From: [email protected] To: [email protected] Subject: Condition Petition for Thomas Rosenberger Date: Tuesday, December 31, 2019 5:15:54 PM Attachments: Question 1 Autism.pdf Question 2 Autism.pdf Question 3 Autism.pdf Question 5 Autism.pdf

This message was sent from the Condition page on medicalmarijuana.ohio.gov.

Box was check regarding file size being too large to upload. Action needed!

Name: Thomas Rosenberger Address: 815 Grandview Ave Suite 400, Columbus, OH, 43215 Phone: (614) 706-3782 Email: [email protected]

Specific Disease or Condition: Autism Spectrum Disorder (ASD)

Information from experts who specialize in the disease or condition. See attached file

Question 1 Autism.pdf

Relevant medical or scientific evidence pertaining to the disease or condition. See attached file

Question 2 Autism.pdf

Consideration of whether conventional medical therapies are insufficient to treat or alleviate the disease or condition. See attached file

Question 3 Autism.pdf

Evidence supporting the use of medical marijuana to treat or alleviate the disease or condition, including journal articles, peer-reviewed studies, and other types of medical or scientific documentation. File larger than 3MB

Letters of support provided by physicians with knowledge of the disease or condition. This may include a letter provided by the physician treating the petitioner, if applicable. See attached file

Question 5 Autism.pdf

Question 1

Information from experts who specialize in the disease or condition

Contents

Overview – 3

Prevalence of Autism Spectrum Disorder Among Children Aged 8 Years — Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States, 2014 – 4

Overview

Autism spectrum disorder (ASD) is characterized by challenges with social skills, repetitive behaviors, speech and nonverbal communication. The conditions impact varies wildly, with some patients functioning at a high level with little intervention, while other patients are never able to live independently.

We still know little about the cause of ASD, but evidence suggests the condition is on the rise. The Autism and Developmental Disabilities Monitoring Network compiles reports like the one attached below regularly regarding the rate of ASD. In 2014, they estimated 16.8 per 1,000 children aged 8 have ASD.

With the rate of ASD on the rise it is more important than ever that we provide physicians the tools they need to treat this condition based on their assessment of an individual patient. The evidence provided within this application shows clearly that medical marijuana can be an effective treatment for some individuals with ASD.

Morbidity and Mortality Weekly Report Surveillance Summaries / Vol. 67 / No. 6 April 27, 2018

Prevalence of Autism Spectrum Disorder Among Children Aged 8 Years — Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States, 2014

U.S. Department of Health and Human Services Centers for Disease Control and Prevention Surveillance Summaries

CONTENTS

Introduction...... 2 Methods...... 4 Results...... 9 Discussion...... 12 Limitations...... 15 Future Surveillance Directions...... 15 Conclusion...... 15 References...... 16

The MMWR series of publications is published by the Center for Surveillance, Epidemiology, and Laboratory Services, Centers for Disease Control and Prevention (CDC), U.S. Department of Health and Human Services, Atlanta, GA 30329-4027. Suggested citation: [Author names; first three, then et al., if more than six.] [Title]. MMWR Surveill Summ 2018;67(No. SS-#):[inclusive page numbers]. Centers for Disease Control and Prevention Robert R. Redfield, MD, Director Anne Schuchat, MD, Principal Deputy Director Leslie Dauphin, PhD, Acting Associate Director for Science Joanne Cono, MD, ScM, Director, Office of Science Quality Chesley L. Richards, MD, MPH, Deputy Director for Public Health Scientific Services Michael F. Iademarco, MD, MPH, Director, Center for Surveillance, Epidemiology, and Laboratory Services MMWR Editorial and Production Staff (Serials) Charlotte K. Kent, PhD, MPH, Acting Editor in Chief, Executive Editor Martha F. Boyd, Lead Visual Information Specialist Christine G. Casey, MD, Editor Maureen A. Leahy, Julia C. Martinroe, Mary Dott, MD, MPH, Online Editor Stephen R. Spriggs, Tong Yang, Teresa F. Rutledge, Managing Editor Visual Information Specialists David C. Johnson, Lead Technical Writer-Editor Quang M. Doan, MBA, Phyllis H. King, Jeffrey D. Sokolow, MA, Project Editor Paul D. Maitland, Terraye M. Starr, Moua Yang, Information Technology Specialists MMWR Editorial Board Timothy F. Jones, MD, Chairman William E. Halperin, MD, DrPH, MPH Jeff Niederdeppe, PhD Matthew L. Boulton, MD, MPH King K. Holmes, MD, PhD Patricia Quinlisk, MD, MPH Virginia A. Caine, MD Robin Ikeda, MD, MPH Patrick L. Remington, MD, MPH Katherine Lyon Daniel, PhD Rima F. Khabbaz, MD Carlos Roig, MS, MA Jonathan E. Fielding, MD, MPH, MBA Phyllis Meadows, PhD, MSN, RN William L. Roper, MD, MPH David W. Fleming, MD Jewel Mullen, MD, MPH, MPA William Schaffner, MD Surveillance Summaries

Prevalence of Autism Spectrum Disorder Among Children Aged 8 Years — Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States, 2014

Jon Baio, EdS1; Lisa Wiggins, PhD1; Deborah L. Christensen, PhD1; Matthew J Maenner, PhD1, Julie Daniels, PhD2; Zachary Warren, PhD3; Margaret Kurzius-Spencer, PhD4; Walter Zahorodny, PhD5; Cordelia Robinson Rosenberg, PhD6; Tiffany White, PhD7; Maureen S. Durkin, PhD8; Pamela Imm, MS8; Loizos Nikolaou, MPH1,9; Marshalyn Yeargin-Allsopp, MD1; Li-Ching Lee, PhD10; Rebecca Harrington, PhD10; Maya Lopez, MD11; Robert T. Fitzgerald, PhD12; Amy Hewitt, PhD13; Sydney Pettygrove, PhD4; John N. Constantino, MD12; Alison Vehorn, MS3; Josephine Shenouda, MS5; Jennifer Hall-Lande, PhD13; Kim Van Naarden Braun, PhD1; Nicole F. Dowling, PhD1

