (BARE) that has an

HNF4α binding site embedded in two overlapping FTF biding sites [39]. But on the human CYP8B1 promoter, only one FTF binding site and HNF4α binding site is overlapped [10]. The mechanism of bile acids inhibition of CYP8B1 varies among different species. Bile acid/FXR can induce SHP interaction with FTF, and thus inhibits rat CYP8B1 gene transcription [39]. On the human CYP8B1 promoter, SHP might directly interact with HNF4α and/or inhibit HNF4α expression to down-regulate the

CYP8B1 activity [10]. Recently, a FXR binding site has been identified on the remote site of human CYP8B1 promoter sequence, which may stimulate CYP8B1 promoter activity [48]. This finding might explain the reason that bile acids moderately suppress the activity of CYP8B1. The effect of bile acids on CYP8B1 may be due to the balance of the negative and positive response elements. In SHP-/- mice, bile acids reduce CYP8B1 expression, indicating that other pathways might be involved in the suppression of

CYP8B1 [110]. In contrast, recent studies, using liver-specific FXR knockout mice, support that CYP8B1 is mainly regulated by the liver FXR/SHP pathway [111]. In the

Fig. 6

-112 tgattcatttctaccaactgaactggcaaataaataaaagcatgagt TATA Box -65 aaatgggggtataaatagtctgtcagctatgggggtgggagtgggctcaaggcaggctta

(+1) HRE/Reverb-α -5 gagagaaggtgcaagagctgtctgaaaaggtcagagcaaagcatgaagctggtgagcagc

+56 tgtgaccatagctggaagcttctctctgagctttctcctggttacctcctcctcccctac

+116 gtgaccagtcagccaagtgttaagtccaggggaacattttgctgcttccaagtactgtct

HNF4α and CPF +176 cactagtgttatttgccataacttgcggccacagggcaaggtccaggtgctcagaccttt

+237 acatcctggactttccaaggcctcccaaagctctctggcacccagggaacagtgtgcgtg

Met +297 tcgagagcttaatccgcaggagcatagccatg

Fig. 6. The partial nucleotide sequences of 5’-flanking region of the human CYP8B1.

The putative Reverb-α and HNF4α response element are shown in bold black low case.

The transcription start site (+1) is an “a” located 325 base pairs upstream of the start codon.

hepKO mice, CYP8B1 mRNA level was significantly decreased and cholic acid was eliminated [59, 112]. These studies indicate that LRH-1 is necessary for FXR inhibition of CYP8B1 gene transcription. In addition, SHP-independent pathway, probably through an inflammatory cytokines IL-2 and MAPK signaling mechanism, might contribute to the inhibition of CYP8B1 gene transcription [113]. In addition to the bile acids, some hormones also can regulate CYP8B1 expression. For example, the CYP8B1 level is increased in streptozotocin-induced diabetic rats, but the CYP8B1 level is suppressed after insulin administration. The CYP8B1 mRNA level of rat hepatoma cell line is suppressed by insulin [4]. These results indicate that rat CYP8B1 expression is regulated by insulin in hepatocytes. Moreover, the sterol-12α-hydroxylase activity in rat livers is stimulated by thyroidectomy, but inhibited by thyroid hormone [114, 115]. However, the direct binding sites for thyroid hormone have not been revealed on the CYP8B1 promoter.

6. Hypothesis, Specific Aims, Approaches and Significance

It has been well established that CYP8B1 transcription is strongly regulated by cholesterol, insulin and circadian rhythm. Different NRs, including HNF4α, FXR,

SREBPs, FTF, and DBP, may be involved in the biological regulation of CYP8B1.

Among these factors, SREBPs are involved in the synthesis of cholesterol and fatty acids.

In particular, SREBP2 acts as a cholesterol level sensor in the cell and keeps the homeostasis of the cholesterol by regulating cholesterol synthesis and catabolic enzymes, such as HMGCR and CYP8B1. Although rat CYP8B1 promoter may be suppressed by

SREBP2, it is still unclear whether SREBP2 also is involved in the regulation of human

CYP8B1.

Cholesterol homeostasis can be interrupted by Clock gene mutation [116]. This indicates that enzymes as CYP7A1 and CYP8B1 may also be regulated by clock genes. A diurnal variation of cholic acid and chenodeoxycholic acid concentration has also been demonstrated in human, with a peak in the morning and nadir in the night [117]. Reverb- alpha is one of the clock genes involved in regulation CYP7A1. By sequencing human

CYP8B1 promoter, a Reverb-α response element has been identified on the promoter of

CYP8B1 [10]. At present, it is still unclear whether Reverb-α is involved in the transcriptional regulation of human CYP8B1 and influence the cholesterol homeostasis.

Heme level can regulate the expression of the target gene of Reverb-α [30]. Previous study has revealed that the step-limiting enzyme of heme synthesis (ALAS) can be inhibited by the increased level of insulin [118]. In addition, SREBP2 is a molecule at the downstream of insulin signaling pathway. Therefore, heme might act as a common factor in the regulation of CYP8B1 by insulin and circadian rhythm pathway. However, the heme regulation of human CYP8B1 promoter activity and mRNA expression remains to be elucidated.

Hypothesis 1: SREBP2 has inhibitory effects on human CYP8B1 gene expression by competing with the recruitment of PGC-1α to the CYP8B1 promoter.

Hypothesis 2: Reverb-α inhibits human CYP8B1 promoter activity by binding at the

RevRE on human CYP8B1 promoter. An increase in heme, the ligand of human Reverb-

α, may reduce CYP8B1 mRNA expression, and enhance the inhibitory effects of Reverb-

α on human CYP8B1 transcriptional activity.

Specific Aim 1: SREBP2, as a cofactor or transcription factor, inhibits human CYP8B1 gene expression by competing with PGC1 binding of HNF4α on the CYP8B1 promoter.

1. We used transfection assay to identify the inhibitory effects of SREBP2 on human

CYP8B1 promoter activity. Human phCYP8B1-514/+300Luc was transiently cotransfected with SREBP2 into HepG2 cells.

2. To determine the SREBP2 response element on human CYP8B1 gene promoter, 3‟- deletion constructs of human CYP8B1 and mutation constructs that abolished the multiple HNF4α and CPF binding site were transient transfected into HepG2 cells.

3. To identify whether SREBP2 inhibits human CYP8B1promoter activity through the competition of PGC-1α that is an important co-activator of HNF4α, mammalian one- hybrid assay was performed in HepG2 cells. To study the effects of SREBP2 on HNF4α trans-activation activity of Gal4-(5×UAS)/TK/Luc reporter, we used transient transfection assay to identify whether SREBP2 can significantly decrease the reporter activity. Further, human CYP8B1 luciferase reporter was co-transfected with HNF4α,

PGC-1α and SREBP2 in HepG2 cells to investigate the effects of SREBP2 on HNF4α,

PGC-1α co-activation effect on human CYP8B1.

Specific Aim 2: Reverb-α inhibits human CYP8B1 gene expression by binding to the

Reverb-α response element located in the human CYP8B1 promoter. Increased levels of

heme further inhibit human CYP8B1 gene expression in primary hepatocytes. Also, heme inhibits human CYP8B1 transcription activity in HepG2 cells.

1. Transient transfection assay was used to study the effects of Reverb-α on human

CYP8B1 promoter activity. Human CYP8B1 3.5k/Luciferase constructs were cotransfected with Reverb-α.

2. To locate the Reverb-α response element on human CYP8B1 promoter, we used the deletion constructs of human CYP8B1 to co-transfect with Reverb-α. Mutations were introduced into the 5‟ A/T- rich region of RevRE using Site-directed Mutagenesis Kit.

The mutation of three bases „AAA‟ to „ggg‟ on the human CYP8B1 RevRE was confirmed by DNA sequencing.

3. To test whether heme regulates human CYP8B1 promoter activity and gene expression through Reverb-α, transient transfection assay and real-time PCR experiment were performed.

Significance: The objective of this project is to study whether human CYP8B1 promoter activity can be regulated by SREBP2 and Reverb-α, which may provide possible mechanisms for transcriptional regulation of CYP8B1 by cholesterol, diurnal rhythm and insulin. Since CYP8B1 plays an important role in cholesterol homeostasis and bile acid synthesis, the results may reveal important clues for the treatment of cholesterol metabolism-related diseases, such as hypercholesterolesterolemia and cholesterol gallstones in human.

CHARPTER II

MATERIALS AND METHODS

1. Cell culture

1.1 Human hepatoma cell line culture

The human hepatoma cell line (HepG2, HB805) was purchased from American Type

Culture Collection (ATCC, Manassas, MA). Cells were thawed in water bath at 37 °C after taken from -150 °C freezer, and cultured in DEME/F12 medium supplemented with

10% heat-inactivated fetal bovine serum and 1% penicillin G (100U/ml)/streptomycin sulfate(whole medium). Cells were grown in the 37°C humidified, 5% CO2 incubator.

Medium was changed every two days. When grown to 90% confluent in the T75 flask, cells were washed one time using PBS buffer, and then treated with 0.5% trypsin EDTA for about two minutes in order to detach the cells from the bottom of the flask. The trypsin was aspirated and then 10ml of fresh medium was added to the flask. The cells were distributed evenly in the suspension. Then, 1.5-2.0 ml of suspended cells was transferred into a new flask which contained 13-15 ml fresh medium. Flasks were put back to the incubator to keep the cells grow, which was split every week.

