Epigenetic Silencing of Mirna-338-5P and Mirna-421

Published OnlineFirst December 26, 2018; DOI: 10.1158/1078-0432.CCR-18-3230

Translational Cancer Mechanisms and Therapy Clinical Cancer Research Epigenetic Silencing of miRNA-338-5p and miRNA-421 Drives SPINK1-Positive Prostate Cancer Vipul Bhatia1, Anjali Yadav1, Ritika Tiwari1, Shivansh Nigam1, Sakshi Goel1, Shannon Carskadon2, Nilesh Gupta3, Apul Goel4, Nallasivam Palanisamy2, and Bushra Ateeq1

Abstract

Purpose: Serine peptidase inhibitor, Kazal type-1 (SPINK1) DNA immunoprecipitation were performed on prostate overexpression defines the second most recurrent and aggres- cancer cell lines and patients' specimens. sive prostate cancer subtype. However, the underlying molec- Results: We established a critical role of miRNA-338-5p/- ular mechanism and pathobiology of SPINK1 in prostate 421 in posttranscriptional regulation of SPINK1. Ectopic cancer remains largely unknown. expression of miRNA-338-5p/-421 in SPINK1-positive cells Experimental Design: miRNA prediction tools were abrogates oncogenic properties including cell-cycle progres- employed to examine the SPINK1-30UTR for miRNA bind- sion, stemness, and drug resistance, and shows reduced tumor ing. Luciferase reporter assays were performed to confirm burden and distant metastases in a mouse model. Importantly, the SPINK1-30UTR binding of shortlisted miR-338-5p/ we show that patients with SPINK1-positive prostate cancer miR-421. Furthermore, miR-338-5p/-421–overexpressing exhibit increased EZH2 expression, suggesting its role in cancer cells (SPINK1-positive) were evaluated for onco- epigenetic silencing of miRNA-338-5p/-421. Furthermore, genic properties using cell-based functional assays and a presence of CpG dinucleotide DNA methylation marks on mouse xenograft model. Global gene expression profiling the regulatory regions of miR-338-5p/-421 in SPINK1-positive was performed to unravel the biological pathways altered prostate cancer cells and patients' specimens confirms epige- by miR-338-5p/-421. IHC and RNA in situ hybridization netic silencing. were carried out on prostate cancer patients' tissue micro- Conclusions: Our findings revealed that miRNA-338-5p/- array for SPINK1 and EZH2 expression, respectively. 421 are epigenetically silenced in SPINK1-positive prostate Chromatin immunoprecipitation assay was performed cancer, although restoring the expression of these miRNAs to examine EZH2 occupancy on the miR-338-5p/-421– using epigenetic drugs or synthetic mimics could abrogate regulatory regions. Bisulfite sequencing and methylated SPINK1-mediated oncogenesis.

Introduction with this disease (1–3). Majority of these patients harbor gene rearrangements between members of the E26 transformation– Prostate cancer is characterized by extensive molecular hetero- specific(ETS) transcription factor family and the androgen-reg- geneity and varied clinical outcomes (1). Multiple molecular ulated transmembrane protease serine 2 (TMPRSS2), most recur- subtypes involving recurrent genetic rearrangements, DNA copy rent (50%) being TMPRSS2-ERG, involving the v-ets erythro- number alterations, and somatic mutations have been associated blastosis virus E26-oncogene homolog (ERG; refs. 3, 4). The TMPRSS2-ERG–encoded ERG transcription factor is known to drive cell invasion and metastases, DNA damage in vitro, and focal 1Molecular Oncology Lab, Department of Biological Sciences and Bioengineer- precancerous prostatic intraepithelial neoplasia (PIN) lesions in ing, Indian Institute of Technology Kanpur, Kanpur, Uttar Pradesh, India. 2Vatti- transgenic mice (5, 6). kuti Urology Institute, Department of Urology, Henry Ford Health System, While TMPRSS2-ERG fusion forms the most frequent molec- 3 Detroit, Michigan. Department of Pathology, Henry Ford Health System, ular subtype, a significant subset of ETS-negative (–) prostate 4 Detroit, Michigan. Department of Urology, King George's Medical University, cancer show overexpression of serine peptidase inhibitor, Kazal Lucknow, Uttar Pradesh, India. type-1 (SPINK1) in approximately 10%–15% of the total patients Note: Supplementary data for this article are available at Clinical Cancer with prostate cancer, a distinct subtype defined by overall higher Research Online (http://clincancerres.aacrjournals.org/). Gleason score, shorter progression-free survival, and biochemical V. Bhatia and A. Yadav contributed equally to this article. recurrence (7–9). SPINK1 promotes cell proliferation and inva- Corresponding Author: Bushra Ateeq, Molecular Oncology Lab, Department of sion through autocrine/paracrine signaling and mediates its onco- Biological Sciences and Bioengineering, Indian Institute of Technology Kanpur, genic effects, in part, through EGFR interaction by activating Kanpur, Uttar Pradesh 208016, India. Phone: 91-512-259-4083; Fax: 91-512-259- downstream signaling. Monoclonal EGFR antibody administered 4010; E-mail: [email protected] in SPINK1-positive xenografted mice showed only a marginal doi: 10.1158/1078-0432.CCR-18-3230 decrease in tumor burden, suggesting involvement of EGFR- 2018 American Association for Cancer Research independent oncogenic pathways (10).

www.aacrjournals.org OF1

Bhatia et al.

Translational Relevance Materials and Methods Human prostate cancer specimens We establish a regulatory model involving the functional Fresh-frozen prostate cancer specimens used in this study interplay between SPINK1, miRNA-338-5p/miRNA-421, were procured from King George's Medical University (KGMU, and EZH2, thereby revealing hitherto unknown mechanism Lucknow, India). Clinical specimens were collected after of SPINK1 upregulation in SPINK1-positive prostate cancer obtaining written informed consent and institutional review subtype. Our findings provide a strong rationale for the board approvals from KGMU and Indian Institute of Technol- development of potential therapeutic strategies for SPINK1- ogy Kanpur (Kanpur, India). A total of 20 prostate cancer positive malignancies. We demonstrate that restoring specimens were selected for this study based on SPINK1 and miRNA-338-5p/miRNA-421 expression using epigenetic TMPRSS2-ERG status, confirmed by qPCR, IHC, and FISH (4). drugs, including DNA methyltransferase (DNMT) inhibitors Tissue microarrays (TMA) comprising prostate cancer speci- in combination with histone deacetylase (HDAC) or histone mens (n ¼ 238) were obtained from Department of Pathology, lysine methyltransferase (HKMT) inhibitors or miRNA syn- Henry Ford Health System (Detroit, MI), after getting written thetic mimics in SPINK1-positive prostate cancer, abrogates informed consent and institutional review board approval. All SPINK1-mediated oncogenicity. The major findings of this patients' specimens used in this study were collected in accor- study will not only advance the prostate cancer field, but dance with the Declaration of Helsinki. TMAs were stained for also be valuable for treatment and disease management of SPINK1 and EZH2 by performing IHC and RNA in situ hybrid- other SPINK1-positive malignancies. ization (RNA-ISH), respectively.

Mouse xenograft studies For mouse xenograft studies, 5- to 6-week-old NOD.CB17- scid Although, genomic events such as gene rearrangements and Prkdc /J (NOD/SCID) male mice (Jackson Laboratory) were n ¼ somatic mutations constitute most recurrent oncogenic aberra- randomized into three groups ( 8 for each experimental tions,manycouldalsobeattributedtoepigeneticalterations. condition). All procedures involving mice were approved by Earlier studies have shown that aberrant expression of enhancer the Committee for the Purpose of Control and Supervision of of zeste homolog 2 (EZH2) owing to genomic loss of miRNA- Experiments on Animals (CPCSEA) and conform to all regu- 101 (11) or hypermethylation of miR-26a (12) constitutes a latory standards of the Institutional Animal Ethics Committee common regulatory mechanism across several solid cancers. of the Indian Institute of Technology Kanpur. Detailed meth- EZH2, being the key component of the polycomb-repressive odology of the xenograft studies is provided in the Supple- complex 2 (PRC2) mediates trimethylation on the histone 3 mentary Methods and Supplementary Table S1. lysine 27 (H3K27me3), leading to gene silencing (13). How- 0 ever, phosphorylated form of EZH2 is known to switch its miRNA 3 UTR SPINK1 luciferase reporter assay 0 0 function from polycomb repressor to transcriptional coactiva- Full-length SPINK1 3 untranslated region (3 UTR) wild- tor of androgen receptor in castration-resistant prostate cancers type and mutant with altered residues in the binding sites of (CRPC; ref. 14). Moreover, recent studies have shown PRC2 miR-338-5p and miR-421 was cloned in Firefly/Renilla Dual- epigenetically suppresses the expression of several tumor-sup- Luciferase reporter vector pEZX-MT01 (GeneCopoeia). Cells pressive miRNAs such as, miR-181a/b, miR-200b/c, and miR- were seeded in a 24-well plate at 30%–40% confluency and 203, while these miRNAs in turn directly target PRC1 members, cotransfected with 30 pmol of miRNA mimics along with 25 ng namely BMI1 and RING2, thereby reinforcing the repressive of pEZX-MT01 constructs using Lipofectamine RNAiMax (Invi- molecular circuitry (15). trogen). Luciferase assay was performed using Dual-Glo Lucif- Although overexpression of SPINK1 forms the second most erase Assay (Promega) 24 hours after the second transfection. prevalent and aggressive subtype of prostate cancer (4, 7), the Firefly luciferase activity was obtained by normalizing with underlying mechanism involved in its upregulation is poorly Renilla for each sample. understood and remains a matter of conjecture. Furthermore, SPINK1 overexpression is not ascribed to chromosomal rear- Gene expression array analysis rangement, deletion, or amplification (7), and thus alludes Total RNA was isolated from stable 22RV1-miR-338-5p, to a possible transcriptional or posttranscriptional regulation. 22RV1-miR-421, and 22RV1-CTL cells and subjected to Whole A recent study showed the transcriptional activation of Human Genome Oligo Microarray profiling (dual color) using SPINK1 along with gastrointestinal lineage signature genes in Agilent platform (8 60K format) according to the manufac- patients with CRPC (16). Our study focuses on the posttran- turer's protocol. Microarray hybridization was performed using scriptional regulation of SPINK1 expression by miR-338-5p three independent stable miRNA-overexpressing clones against and miR-421, which are epigenetically silenced in SPINK1- control cells. Microarray data was normalized by following locally positive prostate cancer. We also provide evidence that EZH2 weighted linear regression (Lowess normalization). Furthermore, acts as an epigenetic switch, thereby promoting transcriptional details of differential expression analysis are provided in the silencing of miR-338-5p/miR-421 by establishing H3K27me3- Supplementary Methods and Supplementary Table S1. repressive marks, thus leading to SPINK1 overexpression. Collectively, our findings suggest potential benefits with epi- Statistical analysis genetic inhibitors or synthetic miR-338-5p/-421 mimics as Statistical significance was determined by either two-tailed þ adjuvant therapy for the treatment of aggressive SPINK1 Student t test for independent samples or one-way ANOVA, malignancies. otherwise specified. The differences between the experimental