1National Center on Birth Defects and Developmental Disabilities, CDC; 2University of North Carolina, Chapel Hill; 3Vanderbilt University Medical Center, Nashville, Tennessee; 4University of Arizona, Tucson; 5Rutgers University, Newark, New Jersey; 6University of Colorado School of Medicine at the Anschutz Medical Campus; 7Colorado Department of Public Health and Environment, Denver; 8University of Wisconsin, Madison; 9Oak Ridge Institute for Science and Education, Oak Ridge, Tennessee; 10Johns Hopkins University, Baltimore, Maryland; 11University of Arkansas for Medical Sciences, Little Rock; 12Washington University in St. Louis, Missouri; 13University of Minnesota, Minneapolis

Abstract

Problem/Condition: Autism spectrum disorder (ASD). Period Covered: 2014. Description of System: The Autism and Developmental Disabilities Monitoring (ADDM) Network is an active surveillance system that provides estimates of the prevalence of autism spectrum disorder (ASD) among children aged 8 years whose parents or guardians reside within 11 ADDM sites in the United States (Arizona, Arkansas, Colorado, Georgia, Maryland, Minnesota, Missouri, New Jersey, North Carolina, Tennessee, and Wisconsin). ADDM surveillance is conducted in two phases. The first phase involves review and abstraction of comprehensive evaluations that were completed by professional service providers in the community. Staff completing record review and abstraction receive extensive training and supervision and are evaluated according to strict reliability standards to certify effective initial training, identify ongoing training needs, and ensure adherence to the prescribed methodology. Record review and abstraction occurs in a variety of data sources ranging from general pediatric health clinics to specialized programs serving children with developmental disabilities. In addition, most of the ADDM sites also review records for children who have received special education services in public schools. In the second phase of the study, all abstracted information is reviewed systematically by experienced clinicians to determine ASD case status. A child is considered to meet the surveillance case definition for ASD if he or she displays behaviors, as described on one or more comprehensive evaluations completed by community-based professional providers, consistent with the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision (DSM-IV-TR) diagnostic criteria for autistic disorder; pervasive developmental disorder–not otherwise specified (PDD-NOS, including atypical autism); or Asperger disorder. This report provides updated ASD prevalence estimates for children aged 8 years during the 2014 surveillance year, on the basis of DSM-IV-TR criteria, and describes characteristics of the population of children with ASD. In 2013, the American Psychiatric Association published the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5), which made considerable changes to ASD diagnostic criteria. The change in ASD diagnostic criteria might influence ADDM ASD prevalence estimates; therefore, most (85%) of the records used to determine prevalence estimates based on DSM-IV-TR criteria underwent additional review under a newly operationalized surveillance case definition for ASD consistent with the DSM-5 diagnostic criteria. Children meeting this new surveillance case definition could qualify on the basis of one or both of the following criteria, as documented in abstracted comprehensive evaluations: 1) behaviors consistent with the DSM-5 diagnostic features; and/or 2) an ASD diagnosis, whether based on DSM-IV-TR or DSM-5 diagnostic criteria. Stratified comparisons of the number of children meeting either of these two case definitions also are reported.

Corresponding author: Jon Baio, National Center on Birth Defects and Developmental Disabilities, CDC. Telephone: 404-498-3873; E-mail: [email protected].

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 1 Surveillance Summaries

Results: For 2014, the overall prevalence of ASD among the 11 ADDM sites was 16.8 per 1,000 (one in 59) children aged 8 years. Overall ASD prevalence estimates varied among sites, from 13.1–29.3 per 1,000 children aged 8 years. ASD prevalence estimates also varied by sex and race/ethnicity. Males were four times more likely than females to be identified with ASD. Prevalence estimates were higher for non-Hispanic white (henceforth, white) children compared with non-Hispanic black (henceforth, black) children, and both groups were more likely to be identified with ASD compared with Hispanic children. Among the nine sites with sufficient data on intellectual ability, 31% of children with ASD were classified in the range of intellectual disability (intelligence quotient [IQ] <70), 25% were in the borderline range (IQ 71–85), and 44% had IQ scores in the average to above average range (i.e., IQ >85). The distribution of intellectual ability varied by sex and race/ethnicity. Although mention of developmental concerns by age 36 months was documented for 85% of children with ASD, only 42% had a comprehensive evaluation on record by age 36 months. The median age of earliest known ASD diagnosis was 52 months and did not differ significantly by sex or race/ethnicity. For the targeted comparison of DSM-IV-TR and DSM-5 results, the number and characteristics of children meeting the newly operationalized DSM-5 case definition for ASD were similar to those meeting the DSM-IV-TR case definition, with DSM-IV-TR case counts exceeding DSM-5 counts by less than 5% and approximately 86% overlap between the two case definitions (kappa = 0.85). Interpretation: Findings from the ADDM Network, on the basis of 2014 data reported from 11 sites, provide updated population- based estimates of the prevalence of ASD among children aged 8 years in multiple communities in the United States. The overall ASD prevalence estimate of 16.8 per 1,000 children aged 8 years in 2014 is higher than previously reported estimates from the ADDM Network. Because the ADDM sites do not provide a representative sample of the entire United States, the combined prevalence estimates presented in this report cannot be generalized to all children aged 8 years in the United States. Consistent with reports from previous ADDM surveillance years, findings from 2014 were marked by variation in ASD prevalence when stratified by geographic area, sex, and level of intellectual ability. Differences in prevalence estimates between black and white children have diminished in most sites, but remained notable for Hispanic children. For 2014, results from application of the DSM-IV-TR and DSM-5 case definitions were similar, overall and when stratified by sex, race/ethnicity, DSM-IV-TR diagnostic subtype, or level of intellectual ability. Public Health Action: Beginning with surveillance year 2016, the DSM-5 case definition will serve as the basis for ADDM estimates of ASD prevalence in future surveillance reports. Although the DSM-IV-TR case definition will eventually be phased out, it will be applied in a limited geographic area to offer additional data for comparison. Future analyses will examine trends in the continued use of DSM-IV-TR diagnoses, such as autistic disorder, PDD-NOS, and Asperger disorder in health and education records, documentation of symptoms consistent with DSM-5 terminology, and how these trends might influence estimates of ASD prevalence over time. The latest findings from the ADDM Network provide evidence that the prevalence of ASD is higher than previously reported estimates and continues to vary among certain racial/ethnic groups and communities. With prevalence of ASD ranging from 13.1 to 29.3 per 1,000 children aged 8 years in different communities throughout the United States, the need for behavioral, educational, residential, and occupational services remains high, as does the need for increased research on both genetic and nongenetic risk factors for ASD.