1.2 Primary human hepatocyte culture

Primary human hepatocytes (Case #HH1457) were obtained from the Liver Tissue

Procurement and Distribution System (LTPADS) of NIH (Dr. Steven Strom, University of Pittsburgh, Pittsburgh, PA). Cells were plated in a 6-well- plates and were maintained 37

in fresh HMM Modified Williams E Medium (Cambrex, Clonetics, East Rutherford, NJ) overnight. All treatments were performed within 24hrs after receiving.

2. Plasmids DNA Preparation

2.1 Large Scale DNA preparation

For large-scale plasmid isolation, we used Nucleobond Plasmid Purification Kits

(Clontech, Palo Alto, CA). The isolation process was performed according to the manufacture’s instruction. A single colony from the transformed LB plate was inoculated into 2 ml LB medium, which included 50ug/ml of ampicillin. Following overnight culturing with shaking at 37°C, 250 rpm, cells were transferred into a 500ml flask with

200ml LB medium and further cultured for 16 hrs. The cells were then pelleted by centrifugation of 2000g for 10 min, and resuspended in 12 ml buffer S1(50 mM Tris-HCl,

10 mM EDTA, 100 mg/ml RNase A). After transferring cells to the 40 ml centrifuge tube, 12 ml S2 (200 mM NaOH, 1% SDS) was added and gently mixed the medium 6-8 times. After lysis of cells, Buffer S3 (2.8MKAc, pH5.1) was added, and the suspension were mixed by inverting the tube 6-8 times. A flocculent precipitate was formed. The suspension was put on ice for 30 minutes and centrifuged at 14,000g, at 4 °C for 20 minutes. At the same time, 5 ml N2 buffer (100 mM Tris, 15% ethanol, 900 mM KCl,

0.15% Triton X-100, pH 6.3) was added to equilibrate the A×500 cartridge. The supernatant of the centrifugation was then passed through a filter paper and then the equilibrated cartridge. After washed twice with 12 ml of buffer N3 (100 mM Tris, 15% ethanol, 1.15 M KCl, pH 6.3), the DNA was collected when eluted by 12ml N5 buffer

(100 mM Tris, 15% ethanol, 1 M KCl, pH 8.5). The purified DNA was precipitated with

10 ml isopropanol and centrifuged at 12,000g at 4 °C for 30 minutes. Then the supernatant was carefully discarded and the DNA pellet was washed with 10 ml 70% ice cold ethanol. The DNA pellet was mixed and centrifuged again at 12000g 5 minutes. The ethanol was removed from the tube carefully with a pipette tip, and the pellet was dried at room temperature for 5 minutes. The pellet was re-dissolved in 300-500 µl 1×TE buffer

(10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The DNA was quantitated by measuring the

O.D. 260 using a NanoDropND-1000 spectrophotometer (NanoDrop Technologies, Inc,

DE, USA).

2.2 Small Scale DNA preparation

For small scale plasmid isolation, we used the QIAprep® Spin Miniprep Kit (QIAGEN,

Inc, CA, USA). On the day before the purification of plasmid DNA, a single bacterial colony was picked up from the transformed LB plate and inoculated into 1-5 ml LB medium, which included 50µg/ml Ampicillin. After shaking overnight at 37 °C, bacterial cells were centrifuged at 3000-4500 rpm for 10 minutes. Then, 250 µl buffer P1 was added for suspending the pellet, and 250 µl buffer P2 was added to lyse cells. Cells were centrifuged at 10000 rpm, 10 minutes. The supernatants were aspirated and transferred to

QIAprep spin column, and centrifuged for 1 minute. The flow-through was discarded, and the QIAprep spin column was washed by adding 750 µl buffer PE. The residual buffer was removed by 1 minute centrifuge. The QIAprep column was put in a 1.5 ml microcentrifuge tube. Then, 50 µl buffer EB (10 mM Tris·HCl, pH 8.5) was added at the center of QIAprep spin column. The column was allowed to stand for 1 minute at room temperature and the centrifuged 10000 rpm for 2 minutes. The DNA was eluted from the

spin column and was quantitated by using a NanoDropND-1000 spectrophotometer

(NanoDrop Technologies, Inc, USA).

3. Preparation of Competent Cells

Competent cells were used for gene cloning and mutation. We used calcium chloride method to prepare competent DH5α bacteria. On day one, an LB-agar plate (without

Ampicillin) with an inoculated loop full of DH5α was prepared, and kept at 37 °C for 12-

16 hours. On the second day, 2 ml LB (No AMP) was inoculated from a single colony and further cultured 37 °C overnight. On day three, 2 ml cells were inoculated into 100 ml LB (No AMP) at 37°C with vigorous shaking. To monitor the growth of the culture, the OD600 was determined at very 20-30 minutes until the value was between 0.4 and 0.5.

Cells were aseptically transferred to several sterile, disposable, ice-cold 50 ml polypropylene tubes. Then, cells were pellet by centrifugation at 2400 g for 10 minutes at

4 °C. The supernatant were poured off and 10 ml of 0.1 M CaCl2 (cold) was added to resuspended pellet. Cells were put on ice and centrifuged again at 4000 rpm for 10 minutes at 4 °C. Each pellet from the original 50 ml culture was re-suspended in 1.4 ml

0.1M CaCl2 (cold) and incubated on ice for 20 minutes. At this point, 0.6 ml 100 % glycerol was combined together with the 1.4 ml cells. Cells were quickly dispensed aliquots of 50 µl into chilled, sterile microfuge tubes. The competent cells were snap freeze by immersing into liquid nitrogen and stored at -80 °C.

4. Bacterial Cell Transformation

For transformation, the DH5α cells stored at -80 °C were thawed and incubated on ice for

30 minutes. Plasmid DNA 1-10 µl (about 10-50 ng) was added to each tube with competent cells and mixture were keep on ice for 30 minutes, after which the tubes were transferred to 42 °C heat block for 90 seconds in water-bath. Tubes were rapidly put on ice and the cells were allowed to chill for 1-2 minutes. Then, 800 µl of LB broth was added to the mixture. The mixture were put in a 37°C incubator with shaking gently (225 rpm cycles/min or less), and cultured for 1 hour. The transformed cells (200 µl) were aspirated and transferred to a LB agar medium plate (containing Ampicillin 50ug/ml).

Transformed cells were gently spread by using a sterile bent glass rod. After incubated at

37 °C for 16 hrs, DH5α cells containing colonies of the plasmid were grew on plate. The plasmid was further confirmed DNA sequencing.

5. Transient Transfection Assay

HepG2 cells were split after 5-day culture. The cells were diluted by fresh medium at

1:4.8 (v:v) ratio. The diluted HepG2 cells were further mixed with the same volume of whole medium and aliquot 1ml in each well of 24-well plate. The plate was then put in the 37 °C, 5% CO2 incubator. After 24 hrs culture, the cell density was grown up to 80% confluent. Fresh whole medium (without Penicillin G) of 0.5ml was added in each well 1 hour before the transfection. All the plasmids transfected into the cells were conducted with lipofectamin2000 (Invitrogen). For each well, 0.5-0.8 µg of DNA was diluted into

100 µl of Opti-MEM I Reduced Serum Medium without serum. Also, 2 µl of

Lipofectamine 2000 was added into the above diluted DNA solution. The DNA-

Lipofectamine LTX complexes were formed after incubation at room temperature for 10-

20 minutes, which was then transferred to the wells of cultured cells. After fully mixed, the plate was returned to the CO2 incubator for 4 hrs. Then, the medium was changed with 1 ml fresh serum free medium containing 1% Penicillin G (100 U/ml)/streptomycin sulfate. The cells were lysed 40 hrs after transfection, and the luciferase and β- galactosidase activity was detected.

5.1 Luciferase assay

For each well, 120 µl of passive lysis buffer (40 mM Tricine pH 7.8, 50 mM NaCl, 2 mM

EDTA, 1 mM MgSO4, 5 mM DTT, 1% Triton X-100) was added. The plate was then shaken at the room temperature for 20 minutes. The cell lysate (20 µl) was used to detect the luciferase activity in a Lumat LB9501 Luminometer. Luciferase activity was analyzed by using Luciferase Assay System (Promega, Madison, WI). Relative luciferase activity was calculated as relative light units of luciferase divided by β-galactosidase activity.

5.2 β-Galactosidase activity assay

To normalize the luciferase activity according to different transfection efficiency and cell number in each well, an expression plasmid containing E.coli β-galactosidase gene was cotransfected with luciferase reporter constructs as internal control. Cell lysate (50 µl) was aspirated from the 24-well plate and transferred into a 96-well microplate. Lysates from wells that were untransfected with DNA plasmid were used as a negative control.

Then 50 µl 2× β-gal solution buffer (1 µl 100x Mg Solution(0.1M MgCl2, 4.5M β- mercaptoethanol); 22 µl 1×ONPG (o-nitrophenyl-β-D-galactopyranoside); 67 µl 0.1 M sodium phosphate (pH 7.5) were added in each well and incubated at 37 °C incubator

until a yellowish color developed. The solution absorbance at 405 nm was read by

Microplate reader Spectra Max 250 (Molecular Devices, Sunnyvale, CA). Luciferase activity was normalized by dividing the relative light units (RLU) by β-galactosidase activity and expressed as relative luciferase activity. Each assay was performed in triplicate, and individual experiments were repeated at least two times. Data are plotted as means ± standard deviation. Statistical analyses of treated vs. untreated controls were performed using Student’s t-test. The difference is considered statistically significant if P

< 0.05.

6. Mammalian One-Hybrid Assays

Mammalian One-hybrid assay is an assay for studying the protein-protein interactions.