OF2 Clin Cancer Res; 2018 Clinical Cancer Research

Silencing of miR-338-5p/-421 Drives SPINK1-Positive Cancer

PITA miR-338-5p B A miR-616-5p miR-421 −10 −5 0 5 10 miR-876-5p miR-1201 215

SPINK1 miR-494 miRmap miR- miR- 373 4261 ERG 488 3978 4330 4502 miR-338-5p

miRanda miR-421 miR-3167 miR-5100 1323 3661 TCGA-PRAD (n = 119) miR-769-3p miR- 607 95-3p miR-3142 212-3p C SPINK1 n 1305 182-5p 4272 Positive ( = 9) 1290 ERG Positive (n = 11) RNA Hybrid 3201 miR-421 miR-338-5p miR-876-5p 9 5'- AGGCCUGACUGGCCUUAUUGUU-3' SPINK1 • P = 0.03 3'- GUGAGUCGUGGUCCUAUAACAA-5' miR-338-5p SPINK1 SPINK1

5’-GAACCAAGGUUUUGAAAUCCC-3’ 5'- agGCCUGACUGGCCUUAUUGUUGAa -3' ::::: P = 0.02 P = 0.29 • 3’-ACCACUAAGUGUUUCUUUAGGU-5’ 3'- cgCGGGUUAAUU- - ACAGACAACUa -5' miR-876-5p miR-421 19nt 36nt 59nt SPINK1 • • • 1234567 3’UTR (89 nt) Target/RNUB6 expression • • 0 5 10 15 20 25 30 D E 02468

+++++++++++++++++ +++++++++++++++++ ++++++ ++++++++++ ++++++++++++ 1.00 +++++++++ 1.00 +++ +++++++++++++ ++++++ + + ++++++++ + +++ +++++++++++++++ +++++++++++++++++++++++++++++++++++++++++ TCGA-PRAD ++ +++++++++++++++++++++++++++++++++ +++++++ +++++++++++++++++ ++++ ++++++++++++++++ ++++ ++++++++ + +++++++++++++++++++++++++++++++ ++++++ +++++++++++++++++++++++ +++++++++++++ ++++++ ++++++++ 6 3 +++++++++++++ ++ +++ + ns ++ ++++++++++++++++++++ + + +++++++++++++++++ ++++ +++++++ * +++++++ +++++++ ++++++++ +++++++++++++++ + + +++++++++++ ++++++ +++++++ ++++++++++++++++++++++++++++ +++++++++++++++++ +++ ++ +++++++++++++++ ++++++ ++++++++++++ +++ ++++++ ** 0.75 ++ 0.75 ++++++++++++++++++++++++++ + ++ ++ ++++++++++ +++++ +++++ +++ ++++++++++ ++++ + +++++++++++++ + + +++ + ++ ++ ++ ++ +++++++ +++++++ + + + 4 2 0.50 ++++++++++++++ + 0.50 RPM+1) 2 0.25 + miR-338-5p Low 0.25 + miR-421 Low 2 1 + (log + miR-338-5p High miR-421 High (log2 RPM+1) miR-421 expression Survival probability P = 0.0024 P = 0.13 0.00 0.00 miR-338-5p expression 0 0 012345 031 254 34 5 34 5 Days (x1,000) Days (x1,000) Primary Gleason score Primary Gleason score Number at risk Number at risk Low 151 53 19 6 2 1 173 65 17 3 2 1 F High 324 123 27 3 1 0 291 105 27 5 1 0 GSE45604 100 miR-338-5p 400 miR-421 P = 0.0001 P = 0.0005 80 300 60 G Wild type 5'- AGGCCTGACTGGCCTTATTGTTGAATAAATGT -3' 200 40 Mutant 5'- AGACTTGCCGGGCCCTATGCTGCGACAAATGT -3' 20 100 Fireﬂy luc SPINK1 3’-UTR 0 0

Normalized signal intensity Normal 6 78 9 Normal 6 7 8 9 miR-338-5p and 421 Gleason score Gleason score 160 HEK293T binding site ** 120 HI * 2.5 VCaP ERG ** SPINK1 80 2.0 2.1 VCaP * 1.9 ** 40 1.5 1.7 * Luciferase activity (%) 0 1.0 1.5 SPINK1 3’UTR + - + + - - GAPDH expression 1.3 SPINK1 0.5 3’UTR mut - + - - + + 1.1 Nontargeting + + - - - -

target / 0 1 miR-338-5p mimic - - + - + - NT 338-5p 421 Absorbance (550 nm) NT 338-5p 421 miR-421 mimic - - - + - + AntagomiR AntagomiR

22RV1 DAPI SPINK1 F-ACTIN MERGE

J miR-338-5p 22RV1 miR-421 22RV1 3.5 SPINK1 1.2 3.0 SPINK1 1.2 ** 3.0 1.0 2.5 * 1.0 2.5 0.8 2.0 0.8 2.0 ** * 0.6 1.5 * 0.6 1.5 0.4 1.0 0.4 1.0 ** 0.5 ** 0.2 0.5 ** 0.2 ** ** ** SPINK1/GAPDH expression 0 0 miR-421/RNUB6 expression 0 0 SPINK1 / GAPDH expression CTL C-1 C-2 C-3 CTL Pool C-1 C-2 miR-338-5p/RNUB6 expression

miR-338-5p miR-421 miR-421 miR-338-5p CTL

Figure 1. miR-338-5p and miR-421 are differentially expressed in SPINK1þ/ERG fusion–negative prostate cancer. A, Venn diagram displaying miRNAs computationally predicted to target SPINK1 by PITA, miRmap, miRanda, and RNAHybrid (top). Schematic of predicted miR-338-5p, miR-421, and miR-876-5p–binding sites on the 30-UTR of SPINK1 (bottom). B, Heatmap depicting miR-338-5p and miR-421 expression in the SPINK1þ/ERG patients (n ¼ 119) in TCGA-PRAD dataset. Shades of blue and gold represent log2 (x þ 1), where x represents the gene expression value. (Continued on the following page.)

www.aacrjournals.org Clin Cancer Res; 2018 OF3

Bhatia et al.

groups were considered significant if the P value was of less than independent cohort (GSE45604) (Fig. 1F). In summary, þ 0.05. Error bars represent mean SEM. All experiments were SPINK1 subtype shows lower expression of miR- repeated three times in triplicates. 338-5p/-421, which strongly associates with overall poor survival and aggressiveness of the disease. Supplementary methods Additional methodologic details are available in the Supple- miR-338-5p and miR-421 directly target SPINK1 and modulate mentary Methods and Supplementary Table S1. its expression Having established an association between miR-338-5p/-421 Data availability and SPINK1 expression in prostate cancer specimens, we next 0 The gene expression microarray data from this study has been examined the ability of these miRNAs to bind to SPINK1-3 -UTR. 0 0 0 submitted to the NCBI Gene Expression Omnibus (GEO, http:// The wild-type (3 -UTR-WT) and mutant (3 -UTR-mut) SPINK1-3 - www.ncbi.nlm.nih.gov/geo/) under the accession number UTR cloned in Firefly/Renilla dual-luciferase reporter vectors were GSE108558. cotransfected with synthetic mimics for miR-338-5p or miR-421 in HEK293T cells, a significant reduction in the luciferase activity was noted with 30-UTR-WT, while no suppressive effect was Results observed in 30-UTR-mut constructs (Fig. 1G). We next evaluated þ Identification of differentially expressed miRNAs in SPINK1 / the expression of these miRNAs in various prostate cancer cell þ ERG-fusion–negative prostate cancer lines including 22RV1 (SPINK1 ), ETS-fusion positive VCaP þ þ We employed four miRNA prediction algorithms, namely PITA (TMPRSS2-ERG ), and LNCaP (ETV1 ) cells. Supporting our (omicstools.com), miRmap (mirmap.ezlab.org), miRanda observation in clinical specimens, the cell line data also showed (microRNA.org), and RNAHybrid (BiBiserv2-RNAhybrid) to lower expression of miR-338-5p/-421 in 22RV1 cells relative to examine putative binding of miRNAs to the 30UTR of SPINK1 ETS-fusion–positive cell lines (Supplementary Fig. S1A). To fur- transcript. Notably, three miRNAs (miR-338-5p, -421, and -876- ther ascertain that miR-338-5p/-421 specifically regulates 5p) were predicted as strong candidates by all four algorithms SPINK1, we used antagomiRs (anti-miR) to abrogate miR-338- (Fig. 1A; Supplementary Table S2), and were taken forward for 5p and miR-421 expression (anti-338-5p and anti-421, respec- further investigation. To examine the differential expression of tively) in VCaP cells (Supplementary Fig. S1B). As expected, anti- þ þ these miRNAs between SPINK1 and ERG patients' specimens, 338-5p or anti-421 significantly induced SPINK1 expression with publicly available RNA-sequencing (RNA-seq) data from The concomitant increase in cell invasion and migration (Fig. 1H Cancer Genome Atlas Prostate Adenocarcinoma (TCGA-PRAD) and I; Supplementary Fig. S1C and S1D), while there was no dataset were analyzed. Interestingly, hierarchical clustering of change in the endogenous ERG expression (Fig. 1H; Supple- TCGA-PRAD RNA-seq data exhibit reduced expression of miR- mentary Fig. S1C). We next established stable miR-338-5p or þ 338-5p and miR-421 (miR-338-5p/-421) in SPINK1 /ERG miR-421–overexpressing 22RV1 cells (22RV1-miR-338-5p and patients (Fig. 1B). To validate further, we examined the expression 22RV1-miR-421, respectively) and examined SPINK1 expression, of miR-338-5p/-421 and miR-876-5p in our prostate cancer a significant reduction in SPINK1 both at transcript (80%–90%) patients' specimens. A significant lower expression of miR-338- and protein (Fig. 1J) levels was observed. Because, SPINK1 over- þ 5p and miR-421 was observed specifically in SPINK1 as com- expression has also been implicated in colorectal, lung, pancre- þ pared with ERG specimens, while no difference in miR-876-5p atic, breast, and ovarian cancers (17, 18), we sought to examine expression was noticed (Fig. 1C). To understand the clinical whether SPINK1 is regulated by a similar mechanism in cancers of significance of miR-338-5p/-421, we stratified TCGA-PRAD data different cellular/tissue origins. Thus, we determined the status of into high and low miRNA-expressing groups. Intriguingly, SPINK1 expression in multiple cancer cell lines (Supplementary þ patients with low miR-338-5p expression showed significant Fig. S2A and S2B). Furthermore, SPINK1 cancer cell lines, (P ¼ 0.0024) association with decreased survival probability namely, colorectal (WiDr), melanoma (SK-MEL-173), pancreatic compared with high miRNAs group, while no such association (CAPAN-1), and prostate (22RV1) transfected with mimics for was found in case of miR-421 (Fig. 1D). We speculate that this miR-338-5p or miR-421 showed a significant decrease in SPINK1 could be attributed due to narrow range of miRNA-421 expression expression (Supplementary Fig. S2C and S2D). This provides in TCGA-PRAD cohort. Moreover, lower expression of miR-338- irrevocable evidence that these two miRNAs modulate the expres- 5p also associates with higher Gleason score (Fig. 1E). Similar sion of SPINK1 transcript irrespective of the tissue background. To association for both miRNAs was further confirmed in another ascertain whether decrease in oncogenic properties is indeed due