Introduction estimates compared with other prevalence studies of that era. In 2000, CDC established the Autism and Developmental Autism spectrum disorder (ASD) is a developmental Disabilities Monitoring (ADDM) Network to collect data that disability defined by diagnostic criteria that include deficits would provide estimates of the prevalence of ASD and other in social communication and social interaction, and the developmental disabilities in the United States (4,5). presence of restricted, repetitive patterns of behavior, interests, Tracking the prevalence of ASD poses unique challenges 1 or activities that can persist throughout life ( ). CDC began because of the heterogeneity in symptom presentation, lack of tracking the prevalence of ASD and characteristics of children biologic diagnostic markers, and changing diagnostic criteria 2 3 with ASD in the United States in 1998 ( , ). The first (5). Initial signs and symptoms typically are apparent in the early CDC study, which was based on an investigation in Brick developmental period; however, social deficits and behavioral 2 Township, New Jersey ( ), identified similar characteristics patterns might not be recognized as symptoms of ASD until but higher prevalence of ASD compared with other studies a child is unable to meet social, educational, occupational, of that era. The second CDC study, which was conducted in or other important life stage demands (1). Features of ASD 3 metropolitan Atlanta, Georgia ( ), identified a lower prevalence might overlap with or be difficult to distinguish from those of of ASD compared with the Brick Township study but similar other psychiatric disorders, as described extensively in DSM-5

2 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries

(1). Although standard diagnostic tools have been validated 2012. Estimated prevalence among white children exceeded to inform clinicians’ impressions of ASD symptomology, that among Hispanic children by nearly 70% in 2002 and inherent complexity of measurement approaches and variation 2006, and by approximately 50% in 2008, 2010, and 2012. in clinical impressions and decision-making, combined with ASD prevalence estimates from the ADDM Network also have policy changes that affect eligibility for health benefits and varied by socioeconomic status (SES). A consistent pattern educational programs, complicates identification of ASD as a observed in ADDM data has been higher identified ASD behavioral health diagnosis or educational exceptionality. To prevalence among residents of neighborhoods with higher reduce the influence of these factors on prevalence estimates, socioeconomic status (SES). Although ASD prevalence has the ADDM Network has consistently tracked ASD by applying increased over time at all levels of SES, the absolute difference a surveillance case definition of ASD and using the same in prevalence between high, middle, and lower SES did not record-review methodology and behaviorally defined case change from 2002 to 2010 (14,15). In the context of declining inclusion criteria since 2000 (5). white:black and white:Hispanic prevalence ratios amidst ADDM estimates of ASD prevalence among children aged consistent SES patterns, a complex three-way interaction 8 years in multiple U.S. communities have increased from among time, SES, and race/ethnicity has been proposed (16). approximately one in 150 children during 2000–2002 to one in Finally, ADDM Network data have shown a shift toward 68 during 2010–2012, more than doubling during this period children with ASD with higher intellectual ability (9–11), (6–11). The observed increase in ASD prevalence underscores as the proportion of children with ASD whose intelligence the need for continued surveillance using consistent methods quotient (IQ) scores fell within the range of intellectual to monitor the changing prevalence of ASD and characteristics disability (ID) (i.e., IQ <70) has decreased gradually over of children with ASD in the population. time. During 2000–2002, approximately half of children with In addition to serving as a basis for ASD prevalence estimates, ASD had IQ scores in the range of ID; during 2006–2008, ADDM data have been used to describe characteristics of this proportion was closer to 40%; and during 2010–2012, children with ASD in the population, to study how these less than one third of children with ASD had IQ ≤70 (9–11). characteristics vary with ASD prevalence estimates over This trend was more pronounced for females as compared time and among communities, and to monitor progress with males (9). The proportion of males with ASD and ID toward Healthy People 2020 objectives (12). ADDM ASD declined from approximately 40% during 2000–2008 (9) to prevalence estimates consistently estimated a ratio of 30% during 2010–2012 (10,11). The proportion of females approximately 4.5 male:1 female with ASD during 2006–2012 with ASD and ID declined from approximately 60% during (9–11). Other characteristics that have remained relatively 2000–2002, to 45% during 2006–2008, and to 35% during constant over time in the population of children identified 2010–2012 (9–11). with ASD by ADDM include the median age of earliest known All previously reported ASD prevalence estimates from the ASD diagnosis, which remained close to 53 months during ADDM Network were based on a surveillance case definition 2000–2012 (range: 50 months [2012] to 56 months [2002]), aligned with DSM-IV-TR diagnostic criteria for autistic and the proportion of children receiving a comprehensive disorder; pervasive developmental disorder–not otherwise developmental evaluation by age 3 years, which remained close specified (PDD-NOS, including atypical autism); or Asperger to 43% during 2006–2012 (range: 43% [2006 and 2012] to disorder. In the American Psychiatric Association’s 2013 46% [2008]). publication of DSM-5, substantial changes were made to the ASD prevalence by race/ethnicity has been more varied over taxonomy and diagnostic criteria for autism (1,17). Taxonomy time among ADDM Network communities (9–11). Although changed from Pervasive Developmental Disorders, which ASD prevalence estimates have historically been greater among included multiple diagnostic subtypes, to autism spectrum white children compared with black or Hispanic children (13), disorder, which no longer comprises distinct subtypes but ADDM-reported white:black and white:Hispanic prevalence represents one singular diagnostic category defined by level ratios have declined over time because of larger increases of support needed by the individual. Diagnostic criteria in ASD prevalence among black children and, to an even were refined by collapsing the DSM-IV-TR social and greater extent, among Hispanic children, as compared with communication domains into a single, combined domain the magnitude of increase in ASD prevalence among white for DSM-5. Persons diagnosed with ASD under DSM-5 children (9). Previous reports from the ADDM Network must meet all three criteria under the social communication/ estimated ASD prevalence among white children to exceed interaction domain (i.e., deficits in social-emotional reciprocity; that among black children by approximately 30% in 2002, deficits in nonverbal communicative behaviors; and deficits in 2006, and 2010, and by approximately 20% in 2008 and developing, understanding, and maintaining relationships) and