The 5×UAS-TK- Luc reporter was used in the assay. It is consisted of 5 copies of the upstream activating sequence (UAS), fused upstream of a thymidine kinase minimum promoter (TK) and a luciferase gene. Gal4 HNF4α is a fusion protein in which HNF4α is fused with yeast Gal4 DBD (DNA Binding Domain), and it is able to bind to the Gal4 binding sites on the reporter UAS and to activate the reporter activity. When a co- regulator (co-activator or co-repressor) were cotransfected with the reporter and Gal4-

HNF4α into the cells, the interaction between the co-regulator and HNF4α can be tested according to the luciferase reporter activity.

7. Site-directed Mutagenesis

QuikChange®Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) was used to introduce the mutations into the certain region of a DNA plasmid. We designed two complementary oligonucleotides containing the mutations on the luciferase reporter

promoter and used them as the PCR primers. Wild type plasmid (CYP8B1ph -514/+300) purified from bacterial DH5α was used as the template. The protocol was followed the company’s instruction. Briefly, 50 ng of template DNA, 125 ng of primers, 5 µl of 10× reaction buffer, 1 µl of dNTP mix and ddH2O were added in the regular PCR reaction tube to make final volume of 50 µl in each tube. DNA polymerase (1 µl in 2.5 U/µl) was added in each tube. The PCR cycling parameters were set as following: at the first cycle, denaturing DNA plasmid at 95°C for 2 minutes; followed by 18 cycles at 95°C for 30 s,

55 °C for 1 minute and 68°C for 18 minute. After that, the PCR mixture was incubated with Dpn I for 2 hrs at 37 °C to digest the template DNA. Since the mutant DNAs were not to be methylated, and were protected from digested by Dpn I. PCR reaction mixture

(2 µl) was transformed into XL1-Blue super competent cells (Stratagene) following the company’s protocol and the mutant colons were selected. Mutations in each clone were confirmed by DNA sequencing.

8. Quantitative Real-time PCR

8.1 RNA isolation

The primary human hepatocytes were culture in a 6-well plate. After the culture medium was aspirated, 1 ml of Tri-ReagentTM (Sigma-Aldrich, St. Louis, MO, USA) was added in each well. Cells were lysed after pipeting. The homogenous lysate in each well was then transferred to a 1.5 ml Eppendorf tube, which was kept at room temperature for 15 minutes to completely dissociate the nucleoprotein complexes. Then 200 µl of chloroform was added in each tube and vortex 20 second, it was further kept at the room temperature for another 15 minutes. The mixture was further centrifuged at 4 °C 10,000 g

for 10 minutes. The upper aqueous phase (400 µl) was carefully removed and transferred to a new tube. The same volume of isopropanol was added in the tube. Tubes were put in

-20 °C freezer for at least 20 minutes and then were centrifuged at 4 °C, 12000rpm for 10 minutes. The supernatant was carefully removed by the pipette and 1 ml ice-cold 75%

ETOH in DEPC water was added. RNA samples were further centrifuged at 10,000g for another 5 minutes and upper phase of ETOH were disposed. The RNA pellet was then air dried at room temperature and dissolved in 40-50 µl DEPC water. The RNA was quantitated by measuring the O.D.260 by a NanoDropND-1000 spectrophotometer (NanoDrop Technologies, Inc, USA).

8.2 Reverse transcription PCR

RETROscript kit was used for reverse transcription RNA to cDNA. First, the total RNA was treated with DNase to eliminate any DNA contamination in the RNA isolated sample. The 10 µg RNA was treated with 1µl of RNase free DNaseI (DNA-freeTM,

Ambion, Austin, TX, USA) in 0.1 volume of 10× DNase reaction buffer, for 30 minutes at 37 °C incubator. DNase was inactivated by incubating in the 2 µl of DNase inactivation reagent for 2 minutes at room temperature. After centrifugation at 10,000g for 1 minute, the RNA was transferred into a new tube, and then the RNA concentration was determined by spectrophotometer. Next, the reverse transcription reaction was performed by following the instruction of Retroscript kit (Ambion Inc., Austin, TX,

USA). The 2 µg RNA and 2 µl random primers were added to the bottom of the tube and nuclear-free water was added to make the final reaction volume at 12 µl. Then PCR reaction tubes were put on a thermo cycler (Gene Amp PCR System 9700, Applied

Biosystems, Foster City, CA, USA). The PCR recycling parameters are listed as following: 78 °C, 5 mintues and 4 °C, 2 minutes. A mixture which contained 4 µl dNTP,

2 µl 10× RT buffer, 1 µl RNase inhibitor and 1 µl of MMLV-reverse transcriptase was then added and the tubes were further incubated at 42 °C for 1.5 hrs. The tubes were heated at 95 °C for 10 minutes and diluted to 10 fold with TE buffer. The cDNA was stored in -20 °C for real-time PCR experiments.

8.3 Real-time PCR

For detecting the mRNA level in primary hepatocytes, real-time PCR reaction was performed according to the PCR 2×Taqman Universal Master Mix protocol (Applied

Biosystems, Foster City, CA). Diluted cDNA 5 µl, 12.5 µl Taqman 2×Universal Master

Mix, 1.25 µl Taqman primers and 6.25 µl water were mixed and added in a 96-well PCR plate. PCR was performed on an ABI 7500 real-time PCR system. The PCR cycle parameters were listed as following: step1(1 cycle): 2 minutes at 50 °C; step2 (1 repeat):

10 minutes at 90 °C; step3 (40 cycles): 15 seconds at 95 °C followed by 1 minute at 60

°C. Ubiquitin C (UBC) was used as an internal reference gene. Taqman MGB probe mix were purchased form Applied Biosystems (Foster City, CA). Each sample was measured in triplicate.

Real-time PCR results were quantified by the comparative CT (ΔΔCt) method, following the instruction of ABI manual. Ct values were acquired after each real-time PCR experiment and the relative mRNA expression was calculated with formulas as below.

Relative mRNA expression=2-ΔΔCt

High range: 2-(ΔΔCt-S.D.ΔCt)

Low range: 2-(ΔΔCt+S.D.ΔCt)

Ct is the cycle number at which the PCR amplified product reaches a fixed threshold.

ΔCt=Ct of gene of interest- Ct of reference gene

ΔΔCt of control= ΔCt of control- ΔCt of control (equals to zero)

ΔΔCt of experiment= ΔCt of experiment- ΔCt control

Standard Deviation of ΔCt= Square Root [(S.D. of reference gene) 2+ (S.D. of gene of interest)2]

We set ΔΔCt of control to zero, and then the relative mRNA expression of control is equal to 1 (20=1). If there is a two fold increase in the mRNA; it is expressed as 21=2. In the histograms, the upper end of error bar indicates high range minus relative expression; while the lower end of error bar represents relative expression minus low range.

CHAPTER III

RESULTS

SREBP2 inhibited human CYP8B1 promoter activity

To test whether SREBP2 is involved in the regulation of human CYP8B1 gene transcription, human phCYP8B1-514/+300/Luc was transiently co-transfected with

SREBP2 into HepG2 cells. We found that the human CYP8B1 reporter activity was significantly decreased by more than 70%, 48 hrs after transfection of SREBP2 in HepG2 cell (Fig. 7). These data indicate an inhibitory effect of SREBP2 on CYP8B1 gene transcription.

Mapping the SREBP2 response element on human CYP8B1 gene promoter

To locate the SREBP2 response element on human CYP8B1 gene promoter, 3‟-deletion constructs of human CYP8B1 were transiently transfected with SREBP2 into HepG2 cells. The CYP8B1 reporter activities of ph+300/Luc, ph+248/Luc and ph+220/Luc were decreased by more than 70% when co-transfected with SREBP2. The inhibitory effect of

SREBP2 on CYP8B1/Luc reporter activity was significantly diminished when the region from +220 to +200 of CYP8B1 was deleted (Fig. 8). This result indicates that the

SREBP2 response element is located within this region that contains the HNF4α and CPF multiple binding sites. Since SREBP2 may interact with HNF4α and LRH (human CPF homology) [119, 120], SREBP2 might inhibit their transactivation activity by interfering

with HNF4α or CPF binding to DNA. To test whether the HNF4α and CPF binding site was involved in the SREBP2 regulation of human CYP8B1, mutations that abolish the overlapping HNF4α and CPF binding site were introduced into the CYP8B1 reporter construct. The HNF4α and CPF multiple binding site mutant reporter (MHNF4α+CPF- ph-514/+300/Luc) had a much lower basal activity, these mutations led to a dramatic decrease of the inhibitory effect of SREBP2 (Fig. 9). Our results indicate that SREBP2 may inhibit CYP8B1 trans-activation activity.

Mechanism involved in the SREBP2 regulation of human CYP8B1 expression

We further investigated the mechanisms underlying the SREBP2 regulation of human

CYP8B1 transcription activity. We also examined whether SREBP2 inhibits CYP8B1 promoter activity via competition with PGC-1α (an important co-activator of HNF4α), similar to the mechanism of SREBP1c inhibition on CYP7A1. Mammalian one-hybrid assay was performed in HepG2 cells to study the effect of SREBP2 on HNF4α transactivation activity of Gal4-(5×UAS)/TK/Luc reporter. The Gal4-HNF4α activation of

Gal4 reporter was significantly increased by PGC-1α, and SREBP2 inhibited the Gal4--

(5×UAS)/TK/Luc reporter activity in a dose-dependent manner (Fig. 10). Thus, SREBP2 may block the physiology interaction between HNF4α and PGC-1α and inhibit their co- activation effect on human CYP8B1. The effect of SREBP2 on HNF4α and PGC-1α co- activation of human CYP8B1 reporter activity was also studied. Using transient transfection assay, we found that SREBP2 significantly decreased promoter activity of human CYP8B1, which was enhanced by HNF4α and/or PGC-1α (Fig. 11). These results

Fig. 7

Fig. 7. Effects of SREBP2 on human CYP8B1 reporter activity. Human CYP8B1 reporter constructs (0.3 µg) were co-transfected with SREBP2 expression plasmids (0.15

µg) or pcDNA3 (0.15 µg) empty vector in HepG2 cells. PGL3 (0.3 µg) co-transfected with pcDNA were used as a control group. The luciferase activity was detected 40 hrs after trasfection. RLU, relative light units. The transfection assays were performed as described in “ Materials and Methods”. Each assay was performed in triplicate, and the statistical analysis was performed using Student‟s t test. *, statistically significant difference between transfection with SREBP2 vs pcDNA control (P < 0.05).

