The Role of Nutrition in Creation of the Eye Imaginal Disc and Initiation of Metamorphosis in Manduca Sexta

View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Biology 285 (2005) 285 – 297 www.elsevier.com/locate/ydbio The role of nutrition in creation of the eye imaginal disc and initiation of metamorphosis in Manduca sexta Steven G.B. MacWhinniea, J. Paul Alleea, Charles A. Nelsonb, Lynn M. Riddifordb, James W. Trumanb, David T. Champlina,* aDepartment of Biology, University of Southern Maine, 96 Falmouth Street, Portland, ME 04103-9300, USA bDepartment of Biology, University of Washington, 24 Kincaid Hall, Box 351800, Seattle, WA 98195-1800, USA Received for publication 31 May 2005, revised 1 June 2005, accepted 1 June 2005 Available online 15 August 2005 Abstract With the exception of the wing imaginal discs, the imaginal discs of Manduca sexta are not formed until early in the final larval instar. An early step in the development of these late-forming imaginal discs from the imaginal primordia appears to be an irreversible commitment to form pupal cuticle at the next molt. Similar to pupal commitment in other tissues at later stages, activation of broad expression is correlated with pupal commitment in the adult eye primordia. Feeding is required during the final larval instar for activation of broad expression in the eye primordia, and dietary sugar is the specific nutritional cue required. Dietary protein is also necessary during this time to initiate the proliferative program and growth of the eye imaginal disc. Although the hemolymph titer of juvenile hormone normally decreases to low levels early in the final larval instar, eye disc development begins even if the juvenile hormone titer is artificially maintained at high levels. Instead, creation of the late- forming imaginal discs in Manduca appears to be controlled by unidentified endocrine factors whose activation is regulated by the nutritional state of the animal. D 2005 Elsevier Inc. All rights reserved. Keywords: Imaginal disc; Insect metamorphosis; Juvenile hormone; Ecdysteroid; Eye; Manduca sexta Introduction occur (Nijhout, 2003). Early during the final feeding stage, the imaginal primordia initiate proliferative programs to form In holometabolous insects, many adult-specific structures the adult structures (Miles and Booker, 1993; Monsma and are formed from cells that either are set aside early and Booker, 1996; Kremen and Nijhout, 1998; Tanaka and proliferate throughout most of larval life, e.g., the imaginal Truman, 2005; Allee et al., submitted for publication). Later, discs of Drosophila (Cohen, 1993), or form from regions of the animal achieves a critical size, and the endocrine events the larval epidermis during the final larval instar, e.g., the that lead to the cessation of feeding and overt metamorphosis imaginal primordia for the eye, leg, proboscis, and antenna of are set in motion. Lepidoptera (Sehnal et al., 1996; Truman and Riddiford, Insect molting and metamorphosis are governed primarily 1999, 2002). In Lepidoptera, larval growth occurs during a by two hormones, ecdysteroids that cause the molts and species-specific number of instars followed by metamorpho- juvenile hormone (JH) that prevents metamorphic molts sis after attaining an appropriate size (Nijhout, 2003). The (Nijhout, 1994). In the final larval instar of the tobacco final larval instar is determined by the body size at the outset hornworm, Manduca sexta, the JH titer declines to undetect- of the instar, but nutrient intake and further growth are able levels by the time the larva attains its critical size for necessary during this instar in order for metamorphosis to feeding to cease (Nijhout and Williams, 1974a,b; Fain and Riddiford, 1975; Baker et al., 1987; Davidowitz et al., 2003) * Corresponding author. Fax: +1 207 228 8116. (Fig. 1). A small surge of ecdysteroid in the absence of JH E-mail address: [email protected] (D.T. Champlin). causes the cessation of feeding, commitment of the general 0012-1606/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2005.06.021 286 S.G.B. MacWhinnie et al. / Developmental Biology 285 (2005) 285–297 MP Biomedicals, Aurora, OH) that included 100 mg antibiotic/l (tetracycline or streptomycin). Larvae fed mini- mal dietary nutrients were switched at ecdysis to the fifth instar from the normal diet to a 3% non-nutritive agar block or a 3% agar block supplemented with one or two of the following as indicated, 7% sucrose or a 5.8% suspension of Fig. 1. Hemolymph titers of JH and ecdysteroid during the fourth and fifth larval instars, adapted from Riddiford (1994). Dashed line = JH titer in either of two isolates of casein (#1 = #C5679, #2 = #C6554, larvae fed continuously. Double-dotted line = JH titer in larvae removed Sigma-Aldrich, St. Louis, MO) (Jones et al., 1981). from food at ecdysis to the fifth instar (Nijhout and Williams, 1974b; The ages of animals are referenced relative to larval Cymborowski et al., 1982). ecdyses either in hours or days (ecdysis is designated as occurring on