(Continued.) C, Taqman assay showing relative expression for miR-338-5p, miR-421, and miR-876-5p in SPINK1þ and ERGþ prostate cancer patients' specimens (n ¼ 20). Data represent normalized expression values with respect to RNUB6 control. Error bars, mean SEM. P values were calculated using two-tailed unpaired Student t test. D, Kaplan–Meier curve showing survival probability in TCGA-PRAD cohort stratified on the basis of high versus low miR-338-5p and miR- 421 expression (n ¼ 475 and n ¼ 465, respectively). E, RNA-seq data from TCGA-PRAD cohort showing expression of miR-338-5p (n ¼ 475) and miR-421 (n ¼ 465) in prostate cancer patients, categorized by varying primary Gleason score. F, Expression of miR-338-5p and miR-421 in prostate cancer patients (normal ¼ 10, PCa ¼ 50), categorized by Gleason grades (from GSE45604 dataset). G, Schematic of luciferase reporter construct with the wild-type or mutated (altered residues in red) SPINK1 30 untranslated region (30UTR) downstream of the Firefly luciferase reporter gene (top). Luciferase reporter activity in HEK293T cells cotransfected with wild-type or mutant 30-UTR SPINK1 constructs with mimics for miR-338-5p or miR-421. luc, luciferase; mut, mutated. H, qPCR data showing SPINK1 and ERG expression in VCaP cells transfected with antagomiRs as indicated (n ¼ 3 biologically independent samples; data represent mean SEM). I, Boyden chamber Matrigel invasion assay using same cells as in E. Representative fields of the invaded cells are shown in the inset. J, qPCR analysis demonstrating SPINK1 and miRNA expression in stable 22RV1-miR-338-5p (left) and 22RV1-miR-421 cells (middle; n ¼ 3 biologically independent samples; data represent mean SEM). Immunostaining for SPINK1 (right). Scale bar, 20 mm. Statistical significance was calculated by one-way ANOVA with Tukey post hoc test for multiple comparisons in E and F. For all other panels, , P 0.05 and , P 0.005 using two-tailed unpaired Student t test.

OF4 Clin Cancer Res; 2018 Clinical Cancer Research

Silencing of miR-338-5p/-421 Drives SPINK1-Positive Cancer

to miR-338/-421–mediated reduction in SPINK1 expression, a F). To examine spontaneous metastases, lung, liver, and bone rescue cell migration assay using human recombinant SPINK1 marrow were excised from the xenografted mice, and genomic (rSPINK1) was performed. As expected, 22RV1-miR-338/-421 DNA was quantified for the presence of human-specific Alu cells show decrease in migration, while adding rSPINK1 to these sequences. A significant decrease (85% for miR-338-5p and miRNA-overexpressing cells rescued the invasive phenotype, indi- 90% for miR-421) in cancer cell metastases was observed in cating that miR-338/-421–mediated effects are indeed due to the groups implanted with miRNA-338-5p/-421–overexpressing reduced SPINK1 expression (Supplementary Fig. S2E). cells (Fig. 2G). Similar to CAM assay, cancer cells failed to metastasize to murine liver (data not shown). Furthermore, a Ectopic expression of miR-338-5p and miR-421 attenuate significant drop (50%) in Ki-67–positive cells in the miRNA- SPINK1-mediated oncogenesis overexpressing xenografts confirms that tumor regression was SPINK1 overexpression is known to contribute to cell prolif- indeed due to decline in cell proliferation (Supplementary Fig. eration, invasion, motility, and distant metastases (4, 7, 19). S4E). Taken together, our findings indicate that miR-338-5p/-421 Hence, to understand the functional relevance of miR-338-5p/- downregulate the expression of SPINK1 and abrogate SPINK1- 421, we examined 22RV1-miR-338-5p and 22RV1-miR-421 cells mediated oncogenic properties and tumorigenesis. for any change in their oncogenic properties. Both 22RV1-miR- 338-5p (C1 and C2) and 22RV1-miR-421 (pooled and C1) cells miR-338-5p and miR-421 exhibit functional pleiotropy by showed a significant decrease in cell proliferation compared with regulating diverse biological processes 22RV1-CTL cells (Fig. 2A). Similarly, a significant reduction in To explore critical biological pathways involved in the tumor- þ invasive properties of 22RV1-miR-338-5p and 22RV1-miR-421 suppressive properties rendered by miR-338-5p/-421 in SPINK1 cells was noted (40% and 60%, respectively; Fig. 2B), whereas cancers, we determined global gene expression profiles of miRNA- only a modest decrease in cell proliferation and invasion was overexpressing 22RV1 cells. Our analysis revealed 2,801 and observed in pooled 22RV1-miR-338-5p cells (Supplementary Fig. 2,979 genes significantly dysregulated in 22RV1-miR-338-5p and S3A–S3C). To assess any change in neoplastic transformation, 22RV1-miR-421 cells, respectively, relative to control (log2 fold soft-agar colony formation assay was performed, where both change of 0.6, FDR < 0.05 and P < 0.05). Approximately 22% (704 22RV1-miR-338-5p and 22RV1-miR-421 cells exhibited marked genes) of the downregulated and approximately 15% (506 genes) reduction (60% and 80%, respectively) in number and size of of the upregulated transcripts show an overlap in miRNA-over- the colonies (Fig. 2C). Likewise, 22RV1-miR-338-5p and 22RV1- expressing cells (90% confidence interval; Fig. 3A), indicating that miR-421 cells demonstrate significantly lower numbers (70% these miRNAs regulate a significant number of common gene sets and 60%, respectively) of dense foci (Fig. 2D). However, over- and cellular processes. To examine biological processes common- expressing miR-338-5p/-421 in immortalized benign prostate ly regulated by miR-338-5p/-421, we employed the Database for epithelial RWPE-1 cells show no significant change in cell pro- Annotation, Visualization and Integrated Discovery (DAVID) and liferation or migration with miR-338-5p mimics' transfection, but gene set enrichment analysis (GSEA). Most of the downregulated a marginal decrease in proliferation and migration was noted with genes were associated with DNA double-strand break repair by miR-421 (Supplementary Fig. S3D). Furthermore, to demonstrate homologous recombination, cell-cycle regulation including that miR-338-5p/-421 modulate SPINK1 expression and attenu- G2–M-phase transition, stem cell maintenance, histone methyl- ate SPINK1-mediated oncogenicity irrespective of the tissue back- ation, and negative regulation of cell–cell adhesion, whereas ground, we performed functional assays using colorectal carci- genes involved in negative regulation of gene expression or epi- þ noma WiDr cells (SPINK1 ) stably overexpressing these miRNAs. genetics, intrinsic apoptotic signaling pathways, and negative As anticipated, a significant decrease in the oncogenic potential of regulation of metabolic process and cell cycle were significantly the miR-338-5p/-421–overexpressing WiDr cells was observed upregulated (Fig. 3B; Supplementary Table S3). Moreover, GSEA (Supplementary Fig. S3E and S3F). also revealed a significant decrease in enrichment of genes asso- To examine the tumorigenic potential of 22RV1-miR-338-5p ciated with sustaining proliferative signaling (EGFR and MEK/ and 22RV1-miR-421 cells in vivo, chick chorioallantoic membrane ERK) and cell-cycle regulators (E2F targets and G2–M transition)in (CAM) assay was performed, and relative number of intravasated miRNA-overexpressing cells, while tumor-suppressive p53 signal- cancer cells was analyzed. Consistent with in vitro results, 22RV1- ing was found to be positively enriched (Fig. 3C), indicating their miR-338-5p and 22RV1-miR-421 cells showed significant reduc- role in reduced oncogenicity. In addition, an overlapping network tion in the number of intravasated cells and tumor weight, of pathways using Enrichment map revealed regulation of cell- compared with control (Supplementary Fig. S4A–S4C). To eval- cycle phase transition and DNA repair pathways (overlap coeffi- uate distant metastases, lungs and liver excised from the chick cient ¼ 0.8, P < 0.001, FDR ¼ 0.01), as one of the significantly embryos were characterized for metastasized cancer cells. The enriched pathways for both miRNAs (Supplementary Fig. S5). groups implanted with miRNA-overexpressing cells revealed Because MAPK signaling pathways involving a series of protein approximately 80% reduction in cancer cell metastases to lungs kinase cascades play a critical role in the regulation of cell (Supplementary Fig. S4D), while no sign of liver metastases was proliferation, we examined the phosphorylation status of MEK observed in either group. Furthermore, tumor xenograft experi- (pMEK) and ERK (pERK), as a read-out of this pathway. In ment was recapitulated in immunodeficient NOD/SCID mice agreement with our in silico analysis, a significant decrease in (n ¼ 8 per group) by subcutaneously implanting 22RV1-miR- pMEK and pERK was observed in 22RV1-miR-338-5p and 22RV1- 338-5p, 22RV1-miR-421, and 22RV1-CTL cells into flank region, miR-421 cells (Fig. 3D). E2F transcription factors are known to and trend of tumor growth was recorded. A significant reduction interact with phosphorylated retinoblastoma and positively reg- in the tumor burden was observed in the mice bearing miR-338- ulate genes involved in S-phase entry and DNA synthesis (20); 5p and miR-421–overexpressing xenografts as compared with thus, we next examined the E2F1 level in miRNA-overexpressing control (70% and 85% reduction, respectively; Fig. 2E and cells, surprisingly a notable decrease in E2F1 was observed

www.aacrjournals.org Clin Cancer Res; 2018 OF5

Bhatia et al.

A B 6 CTL 14 CTL miR-338-5p C-1 5 12 miR-421 Pool 1.2 1.2 )

4 miR-338-5p C-2 miR-421 C-1 1.0 4 10 1.0 8 0.8 0.8 3 ** ** * ** ** 6 ** 0.6 0.6 2 ** ** 4 * ** 0.4 0.4 ** ** * **

Cell number (x10 1 2 ** ** 0.2 0.2 Absorbance (550 nm) 0 0 0 0 142 3 142 3 CTLoC-1 C-2 CTL P ol C-1 Days Days miR-338-5p miR-421 C D

120 120 120 120 100 100 100 100 80 80 80 80 * 60 60 60 60 40 40 40 ** 40 ** ** ** 20 20 20 20 ** ** ** Foci formation (%) Colony formation (%) 0 0 0 0 CTL C-1 C-2 CTL Pool C-1 CTLoC-1 C-2 CTL P ol C-1 miR-338-5p miR-421 miR-338-5p miR-421 E F G CTL CTL

miR-338-5p miR-421 x109 x107 8 Bone marrow 40 x100 x100 ) )

3 Lungs 35 18 3 18 7 CTL CTL 16 16 6 30 14 miR-338-5p 14 miR-421 5 25 12 12 10 10 4 20 8 8 3 ** 15 to lungs 6 ** 6 to bone marrow 2 10 4 ** 4 ** ** * 1 5 2 ** 2 * ** ** ** ** * * 0 ** 0 Number of cells metastasized

* Number of cells metastasized

Mean tumor volume (mm 0

Mean tumor volume (mm 0 43403533292522 45 16 18 20 22 24 26 28 30 32 CTL miR-338-5p miR-421 Days Days

Figure 2. miR-338-5p and miR-421 abrogate oncogenic properties of SPINK1þ prostate cancer cells. A, Cell proliferation assay using 22RV1-miR-338-5p, 22RV1-miR-421 and 22RV1-CTL cells at the indicated time points. B, Boyden chamber Matrigel invasion assay using same cells as in A. Representative ﬁelds with invaded cells are shown in the inset (n ¼ 3 biologically independent samples; data represent mean SEM). C, Soft agar assay for anchorage-independent growth using same cells as in A. Representative soft agar colonies are shown in the inset (n ¼ 3 biologically independent samples; data represent mean SEM). D, Foci formation assay using same cells as in A. Representative images depicting foci are shown in the inset (n ¼ 3 biologically independent samples; data represent mean SEM). E, Mean tumor growth in NOD/SCID mice (n ¼ 8) subcutaneously implanted with stable 22RV1-miR-338-5p and 22RV1-CTL cells. F, Same as E except stable 22RV1- miR-421 cells were implanted. G, Same as E and F except Alu-speciﬁc qPCR using genomic DNA extracted from the lung and bone marrow of the xenografted mice. Data represent mean SEM. , P 0.05 and , P 0.005 using two-tailed unpaired Student t test.