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 3 Surveillance Summaries at least two of the four criteria under the restrictive/repetitive Surveillance Program (MADDSP) (24). As feasible, the behavior domain (i.e., repetitive speech or motor movements, surveillance methods have remained consistent over time. insistence on sameness, restricted interests, or unusual response Certain minor changes have been introduced to improve to sensory input). efficiency and data quality. Although a different array of Although the DSM-IV-TR criteria proved useful in geographic areas was covered in each of the eight biennial identifying ASD in some children, clinical agreement and ADDM Network surveillance years spanning 2000–2014, diagnostic specificity in some subtypes (e.g., PDD-NOS) was these changes have been documented to facilitate evaluation poor, offering empirical support to the notion of two, rather of their impact. than three, diagnostic domains. The DSM-5 introduced a The core surveillance activities in all ADDM Network framework to address these concerns (18), while maintaining sites focus on children aged 8 years because the baseline ASD that any person with an established DSM-IV-TR diagnosis prevalence study conducted by MADDSP suggested that this of autistic disorder, Asperger disorder, or PDD-NOS would is the age of peak prevalence (3). ADDM has multiple goals: automatically qualify for a DSM-5 diagnosis of autism 1) to provide descriptive data on classification and functioning spectrum disorder. Previous studies suggest that DSM-5 criteria of the population of children with ASD, 2) to monitor the for ASD might exclude certain children who would have prevalence of ASD in different areas of the United States, and qualified for a DSM-IV-TR diagnosis but had not yet received 3) to understand the impact of ASD in U.S. communities. one, particularly those who are very young and those without Funding for ADDM Network sites participating in the ID (19–23). These findings suggest that ASD prevalence 2014 surveillance year was awarded for a 4-year cycle covering estimates will likely be lower under DSM-5 than they have 2015–2018, during which time data were collected for children been under DSM-IV-TR diagnostic criteria. aged 8 years during 2014 and 2016. Sites were selected through This report provides the latest available ASD prevalence a competitive objective review process on the basis of their estimates from the ADDM Network based on both DSM- ability to conduct active, records-based surveillance of ASD; IV-TR and DSM-5 criteria and asserts the need for future they were not selected to be a nationally representative sample. monitoring of ASD prevalence trends and efforts to improve A total of 11 sites are included in the current report (Arizona, early identification of ASD. The intended audiences for Arkansas, Colorado, Georgia, Maryland, Minnesota, Missouri, these findings include pediatric health care providers, school New Jersey, North Carolina, Tennessee, and Wisconsin). psychologists, educators, researchers, policymakers, and Each ADDM site participating in the 2014 surveillance year program administrators working to understand and address the functioned as a public health authority under the Health needs of persons with ASD and their families. These data can Insurance Portability and Accountability Act of 1996 Privacy be used to help plan services, guide research into risk factors Rule and met applicable local Institutional Review Board and and effective interventions, and inform policies that promote privacy and confidentiality requirements under 45 CFR 46 (25). improved outcomes in health and education settings. Case Ascertainment Methods ADDM is an active surveillance system that does not depend on family or practitioner reporting of an existing Study Sites ASD diagnosis or classification to determine ASD case status. ADDM staff conduct surveillance to determine case status in The Children’s Health Act (4) authorized CDC to monitor a two-phase process. The first phase of ADDM involves review prevalence of ASD in multiple areas of the United States, and abstraction of children’s evaluation records from data a charge that led to the formation of the ADDM Network sources in the community. In the second phase, all abstracted in 2000. Since that time, CDC has funded grantees in 16 evaluations for each child are compiled in chronological order states (Alabama, Arizona, Arkansas, Colorado, Florida, into a comprehensive record that is reviewed by one or more Maryland, Minnesota, Missouri, New Jersey, North Carolina, experienced clinicians to determine the child’s ASD case Pennsylvania, South Carolina, Tennessee, Utah, West Virginia, status. Developmental assessments completed by a wide range and Wisconsin). CDC tracks ASD in metropolitan Atlanta and of health and education providers are reviewed. Data sources represents the Georgia site collaborating with competitively are categorized as either 1) education source type, including funded sites to form the ADDM Network. evaluations to determine eligibility for special education The ADDM Network uses multisite, multisource, records- services or 2) health source type, including diagnostic and based surveillance based on a model originally implemented developmental assessments from psychologists, neurologists, by CDC’s Metropolitan Atlanta Developmental Disabilities