Fig. 8

Fig. 8. Mapping the response element of SREBP2 on the human CYP8B1 gene.

Transient co-transfection of the 3‟-deletion constructs of human CYP8B1/Luc reporter

(0.3 µg) with SREBP2 (0.15ug) in HepG2 cells. Reporter assays were carried out 40hrs after transfection as described in the “material and methods”. The error bars represent the standard deviation from the mean of triplicate assays of each experiment (n = 3)). *, statistically significant difference between transfection with SREBP2 vs pcDNA control according to student t-test (P <0 .05).

Fig. 9

Fig. 9. Effect of HNF4α and CPF binding site mutation on the SREBP2 inhibitory effect on human CYP8B1 luciferase reporter activity. HNF4α and CPF site mutant reporter MHNF4+CPF (0.3 µg) was co-transfected with pcDNA3 or SREBP2 expression plasmid (0.15 µg) into HepG2 cells. The sequences of wild type and mutation of common

HNF4α and CPF binding sites, which were introduced into human CYP8B1 promoter/luciferase construct, are shown at the bottom. Reporter assays were carried out as described in the “material and methods”. The error bars represent the standard deviation from the mean of triplicate assays of each experiment (n = 3). *, statistically significant difference between transfection with SREBP2 vs pcDNA control according to student t-test (P <0 .05).

Fig. 10

Fig. 10. Mammalian one-hybrid assay. The Gal4/luciferase reporter, 5×UAS/TK/Luc

(0.2 µg) was co-transfected with Gal4 empty vector (0.1 µg), or Gal4-HNF4α (0.1 µg),

PGC-1α (0.1 µg), or different amounts of SREBP-2 (0.05-0.2 µg). Each assay was performed in triplicate, and statistical analysis was performed using Student‟s t test. *, statistically significant between experiment groups cotransfected Gal4-HNF4α and PGC-

1α with or without SREBP2, P < 0.05.

indicate that in addition to interfering with HNF4α binding to DNA, SREBP2 might also block HNF4α and PGC-1α co-activation of human CYP8B1 reporter activity.

Reverb-α has inhibitory effects on human CYP8B1 promoter activity

We used transient transfection assay to study the inhibitory effects of Reverb-α on human

CYP8B1 promoter activity. Human CYP8B1 3.5k/Luciferase constructs were cotransfected with Reverb-α. We found that the human CYP8B1 reporter activity was decreased, in a dose-dependent manner, when co-transfected with Reverb-α in HepG2 cells (P < 0.05; Fig. 12).

Identification of the Reverb-α response element on human CYP8B1 gene promoter

To confirm the Reverb-α response element in human CYP8B1 promoter, we used the 5‟ and 3‟-sequential deletions constructs of human CYP8B1 to co-transfect with Reverb-α.

Our data demonstrated that Reverb-α should be located between -57 to +300 (Fig. 13).

Together with 3‟ deletion results, it is strongly suggest that Reverb-α may be located at the region between -57 and +76 of the human CYP8B1 promoter. In this region there is a

Reverb-α response element locate at +17 to +19. Since previous study identified that the

5‟ A/T- rich region of Reverb-α response element is critical for Reverb-α binding activity

[63], mutations were introduced into the 5‟ A/T- rich region by using Site-directed

Mutagenesis Kit. The mutation of three bases of „AAA‟ to „ggg‟ of RevRE was confirmed by DNA sequencing. The inhibitory effects of Reverb-α were eliminated in this mutant (Fig. 14). These results indicate that Reverb-α inhibits human CYP8B1 promoter activity through RevRE.

Effects of heme on human CYP8B1 transcription in HepG2 cell

Heme has been clarified as the ligand of human Reverb-α. To test the inhibitory effects of heme on human CYP8B1 promoter activity, the effects of hemin treatment on

CYP8B1/Luc reporter activity were examined. Hemin treatment was performed 24 hrs after transfection with Reverb-α in HepG2 cells. We found that hemin treatment (30 µM, for 24 hrs) further inhibited human CYP8B1 luciferase reporter activity (Fig. 15). These data indicate that increased levels of intracellular heme may lead to a further enhancement of the inhibitory effects of Reverb-α on CYP8B1 promoter activity.

Effects of heme on human CYP8B1 mRNA expression in human primary hepatocytes

Quantitative real-time PCR experiments were performed to determine the effects of heme on CYP8B1 mRNA expression in human primary hepatocytes. Target genes of Reverb-α, such as Bmal1, has been shown to be regulated by intracellular heme [30, 121]. In the present study, we detected the Bmal mRNA levels after treated with hemin, which serves as a positive control. Succinylacetone, a specific inhibitor of an internal heme rate- limiting enzyme (ALAS), may stimulate human CYP8B1 transcriptional activity by depleting intracellular heme. Indeed, human CYP8B1 gene expression was significantly decreased in human primary liver cell with treatment of 30 μM hemin for 24 hrs (Fig.

16). However, the CYP8B1 mRNA level was significantly increased in the presence of

0.5 μM succinylactone (Fig. 17). These results support the conclusion that human

CYP8B1 mRNA expression in hepatocytes may be regulated by heme.

Fig. 11

Fig. 11. SREBP2 influences the co-activation effect of HNF4α and PGC-1α on human CYP8B1reporter activity. Human CYP8B1 luciferase reporter, ph3.5k/Luc (0.2

µg) was cotransfected with 0.1 µg HNF4α and PGC-1α and/or SREBP2. Each assay was performed in triplicate, and statistical analysis was performed using Student‟s t test. *. statistically significant between the control and experiment group, P < 0.05.

Fig. 12

Fig. 12. Dose-dependent effects of REVERB-α on human CYP8B1 reporter activity.

Human CYP8B1/-3.5k/Luc reporter(0.2 µg) cotransfected with pcDNA3 empty vector or different amount of SREBP2 (0.025-0.1 µg). Each assay was performed in triplicate, and statistical analysis was performed using Student‟s t test. *, statistically significant between the control and experiment group, P < 0.05.

Fig. 13

-514 +1 +300 -514/+300 Luc

-514 +1 +200 -514/+200 Luc

-514 +1 +180 -514/+180 Luc

-514 +1 +137 -514/+137 Luc PCDNA Reverb -514 +1 +76 -514/+76 Luc

-57 +1 +300 -57/+300 Luc

-111 +1 +300 -111/+300 Luc

-164 +1 +300 -164/+300 Luc

PGL3

Fig. 13. Mapping the response element of REVERB-α on the human CYP8B1 gene. .

Transient transfection assays were performed 40 hrs after co-transfection of the deletion constructs of human CYP8B1/Luc reporter (0.25 µg) and REVERB-α (0.15 µg) in

HepG2 cells. Reporter assays were carried out as described in the “material and methods”. The error bars represent the standard deviation from the mean of triplicate assays of each experiment (n = 3). *, statistically significant difference between transfection with REVERB-α vs pcDNA control according to student t-test (P < 0.05).

Fig. 14

Fig. 14. Effect of REVERB-α binding site mutation on the human CYP8B1

Luciferase reporter activity. Transient transfection assay of the human CYP8B1 mutant/Luc reporter (0.25 µg) was performed (containing the mutated REVERB-α 5‟ A/T rich site of the CYP8B1 promoter) in HepG2 cells, together with cotransfection of

REVERB-α. Sequence of wild type and mutation introduced into human CYP8B1 promoter/luciferase construct are shown at the bottom. Reporter assays were carried out as described in the “material and methods”. The error bars represent the standard deviation from the mean of triplicate assays of each experiment.

Fig. 15

Fig. 15. Effects of Hemin on human CYP8B1 reporter activity in HepG2 cells.

Transiently trasfected human CYP8B1 (-514/+300)/Luc reporter (0.2 µg) with REVERB-

α (0.1 µg) was treated with different concentrations of hemin (3 µM or 30 µM) for 24 hrs.

Reporter assay were carried out 40 hrs after transfection as described in the “material and methods”. The error bars represent the standard deviation from the mean of triplicate assays of each experiment (n =3). *, statistically significant difference between control group and experimental group treated with 30 μM of hemin. #, significant difference between groups cotransfected with empty pcDNA and REVERB-α.

Fig. 16

Fig. 16 a. Time course of Hemin effects on human CYP8B1mRNA level. Real-time

PCR was used to detect the effect of hemin (30 μM) on CYP8B1 gene expression (in 4, 8 and 24 hrs) in primary human hepatocytes (#1457). The CYP8B1 mRNA expression was assayed in triplicate and expressed as the mean ± S.D. *, statistically significant difference between groups treated with vehicle and 30 μM of hemin (P < 0.05, with student t-test). b. Time course of Hemin effects on human BAML mRNA level. Real- time PCR was used to detect the effects of hemin (30 μM) on BAML gene expression (in

4, 8 and m24 hrs) in primary human hepatocytes (#1457). The BAML mRNA expression was assayed in triplicate and expressed as the mean ± S.D. *, statistically significant difference between groups treated with vehicle and 30μM of hemin (P < 0.05, with student t-test).