(Fig. 3D). Furthermore, a significant decrease in the expression of miR-338-5p/miR-421–binding sites on the 30UTRs of these genes involved in G1–S transition such as cyclin E2 (CCNE2), cell-cycle regulators (Supplementary Table S4) further support cyclin A2 (CCNA2), and cyclin-dependent kinase (CDK1 and that these targets could be directly controlled by these miRNAs. CDK6), including mini-chromosome maintenance (MCM3 and Next, to validate that miR-338-5p/-421 overexpression leads MCM10), required for the initiation of eukaryotic replication to cell-cycle arrest, cell-cycle analysis using miRNA mimic– machinery was recorded (Fig. 3E). Thus, these findings corrobo- transfected 22RV1 cells revealed a significant increase in cells rate with previous literature that during DNA damage, CDKs arrested in S-phase (Supplementary Fig. S6A). To delineate that being cell-cycle regulators crosstalk with the checkpoint activation this increase in the S-phase cells is indeed due to cell-cycle arrest network to temporarily halt the cell-cycle progression and pro- and not because of DNA replication, BrdU-7AAD–based cell-cycle mote DNA repair (21). Intriguingly, presence of putative analysis was performed, which revealed a significant decrease

OF6 Clin Cancer Res; 2018 Clinical Cancer Research

Silencing of miR-338-5p/-421 Drives SPINK1-Positive Cancer

in the percentage of BrdU-incorporated S-phase cells (Fig. 3F). Ectopic expression of miR-338-5p and miR-421 suppresses Taken together, our ﬁndings strongly indicate that miR-338-5p/- epithelial-to-mesenchymal transition and stemness 421 overexpression led to S-phase arrest, thus elucidating the Association between epithelial-to-mesenchymal transition mechanism for reduced proliferation and dramatic regression in (EMT) and cancer stem cells (CSC) has been well-established, tumor growth. indicating that a subpopulation of neoplastic cells, which harbor

A B Downregulated pathways Upregulated pathways Number of genes miR-338 Down 75 152535455565 5 15 25 35 45 55 65 Regulation of cytokine-mediated Negative regulation of protein signaling pathway serine/threonine kinase activity 1,079 1,372704 Negative regulation of cell–cell adhesion Epithelial tube morphogenesis Histone methylation Negative regulation of MAPK activity Double-strand break repair via homologous recombination miR-421 Down Negative regulation of cell cycle

Cell-cycle G2–M phase transition miR-338 Up Negative regulation of cell proliferation Regulation of cell proliferation Intrinsic apoptotic signaling pathway Stem cell population maintenance 1,302 1,614506 Transcription from RNA Positive regulation of protein secretion polymerase II promoter Negative regulation of metabolic process miR-421 Up Cell cycle Negative regulation of gene DNA repair expression, Epigenetics 4.5 2.53.5 1.5 0.5 012345678 P -log10( ) C CDK1 CCNE2 miR-338-5p miR-421 22RV1 0.5 CDK6 MCM3 0.4 NES=2.064 0.4 NES=1.89 D E 1.2 CCNA2 MCM10 0.3 P = 0.000 0.3 P = 0.000 0.2 FDR=0.000 0.2 FDR=0.000 1.0 0.1 0.1 Control miR-338-5p Control miR-421 22RV1-miR-338 22RV1-miR-421 ** 0.0 0.0 0.8 * -0.1 -0.1 *** 0.6 * * CTL C-1 C-2 C-3 Pool C-1 C-2 CTL * * ** EGFR Signaling * ** * 0.4 * 0.5 NES=2.08 0.5 NES=1.53 pMEK 0.2 * 0.4 0.4 signals P = 0.000 P = 0.004 0.3 0.3 0 0.2 FDR=0.000 0.2 FDR=0.014 tMEK 0.1 CTL C-1 C-2 C-3 Control miR-338-5p 0.1 Control miR-421 0.0 0.0 miR-338-5p

-0.1 Sustaining proliferative 1.2 -0.1 MEK/ERK pERK 1.0 tERK 0.8 * 0.6 * * 0.6 NES=2.62 NES=2.62 E2F1 0.6 * * 0.5 P = 0.000 0.5 P = 0.000 * * * 0.4 0.4 * FDR=0.000 FDR=0.000 0.4 * * * * 0.3 0.3 β-Actin * * 0.2 0.2 0.2 ** 0.1 Control miR-338-5p 0.1 Control miR-421 * 0.0 0.0 0 Target/ GAPDH expression Target/ GAPDH expression E2F Targets CTL Pool C-1 C-2

Enrichment score (ES) miR-421 0.05 Control NES=-1.80 0.1 NES=-1.70 Control -0.05 P = 0.000 0.0 P = 0.000 F -0.15 FDR=0.006 -0.1 FDR=0.004 Non-targeting miR-338-5p miR-421 -0.25 -0.2 -0.35 miR-338-5p -0.3 miR-421 -0.45 -0.4 S-Phase

p53 Pathway 2 2 2 10 23.5% 10 5.72% 10 1.84% Cell-cycle regulation 0.5 NES=2.38 0.5 NES=2.42 0.4 P = 0.000 0.4 P = 0.000 101 101 101 0.3 0.3

FDR=0.000 FDR=0.000 BrdU-FITC 0.2 0.2 0.1 0.1 G1–G0 G2–M Control miR-338-5p Control miR-421

0.0 0.0 –M Phase 0 54.6% 3.55% 0 75.4% 2.80% 0 68.1% 0.23% 2 10 10 10 G 0 200 400 600 0 200 400 600 0 200 400 600 7-AAD

Figure 3. miR-338-5p and miR-421 overexpression suppress oncogenic pathways and triggers G1–S arrest. A, Gene expression proﬁling data showing overlap of downregulated (top) and upregulated genes (bottom) in stable 22RV1-miR-338-5p and 22RV1-miR-421 cells relative to 22RV1-CTL cells (n ¼ 3 biologically independent samples). B, Same as in A except DAVID analysis showing various downregulated (left) and upregulated (right) pathways. Bars represent log10 (P values), and frequency polygon (line in red) represents the number of genes. C, GSEA plots showing various deregulated oncogenic gene signatures with the corresponding statistical metrics in the same cells as in A. D, Western blot analysis for phosphor (p) and total (t) MEK1/2, ERK1/2, and cell-cycle regulator E2F1 levels. b-Actin was used as a loading control. E, qPCR analysis showing expression of cell-cycle regulators for G1- and S-phase as indicated. Expression level for each gene was normalized to GAPDH. F, BrdU/7-AAD cell-cycle analysis for S-phase arrest in 22RV1 cells transfected with miR-338-5p or miR-421 mimics relative to control cells. In D–F, biologically independent samples were used (n ¼ 3); data represent mean SEM (, P 0.05 and , P 0.005 using two-tailed unpaired Student t test).

www.aacrjournals.org Clin Cancer Res; 2018 OF7

Bhatia et al.