4 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries developmental pediatricians, child psychiatrists, physical reviewed for certain behavioral or diagnostic descriptions therapists, occupational therapists, and speech/language defined by ADDM as triggers for abstraction (e.g., child does pathologists. Agreements to access records are made at the not initiate interactions with others, prefers to play alone or institutional level in the form of contracts, memoranda, or engage in solitary activities, or has received a documented other formal agreements. ASD diagnosis). If abstraction triggers are found, evaluation All ADDM Network sites have agreements in place to information from birth through the current surveillance year access records at health sources; however, despite the otherwise from all available sources is abstracted into a single composite standardized approach, not all sites have permission to access record for each child. education records. One ADDM site (Missouri) has not been In the second phase of surveillance, the abstracted composite granted access to records at any education sources. Among the evaluation files are deidentified and reviewed systematically remaining sites, some receive permission from their statewide by experienced clinicians who have undergone standardized Department of Education to access children’s educational training to determine ASD case status using a coding scheme records, whereas other sites must negotiate permission from based on the DSM-IV-TR guidelines. A child meets the numerous individual school districts to access educational surveillance case definition for ASD if behaviors described records. Six sites (Arizona, Georgia, Maryland, Minnesota, in the composite record are consistent with the DSM-IV-TR New Jersey, and North Carolina) reviewed education records diagnostic criteria for any of the following conditions: autistic for all school districts in their covered surveillance areas. Three disorder, PDD-NOS (including atypical autism), or Asperger ADDM sites (Colorado, Tennessee, and Wisconsin) received disorder (Box 1). A child might be disqualified from meeting permission to review education records in only certain school the surveillance case definition for ASD if, based on the districts within the overall geographic area covered for 2014. In clinical judgment of one or more reviewers, there is insufficient Tennessee, permission to access education records was granted or conflicting information in support of ASD, sufficient from 13 of 14 school districts in the 11-county surveillance information to rule out ASD, or if one or more other diagnosed area, representing 88% of the total population of children conditions better account for the child’s symptoms. aged 8 years. Conversely, access to education records was Although new diagnostic criteria became available in 2013, limited to a small proportion of the population in the overall the children under surveillance in 2014 would have grown up geographic area covered by two sites (33% in Colorado and primarily under the DSM-IV-TR definitions for ASD, which 26% in Wisconsin). In the Colorado school districts where are prioritized in this report. The 2014 surveillance year is the access to education records is permitted for ADDM, parents are first to operationalize an ASD case definition based on DSM-5 directly notified about the ADDM system and can request that diagnostic criteria, in addition to that based on DSM-IV-TR. their children’s education records be excluded. The Arkansas Because of delays in developing information technology systems ADDM site received permission from their state Department to manage data collected under this new case definition, the of Education to access children’s educational records statewide; surveillance area for DSM-5 was reduced by 19% in an effort to however, time and travel constraints prevented investigators include complete estimates for both DSM-IV-TR and DSM-5 from visiting all 250 school districts in the 75-county in this report. Phase 1 record review and abstraction was the surveillance area, resulting in access to education records for same for DSM-IV-TR and DSM-5; however, a coding scheme 69% of the statewide population of children aged 8 years. The based on the DSM-5 definition of ASD was developed for two sites with access to education records throughout most, Phase 2 of the ADDM methodology (i.e., systematic review by but not all, of the surveillance area (Arkansas and Tennessee) experienced clinicians). The new coding scheme was developed received data from their state Department of Education to through a collaborative process and includes reliability measures, evaluate the potential impact on reported ASD prevalence although no validation metrics have been published for this new estimates attributed to missing records. ADDM Network DSM-5 case definition. A child could meet Within each education and health data source, ADDM the DSM-5 surveillance case definition for ASD under one sites identify records to review based on a child’s year of or both of the following criteria, as documented in abstracted birth and one or more selected eligibility classifications for comprehensive evaluations: 1) behaviors consistent with the special education or International Classification of Diseases, DSM-5 diagnostic features; and/or 2) an ASD diagnosis, Ninth Revision (ICD-9) billing codes for select childhood whether based on DSM-IV-TR or DSM-5 diagnostic criteria disabilities or psychological conditions. Children’s records are (Box 2). Children with a documented ASD diagnosis were first reviewed to confirm year of birth and residency in the included as meeting the DSM-5 surveillance case definition surveillance area at some time during the surveillance year. for two reasons. First, published DSM-5 diagnostic criteria For children meeting these requirements, the records are then include the presence of a DSM-IV-TR diagnosis of autistic

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 5 Surveillance Summaries

BOX 1. Autism spectrum disorder (ASD) case determination criteria under DSM-IV-TR

DSM-IV-TR behavioral criteria

Social 1a. Marked impairment in the use of multiple nonverbal behaviors, such as eye-to-eye gaze, facial expression, body postures, and gestures to regulate social interaction 1b. Failure to develop peer relationships appropriate to developmental level 1c. A lack of spontaneous seeking to share enjoyment, interests, or achievements with other people (e.g., by a lack of showing, bringing, or pointing out objects of interest) 1d. Lack of social or emotional reciprocity

Communication 2a. Delay in, or total lack of, the development of spoken language (not accompanied by an attempt to compensate through alternative modes of communication, such as gesture or mime) 2b. In individuals with adequate speech, marked impairment in the ability to initiate or sustain a conversation with others 2c. Stereotyped and repetitive use of language or idiosyncratic language 2d. Lack of varied, spontaneous make-believe play or social imitative play appropriate to developmental level

Restricted behavior/ 3a. Encompassing preoccupation with one or more stereotyped and restricted patterns of interest that is abnormal either in intensity or focus Interest 3b. Apparently inflexible adherence to specific, nonfunctional routines, or rituals 3c. Stereotyped and repetitive motor mannerisms (e.g., hand or finger flapping or twisting, or complex whole body movements) 3d. Persistent preoccupation with parts of objects