Fig. 17

Fig. 17 a. Human CYP8B1 mRNA level after depleting heme with succinylacetone.

Real-time PCR was used to detect the effect of specific hemin synthesis inhibitor succinylactone (0.05, 0.5μM, 24 hrs) on CYP8B1 gene expression in human primary hepatocytes (#1457). The mRNA expression was assayed in triplicate and expressed as the mean ± S.D. *, statistically significant difference between groups treated with vehicle and succinylactone (P < 0.05, with student t-test). b. Human BAML mRNA level after depleting heme with succinylacetone. Real-time PCR was used to detect effect of specific hemin synthesis inhibitor succinylactone (0.05, 0.5μM, 24 hrs) on BAML gene expression in human primary hepatocytes (#1457). The BAML mRNA expression was assayed in triplicate and expressed as the mean ± S.D. *, statistically significant difference between groups treated with vehicle and succinylactone (P < 0.05, with student t-test).

CHAPTER IV

DISCUSSION

The purpose of the present study is to identify whether nuclear receptors, SREBP2 and

Reverb-α, have inhibitory effects on human CYP8B1 gene transcription and expression.

Our results have revealed novel mechanisms involved in the regulation of CYP8B1 by cholesterol and diurnal rhythm.

We used the HepG2 cell line and human primary hepatocytes as models to study the transcriptional effects of SREBP2 on human CYP8B1 promoter activity. SREBP2 is the sensor for cholesterol level in cells [122]. It has been shown that SREBP2 can regulate genes involved in cholesterol synthesis and uptake [86, 123]. Previous studies have also identified that cholesterol feeding can inhibit the rat CYP8B1 luciferase reporter activity

[103]. In the present study, with transient transfection assays, we revealed that SREBP2 could significantly inhibit human CYP8B1 promoter activity. Our results also indicate that SREBP2 may play as a co-repressor that inhibits CYP8B1 activity via an indirectly mechanism, as human CYP8B1 transcriptional activity was inhibited by SREBP2 through mechanisms of influencing the HNF4α and CPF DNA binding, and disrupting

HNF4α and PGC-1α co-activation activity. Although a SRE has been identified within the region of +200 to +206 of human CYP8B1 promoter [9], the inhibitory effects of

SREBP2 on human CYP8B1 cannot be abolished when the SRE site was mutated (data not shown). Our results are consistent with previous studies that SREBP2 may inhibit rat

CYP8B1 activity by competing with the FTF binding [7]. However, a recent study found that, in HEK293 cells, the human CYP8B1 promoter activity showed no change when cotransfected with SREBP2 reporter [9]. This discrepancy may be due to the difference between cell lines, i.e., HepG2 cell vs. HEK293 cells. It is possible that HEK293 cells may lack some factors that mediate the inhibitory effects of SREBP2 on CYP8B1 transcriptional activity. For example, HNF4 alpha is not expressed in HEK293 cells [124,

125]. Given that CYP8B1 is the enzyme expressed exclusively in the liver, HepG2 cell line might be more reliable than HEK293 cell line as the model to investigate the

SREBP2 effects on human CYP8B1promoter activity.

In contrast to the inhibitory effects of SREBP2, SREBP1a and SREBP1c have been reported to possess stimulatory effects on CYP8B1 transcriptional activity, presumably by direct binding at the SRE sequence [9]. In rodents with the high cholesterol diet, the expression of SREPB1 was decreased, correlating with the inhibited CYP8B1 transcriptional activity. On the other hand, lower levels of intracellular cholesterol may cause an increase in the translocation rate of SREBP2 from cytosol to the nucleus, which up-regulates genes related to cholesterol genesis. Our results suggest that SREBP2 may also suppress the conversion of cholesterol into bile acids by inhibiting human CYP8B1 activity. An increased SREBP2/SREBP1 ratio may inhibit CYP8B1 activity, and hence lead to a decrease in the proportion of CA in the bile acids. As a consequence, the hydrophobicity of the bile acids will be increased. Furthermore, the increased

hydrophobicity of bile acids may strongly suppress CYP7A1 expression through a FXR-

SHP pathway, which further decreases the conversion of cholesterol into bile acids. This pathway may be important for controlling cholesterol levels in physiological range.

Therefore, SREBP2 is not only a sensor of sterol, but also acts as a common factor in multiple networks for maintaining cholesterol homeostasis.

In addition, we demonstrated that Reverb-α, one of the clock genes, exhibits a binding site within the human CYP8B1 promoter sequence. Moreover, increased heme levels led to an inhibition of the transcriptional activity of CYP8B1. Recently, heme has been identified as the ligand of Reverb-α, by reversibly and specifically binding on the LBD of

Reverb-α [30]. The molecular mechanisms underlying the inhibitory effects of Reverb-α on the expression of its target genes has been referred to recruitment of co-repressor

NCOR3 through heme binding at Reverb-α [104]. Using transient transcriptional assays, our results revealed that Reverb-α might bind at human CYP8B1 promoter RevRE as a monomer. As detected by real-time PCR method, the human CYP8B1 mRNA levels were decreased by more than two folds in primary hepatocytes after treatment with hemin for

24 hrs. These data indicate that human CYP8B1 expression may be regulated by the heme through its sensor Reverb-α. We also examined the expression levels of SHP and

HNF4α after treatment with hemin for 24 hrs. However, no significant change of the expression was observed in both factors (data not shown). Therefore, neither the enhancement of SHP expression nor the suppression of the activator HNF4α might be involved in the inhibitory effects of hemin on CYP8B1 activity. The Reverb-α inhibition on CY8B1 is consistent with other studies that Reverb-α inhibits clock gene Bmal1 [104].

However, it remains to be elucidated whether hemin increases the recruitment of NCOR to the human CYP8B1 promoter by binding at the Reverb-α ligand binding domain.

Previous studies have indicated that, in rodent and human, the expression of both

CYP7A1 and CYP8B1 exhibit prominent diurnal rhythm [6, 72, 117]. Reverb-α is one of the clock genes that are involved in the control of the circadian rhythm of bile acid synthesis. Two models have been proposed for Reverb-α in the regulation of bile acid synthesis: 1) Reverb-α may induce mouse CYP7A1 expression by inhibiting the expression of SHP and E4BP4, while the hepatic expression of CYP8B1 has no change compared with the control [73]; 2) Reverb-α may directly binding at RevRE located in the mouse CYP7A1 promoter, and thus stimulates the CYP7A1 transcriptional activity

[72]. In the human, the bile acids display a diurnal variation, with a different pattern from that of the rodent. The bile acid synthesis in human exhibits two peaks during the daytime

(around 3:00 pm and 9:00 pm), which is opposite to the circadian rhythm of cholesterol synthesis. In rodent, the production of bile acid is the highest at midnight, in parallel with the cholesterol synthesis. The molecular mechanisms of the difference in diurnal variation of bile acid synthesis between these species are still unclear. Nevertheless, the promoter sequences may partially explain this difference. For example, the homology of promoter sequence in CYP8B1 is only 21% between human and mouse. Moreover, at the

5’ promoter sequence of mice CYP8b1, no Reverb-α response element has been found.

Thus, it is necessary to further investigate the mechanism of diurnal rhythm regulation of bile acid in human model system, and to verify the results from animal studies. Our results suggest that Reverb-α may directly bind at the Reverb-α binding site located on

the human CYP8B1 promoter sequence [10]. Heme, as the ligand of Reverb-α, may further inhibit the expression of human CYP8B1 promoter activity. It is indicated that the expression of human CYP8B1 might also be regulated by the endogenous heme levels. It has been revealed that ALAS1, the heme speed-limiting synthesis enzyme, is a sensor of intracellular nutrition and energy levels, and can be regulated by the fasting through a PGC-1α mechanism [76]. Our studies indicate that human CYP8B1 transcriptional activity may be regulated by the diurnal rhythm, and probably by the nutrition and energy levels in hepatocytes. Thus, the homeostasis of bile acids may be regulated through multiple pathways which can cross talk each other by small biological molecules.

In summary, SREBP2 acts as a co-repressor of HNF4α/CPF independent of DNA binding; it can also interfere with HNF4α/CPF and PGC-1α co-activation of CYP8B1 gene transcription. The response element of SREBP2 is located at +220 to +200 of

CYP8B1, which are the multiple binding sites for HNF4α and CPF. Clock gene Reverb-α suppresses human CYB8B1 promoter activity through the RevRE site, which is most likely located at -56 to +76 of CYP8B1. Human CYB8B1 transcriptional activity can be inhibited or enhanced by increased or decreased heme levels, respectively. Our results indicate that heme may be an important small molecule for the regulation of human

CYP8B1 expression, and importantly, heme may serve as a cross factor in the regulation of CYP8B1 by nutrition and circadian rhythms.