self-renewal capacity and pluripotency, are associated with highly miRNAs could represent alternative novel approaches for inte- metastatic and drug-resistant cancers (22). To delineate the path- grative cancer therapy (Fig. 4K). ways involved in miR-338-5p/-421–mediated regression in tumor burden and metastases (Fig. 2E–G), we analyzed micro- Transcriptional repression of miR-338 and miR-421 by EZH2 array data and noted a marked decrease in the expression of genes drives SPINK1-positive prostate cancer involved in EMT and stemness (Fig. 4A), including the EMT- Aberrant transcriptional regulation, genomic loss, or epigenetic inducing transcription factors namely, SNAI1 (SNAIL), SNAI2 silencing are well-known mechanisms involved in miRNA dereg- þ (SLUG), and TWIST1 (Fig. 4B and C). Because SNAIL and SLUG ulation (27, 28). Because SPINK1 patients exhibit reduced are known to negatively regulate CDH1 (E-Cadherin; ref. 23), an expression of miR-338-5p/-421, we sought to decipher the role epithelial marker involved in cell–cell adhesion, we next exam- of epigenetic silencing involved in reduced expression of these ined miR-338-5p/-421–overexpressing cells for any change in miRNAs. Moreover, one of the well-studied key players of epige- E-Cadherin expression: a prominent increase in the membrane netic silencing is EZH2, implicated in many malignancies; thus, localization of E-Cadherin, while a significant decrease in the we interrogated for any plausible association between SPINK1 expression of vimentin, a mesenchymal marker, was observed and EZH2 using Memorial Sloan Kettering Cancer Center (Fig. 4D). (MSKCC) patients' cohort on cBioPortal (http://cbioportal.org). þ þ þ A subpopulation (CD117 /ABCG2 ) of 22RV1 cells, known as Interestingly, most of the SPINK1 specimens show concordance prostate carcinoma–initiating stem-like cells, has been shown to with EZH2 expression (Fig. 5A). Furthermore, TCGA-PRAD exhibit stemness and multi-drug resistance (24). Therefore, we patients harboring higher expression of EZH2 show increased examined the expression of genes associated with CSC-like prop- levels of SPINK1 and decreased expression of miR-338-5p/-421 as erties in 22RV1-miR-338-5p/-421 cells. Strikingly, the expression compared with EZH2-low patients (Fig. 5B). To further confirm of well-known pluripotency markers, such as AURKA, SOX9, and the association between these two oncogenes, we performed IHC OCT-4, and stem cell surface markers EPCAM, CD117 (c-Kit), and and RNA-ISH for SPINK1 and EZH2 expression, respectively, ABCG2, an ATP-binding cassette transporter, were markedly using TMAs comprising a total of 238 prostate cancer specimens. downregulated in miRNA-overexpressing cells (Fig. 4E and F). In accordance with the previous reports (3, 4), we found that 21% Having confirmed that miR-338-5p/-421 downregulate the of patients with prostate cancer (50 of 238 cases) were positive for expression of ABCG2 and c-Kit, we next evaluated the efflux of SPINK1 expression. Interestingly, 88% (44 cases) of these þ Hoechst dye via ABC transporters in the absence or presence of SPINK1 specimens show positive staining for EZH2, of which þ þ verapamil, a competitive inhibitor for ABC transporters (25). As approximately 14% of the SPINK1 /EZH2 patients fall into the expected, 22RV1-miR-338-5p/-421 cells show a significant reduc- high EZH2 range (score 3 and 4), approximately 36% in medium tion (91% and 89%, respectively) in the side population (SP) EZH2 (score 2) and approximately 50% into low EZH2 expression cells involved in Hoechst dye efflux (Fig. 4G). As expected, efflux group (score 1) indicating a significant association between assay performed in the presence of verapamil shows substantial SPINK1 and EZH2 expression (Fig. 5C; x2 ¼ 13.66; P ¼ reduction in the SP cells due to inhibition of ABC transporters 0.008). Although 75% (141 cases) of the SPINK1 patients were (Fig. 4G). Furthermore, to confirm whether miRNA overexpres- also found positive for EZH2, while majority of these cases sion leads to decrease in CSC-like properties, prostatosphere (71%) exhibit low EZH2 levels (score 1). Thus, in corroboration assay, a surrogate model for testing enhanced stem cell–like with the previous reports (1, 12), our data indicate a more properties, was performed: a significant decrease in the size and pronounced role of epigenetic alterations involved in ETS þ prostatosphere-forming efficiency was observed in 22RV1-miR- fusion–negative prostate cancer. Although, six SPINK1 cases 338-5p/-421 cells (Fig. 4H and I). Furthermore, prostatospheres failed to show any expression of EZH2, indicating that an alter- formed by miRNA-overexpressing cells exhibit a significant reduc- native mechanism may be involved in SPINK1 regulation or tion in the expression of genes implicated in self-renewal and possibly miRNA-338/-421 genomic deletion could be a cause. stemness (Supplementary Fig. S6B). Intriguingly, miR-338-5p/- To investigate whether epigenetic silencing of these miRNAs is 421 putative binding sites on the 30UTR of EPCAM, c-Kit, SOX9, mediated by EZH2, we screened the promoters of miR-338, miR- SOX2, and ABCG2 were also noticed (Supplementary Table S4), 421, and FTX (miR-421 host gene) for putative transcription suggesting a possible mechanism involved in the downregulation factor–binding sites and identified MYC and MAX (Myc-Associ- of these genes. ated Factor X) elements within approximately 2-kb upstream of Epigenetic regulators, such as ten-eleven-translocation (TET) Transcription Start Site (TSS). MYC is known to form a repressive family member, TET1, convert 50-methylcytosine (5mC) to 50- complex with EZH2 and histone deacetylases (HDAC), and hydroxymethylcytosine (5hmC) and are well-known to induce downregulates multiple tumor-suppressive miRNAs, which in pluripotency and maintain self-renewal capacity (26). Thus, we turn target PRC2-interacting partners (29). In addition, EZH2- analyzed the expression of TET family members. A striking silenced DU145 cells' miRNA expression data (GSE26996) indi- decrease in TET1 expression was observed in miRNA-overexpres- cates an increase in the expression of numerous EZH2-regulated sing cells (Fig. 4J). Because major players involved in drug miRNAs including miR-338-5p and miR-421 (Supplementary resistance, such as ABCG2 and c-Kit were downregulated in Fig. S7A). We therefore examined the promoters of miR-338 and miRNAs-overexpressing cells, we examined the sensitivity of these FTX for the recruitment of EZH2 in stable 22RV1-miR-338-5p, cells to chemotherapeutic drugs. Interestingly, 22RV1-miR-338- 22RV1-miR-421, and 22RV1-CTL cells. Interestingly, a significant 5p/-421 cells show enhanced sensitivity to doxorubicin as com- enrichment of EZH2 over input was observed on the promoters of pared with 22RV1-CTL (Supplementary Fig. S6C). Collectively, miR-338 and FTX in control cells, while a substantial decrease in miR-338-5p/-421 downregulates the expression of genes impli- miR-338-5p/-421–overexpressing cells was noticed (Fig. 5D), cated in multiple oncogenic pathways namely EMT, stemness, suggesting the presence of negative feedback–regulatory network and drug resistance, signifying that these two tumor suppressor between miR-338-5p/-421 and EZH2. Subsequently, we checked

OF8 Clin Cancer Res; 2018 Clinical Cancer Research

Silencing of miR-338-5p/-421 Drives SPINK1-Positive Cancer

log FC A 2 B D miR-338-5p miR-421 22RV1 TWIST SLUG 22RV1 TWIST SLUG CTL miR-338-5p miR-421 1.2 N-Cad 1.2 N-Cad VIM −4−2 0 2 4 1.0 1.0 C-1 C-2 C-3 Pool C-2 C-3 SNAI2 0.8 0.8 DAPI * SNAI1 * * CDH1 0.6 ** 0.6 * OCLN SNAI3 0.4 * 0.4 ** ** CDH2 0.2 0.2 ** ** **

** ** E-CAD VIM ** ** ** ** PCDH7 0 ** ** 0 ** Target/ GAPDH expression MUC13 CTL C-1 C-2 C-3 Target/ GAPDH expression CTL Pool C-1 C-2 CDH17 EMT SCAI miR-338-5p miR-421 MAPK9 CORO1A C MERGE AGT DAPI SNAIL F-ACTIN MERGE DAPI SLUG F-ACTIN MERGE GTPBP4 MAP2K1 MAP3K1

ABCG2 DAPI KIT SOX2 NANOG TET1 SOX9 POU5F1 VIM AURKA

SMC3 Stemness ASPM MTF2 EPAS1 MERGE

EPHA1 miR-421 miR-338-5p CTL

E G CTL miR-338-5p miR-421 22RV1 EPCAM c-Kit 40K 40K 40K 1.2 1.2 AURKA OCT-4 SOX9 ABCG2 30K 30K 30K 1.0 1.0 * 20K 20K 20K

0.8 * 0.8 10K 10K 10K Hoechst * * * * 11.8% 0.98% 1.32% 0.6 * * 0.6 * ** 0 0 0 * 0 10K 30K20K40K 0 10K20K 30K 40K 0 10K20K 30K 40K 0.4 ** 0.4 * * ** ** * 40K 40K 40K ** ** ** *** 0.2 0.2 * Hoechst Blue ** 30K 30K 30K

Target/ GAPDH expression 0 0 CTL C-1 C-2 CTL Pool C-1 20K 20K 20K miR-338-5p miR-421 10K 10K 10K 0.67% 0.50% 1.28%

0 0 0 Hoechst+Verapamil F CTLmiR-338-5p miR-421 CTL miR-338-5p miR-421 0 10K 30K20K40K 0 10K20K 30K 40K 0 10K20K 30K 40K Hoechst FR DAPI DAPI H I Day 6 Day 8 Day 10 Day 12

3 ) x10 2 CTL c-Kit SOX9 120 7 100 6 5 80 4 F-ACTIN F-ACTIN 60 ** 3 miR-338-5p ** 40 ** 2 20 ** 1 MERGE MERGE 0 0 miR-421 CTL 338-5p 421 Mean area of spheres (μm Sphere formation efficiency (%) miRNA J K TET1 TET1 miR-338-5p ABCG2 SPINK1 -Actin -Actin SPINK1 c-Kit miR-338-5p/ miR-421 miR-338-5p/ miR-421 miR-421 ABCG2 1.2 1.2 c-Kit 1.0 1.0 0.8 * 0.8 N-Cad 0.6 0.6 E-Cad ** ** SLUG N-Cad 0.4 0.4 ** SNAIL EMT/Stemness SLUG EMT/Stemness 0.2 ** 0.2 Oct-4 Invasion SNAIL Invasion ** SOX 2/9 Metastasis Oct-4 Metastasis 0 0 EPCAM Self renewal SOX 2/9 Self renewal

TET1/GAPDH expression CTL C-1 C-2 C-3 CTL Pool C-1 C-2 TET1 Drug resistance EPCAM Drug resistance TET1/GAPDH expression TET1 miR-338-5p miR-421

Figure 4. miR-338-5p and miR-421 overexpression attenuates EMT and stemness. A, Heatmap depicting change in the expression of EMT and pluripotency markers in 22RV1-miR-338-5p and 22RV1-miR-421 cells. Shades of blue represents log2 fold change in gene expression (n ¼ 3 biologically independent samples). B, qPCR analysis depicts expression of EMT markers in 22RV1-miR-338-5p, 22RV1-miR-421, and control cells. Expression for each gene was normalized to GAPDH. N-Cad, N-Cadherin; VIM, Vimentin. C, Immunostaining showing SLUG and SNAIL expression in the same cells as in B. D, Same cells as in B except immunostained for E-Cadherin (E-CAD) and Vimentin (VIM). E, Same cells as in B except qPCR analysis for stem cell markers. F, Same cells as in B except immunostained for c-Kit and SOX-9. G, Hoechst 33342 staining for side-population (SP) analysis using same cells as in B. Percentages of SP were analyzed using the blue and far red ﬁlters; gated regions as indicated (red) in each panel. H, Phase contrast microscope images for the prostatospheres using same cells as in B. Scale bar, 100 mm. I, Bar plot depicts percentage of sphere-forming efﬁciency and mean area of the prostatosphere. J, Expression of TET1 by qPCR and Western blot analysis using same cells as in B. K, Schematic describing the role of miR-338-5p and miR-421 in regulating EMT, cancer stemness, and drug resistance in SPINK1þ cancer. E-Cad, E-Cadherin; N-Cad, N-Cadherin. For C, D, and F, scale bar represents 20 mm. In B, E, I,andJ, biologically independent samples were used (n ¼ 3); data represent mean SEM (, P 0.05 and , P 0.005 using two-tailed unpaired Student t test).

www.aacrjournals.org Clin Cancer Res; 2018 OF9

Bhatia et al.

for EZH2 recruitment on miR-421 promoter and no enrichment thermore, to conﬁrm EZH2-mediated methyltransferase activity, was observed (Supplementary Fig. S7B), indicating that FTX we sought to identify H3K27me3 marks on these promoters. A promoter regulates the expression of this intronic miRNA. Fur- remarkable enrichment of H3K27me3 marks on the miR-338,

A B TCGA-PRAD EZH2 High (Upper quartile; n = 119) EZH2 n MSKCC cohort (n = 150 patients) proﬁled in mRNA expression Z-scores vs. normals Low (Lower quartile; = 119) 20 5 SPINK1+/EZH2+ P = 0.02 P = 0.0001 2.5 P = 0.03 SPINK1(15%) 15 4 2.0 EZH2 (47%) 3 1.5 10 (RPM+1)

SPINK1 2 EZH2 2 1.0 (norm_count+1) 2

5 Log Z-Score 1 0.5

Genetic alteration No alterations mRNA Upregulation mRNA Downregulation Log -3 3 0 0 0.0 SPINK1 miR-338-5p miR-421

C D chr17:81,117,366-81,166,088 chrX:74,028,136-74,293,574 81,118K 81,125K 81,135K 81,150K 81,166K 74,029K 74,100K 74,200K 74,250K 74,293K AATK FTX hsa-miR-421 81,125,000 hsa-miR-338 TSS 81,126,500 74,292,342 FTX TSS 74,293,842 100 m 100 m +20-70 -460 -600 +1 -290 -800 -1.7K pF1/R1 pF2/R2 pF1/R1 pF2/R2 22RV1-CTL 22RV1-miR-338-5p miR-338: pF1/R1 pF2/R2 pF1/R1 pF2/R2 8 12 2 ** 4 ** 20 m 25 m ** ** 1.8 7 10 3.5 6 1.6 3 8 1.4 5 1.2 2.5