Day 0). Lights-off is designated as 00:00 AZT body epidermis to make pupal cuticle at the next molt, and (Arbitrary Zeitgeber Time, Pittendrigh, 1965). onset of wandering to find a pupation site (Riddiford, 1978; Larvae were treated with the JH mimic pyriproxifen Dominick and Truman, 1985). Later, a large ecdysteroid (Valent USA Corporation, Walnut Creek, CA). Ten micro- surge in the presence of JH causes the pupal molt (Fig. 1). If a liters of carrier alone or carrier plus pyriproxifen (1 Ag JH mimic is given at the onset of the small surge of pyriproxifen/Al cyclohexane) was applied topically along ecdysteroid, the larva will molt to a larval–pupal intermedi- the dorsal midline of the thorax at the stage indicated. ate showing a normal larval body with small pupal structures Images were taken on a Leica GZ6 stereo zoom formed by the imaginal primordia (Truman et al., 1974; microscope. Hatakoshi et al., 1988), indicating that the primordia had undergone pupal commitment prior to addition of the JH Analysis of broad expression by qRT-PCR mimic. When larvae are starved early in the instar for several days then fed, many molt to supernumerary larvae showing Total RNA was isolated using the SV total RNA isolation pupal cuticle at sites of the imaginal primordia and on the kit (Promega, Madison, WI) followed by cDNA synthesis wing discs (Nijhout and Williams, 1974b; Jones et al., 1980; with SuperScript II reverse transcriptase (Invitrogen, Carls- Cymborowski et al., 1982; Safranek and Williams, 1984). bad, CA) according to the manufacturer’s instructions using Starvation immediately after ecdysis causes the JH titer to an oligo d(T) primer and 3 Ag of RNA. Quantitative RT- remain high (Cymborowski et al., 1982)(Fig. 1). PCR (qRT-PCR) was done using the Brilliant SYBR Green Our recent study on the early formation of the eye qPCR kit and MX4000 multiplex quantitative PCR system imaginal disc in Manduca showed that the adult eye (Stratagene, La Jolla, CA). qRT-PCR conditions were primordium detaches from the overlying cuticle about 20 optimized for each primer set, and the product confirmed hours (h) after ecdysis to the fifth instar, and about 4 h later, by DNA sequencing. Each histogram shown is the average the cells begin to proliferate and fold inward to form the of nine samples (three independent experiments with each imaginal disc (Allee et al., submitted for publication). Long- cDNA sample amplified in triplicate). The insecticyanin lasting JH mimics given prior to the molt to the fifth instar gene (ins-a) was used as the normalizer. The overall level of had no effect on this development, suggesting that factors insecticyanin remained fairly constant despite the loss of other than the decline of JH in the early final instar are insecticyanin mRNA from the cells of the eye primordium responsible for the initiation of disc development. Here, we by 24 h after ecdysis in normal fed larvae because isolated show that feeding for a minimum of 9–12 h in the fifth tissue included flanking larval epidermal cells that maintain instar is necessary for the adult eye primordium to become high levels of insecticyanin expression (Allee et al., pupally committed and that commitment depends only on submitted for publication). The INS-a4 INS-a5 primer pair intake of sugar during this period. By contrast, the later was used to test for genomic DNA contamination, and no onset of proliferative growth to form the disc occurs only genomic DNA was detected in any cDNA sample when after feeding on a mixture of sugar and amino acids. using the SV total RNA isolation kit. Importantly, the other imaginal primordia have a similar insecticyanin, ins-a gene (Li and Riddiford, 1992) dependence on nutrient intake, indicating that a specific ACCESSION: X64714: signal may be coordinating their responses to nutrition. INS-a1 CAGAGGTTCCTAGTCTTCACCA INS-a2 GTCAGGGCCGGTAAGGCTGTAT Materials and methods Experimental animals and hormone treatments 609 base pair product from cDNA template and 4410 base pair product from genomic DNA template. Larvae of the tobacco hornworm, M. sexta (L.), were reared in individual containers at 26-C under a 17L:7D INS-a4: CACCCTGACAAGAAGGCCCACA photoperiod on an artificial diet (gypsy moth wheat germ diet, INS-a5: CCTAATGGCTGTAAATATGCCAATG S.G.B. MacWhinnie et al. / Developmental Biology 285 (2005) 285–297 287 256 base pair product from genomic DNA template and at room temperature 4 h in PBS with 15 Ag BrdU/ml. After no product from cDNA template. labeling, tissues were fixed overnight at 4-C with 3.7% Broad cDNA Z2-isoform (Zhou et al., 1998) ACCES- formaldehyde in PBS and then acid-treated to expose the SION AF032674: BrdU epitope as described (Champlin and Truman, 1998a). Tissues were then incubated sequentially at 4-C in the Z2F CTATGCGGCAAAGTACTGT following with extensive washes in PBS–0.3% TX between Z2R CCCTGGCCTCGACTTGTGGTAG each step: 2% normal donkey serum overnight; a 1:200 dilution of anti-BrdU monoclonal antibody (Becton-Dick- 165 base pair product from cDNA template.

Load more