APPENDIX

ABBREVIATIONS

ACAT: acyl-CoA-cholesterol acyltransferase

AF: Activation function domain

AP-1 Activation protein-1

Apo (A1, B, B100, CII, CIII): Apolipoprotein (A1, B, B100, CII, CIII)

AR: Androgen receptor

BARE (I/II): Bile acid response element (I/II) bHLH: basic helix-loop-helix

3β-hsd: 3β-hydroxy-C27-steroid dehydrogenase/isomerase

CA: Cholic acid

CAR: Constitutive androstane receptor

CDCA: Chenodeoxycholic acid

CM: Chylomicro

COPII: coat protein complex II

COUP-TF (I/II): Chicken ovalbumin upstream promoter transcription factors (I/II)

CREB: cAMP response element binding protein

CBP: CREB binding protein

CYP7A1: Cholesterol 7α-hydroxylase

CYP7B1: Oxysterol 7α-hydroxylase

CYP8B1; Sterol 12α-hydroxylase

CYP27A1: Sterol 27-hydroxylase

DBD: DNA binding domain

DBP: Albumin D-site binding protein

DCA: Deoxycholic acid dnHNF4α: Dominant negative HNF4α

DR: Direct repeat

ER: Everted repeat

ER: Estrogen receptor

FGF19: Fibroblast growth factor 19

FGFR4: Fibroblast growth factor receptor 4

FTF: α-fetoprotein transcription factor

FXR: Farnesoid X receptor

GR: Glucocorticoid receptor

HAT: Histone acetyltransferase

H3K9: Histone H3 lysine 9

HDAC: Histone deacetylases

HDL: High density lipoprotein

Hek293: Human embryonic kidney cell line

HepG2: Human hepatoma cell line

HMG-CoA reductase: Hydroxy-3-methyl glutyryl-CoA reductase

HNF4α: Hepatocyte nuclear factor-4α

HREs: Hormone response elements

IDL: Intermediate density lipoprotein

IL-2: Interleukin-2

Insig (1, 2a, 2b): Insulin-induced gene (1, 2a, 2b)

IR: Inverted repeat

LBD: Ligand binding domain

LCA: Lithocholic acid

LDL: Low density lipoprotein

LPS: Lipopolysaccharide

LRH: Mouse liver-related homolog

LRP: LDL receptor related protein

LXR: Liver X receptor

MAPK: Mitogen activated protein kinase

MR: Mineralocorticoid receptor

NRs: Nuclear receptors

NRID: Nuclear-receptor-interaction domain

NTCP: Sodium taurocholate cotransporting polypeptide

PAS: PER/ARNT/SIM homology domain

PCR: Polymerase chain reaction

PGC-1α: PPARγ co-activator 1α

PPARα: Peroxisome proliferator response element

PR: Progesterone receptor

PXR: Pregnane X receptor

RAR: Retinoic acid receptor

RAT: Retinoic acid receptor

RevRE: Reverb-α response element

RXR: Retinoid X receptor

S1P: Site-1 protein

S2P: Site-2 protein

SCAP: SREBP cleavage activation protein

SCN: Suprachiasmatic nucleus

SP1: Specificity protein-1

SRC-1: Sterol receptor co-activator

SHP: Small heterodimer partner

SREs: Sterol response elements

SREBPs: Sterol response element binding proteins

SREBP (1a/1c/2): Sterol response element binding protein 1a/1c/2

Swi/Snf-Brm: Mating-type switch/sucrose nonfermenting-Brahma

TK: Thymidine kinase

UAS: Upstream activating sequence

UBC: Ubiquitin C

VDR: Vitamin D receptor

VLDL: Very low density lipoprotein

REFERENCES

1. Pandak, W.M., et al., Expression of sterol 12alpha-hydroxylase alters bile acid pool composition in primary rat hepatocytes and in vivo. Gastroenterology, 2001. 120(7): p. 1801-9. 2. Li-Hawkins, J., et al., Cholic acid mediates negative feedback regulation of bile acid synthesis in mice. J Clin Invest, 2002. 110(8): p. 1191-200. 3. Murphy, C., et al., Cholic acid as key regulator of cholesterol synthesis, intestinal absorption and hepatic storage in mice. Biochim Biophys Acta, 2005. 1735(3): p. 167-75. 4. Ishida, H., et al., Insulin is a dominant suppressor of sterol 12 alpha-hydroxylase P450 (CYP8B) expression in rat liver: possible role of insulin in circadian rhythm of CYP8B. J Biochem, 2000. 127(1): p. 57-64. 5. Vlahcevic, Z.R., et al., Regulation of sterol 12alpha-hydroxylase and cholic acid biosynthesis in the rat. Gastroenterology, 2000. 118(3): p. 599-607. 6. Yamada, M., et al., Circadian rhythms of sterol 12alpha-hydroxylase, cholesterol 7alpha-hydroxylase and DBP involved in rat cholesterol catabolism. Biol Chem, 2000. 381(12): p. 1149-53. 7. del Castillo-Olivares, A. and G. Gil, Differential effects of sterol regulatory binding proteins 1 and 2 on sterol 12 alpha-hydroxylase. SREBP-2 suppresses the sterol 12 alpha-hydroxylase promoter. J Biol Chem, 2002. 277(8): p. 6750-7. 8. Noshiro, M., et al., Rhythmic expression of DEC1 and DEC2 in peripheral tissues: DEC2 is a potent suppressor for hepatic cytochrome P450s opposing DBP. Genes Cells, 2004. 9(4): p. 317-29. 9. Yang, Y., et al., Mechanisms of cholesterol and sterol regulatory element binding protein regulation of the sterol 12alpha-hydroxylase gene (CYP8B1). Biochem Biophys Res Commun, 2004. 320(4): p. 1204-10. 10. Zhang, M. and J.Y. Chiang, Transcriptional regulation of the human sterol 12alpha-hydroxylase gene (CYP8B1): roles of heaptocyte nuclear factor 4alpha in mediating bile acid repression. J Biol Chem, 2001. 276(45): p. 41690-9. 11. Chiang, J.Y., Regulation of bile acid synthesis. Front Biosci, 1998. 3: p. d176-93. 12. Chiang, J.Y., Bile acid regulation of gene expression: roles of nuclear hormone receptors. Endocr Rev, 2002. 23(4): p. 443-63. 13. Chiang, J.Y., Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. J Hepatol, 2004. 40(3): p. 539-51. 14. Norlin, M. and K. Wikvall, Enzymes in the conversion of cholesterol into bile acids. Curr Mol Med, 2007. 7(2): p. 199-218. 84

15. del Castillo-Olivares, A. and G. Gil, Suppression of sterol 12alpha-hydroxylase transcription by the short heterodimer partner: insights into the repression mechanism. Nucleic Acids Res, 2001. 29(19): p. 4035-42. 16. Duane, W.C. and N.B. Javitt, 27-hydroxycholesterol: production rates in normal human subjects. J Lipid Res, 1999. 40(7): p. 1194-9. 17. Pikuleva, I.A., et al., Activities of recombinant human cytochrome P450c27 (CYP27) which produce intermediates of alternative bile acid biosynthetic pathways. J Biol Chem, 1998. 273(29): p. 18153-60. 18. Brown, M.S. and J.L. Goldstein, A receptor-mediated pathway for cholesterol homeostasis. Science, 1986. 232(4746): p. 34-47. 19. Ishibashi, S., et al., The two-receptor model of lipoprotein clearance: tests of the hypothesis in "knockout" mice lacking the low density lipoprotein receptor, apolipoprotein E, or both proteins. Proc Natl Acad Sci U S A, 1994. 91(10): p. 4431-5. 20. Miura, K., et al., Relationship of dietary linoleic acid to blood pressure. The International Study of Macro-Micronutrients and Blood Pressure Study [corrected]. Hypertension, 2008. 52(2): p. 408-14. 21. Mourao, P.A. and C.A. Bracamonte, The binding of human aortic glycosaminoglycans and proteoglycans to plasma low density lipoproteins. Atherosclerosis, 1984. 50(2): p. 133-46. 22. Russell, D.W. and K.D. Setchell, Bile acid biosynthesis. Biochemistry, 1992. 31(20): p. 4737-49. 23. Pullinger, C.R., et al., Human cholesterol 7alpha-hydroxylase (CYP7A1) deficiency has a hypercholesterolemic phenotype. J Clin Invest, 2002. 110(1): p. 109-17. 24. Hofmann, A.F., The enterohepatic circulation of bile acids in mammals: form and functions. Front Biosci, 2009. 14: p. 2584-98. 25. Trauner, M. and J.L. Boyer, Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev, 2003. 83(2): p. 633-71. 26. McEwan, I.J., Nuclear receptors: one big family. Methods Mol Biol, 2009. 505: p. 3-18. 27. Renaud, J.P. and D. Moras, Structural studies on nuclear receptors. Cell Mol Life Sci, 2000. 57(12): p. 1748-69. 28. Forman, B.M. and R.M. Evans, Nuclear hormone receptors activate direct, inverted, and everted repeats. Ann N Y Acad Sci, 1995. 761: p. 29-37. 29. Kumar, R. and E.B. Thompson, The structure of the nuclear hormone receptors. Steroids, 1999. 64(5): p. 310-9. 30. Raghuram, S., et al., Identification of heme as the ligand for the orphan nuclear receptors REV-ERBalpha and REV-ERBbeta. Nat Struct Mol Biol, 2007. 14(12): p. 1207-13. 31. Aranda, A. and A. Pascual, Nuclear hormone receptors and gene expression. Physiol Rev, 2001. 81(3): p. 1269-304. 32. Drewes, T., et al., Human hepatocyte nuclear factor 4 isoforms are encoded by distinct and differentially expressed genes. Mol Cell Biol, 1996. 16(3): p. 925-31.