Developmental Child had identified delays or any concern with development in the following areas at or before the age of 3 years: Social, Communication, history Behavior, Play, Motor, Attention, Adaptive, Cognitive

Autism discriminators Oblivious to children Oblivious to adults or others Rarely responds to familiar social approach Language primarily echolalia or jargon Regression/loss of social, language, or play skills Previous ASD diagnosis, whether based on DSM-IV-TR or DSM-5 diagnostic criteria Lack of showing, bringing, etc. Little or no interest in others Uses others as tools Repeats extensive dialog Absent or impaired imaginative play Markedly restricted interests Unusual preoccupation Insists on sameness Nonfunctional routines Excessive focus on parts Visual inspection Movement preoccupation Sensory preoccupation

DSM-IV-TR case At least six behaviors coded with a minimum of two Social, one Communication, and one Restricted Behavior/Interest; AND evidence of determination developmental delay or concern at or before the age of 3 years OR At least two behaviors coded with a minimum of one Social and either one Communication and/or one Restricted Behavior/Interest; AND at least one autism discriminator coded Note: A child might be disqualified from meeting the DSM-IV-TR surveillance case definition for ASD if, based on the clinical judgment of one or more reviewers, there is insufficient or conflicting information in support of ASD, sufficient information to rule out ASD, or if one or more other diagnosed conditions better account for the child’s symptoms

Abbreviation: DSM-IV-TR = Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (Text Revision). disorder, PDD-NOS, or Asperger disorder, to ensure continuity methods allow differentiation of those meeting the surveillance of diagnoses and services. Second, sensitivity of the DSM-5 case status based on one or both criteria. Consistent with the surveillance case definition might be increased when counting DSM-IV-TR case definition, a child might be disqualified children diagnosed with ASD by a qualified professional, based from meeting the DSM-5 surveillance case definition for ASD on either DSM-IV-TR or DSM-5 criteria, whether or not if, based on the clinical judgment of one or more reviewers, all DSM-5 social and behavioral criteria are documented in there is insufficient or conflicting information in support of abstracted comprehensive evaluations. The ADDM Network ASD, sufficient information to rule out ASD, or if one or

6 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries

BOX 2. Autism spectrum disorder case determination criteria under DSM-5

DSM-5 behavioral criteria

A. Persistent A1: Deficits in social emotional reciprocity deficits in social A2. Deficits in nonverbal communicative behaviors communication and A3. Deficits in developing, maintaining, and understanding relationships social interaction

B. Restricted, repetitive B1: Stereotyped or repetitive motor movements, use of objects or speech patterns of behavior, B2. Insistence on sameness, inflexible adherence to routines, or ritualized patterns of verbal or nonverbal behavior interests, or B3. Highly restricted interests that are abnormal in intensity or focus activities, currently B4. Hyper- or hypo-reactivity to sensory input or unusual interest in sensory aspects of the environment or by history

Historical PDD Any ASD diagnosis documented in a comprehensive evaluation, including a DSM-IV diagnosis of autistic disorder, Asperger disorder, or diagnosis pervasive developmental disorder–not otherwise specified (PDD-NOS)

DSM-5 case All three behavioral criteria coded under part A, and at least two behavioral criteria coded under part B determination OR Any ASD diagnosis documented in a comprehensive evaluation, whether based on DSM-IV-TR or DSM-5 diagnostic criteria Note: A child might be disqualified from meeting the DSM-5 surveillance case definition for ASD if, based on the clinical judgment of one or more reviewers, there is insufficient or conflicting information in support of ASD, sufficient information to rule out ASD, or if one or more other diagnosed conditions better account for the child’s symptoms

Abbreviation: DSM-5 = Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition. more other diagnosed conditions better account for the child’s conducted using state vital records. These data were only symptoms. In this report, prevalence estimates are based on the available for children born in the state where the ADDM site DSM-IV-TR case definition, whereas case counts are presented is located. The race/ethnicity of each child was determined and compared for children meeting the DSM-IV-TR and/or from information contained in source records or, if not found DSM-5 case definitions. in the source file, from birth certificate data on one or both parents. Children with race coded as “other” or “multiracial” Quality Assurance were considered to be missing race information for all analyses that were stratified by race/ethnicity. For this report, data on All sites follow the quality assurance standards established by timing of the first comprehensive evaluation on record were the ADDM Network. In the first phase, the accuracy of record restricted to children with ASD who were born in the state review and abstraction is checked periodically. In the second where the ADDM site is located, as confirmed by linkage to phase, interrater reliability is monitored on an ongoing basis birth certificate records. Data were restricted in this manner to using a blinded, random 10% sample of abstracted records reduce errors in the estimate that were introduced by children that are scored independently by two reviewers (5). For 2014, for whom evaluation records were incomplete because they were interrater agreement on DSM-IV-TR case status (confirmed born out of state and migrated into the surveillance area between ASD versus not ASD) was 89.1% when comparison samples the time of birth and the year when they reached age 8 years. from all sites were combined (k = 0.77), which was slightly Information on children’s functional skills is abstracted below quality assurance standards established for the ADDM from source records when available, including scores on Network (90% agreement, 0.80 kappa). On DSM-5 reviews, tests of adaptive behavior and intellectual ability. Because no interrater agreement on case status (confirmed ASD versus standardized, validated measures of functioning specific to ASD not ASD) was 92.3% when comparison samples from all sites have been widely adopted in clinical practice and because adaptive were combined (k = 0.84). Thus, for the DSM-5 surveillance behavior rating scales are not sufficiently available in health and definition, reliability exceeded quality assurance standards education records of children with ASD, scores of intellectual established for the ADDM Network. ability have remained the primary source of information on Descriptive Characteristics and Data Sources children’s functional skills. Children are classified as having ID if they have an IQ score of ≤70 on their most recent test available Each ADDM site attempted to obtain birth certificate data in the record. Borderline intellectual ability is defined as having for all children abstracted during Phase 1 through linkages an IQ score of 71–85, and average or above-average intellectual