EZH2 RNA-ISH SPINK1 IHC 4 6 1 2

% Input 0.8 3 4 1.5 2 0.6 1 20 m 100 m 25 m 0.4 1 2 0.2 0.5 0 0 0 0 n 2 120 SPINK1 Negative ( = 188) =13.66 IgG EZH2 IgG EZH2 IgG H3K27me3 IgG H3K27me3 SPINK1 Positive (n = 50) P = 0.0085 100 22RV1-CTL 22RV1-miR-421 FTX: pF1/R1 pF2/R2 pF1/R1 pF2/R2 80 * * 12 7 * 12 7 * 60 10 6 10 6 5 8 8 5 40 4 4 6 6 3 3 % Input 4 4 20 2 2 Number of patients (%) 0 2 1 2 1 EZH2 1234 0 0 0 0 IgG EZH2 IgG EZH2 IgG H3K27me3 IgG H3K27me3 Negative EZH2 Intensity score

E F 1.2 22RV1 1.2 EZH2 SUZ12 RBBP4 RBBP7 miR-338-5p miR-421 1.0 1.0 0.7 0.7 MTF2 NES=1.65 0.6 NES=1.42 0.6 0.8 0.8 0.5 P = 0.000 0.5 P = 0.000 0.4 0.4 0.6 0.6 0.3 FDR=0.098 0.3 FDR=0.093 **** **** 0.2 0.2 ** ** ** ** 0.1 Control miR-338-5p 0.1 Control miR-421 0.4 ** 0.4 ** ** **

_Targets ** ** 0.0 0.0 ** ** ** 0.2 ** ** 0.2 ** Kamminga_EZH2 Enrichment score

Target/ GAPDH expression 0 Target/ GAPDH expression 0 CTL C-1 C-2 CTL C-1 C-2 miR-338-5p miR-421

Figure 5. Epigenetic silencing of miR-338-5p and miR-421 via EZH2 in SPINK1þ prostate cancer. A, OncoPrint depicting mRNA upregulation of EZH2 and SPINK1 in MSKCC cohort using cBioPortal. In the bottom panel, shades of blue and red represent Z-score–normalized expression for EZH2 and SPINK1. B, Box plot depicting SPINK1, miR-338-5p, and miR-421 expression in EZH2 high (n ¼ 119) and EZH2 low (n ¼ 119) in patients with prostate cancer from TCGA-PRAD cohort. C, Representative micrographs depicting prostate cancer TMA cores (n ¼ 238) stained for SPINK1 by IHC and EZH2 by RNA-ISH. Top, SPINK1 IHC in SPINK1 and SPINK1þ patients. RNA-ISH intensity score for EZH2 expression was assigned on a scale of 0 to 4 according to visual criteria for the presence of transcript at 40 magniﬁcation. Bar plots show EZH2 expression in the SPINK1 and SPINK1þ patient specimens. P value for x2 test is indicated. D, Genomic location for EZH2-binding sites on the miR-338 and FTX promoters and location of chromatin immunoprecipitation (ChIP) primers (top). ChIP-qPCR data showing EZH2 occupancy and H3K27me3 marks on the miR-338, FTX promoters, and MYT1 used as positive control in stable 22RV1-miR-338-5p, 22RV1-miR-421, and 22RV1-CTL cells. E, GSEA plots showing the enrichment of EZH2 interacting partners (Kamminga) in 22RV1-miR-338-5p and 22RV1-miR-421 cells. F, qPCR data showing expression of EZH2 and its interacting partners in the same cells as indicated. Biologically independent samples (n ¼ 3) were used in D and F; data represent mean SEM (, P 0.05 and , P 0.005 using two-tailed unpaired Student t test).

OF10 Clin Cancer Res; 2018 Clinical Cancer Research

Silencing of miR-338-5p/-421 Drives SPINK1-Positive Cancer

þ miR-421, and FTX promoters were noted relative to IgG control silencing of miRNA-338-5p and miR-421 in SPINK1 subtype, (Fig. 5D; Supplementary Fig. S7B), confirming the role of EZH2- which, in turn, reaffirms its silencing by a positive feedback loop. mediated epigenetic silencing of miRNA-338-5p/-421. Comprehensive GSEA revealed that miRNA-338/-421–overexpressing cells show an enrichment for EZH2-interacting partners, Discussion including PRC2 members (30) and EZH2-regulated genes In this study, we unraveled the underlying molecular mecha- (refs. 31, 32; Fig. 5E; Supplementary Fig. S7C), indicating that nism involved in the overexpression of SPINK1 exclusively in ETS these two miRNAs in turn regulate EZH2 partners and their target fusion–negative prostate cancer. Our study provides a molecular genes. Thus, we next examined the putative binding of miRNA- basis for SPINK1 overexpression, brought about by epigenetic 338-5p/-421 on the 30UTR of the PRC2 members, interestingly repression of the key posttranscriptional negative regulators of both miRNAs show negative mirSVR binding score, indicating SPINK1 namely, miR-338-5p and miR-421. We demonstrate miR- miRNAs binding strength (Supplementary Table S4). Moreover, a 338-5p/-421 exhibits functional anticancer pleiotropy in þ significant decrease in the transcript levels of EZH2, and its SPINK1 subtype, by attenuating oncogenic properties, tumor interacting partners SUZ12, RBBP4, RBBP7, and MTF2, were growth, and metastases in murine model. Conversely, miR-421 observed in miRNA-338-5p/-421–overexpressing cells (Fig. 5F; has been reported to be a potential oncogenic miRNA in multiple Supplementary Fig. S7D). Collectively, our data indicate that cancers (36, 37). However, in corroboration with our findings, a overexpression of miR-338-5p/-421 downregulates EZH2 expres- recent report suggested tumor-suppressive role of miR-421 in sion and its interacting members, leading to impaired histone prostate cancer (38). We also established that miR-338-5p/- methyltransferase activity of PRC2, thereby establishing a double- 421–overexpressing cells display perturbed cell-cycle machinery negative feedback loop. triggered by dysregulated cyclins and CDKs, subsequently leading Because inhibitors for chromatin modifiers are known to erase to S-phase arrest. Recently miRNAs targeting multiple cyclins/ epigenetic marks, we tested 3-Deazaneplanocin A (DZNep), a CDKs are shown to be more effective than the FDA-approved histone methyltransferase inhibitor; 20-deoxy-5-azacytidine (5- CDK4/6 inhibitor in triple-negative breast cancer (39), thus Aza), a DNA methyltransferase (DNMT) inhibitor, and Trichos- supporting our findings that replenishing miRNA-338-5p/-421 þ tatin A (TSA), a HDAC inhibitor, in 22RV1 cells and examined may prove advantageous in SPINK1 cancers. miR-338-5p/-421 expression. Treatment with TSA, DZNep, 5-Aza Emerging evidences suggest a complex interaction between alone or a combination of DZNep and TSA in 22RV1 cells showed EMT and CSCs during cancer progression, and in developing a modest increase in miR-338-5p/-421 expression, while 5-Aza resistance toward anticancer drugs. Previous studies have impli- and TSA together resulted in approximately 9-fold increase cated role of several miRNAs, such as miR-200 family, and miR- (Fig. 6A). Intriguingly, 5-Aza and TSA in combination results in 34a (40, 41) in regulating the expression of genes involved in significant increase in miRNAs expression accompanied with a metastases, stemness, and drug resistance. Furthermore, miR-338 notable decrease (60%–80%) in SPINK1 levels (Fig. 6B). exhibits tumor-suppressive role, and inhibits EMT by targeting Because, 30-arm of miR-338 (miR-338-3p) is known to negatively ZEB2 (42) and PREX2a (43) in gastric cancer. Here, we identified regulate Apoptosis Associated Tyrosine Kinase (AATK) expres- miR-338-5p/-421 as critical regulators of EMT-inducing transcrip- sion (33), likewise a significant reduction in the AATK expression tion factors and -associated markers, which in turn led to was noticed (Fig. 6B). Previously, a deletion construct of FTX decreased stem cell–like features. Moreover, CSCs are known to showed decreased expression of miR-374/-421 cluster (34). Cor- express ABC transporters, which efflux the chemotherapeutic roborating with this, we also observed a significant increase in the drugs during resistance (25). Remarkably, miR-338-5p/-421 over- FTX and miR-421 expression upon 5-Aza and TSA combinatorial expression shows decreased expression of ABCG2 and c-KIT, and treatment, signifying the importance of FTX in the regulation of consequently a significant drop in the drug-resistant side popu- miR-421 (Fig. 6B). lation, indicating that miR-338-5p/-421 are highly effective in In addition, EZH2 is also known to interact with DNMTs, conferring drug sensitivity and reducing the therapy-resistant thus enabling chromatin remodeling and DNA methylation (35). CSCs. Collectively, our findings provide a solid foundation for þ We next examined the presence of methylated CpG marks on qualifying these miRNAs as an adjuvant therapy for the SPINK1 miR-338-5p and FTX promoters. Interestingly, methylated DNA and other drug-resistant malignancies. immunoprecipitation (MeDIP) revealed locus-specific enrich- Our findings were further strengthened by TCGA study (1), ment in 5mC levels over 5hmC on these regulatory regions wherein a subset of prostate cancer patients harboring SPOP- (Fig. 6C). To ascertain the presence of DNA methylation marks, mutation/CHD1-deletion exhibits elevated DNA methylation we performed bisulfite sequencing using prostate cancer cell lines, levels accompanied with frequent events of SPINK1 overexpres- a relative increase in the methylated CpG sites on miR-338 and sion. Recently, a new subtype of ETS fusion–negative tumors has þ FTX promoters was observed in 22RV1 (SPINK1 ) as compared been defined by frequent mutations in the epigenetic regulators þ with VCaP (ERG ) cells (Fig. 6D). No significant difference in the and chromatin remodelers (44). Yet another study, using methylated CpG sites on the AATK and miR-421 promoters was genome-wide methylated DNA immunoprecipitation sequenc- observed (Supplementary Fig. S7E and S7F). To recapitulate this ing, revealed higher number of methylation events in TMPRSS2- finding in patients with prostate cancer, bisulfite sequencing was ERG fusion–negative as compared with normal and TMPRSS2– þ carried out on SPINK1 (n ¼ 5) and ERG fusion–positive (n ¼ 5) ERG fusion–positive prostate cancer specimens (12). Collectively, þ patients' specimens. Interestingly, all SPINK1 specimens exhibit these independent findings reaffirm the critical role of epigenetic þ increased methylation marks on the promoters of miR-338 and pathways engaged in the pathogenesis of SPINK1 subtype. þ FTX as compared with ERG (Fig. 6D). Taken together, our results Interestingly, increased methylated regions in the ETS fusion– strongly indicate that epigenetic machinery comprising of EZH2 negative patients have been attributed to hypermethylation of and its interacting partners play a critical role in the epigenetic miR-26a, a posttranscriptional regulator of EZH2 (12). Thus,

www.aacrjournals.org Clin Cancer Res; 2018 OF11

Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2018 American Association for Cancer Research. OF12 lnCne e;2018 Res; Cancer Clin htae al. et Bhatia ains uo pcmn Pa1t r PN1pstv n C- o1 r R uinpstv) PCR-ampli positive). fusion ERG are 10 in to miR-421 sites. PCa-6 and CpG and methylated from positive show obtained SPINK1 circles sequence are DNA 5 to represent Data (PCa-1 specimens indicated. tumor as patients' TSA or drugs. 5-Aza Bisulﬁ with epigenetic miR-421. of treated and cells combination miR-338-5p 22RV1 the different of with silencing treated cells EZH2-mediated ablate drugs Epigenetic 6. Figure E A C