33. Jung, D. and G.A. Kullak-Ublick, Hepatocyte nuclear factor 1 alpha: a key mediator of the effect of bile acids on gene expression. Hepatology, 2003. 37(3): p. 622-31. 34. Li, T., A. Jahan, and J.Y. Chiang, Bile acids and cytokines inhibit the human cholesterol 7 alpha-hydroxylase gene via the JNK/c-jun pathway in human liver cells. Hepatology, 2006. 43(6): p. 1202-10. 35. Qadri, I., et al., Interaction of hepatocyte nuclear factors in transcriptional regulation of tissue specific hormonal expression of human multidrug resistance- associated protein 2 (abcc2). Toxicol Appl Pharmacol, 2009. 234(3): p. 281-92. 36. van der Leij, F.R., et al., Gene expression profiling in livers of mice after acute inhibition of beta-oxidation. Genomics, 2007. 90(6): p. 680-9. 37. Chen, W. and J.Y. Chiang, Regulation of human sterol 27-hydroxylase gene (CYP27A1) by bile acids and hepatocyte nuclear factor 4alpha (HNF4alpha). Gene, 2003. 313: p. 71-82. 38. Stroup, D. and J.Y. Chiang, HNF4 and COUP-TFII interact to modulate transcription of the cholesterol 7alpha-hydroxylase gene (CYP7A1). J Lipid Res, 2000. 41(1): p. 1-11. 39. Yang, Y., et al., On the mechanism of bile acid inhibition of rat sterol 12alpha- hydroxylase gene (CYP8B1) transcription: roles of alpha-fetoprotein transcription factor and hepatocyte nuclear factor 4alpha. Biochim Biophys Acta, 2002. 1583(1): p. 63-73. 40. Hatzis, P. and I. Talianidis, Dynamics of enhancer-promoter communication during differentiation-induced gene activation. Mol Cell, 2002. 10(6): p. 1467-77. 41. Forman, B.M., et al., Identification of a nuclear receptor that is activated by farnesol metabolites. Cell, 1995. 81(5): p. 687-93. 42. Seol, W., H.S. Choi, and D.D. Moore, Isolation of proteins that interact specifically with the retinoid X receptor: two novel orphan receptors. Mol Endocrinol, 1995. 9(1): p. 72-85. 43. Rizzo, G., et al., Role of FXR in regulating bile acid homeostasis and relevance for human diseases. Curr Drug Targets Immune Endocr Metabol Disord, 2005. 5(3): p. 289-303. 44. Tu, H., A.Y. Okamoto, and B. Shan, FXR, a bile acid receptor and biological sensor. Trends Cardiovasc Med, 2000. 10(1): p. 30-5. 45. del Castillo-Olivares, A. and G. Gil, Role of FXR and FTF in bile acid-mediated suppression of cholesterol 7alpha-hydroxylase transcription. Nucleic Acids Res, 2000. 28(18): p. 3587-93. 46. Wang, J., et al., Studies on LXR- and FXR-mediated effects on cholesterol homeostasis in normal and cholic acid-depleted mice. J Lipid Res, 2006. 47(2): p. 421-30. 47. Chiang, J.Y., Bile acids: regulation of synthesis. J Lipid Res, 2009. 48. Sanyal, S., et al., Involvement of corepressor complex subunit GPS2 in transcriptional pathways governing human bile acid biosynthesis. Proc Natl Acad Sci U S A, 2007. 104(40): p. 15665-70.

49. Denson, L.A., et al., The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroenterology, 2001. 121(1): p. 140-7. 50. Gerloff, T., et al., Functional analysis of the rat bile salt export pump gene promoter. Eur J Biochem, 2002. 269(14): p. 3495-503. 51. Moschetta, A., A.L. Bookout, and D.J. Mangelsdorf, Prevention of cholesterol gallstone disease by FXR agonists in a mouse model. Nat Med, 2004. 10(12): p. 1352-8. 52. Watanabe, M., et al., Bile acids lower triglyceride levels via a pathway involving FXR, SHP, and SREBP-1c. J Clin Invest, 2004. 113(10): p. 1408-18. 53. Duran-Sandoval, D., et al., The farnesoid X receptor modulates hepatic carbohydrate metabolism during the fasting-refeeding transition. J Biol Chem, 2005. 280(33): p. 29971-9. 54. Galarneau, L., et al., The alpha1-fetoprotein locus is activated by a nuclear receptor of the Drosophila FTZ-F1 family. Mol Cell Biol, 1996. 16(7): p. 3853- 65. 55. Nitta, M., et al., CPF: an orphan nuclear receptor that regulates liver-specific expression of the human cholesterol 7alpha-hydroxylase gene. Proc Natl Acad Sci U S A, 1999. 96(12): p. 6660-5. 56. del Castillo-Olivares, A., et al., The role of alpha1-fetoprotein transcription factor/LRH-1 in bile acid biosynthesis: a known nuclear receptor activator that can act as a suppressor of bile acid biosynthesis. J Biol Chem, 2004. 279(16): p. 16813-21. 57. Lee, Y.K., et al., Activation of the promoter of the orphan receptor SHP by orphan receptors that bind DNA as monomers. J Biol Chem, 1999. 274(30): p. 20869-73. 58. Pare, J.F., et al., The mouse fetoprotein transcription factor (FTF) gene promoter is regulated by three GATA elements with tandem E box and Nkx motifs, and FTF in turn activates the Hnf3beta, Hnf4alpha, and Hnf1alpha gene promoters. J Biol Chem, 2001. 276(16): p. 13136-44. 59. Lee, Y.K., et al., Liver receptor homolog-1 regulates bile acid homeostasis but is not essential for feedback regulation of bile acid synthesis. Mol Endocrinol, 2008. 22(6): p. 1345-56. 60. Guillaumond, F., et al., Differential control of Bmal1 circadian transcription by REV-ERB and ROR nuclear receptors. J Biol Rhythms, 2005. 20(5): p. 391-403. 61. Torra, I.P., et al., Circadian and glucocorticoid regulation of Rev-erbalpha expression in liver. Endocrinology, 2000. 141(10): p. 3799-806. 62. Zvonic, S., et al., Characterization of peripheral circadian clocks in adipose tissues. Diabetes, 2006. 55(4): p. 962-70. 63. Harding, H.P. and M.A. Lazar, The orphan receptor Rev-ErbA alpha activates transcription via a novel response element. Mol Cell Biol, 1993. 13(5): p. 3113- 21.

64. Harding, H.P. and M.A. Lazar, The monomer-binding orphan receptor Rev-Erb represses transcription as a dimer on a novel direct repeat. Mol Cell Biol, 1995. 15(9): p. 4791-802. 65. Balsalobre, A., F. Damiola, and U. Schibler, A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell, 1998. 93(6): p. 929-37. 66. Li, N., et al., Suprachiasmatic nucleus slices induce molecular oscillations in fibroblasts. Biochem Biophys Res Commun, 2008. 377(4): p. 1179-84. 67. Panda, S., et al., Coordinated transcription of key pathways in the mouse by the circadian clock. Cell, 2002. 109(3): p. 307-20. 68. Yang, X., et al., Nuclear receptor expression links the circadian clock to metabolism. Cell, 2006. 126(4): p. 801-10. 69. Duez, H. and B. Staels, Rev-erb alpha gives a time cue to metabolism. FEBS Lett, 2008. 582(1): p. 19-25. 70. Kassam, A., J.P. Capone, and R.A. Rachubinski, Orphan nuclear hormone receptor RevErbalpha modulates expression from the promoter of the hydratase- dehydrogenase gene by inhibiting peroxisome proliferator-activated receptor alpha-dependent transactivation. J Biol Chem, 1999. 274(32): p. 22895-900. 71. Teboul, M., et al., The nuclear hormone receptor family round the clock. Mol Endocrinol, 2008. 22(12): p. 2573-82. 72. Noshiro, M., et al., Multiple mechanisms regulate circadian expression of the gene for cholesterol 7alpha-hydroxylase (Cyp7a), a key enzyme in hepatic bile acid biosynthesis. J Biol Rhythms, 2007. 22(4): p. 299-311. 73. Duez, H., et al., Regulation of bile acid synthesis by the nuclear receptor Rev- erbalpha. Gastroenterology, 2008. 135(2): p. 689-98. 74. Ajioka, R.S., J.D. Phillips, and J.P. Kushner, Biosynthesis of heme in mammals. Biochim Biophys Acta, 2006. 1763(7): p. 723-36. 75. Burris, T.P., Nuclear hormone receptors for heme: REV-ERBalpha and REV- ERBbeta are ligand-regulated components of the mammalian clock. Mol Endocrinol, 2008. 22(7): p. 1509-20. 76. Handschin, C., et al., Nutritional regulation of hepatic heme biosynthesis and porphyria through PGC-1alpha. Cell, 2005. 122(4): p. 505-15. 77. Bavner, A., et al., Transcriptional corepression by SHP: molecular mechanisms and physiological consequences. Trends Endocrinol Metab, 2005. 16(10): p. 478- 88. 78. Chanda, D., J.H. Park, and H.S. Choi, Molecular basis of endocrine regulation by orphan nuclear receptor Small Heterodimer Partner. Endocr J, 2008. 55(2): p. 253-68. 79. Fang, S., et al., Coordinated recruitment of histone methyltransferase G9a and other chromatin-modifying enzymes in SHP-mediated regulation of hepatic bile acid metabolism. Mol Cell Biol, 2007. 27(4): p. 1407-24. 80. Goodwin, B., et al., A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell, 2000. 6(3): p. 517-26. 81. Bengoechea-Alonso, M.T. and J. Ericsson, SREBP in signal transduction: cholesterol metabolism and beyond. Curr Opin Cell Biol, 2007. 19(2): p. 215-22.

