Molecular Identification of Leishmania Species in Taybad District, Iran
Total Page：16
File Type：pdf, Size：1020Kb
See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/270758641 Molecular identification of Leishmania species in Taybad district, Iran Article in Asian Pacific Journal of Tropical Disease · September 2014 DOI: 10.1016/S2222-1808(14)60672-1 CITATIONS READS 6 96 7 authors, including: Ghodratollah Salehi Abdolmajid Fata Mashhad University of Medical Sciences Mashhad University of Medical Sciences 10 PUBLICATIONS 80 CITATIONS 87 PUBLICATIONS 559 CITATIONS SEE PROFILE SEE PROFILE Mohammad Ali Mohaghegh Mojtaba Mousavi Bazzaz Torbat Heydarieh University of Medical Sciences Mashhad University of Medical Sciences 51 PUBLICATIONS 189 CITATIONS 48 PUBLICATIONS 199 CITATIONS SEE PROFILE SEE PROFILE Some of the authors of this publication are also working on these related projects: Prevalence and Related Factors of Ritalin Abuse in Undergraduate Students View project Investigation of Soil Contamination With Cryptosporidium spp. Oocysts in DifferentRegions of Yazd, Central Iran View project All content following this page was uploaded by Ghodratollah Salehi on 12 January 2015. The user has requested enhancement of the downloaded file. Asian Pac J Trop Dis 2014; 4(Suppl 2): S535-S539 S535 Contents lists available at ScienceDirect Asian Pacific Journal of Tropical Disease journal homepage: www.elsevier.com/locate/apjtd Document heading doi: 10.1016/S2222-1808(14)60672-1 2014 by the Asian Pacific Journal of Tropical Disease. All rights reserved. 襃 Molecular identification of Leishmania species in Taybad district, Iran 1 1,2 1 3 Salehi Ghodratollah , Fata Abdolmajid *, Mohaghegh Mohammad Ali , Mousavi Bazzaz Sayyed Mojtaba , Rafatpanah 4 1 Hushang , Movahedi Abdolghayom 1Department of Medical Parasitology and Mycology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran 2Cutaneous Leishmaniasis Research Center, Emam Reza Hospital, Mashhad University of Medical Sciences, Mashhad, Iran 3Department of Community Medicine, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran 4Department of Immunology, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran ARTICLE INFO ABSTRACT Article history Objective: Leishmania : To identify species in patients with cutaneous leishmaniasis in the city of Received 10 Dec 2013 Methods:Taybad in Razavi Khorasan Province from April 2012 to March 2013. 52 Received in revised form 13 Jan 2014 Among persons who referred to Health Center of LeishmaniaTaybad with suspected skin lesions, Accepted 3 Jun 2014 stained slide smears of 35 patients showed positive result for . Also polymerase chain Available online 13 Sep 2014 DNA SPSS Results:reaction assay performed using specificLeishmania, k primers. Data of patients were analyzed with . Of 35 positive smears for 21 (60%) belonged to males and 14 (40%) belonged 35 31 (88 6 ) to females. Polymerase Leishmania chain tropica reaction bands were observedLeishmania in all samplesmajor of which . % Keywords samples showed and 4 (11.4%) showed . The highest infected : age group was 11-20 years old. Leishmaniasis Conclusions: Leishmania tropica Both anthroponoticLeishmania cutaneous tropica leishmaniasis and zoonotic cutaneous leishmaniasis are present in Taybad. is the dominant causative species for anthroponotic Leishmania major cutaneousLeishmania leishmaniasis. major Further study is recommended to discover probable reservoir and vector for in Taybad. Taybad Polymerase chain reaction Anthroponotic cutaneous leishmaniasis Zoonotic cutaneous leishmaniasis 1. Introduction important neglected diseases in developing countries[4]. Leishmania Two species of are involved in cutaneous Leishmania major Leishmaniasis is a vector-borne disease of human leishmaniasis (CL) infections in Iran. L. major beings and animals caused by protozoan parasites of the ( ) is causative agent of zoonotic cutaneous Leishmania Leishmania Leishmania tropica L. tropica genus [1]. Over 21 species of cause leishmaniasis (ZCL) and ( ) infection in humans worldwide, resulting in three clinical causes anthroponotic cutaneous leishmaniasis (ACL). L. major L. tropica phenotypes: cutaneous, mucocutaneous, and visceral Both and are intracellular parasites disease[2]. It is estimated that more than 15 million people transmitted through the bite of the female phlebotomine are infected with this disease with 1.5-2.0 million new sand flies[5]. L. tropica cases per year[3]. Leishmaniasis is still one of the most usually leads to dry ulcers on the skin and L. major often produces severely inflamed and ulcerated *Corresponding author: Fata Abdolmajid, Cutaneous Leishmaniasis Research Center, lesions. Both ZCL and ACL are endemic in different parts Emam Reza Hospital, Mashhad University of Medical Sciences, Mashhad, Iran. [6] Tel: +989151160466 of Iran . E-mail: [email protected] ZCL Foundation Project: Supported by Mashhad University of