, 5-Aza DZNeP P DZNeP+TSA 0.75 µmol/L 0.25 µmol/L 5-Aza +TSA Fold enrichment (%) 22RV1 1.0 µmol/L 0.5 µmol/L esqecn hwn p ehlto ak ntergo ptemo i-3-p(et and (left) miR-338-5p of upstream region the on marks methylation CpG showing sequencing te EZH2 FTX AATK 10 20 30 40 50 60 70 35-3.0 -3.5 .0 sn w-aldupie Student unpaired two-tailed using 0.005 Downloaded from 0 miR-338 SUZ12 R1 DMSO Histone acetylation Histone methylation(H3K27me3) Demethylation DNA Methylation RbAp46/48 TSA 1R R3 R2 R1 ** 5hmC 5mC -2.5 SPINK1 EED 261 0246 2R3 R2 miR-338 -1.9 ** Target/RNUB6 expression 06-0.3 -0.6 þ * * Published OnlineFirstDecember26,2018;DOI:10.1158/1078-0432.CCR-18-3230 EZH2 rsaecne.In cancer. prostate * * * SUZ12 ** * * * * ** TSS RbAp46/48 clincancerres.aacrjournals.org EED 29-. 08-0.4 -0.8 -2.6 -2.9

Fold enrichment (%) FTX E, 10 20 30 40 50 60 70 1R2 R1 0 lutaindpcigtemlclrmcaimivle nEH-eitdeieei iecn fmiR-338-5p of silencing epigenetic EZH2-mediated in involved mechanism molecular the depicting Illustration 22RV1 miR-421 miR-338-5p ** 1R2 R1 ** 80 A FTX – miRNA-338 ﬁ C ** eidpnetcoe.Hlo ice ersn omtyae p iuloie,weesbaksolid black whereas dinucleotides, CpG nonmethylated represent circles Hollow clones. independent ve ilgclyidpnetsmls( samples independent biologically , ** miRNA-421 t TSS test). C, SPINK1 D 5-Aza (5µmol/L) 5-Aza (1µmol/L) TSA (0.3µmol/L) eI-PRsoigfl niheto -Coe -m n2R1clsa indicated. as cells 22RV1 in 5-hmC over 5-mC of enrichment fold showing MeDIP-qPCR B B, DMSO CpG CG (%) 100 20 60

PRsoigrltv xrsino i-3-p miR-421, miR-338-5p, of expression relative showing qPCR miR-338-5p/RNUB6 expression 40-. -1.0-1.5 -2.0 -4.0 Cancer Research. PCa-5 PCa-4 PCa-3 PCa-2 PCa-1 22RV1 0 2 4 6 8 22RV1 AATK (17q25.3) (46.2%) (50.7%) (49.2%) (53.8%) (61.5%) (53.8%) miR-338 + 35-. -2.5 -3.0 -3.5 - - - SPINK1 Epigenetic on September 25, 2021. © 2018American Association for hsa-miR-338-5p drugs drugs ++ ++ ------+ ** + ** miR-338-5p AATK A, + - n * aMnasyfrmR385 n i-2 xrsini 22RV1 in expression miR-421 and miR-338-5p for assay TaqMan ¼ PCa-10 PCa-9 PCa-8 PCa-7 PCa-6 VCaP EZH2 (13.8%) (15.4%) (18.4%) (21.5%) (29.2%) (12.3%) 0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 )wr sd aarpeetmean represent data used; were 3) AATK FTX SUZ12 AATK/GAPDH expression RbAp46/48R ERG b EED Metastases Tumorigenesis Drug resistance Stemness Invasion/EMT Cell cycle +

miR-421/RNUB6 expression10 050 -0.5 0 2 4 6 8 FTX (Xq13.2) 22RV1 EZH2 + - - - FTX SUZ12 hsa-miR-421 ++ ++ ------CpG 100 RbAp46/48 CG (%) * rgt n2R1cls CPcls and cells, VCaP cells, 22RV1 in (right) 20 60 40-. -1.0 -2.0 -4.0 ** EED + ﬁ

PCa-5 PCa-4 PCa-3 PCa-2 PCa-1 22RV1 FTX * drgosaedntdb arrows. by denoted are regions ed

(46.7%) (47%) (48.3%) (53.3%) (53.3%) (38.3%) FTX miR-421 35-. -2.5 -3.0 -3.5 ** + - ** SPINK1 miR-338-3p 2 4 6 8 0 AK FTX AATK, + FTX/GAPDH expression lnclCne Research Cancer Clinical E ( SEM miRNA-338 SPINK1/GAPDH expression 0.2 0.4 0.6 0.8 1.0 1.2 0 miRNA-421 -1.5 , ,and PCa-10 PCa-9 PCa-8 PCa-7 PCa-6 VCaP 22RV1 P + - - -

miR-338-5p (13.3%) (15%) (15%) (16.7%) (16.7%) (15%) .5and 0.05 SPINK1 +++ SPINK1 ------ERG D, 050 -0.5 + ** + SPINK1 in ** + - Published OnlineFirst December 26, 2018; DOI: 10.1158/1078-0432.CCR-18-3230

Silencing of miR-338-5p/-421 Drives SPINK1-Positive Cancer

given the central role played by EZH2 and the epigenetic mech- SPINK1-positive and miRNA-338-5p/-421-low criteria could fur- anism involved in ETS fusion–negative cases, our findings ratio- ther improve therapeutic modalities and overall management nalize the role of EZH2-mediated epigenetic regulation of miR- strategies. þ 338-5p/-421 in SPINK1 /ETS subtype. Hence, we propose a molecular model involving SPINK1, EZH2, and miR-338-5p/- fl 421, wherein EZH2 acts as an epigenetic switch and by its histone Disclosure of Potential Con icts of Interest fl methyltransferase activity establishes H3K27me3-repressive No potential con icts of interest were disclosed. marks on the regulatory regions of miR-338 and FTX, a miR- 421 host gene (Fig. 6E). Authors' Contributions In consonance with this, miR-338-5p/-421 overexpression also Conception and design: V. Bhatia, A. Yadav, B. Ateeq results in decreased Tet1 expression. Converging lines of evi- Development of methodology: V. Bhatia, A. Yadav, B. Ateeq dences suggest dual role of Tet1 in promoting transcription of Acquisition of data (provided animals, acquired and managed patients, pluripotency factors and recruitment of PRC2 on CpG-rich pro- provided facilities, etc.): V. Bhatia, A. Yadav, R. Tiwari, S. Nigam, S. Goel, moters (45). Collectively, miR-338-5p/-421–mediated decrease S. Carskadon, N. Gupta, A. Goel, N. Palanisamy, B. Ateeq Analysis and interpretation of data (e.g., statistical analysis, biostatistics, in Tet1 expression might possibly contribute to reduced stemness computational analysis): V. Bhatia, A. Yadav, R. Tiwari, S. Nigam, S. Goel, and drug resistance. We also conjecture that decrease in Tet1 N. Gupta, N. Palanisamy, B. Ateeq expression may result in reduced PRC2 occupancy on the miRNA Writing, review, and/or revision of the manuscript: V. Bhatia, A. Yadav, promoters, diminish epigenetic silencing marks, and consequent- R. Tiwari, S. Nigam, S. Goel, N. Palanisamy, B. Ateeq ly downregulate their targets including SPINK1. Administrative, technical, or material support (i.e., reporting or organizing Currently, there is no effective therapeutic intervention for data, constructing databases): V. Bhatia, B. Ateeq þ Study supervision: B. Ateeq SPINK1 malignancies including prostate, although use of mono- Other (directed the overall project): B. Ateeq clonal EGFR antibody has been suggested (10). Nevertheless, outcome of phase I/II clinical trials using cetuximab (46) Acknowledgments and EGFR small-molecule inhibitors was largely unsuccess- B. Ateeq is an Intermediate Fellow of the Wellcome Trust/DBT India Alliance. ful (47, 48). For instance, in a phase Ib/IIa clinical trial using This work is supported by the Wellcome Trust/DBT India Alliance Fellowship cetuximab and doxorubicin combination therapy, only a fraction [grant number IA/I(S)/12/2/500635; to B. Ateeq). Research funding from of patients with CRPC (8%) showed >50% PSA decline (46), Department of Biotechnology (BT/PR8675/GET/119/1/2015; to B. Ateeq) and revealing its limited efficacy. Owing to the pleiotropic anticancer Science and Engineering Research Board (EMR/2016/005273; to B. Ateeq), Government of India, is also acknowledged. The authors thank Yuping Zhang, effects exhibited by miRNA-338-5p/-421, we propose miRNA Mahendra Palecha, Ayush Praveen for their technical support, and Anjali Bajpai replacement therapy as one of the potential therapeutic for critically reading the manuscript. We also thank Jonaki Sen for extending the þ approaches for SPINK1 cancers; nonetheless in vivo delivery use of fertilized eggs facility. The IIT Kanpur has filed a patent (IN methods and stability are some of the major challenges for 201611016564) on the therapeutic applicability of miR-338-5p and miR- successful translation into the clinic (49). While not restricted to 421 described in this study in which B. Ateeq, V. Bhatia, and A. Yadav are miRNA replacement therapy, this study also suggests alternative named as inventors. þ therapeutic avenues for SPINK1 malignancies, for instance, The costs of publication of this article were defrayed in part by the payment of adjuvant therapy using inhibitors against DNMTs, HDACs, or page charges. This article must therefore be hereby marked advertisement in EZH2, several of which are already in clinical trials (50). Con- accordance with 18 U.S.C. Section 1734 solely to indicate this fact. clusively, we moved the field forward by addressing an important question that how SPINK1 is aberrantly overexpressed in ETS Received October 2, 2018; revised November 9, 2018; accepted December 19, prostate cancer, and the stratification of patients based on 2018; published first December 26, 2018.