82. Raghow, R., et al., SREBPs: the crossroads of physiological and pathological lipid homeostasis. Trends Endocrinol Metab, 2008. 19(2): p. 65-73. 83. Brown, M.S. and J.L. Goldstein, The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell, 1997. 89(3): p. 331-40. 84. Xie, X., et al., Down-regulation of hepatic HNF4alpha gene expression during hyperinsulinemia via SREBPs. Mol Endocrinol, 2009. 23(4): p. 434-43. 85. Li, T., et al., Forkhead box transcription factor O1 inhibits cholesterol 7alpha- hydroxylase in human hepatocytes and in high fat diet-fed mice. Biochim Biophys Acta, 2009. 86. Goldstein, J.L., R.A. DeBose-Boyd, and M.S. Brown, Protein sensors for membrane sterols. Cell, 2006. 124(1): p. 35-46. 87. Li, T., et al., Insulin regulation of cholesterol 7alpha-hydroxylase expression in human hepatocytes: roles of forkhead box O1 and sterol regulatory element- binding protein 1c. J Biol Chem, 2006. 281(39): p. 28745-54. 88. Xu, Z., et al., Activation of bile acid biosynthesis by the p38 mitogen-activated protein kinase (MAPK): hepatocyte nuclear factor-4alpha phosphorylation by the p38 MAPK is required for cholesterol 7alpha-hydroxylase expression. J Biol Chem, 2007. 282(34): p. 24607-14. 89. Norlin, M. and J.Y. Chiang, Transcriptional regulation of human oxysterol 7alpha-hydroxylase by sterol response element binding protein. Biochem Biophys Res Commun, 2004. 316(1): p. 158-64. 90. Heemers, H.V., G. Verhoeven, and J.V. Swinnen, Androgen activation of the sterol regulatory element-binding protein pathway: Current insights. Mol Endocrinol, 2006. 20(10): p. 2265-77. 91. Puigserver, P., et al., Activation of PPARgamma coactivator-1 through transcription factor docking. Science, 1999. 286(5443): p. 1368-71. 92. Christian, M., R. White, and M.G. Parker, Metabolic regulation by the nuclear receptor corepressor RIP140. Trends Endocrinol Metab, 2006. 17(6): p. 243-50. 93. Feige, J.N. and J. Auwerx, Transcriptional coregulators in the control of energy homeostasis. Trends Cell Biol, 2007. 17(6): p. 292-301. 94. Lin, J., C. Handschin, and B.M. Spiegelman, Metabolic control through the PGC- 1 family of transcription coactivators. Cell Metab, 2005. 1(6): p. 361-70. 95. Puigserver, P. and B.M. Spiegelman, Peroxisome proliferator-activated receptor- gamma coactivator 1 alpha (PGC-1 alpha): transcriptional coactivator and metabolic regulator. Endocr Rev, 2003. 24(1): p. 78-90. 96. Bhalla, S., et al., Ligand-activated pregnane X receptor interferes with HNF-4 signaling by targeting a common coactivator PGC-1alpha. Functional implications in hepatic cholesterol and glucose metabolism. J Biol Chem, 2004. 279(43): p. 45139-47. 97. Okada, K., et al., Preparation and magnetic properties of Mn(hfac)(2)-complexes of 2-(5-pyrimidinyl)- and 2-(3-pyridyl)-substituted nitronyl nitroxides. Inorg Chem, 2003. 42(10): p. 3221-8.

98. Schibler, U., The daily rhythms of genes, cells and organs. Biological clocks and circadian timing in cells. EMBO Rep, 2005. 6 Spec No: p. S9-13. 99. Bunger, M.K., et al., Progressive arthropathy in mice with a targeted disruption of the Mop3/Bmal-1 locus. Genesis, 2005. 41(3): p. 122-32. 100. Zhang, J., et al., The N-CoR-HDAC3 nuclear receptor corepressor complex inhibits the JNK pathway through the integral subunit GPS2. Mol Cell, 2002. 9(3): p. 611-23. 101. Guenther, M.G., O. Barak, and M.A. Lazar, The SMRT and N-CoR corepressors are activating cofactors for histone deacetylase 3. Mol Cell Biol, 2001. 21(18): p. 6091-101. 102. Fischle, W., et al., Enzymatic activity associated with class II HDACs is dependent on a multiprotein complex containing HDAC3 and SMRT/N-CoR. Mol Cell, 2002. 9(1): p. 45-57. 103. Voss, T.C., et al., Functional interactions with Pit-1 reorganize co-repressor complexes in the living cell nucleus. J Cell Sci, 2005. 118(Pt 15): p. 3277-88. 104. Yin, L. and M.A. Lazar, The orphan nuclear receptor Rev-erbalpha recruits the N- CoR/histone deacetylase 3 corepressor to regulate the circadian Bmal1 gene. Mol Endocrinol, 2005. 19(6): p. 1452-9. 105. Eggertsen, G., et al., Molecular cloning and expression of rabbit sterol 12alpha- hydroxylase. J Biol Chem, 1996. 271(50): p. 32269-75. 106. Gafvels, M., et al., Structure and chromosomal assignment of the sterol 12alpha- hydroxylase gene (CYP8B1) in human and mouse: eukaryotic cytochrome P-450 gene devoid of introns. Genomics, 1999. 56(2): p. 184-96. 107. Ishida, H., et al., Structure, evolution, and liver-specific expression of sterol 12alpha-hydroxylase P450 (CYP8B). J Biochem, 1999. 126(1): p. 19-25. 108. Lundell, K. and K. Wikvall, Gene structure of pig sterol 12alpha-hydroxylase (CYP8B1) and expression in fetal liver: comparison with expression of taurochenodeoxycholic acid 6alpha-hydroxylase (CYP4A21). Biochim Biophys Acta, 2003. 1634(3): p. 86-96. 109. Ellis, E., et al., Feedback regulation of bile acid synthesis in primary human hepatocytes: evidence that CDCA is the strongest inhibitor. Hepatology, 2003. 38(4): p. 930-8. 110. Kerr, T.A., et al., Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis. Dev Cell, 2002. 2(6): p. 713- 20. 111. Kim, I., et al., Differential regulation of bile acid homeostasis by the farnesoid X receptor in liver and intestine. J Lipid Res, 2007. 48(12): p. 2664-72. 112. Mataki, C., et al., Compromised intestinal lipid absorption in mice with a liver- specific deficiency of liver receptor homolog 1. Mol Cell Biol, 2007. 27(23): p. 8330-9. 113. Jahan, A. and J.Y. Chiang, Cytokine regulation of human sterol 12alpha- hydroxylase (CYP8B1) gene. Am J Physiol Gastrointest Liver Physiol, 2005. 288(4): p. G685-95.

114. Andersson, U., et al., Thyroid hormone suppresses hepatic sterol 12alpha- hydroxylase (CYP8B1) activity and messenger ribonucleic acid in rat liver: failure to define known thyroid hormone response elements in the gene. Biochim Biophys Acta, 1999. 1438(2): p. 167-74. 115. Ellis, E.C., Suppression of bile acid synthesis by thyroid hormone in primary human hepatocytes. World J Gastroenterol, 2006. 12(29): p. 4640-5. 116. Kudo, T., et al., Clock mutation facilitates accumulation of cholesterol in the liver of mice fed a cholesterol and/or cholic acid diet. Am J Physiol Endocrinol Metab, 2008. 294(1): p. E120-30. 117. Galman, C., B. Angelin, and M. Rudling, Bile acid synthesis in humans has a rapid diurnal variation that is asynchronous with cholesterol synthesis. Gastroenterology, 2005. 129(5): p. 1445-53. 118. DeLoskey, R.J. and D.S. Beattie, The effects of insulin and glucose on the induction and intracellular translocation of delta-aminolevulinic acid synthase. Arch Biochem Biophys, 1984. 233(1): p. 64-71. 119. Kanayama, T., et al., Interaction between sterol regulatory element-binding proteins and liver receptor homolog-1 reciprocally suppresses their transcriptional activities. J Biol Chem, 2007. 282(14): p. 10290-8. 120. Misawa, K., et al., Sterol regulatory element-binding protein-2 interacts with hepatocyte nuclear factor-4 to enhance sterol isomerase gene expression in hepatocytes. J Biol Chem, 2003. 278(38): p. 36176-82. 121. Meng, Q.J., et al., Ligand modulation of REV-ERBalpha function resets the peripheral circadian clock in a phasic manner. J Cell Sci, 2008. 121(Pt 21): p. 3629-35. 122. Brown, M.S. and J.L. Goldstein, A proteolytic pathway that controls the cholesterol content of membranes, cells, and blood. Proc Natl Acad Sci U S A, 1999. 96(20): p. 11041-8. 123. Nilsson, L.M., et al., Bile acids and lipoprotein metabolism: effects of cholestyramine and chenodeoxycholic acid on human hepatic mRNA expression. Biochem Biophys Res Commun, 2007. 357(3): p. 707-11. 124. Grigo, K., et al., HNF4 alpha orchestrates a set of 14 genes to down-regulate cell proliferation in kidney cells. Biol Chem, 2008. 389(2): p. 179-87. 125. Sel, S., et al., Human renal cell carcinogenesis is accompanied by a coordinate loss of the tissue specific transcription factors HNF4 alpha and HNF1 alpha. Cancer Lett, 1996. 101(2): p. 205-10. 126. Hofmann AF, Hagey LR.Cell Mol Life Sci. Bile acids: chemistry, pathochemistry, biology, pathobiology, and therapeutics. 2008 Aug;65(16):2461- 83. 127 Hofmann AF. Arch Intern Med. 1999 Dec 13-27;159(22):2647-58. The continuing importance of bile acids in liver and intestinal disease.