Medical Sciences (Grant No. is found in many rural foci of Isfahan, Khuzestan 900421). and Khorasan Provinces, while ACL is endemic in many Salehi Ghodratollah et al./Asian Pac J Trop Dis 2014; 4(Suppl 2): S535-S539 S536 μ large and small cities including Shiraz in the south, buffer. For this purpose, poured 200 L of lysis buffer on Kerman in the southeast, and Mashhad in northeastern of the slides and specimen are dissolved in it and moved in μ Iran[6-8]. a 1.5 mL sterile microtube. Then it was added with 20 L ° μ Despite the extensive efforts by the health authorities proteinase K and incubated at 56 C for 1-3 h. Then 200 L to control it, new focuses have appeared in different parts GB buffer was added, which helped to further dissolution ° of the country. The disease is a major health problem of tissues, and incubated at 56 C for 10 min. The DNA μ that causes serious psychological as well as social and was precipitated in 200 L of absolute ethanol and economic burden to the community. In national CL control carefully transfered the lysate into the spin column and program, the identification and description of the disease centrifugated at 10 000 r/m for 1 min. Then spin column have been emphasized[9]. was washed at 2 stages with o.5 mL of GW1 and GW2 buffers In the last few years, polymerase chain reaction and centrifugated at 10 000 r/m for 1 min after each step. μ (PCR) has been widely used due to high sensitivity as a At the last stage, 200 L of GE buffer (D.W. or elute buffer) parasitological diagnostic test[10-12]. This study aimed to was added to the spin column. Eluted DNA was isolated by Leishmania identify species in patients with CL in the city centrifugation at 10 000 r/m for 1 min. DNA was stored in of Taybad in Razavi Khorasan Province from April 2012 to the freezer until the PCR test. March 2013. 2.4. PCR amplification 2. Materials and methods PCR reaction was provided for each sample, using 20 μ Leishmania L PCR mix (containing reagents and kDNA 2.1. Study area μ primers), and 5 L DNA template in 0.2 mL microtubes. A L. major positive control reaction using standard DNA and Taybad is located in the east of Khorasan Razavi near a negative control using distilled water were established the border with Afghanistan. It is situated 225 km from in every round of PCR. ’ southeast of Mashhad. The county s population is reported PCR was performed using specific primers ’ ’ ’ 143 205 at 2006 census. Taybad s altitude is 806 m above F : ( 5 TCGCAGAACGCCCCTAC C 3 ) a n d R : ’ ’ sea level with warm and dry climates. (5 AGGGGTTGGTGTAAAATAGG 3 ) dependent to kDNA of Leishmania . 2.2. Sampling Amplification of the target DNA was performed using thermocycler ASTEC under the following conditions: one ° In this cross-sectional study, patients with suspicious cycle of 5 min initial denaturation at 95 C, followed by 38 ° ° ° lesions referred to health center in Taybad city. First, cycles of 94 C for 30 seconds, 60 C for 45 seconds, 72 C agreement of patients to participate in this study was for 60 seconds, ending by one cycle of final extension at ° acquired. Then personal and epidemiological information 72 C for 7 min. Electrophoresis of the PCR products was μ such as name, sex, age, job, location of lesion and habitat performed using 10 L of each amplicon, on 2% agarose 伊 were recorded in data collection forms. Samples were gel in 0.5 TAE buffer for 50 min at 100 mA, followed by collected using a sterile scalpel by scraping from the edge staining of the gels in 1 mg ethidium bromide in 100 mL and the center of the lesion on the clean microscopic TAE buffer and consequent observation of amplified DNAs slides. Then microscopic slides were air dried and fixed by Gel grab under UV light. Exactly 100 bp DNA Ladder was with methanol and stained with Giemsa and examined also used as the DNA size marker. by light microscope carefully. At least 2 slides for each patient were prepared and kept for DNA extraction. 3. Results 2.3. DNA extraction This descriptive study was carried out on 35 patients ’ DNA was extracted from the prepared slides of patient s with active lesions from April 2012 to March 2013 that lesions[10-13]. It was performed with Genet Bio DNA were positive by PCR. Single fragments of 615 bp and 744 ’ L. major L. tropica extraction kit. According to manufacturer s instructions, bp are indicative of the species and , the tissues on the slides should be suspended in lysis respectively (Figure 1). Salehi Ghodratollah et al./Asian Pac J Trop Dis 2014; 4(Suppl 2): S535-S539 S537 Table 1 Leishmania Frequency of species in different sex and clinical presentation in patients from Taybad with cutaneous leishmaniasis. Data Sex Living place Type of lesion Number of lesion ≥ Male (%) Female (%) Urban (%) Rural (%) Papule & nodule (%) Ulcer (%) 1 (%) 2 (%) 3 (%) 4 (%) L. tropica 17 (48.6) 14 (40) 14 (40) 17 (48.6) 22 (62.9) 9 (25.7) 24 (68.6) 4 (11.4) 2 (5.7) 1 (2.9) L.