References 1. Abeshouse A, Ahn J, Akbani R, Ally A, Amin S, Andry CD, et al. The 8. Leinonen KA, Tolonen TT, Bracken H, Stenman UH, Tammela TL, Saramaki molecular taxonomy of primary prostate cancer. Cell 2015;163:1011–25. OR, et al. Association of SPINK1 expression and TMPRSS2:ERG fusion with 2. Palanisamy N, Ateeq B, Kalyana-Sundaram S, Pﬂueger D, Ramnarayanan K, prognosis in endocrine-treated prostate cancer. Clin Cancer Res 2010;16: Shankar S, et al. Rearrangements of the RAF kinase pathway in prostate 2845–51. cancer, gastric cancer and melanoma. Nat Med 2010;16:793. 9. Ateeq B, Bhatia V, Goel S. Molecular discriminators of racial disparities in 3. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun X-W, prostate cancer. Trends Cancer 2016;2:116–20. et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in 10. Ateeq B, Tomlins SA, Laxman B, Asangani IA, Cao Q, Cao X, et al. prostate cancer. Science 2005;310:644–8. Therapeutic targeting of SPINK1-positive prostate cancer. Sci Transl Med 4. Ateeq B, Kunju LP, Carskadon SL, Pandey SK, Singh G, Pradeep I, et al. 2011;3:72ra17. Molecular proﬁling of ETS and nonETS aberrations in prostate cancer 11. Varambally S, Cao Q, Mani RS, Shankar S, Wang X, Ateeq B, et al. Genomic patients from northern India. Prostate 2015;75:1051–62. loss of microRNA-101 leads to overexpression of histone methyltransferase 5. Brenner JC, Ateeq B, Li Y, Yocum AK, Cao Q, Asangani IA, et al. Mechanistic EZH2 in cancer. Science 2008;322:1695–9. rationale for inhibition of poly (ADP-ribose) polymerase in ETS gene 12. Borno ST, Fischer A, Kerick M, Falth M, Laible M, Brase JC, et al. fusion-positive prostate cancer. Cancer Cell 2011;19:664–78. Genome-wide DNA methylation events in TMPRSS2-ERG fusion- 6. Tomlins SA, Laxman B, Varambally S, Cao X, Yu J, Helgeson BE, et al. Role negative prostate cancers implicate an EZH2-dependent mecha- of the TMPRSS2-ERG gene fusion in prostate cancer. Neoplasia 2008;10: nism with miR-26a hypermethylation. Cancer Discov 2012;2: 177–88. 1024–35. 7. Tomlins SA, Rhodes DR, Yu J, Varambally S, Mehra R, Perner S, et al. The 13. Cao R, Wang L, Wang H, Xia L, Erdjument-Bromage H, Tempst P, et al. Role role of SPINK1 in ETS rearrangement-negative prostate cancers. Cancer Cell of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 2008;13:519–28. 2002;298:1039–43.

www.aacrjournals.org Clin Cancer Res; 2018 OF13

Bhatia et al.

14. Xu K, Wu ZJ, Groner AC, He HH, Cai C, Lis RT, et al. EZH2 oncogenic 33. Kos A, Olde Loohuis NF, Wieczorek ML, Glennon JC, Martens GJ, Kolk SM, activity in castration-resistant prostate cancer cells is Polycomb-indepen- et al. A potential regulatory role for intronic microRNA-338-3p for its host dent. Science 2012;338:1465–9. gene encoding apoptosis-associated tyrosine kinase. PLoS One 2012;7: 15. Cao Q, Mani RS, Ateeq B, Dhanasekaran SM, Asangani IA, Prensner JR, et al. e31022. Coordinated regulation of polycomb group complexes through micro- 34. ChureauC,ChantalatS,RomitoA,GalvaniA,DuretL,AvnerP,etal.Ftx RNAs in cancer. Cancer Cell 2011;20:187–99. is a non-coding RNA which affects Xist expression and chromatin 16. Shukla S, Cyrta J, Murphy DA, Walczak EG, Ran L, Agrawal P, et al. structure within the X-inactivation center region. Hum Mol Genet Aberrant activation of a gastrointestinal transcriptional circuit in 2011;20:705–18. prostate cancer mediates castration resistance. Cancer Cell 2017;32: 35. Vire E, Brenner C, Deplus R, Blanchon L, Fraga M, Didelot C, et al. The 792–806. Polycomb group protein EZH2 directly controls DNA methylation. Nature 17. Rasanen K, Itkonen O, Koistinen H, Stenman UH. Emerging roles of 2006;439:871–4. SPINK1 in cancer. Clin Chem 2016;62:449–57. 36. Hu H, Du L, Nagabayashi G, Seeger RC, Gatti RA. ATM is down-regulated by 18. Soon WW, Miller LD, Black MA, Dalmasso C, Chan XB, Pang B, et al. N-Myc–regulated microRNA-421. Proc Natl Acad Sci U S A 2010;107: Combined genomic and phenotype screening reveals secretory factor 1506–11. SPINK1 as an invasion and survival factor associated with patient prog- 37. Ge X, Liu X, Lin F, Li P, Liu K, Geng R, et al. MicroRNA-421 regulated by HIF- nosis in breast cancer. EMBO Mol Med 2011;3:451–64. 1a promotes metastasis, inhibits apoptosis, and induces cisplatin resis- 19. Tiwari R, Pandey SK, Goel S, Bhatia V, Shukla S, Jing X, et al. SPINK1 tance by targeting E-cadherin and caspase-3 in gastric cancer. Oncotarget promotes colorectal cancer progression by downregulating Metallothio- 2016;7:24466. neins expression. Oncogenesis 2015;4:e162. 38. Meng D, Yang S, Wan X, Zhang Y, Huang W, Zhao P, et al. A transcrip- 20. Qin XQ, Livingston DM, Kaelin WG Jr, Adams PD. Deregulated transcriptional target of androgen receptor, miR-421 regulates proliferation and tion factor E2F-1 expression leads to S-phase entry and p53-mediated metabolism of prostate cancer cells. Int J Biochem Cell Biol 2016;73: apoptosis. Proc Natl Acad Sci U S A 1994;91:10918–22. 30–40. 21. Branzei D, Foiani M. Regulation of DNA repair throughout the cell cycle. 39. Hydbring P, Wang Y, Fassl A, Li X, Matia V, Otto T, et al. Cell-cycle-targeting Nat Rev Mol Cell Biol 2008;9:297–308. MicroRNAs as therapeutic tools against refractory cancers. Cancer Cell 22. Mani SA, Guo W, Liao M-J, Eaton EN, Ayyanan A, Zhou AY, et al. The 2017;31:576–90. epithelial-mesenchymal transition generates cells with properties of stem 40. Liu C, Kelnar K, Liu B, Chen X, Calhoun-Davis T, Li H, et al. The microRNA cells. Cell 2008;133:704–15. miR-34a inhibits prostate cancer stem cells and metastasis by directly 23. Moreno-Bueno G, Cubillo E, Sarrio D, Peinado H, Rodríguez-Pinilla SM, repressing CD44. Nat Med 2011;17:211–5. Villa S, et al. Genetic profiling of epithelial cells expressing E-cadherin 41. Tellez CS, Juri DE, Do K, Bernauer AM, Thomas CL, Damiani LA, et al. repressors reveals a distinct role for Snail, Slug, and E47 factors in epithe- EMT and stem cell-like properties associated with miR-205 and miR- lial-mesenchymal transition. Cancer Res 2006;66:9543–56. 200 epigenetic silencing are early manifestations during carcinogen- 24. Liu T, Xu F, Du X, Lai D, Liu T, Zhao Y, et al. Establishment and induced transformation of human lung epithelial cells. Cancer Res characterization of multi-drug resistant, prostate carcinoma-initiating 2011;71:3087–97. stem-like cells from human prostate cancer cell lines 22RV1. Mol Cell 42. Huang N, Wu Z, Lin L, Zhou M, Wang L, Ma H, et al. MiR-338-3p Biochem 2010;340:265–73. inhibits epithelial-mesenchymal transition in gastric cancer cells 25. Zhou S, Schuetz JD, Bunting KD, Colapietro A-M, Sampath J, Morris JJ, et al. by targeting ZEB2 and MACC1/Met/Akt signaling. Oncotarget 2015; The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem 6:15222. cells and is a molecular determinant of the side-population phenotype. 43. Guo B, Liu L, Yao J, Ma R, Chang D, Li Z, et al. miR-338-3p suppresses Nat Med 2001;7:1028. gastric cancer progression through a PTEN-AKT axis by targeting P-REX2a. 26. Gao Y, Chen J, Li K, Wu T, Huang B, Liu W, et al. Replacement of Oct4 by Mol Cancer Res 2014;12:313–21. Tet1 during iPSC induction reveals an important role of DNA methylation 44. Armenia J, Wankowicz SAM, Liu D, Gao J, Kundra R, Reznik E, et al. The and hydroxymethylation in reprogramming. Cell Stem Cell 2013;12: long tail of oncogenic drivers in prostate cancer. Nat Genet 2018;50: 453–69. 645–51. 27. Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, et al. Frequent 45. Wu H, D'Alessio AC, Ito S, Xia K, Wang Z, Cui K, et al. Dual functions of Tet1 deletions and down-regulation of micro- RNA genes miR15 and miR16 at in transcriptional regulation in mouse embryonic stem cells. Nature 2011; 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A 2002;99: 473:389–93. 15524–9. 46. Slovin SF, Kelly WK, Wilton A, Kattan M, Myskowski P, Mendelsohn J, et al. 28. Bueno MJ, Perez de Castro I, Gomez de Cedron M, Santos J, Calin GA, Anti-epidermal growth factor receptor monoclonal antibody cetuximab Cigudosa JC, et al. Genetic and epigenetic silencing of microRNA-203 plus Doxorubicin in the treatment of metastatic castration-resistant pros- enhances ABL1 and BCR-ABL1 oncogene expression. Cancer Cell 2008;13: tate cancer. Clin Genitourin Cancer 2009;7:E77–82. 496–506. 47. Nabhan C, Lestingi TM, Galvez A, Tolzien K, Kelby SK, Tsarwhas D, et al. 29. Zhang X, Zhao X, Fiskus W, Lin J, Lwin T, Rao R, et al. Coordinated silencing Erlotinib has moderate single-agent activity in chemotherapy-naive cas- of MYC-mediated miR-29 by HDAC3 and EZH2 as a therapeutic target of tration-resistant prostate cancer: final results of a phase II trial. Urology histone modification in aggressive B-Cell lymphomas. Cancer Cell 2012; 2009;74:665–71. 22:506–23. 48. Pezaro C, Rosenthal MA, Gurney H, Davis ID, Underhill C, Boyer MJ, et al. 30. Kamminga LM, Bystrykh LV, de Boer A, Houwer S, Douma J, Weersing E, An open-label, single-arm phase two trial of gefitinib in patients with et al. The Polycomb group gene Ezh2 prevents hematopoietic stem cell advanced or metastatic castration-resistant prostate cancer. Am J Clin exhaustion. Blood 2006;107:2170–9. Oncol 2009;32:338–41. 31. Lu C, Han HD, Mangala LS, Ali-Fehmi R, Newton CS, Ozbun L, et al. 49. Adams BD, Parsons C, Walker L, Zhang WC, Slack FJ. Targeting noncoding Regulation of tumor angiogenesis by EZH2. Cancer Cell 2010;18:185–97. RNAs in disease. J Clin Invest 2017;127:761–71. 32. Nuytten M, Beke L, Van Eynde A, Ceulemans H, Beullens M, Van Hum- 50. McCabe MT, Ott HM, Ganji G, Korenchuk S, Thompson C, Van Aller GS, melen P, et al. The transcriptional repressor NIPP1 is an essential player in et al. EZH2 inhibition as a therapeutic strategy for lymphoma with EZH2- EZH2-mediated gene silencing. Oncogene 2008;27:1449. activating mutations. Nature 2012;492:108–12.

OF14 Clin Cancer Res; 2018 Clinical Cancer Research

Epigenetic Silencing of miRNA-338-5p and miRNA-421 Drives SPINK1-Positive Prostate Cancer

Vipul Bhatia, Anjali Yadav, Ritika Tiwari, et al.

Clin Cancer Res Published OnlineFirst December 26, 2018.

Updated version Access the most recent version of this article at: doi:10.1158/1078-0432.CCR-18-3230

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2018/12/22/1078-0432.CCR-18-3230.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/early/2019/03/26/1078-0432.CCR-18-3230. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.