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 7 Surveillance Summaries ability is defined as having an IQ score of >85. In the absence of ability and thus are not affected by the availability of data on a specific IQ score, an examiner’s statement based on a formal these characteristics. assessment of the child’s intellectual ability, if available, is used Statistical tests were selected and confidence intervals (CIs) to classify the child in one of these three levels. for prevalence estimates were calculated under the assumption Diagnostic conclusions from each evaluation record are that the observed counts of children identified with ASD were summarized for each child, including notation of any ASD obtained from an underlying Poisson distribution with an diagnosis by subtype, when available. Children are considered asymptotic approximation to the normal. Pearson chi-square to have a previously documented ASD classification if they tests were performed, and prevalence ratios and percentage received a diagnosis of autistic disorder, PDD-NOS, Asperger differences were calculated to compare prevalence estimates disorder, or ASD that was documented in an abstracted from different strata. Kappa statistics were computed to evaluation or by an ICD-9 billing code at any time from birth describe concordance between the DSM-IV-TR and DSM-5 through the year when they reached age 8 years, or if they case definitions, as well as to describe interrater agreement were noted as meeting eligibility criteria for special education on either case definition for quality assurance. Pearson chi- services under the classification of autism or ASD. square tests also were performed for testing significance in comparisons of proportions, and unadjusted odds ratio (OR) Analytic Methods estimates were calculated to further describe these comparisons. Population denominators for calculating ASD prevalence In an effort to reduce the effect of outliers, distribution medians estimates were obtained from the National Center for Health were typically presented, although one-way ANOVA was used Statistics Vintage 2016 Bridged-Race Postcensal Population to test significance when comparing arithmetic means of these Estimates (26). CDC’s National Vital Statistics System provides distributions. Significance was set at p<0.05. Results for all sites estimated population counts by state, county, single year of combined were based on pooled numerator and denominator age, race, ethnic origin, and sex. Population denominators data from all sites, in total and stratified by race/ethnicity, sex, for the 2014 surveillance year were compiled from postcensal and level of intellectual ability. estimates of the number of children aged 8 years living in the counties under surveillance by each ADDM site (Table 1). Sensitivity Analysis Methods In two sites (Arizona and Minnesota), geographic boundaries Certain education and health records were missing for were defined by constituent school districts included in the certain children, including records that could not be located surveillance area. The number of children living in outlying for review, those affected by the passive consent process unique school districts was subtracted from the county-level census to the Colorado site, and those archived and deemed too costly denominators using school enrollment data from the U.S. to retrieve. A sensitivity analysis of the effect of these missing Department of Education’s National Center for Education records on case ascertainment was conducted. All children Statistics (27). Enrollment counts of students in third grade initially identified for record review were first stratified by two during the 2014–15 school year differed from the CDC factors closely associated with final case status: information bridged-race population estimates, attributable primarily to source (health source type only, education source type only, children being enrolled out of the customary grade for their or both source types) and the presence or absence of either an age or in charter schools, home schools, or private schools. autism special education eligibility or an ICD-9-CM code for Because these differences varied by race and sex within the ASD, collectively forming six strata. The potential number of applicable counties, race- and sex-specific adjustments based cases not identified because of missing records was estimated on enrollment counts were applied to the CDC population under the assumption that within each of the six strata, the estimates to derive school district-specific denominators for proportion of children confirmed as ASD surveillance cases Arizona and Minnesota. among those with missing records would be similar to the Race- or ethnicity-specific prevalence estimates were proportion of cases among children with no missing records. calculated for four groups: white, black, Hispanic (regardless of Within each stratum, the proportion of children with no race), and Asian/Pacific Islander. Prevalence results are reported missing records who were confirmed as having ASD was as the total number of children meeting the ASD case definition applied to the number of children with missing records to per 1,000 children aged 8 years in the population in each race/ estimate the number of missed cases, and the estimates from ethnicity group. ASD prevalence also was estimated separately all six strata were added to calculate the total for each site. for boys and girls and within each level of intellectual ability. This sensitivity analysis was conducted solely to investigate Overall prevalence estimates include all children identified with the potential impact of missing records on the presented ASD regardless of sex, race/ethnicity, or level of intellectual estimates. The estimates presented in this report do not reflect

8 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries this adjustment or any of the other assessments of the potential sites (Table 2), with male-to-female prevalence ratios ranging effects of assumptions underlying the approach. from 3.2 (Arizona) to 4.9 (Georgia). Estimated ASD prevalence All ADDM sites identified records for review from health also varied by race and ethnicity (Table 3). When data from all sources by conducting record searches that were based on a sites were combined, the estimated prevalence among white common list of ICD-9 billing codes. Because several sites were children (17.2 per 1,000) was 7% greater than that among conducting surveillance for other developmental disabilities in black children (16.0 per 1,000) and 22% greater than that addition to ASD (i.e., one or more of the following: cerebral among Hispanic children (14.0 per 1,000). In nine sites, the palsy, ID, hearing loss, and vision impairment), they reviewed estimated prevalence of ASD was higher among white children records based on an expanded list of ICD-9 codes. The than black children. The white-to-black ASD prevalence ratios Colorado site also requested code 781.3 (lack of coordination), were statistically significant in three sites (Arkansas, Missouri, which was identified in that community as a commonly used and Wisconsin), and the white-to-Hispanic prevalence ratios billing code for children with ASD. The proportion of children were significant in seven sites (Arizona, Arkansas, Colorado, meeting the ASD surveillance case definition whose records Georgia, Missouri, North Carolina, and Tennessee). In nine were obtained solely on the basis of those additional codes was sites (Arizona, Arkansas, Colorado, Georgia, Maryland, calculated to evaluate the potential impact on ASD prevalence. Minnesota, Missouri, North Carolina, and Tennessee), the estimated prevalence of ASD was higher among black children than that among Hispanic children. The black-to-Hispanic Results prevalence ratio was significant in three of these nine sites A total population of 325,483 children aged 8 years was (Arizona, Georgia, and North Carolina). In New Jersey, there covered by the 11 ADDM sites that provided data for the was almost no difference in ASD prevalence estimates among 2014 surveillance year (Table 1). This number represented white, black, and Hispanic children. Estimates for Asian/Pacific 8% of the total U.S. population of children aged 8 years in Islander children ranged from 7.9 per 1,000 (Colorado) to 2014 (4,119,668) (19). A total of 53,120 records for 42,644 19.2 per 1,000 (New Jersey) with notably wide CIs. children were reviewed from health and education sources. Of these, the source records of 10,886 children met the criteria Intellectual Ability for abstraction, which was 25.5% of the total number of Data on intellectual ability were reported for nine children whose source records were reviewed and 3.3% of sites (Arizona, Arkansas, Colorado, Georgia, Maryland, the population under surveillance. Of the records reviewed Minnesota, New Jersey, North Carolina, and Tennessee) by clinicians, 5,473 children met the ASD surveillance case having information available for at least 70% of children who definition. The number of evaluations abstracted for each met the ASD case definition (range: 70.8% [Tennessee] to child who was ultimately identified with ASD varied by site 89.2% [North Carolina]). The median age of children’s most (median: five; range: three [Arizona, Minnesota, Missouri, and recent IQ tests, on which the following results are based, was Tennessee] to 10 [Maryland]). 73 months (6 years, 1 month). Data from these nine sites yielded accompanying data on intellectual ability for 3,714 Overall ASD Prevalence Estimates (80.3%) of 4,623 children with ASD. This proportion did Overall ASD prevalence for the ADDM 2014 surveillance not differ by sex or race/ethnicity in any of the nine sites or year varied widely among sites (range: 13.1 [Arkansas] to 29.3 when combining data from all nine sites. Among these 3,714 [New Jersey]) (Table 2). On the basis of combined data from children, 31% were classified in the range of ID (IQ ≤70), all 11 sites, ASD prevalence was 16.8 per 1,000 (one in 59) 25% were in the borderline range (IQ 71–85), and 44% had children aged 8 years. Overall estimated prevalence of ASD IQ >85. The proportion of children classified in the range of was highest in New Jersey (29.3) compared to each of the other ID ranged from 26.7% in Arizona to 39.4% in Tennessee. ten sites (p<0.01). Among children identified with ASD, the distribution by intellectual ability varied by sex, with girls more likely than boys to have IQ ≤70, and boys more likely than girls to Prevalence by Sex and Race/Ethnicity have IQ >85 (Figure 1). In these nine sites combined, 251 When data from all 11 ADDM sites were combined, ASD (36.3%) of 691 girls with ASD had IQ scores or examiners’ prevalence was 26.6 per 1,000 boys and 6.6 per 1,000 girls statements indicating ID compared with 891 (29.5%) of (prevalence ratio: 4.0). ASD prevalence was significantly 3,023 males (odds ratio [OR] = 1.4; p<0.01), though among (p<0.01) higher among boys than among girls in all 11 ADDM individual sites this proportion differed significantly in only

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 9 Surveillance Summaries

FIGURE 1. Most recent intelligence quotient score as of age 8 years among children with autism spectrum disorder for whom test data were available, by sex and site — Autism and Developmental Disabilities Monitoring Network, nine sites,* United States, 2014 100

90

80

70

60

50

Percentage 40

30

20

10

0 FMFMFMFMFMFMFMFMFMFM Arizona Arkansas Colorado Georgia Maryland Minnesota New Jersey North Carolina Tennessee Total ADDM site Above intellectually disabled range (IQ >70) Within intellectually disabled range (IQ ≤70)

Abbreviations: ADDM = Autism and Developmental Disabilities Monitoring Network; ASD = autism spectrum disorder; F = female; IQ = intelligence quotient; ​ M = male. * Includes nine sites (Arizona, Arkansas, Colorado, Georgia, Maryland, Minnesota, New Jersey, North Carolina, and Tennessee) that had intellectual ability data available for ≥70% of children who met the ASD case definition (n = 3,714). one (Georgia, OR = 1.6; p<0.05). The proportion of children with IQ >85 was significantly higher than the proportion of with ASD with borderline intellectual ability (IQ 71–85) did black (27%, OR = 3.4; p<0.01) or Hispanic (36%, OR = 2.2; not differ by sex, whereas a significantly higher proportion of p<0.01) children with IQ>85. males (45%) compared with females (40%) had IQ >85 (i.e., average or above average intellectual ability) (OR = 1.2; p<0.05). First Comprehensive Evaluation The distribution of intellectual ability also varied by race/ ethnicity. Approximately 44% of black children with ASD were Among children with ASD who were born in the same classified in the range of ID compared with 35% of Hispanic state as the ADDM site (n = 4,147 of 5,473 confirmed children and 22% of white children (Figure 2). The proportion cases), 42% had a comprehensive evaluation on record by age of blacks and whites with ID differed significantly in all sites 36 months (range: 30% [Arkansas] to 66% [North Carolina]) except Colorado, and when combining their data (OR = 2.9; (Table 4). Approximately 39% of these 4,147 children did p<0.01). The proportion of Hispanics and whites with ID not have a comprehensive evaluation on record until after differed significantly when combining data from all nine sites age 48 months; however, mention of developmental concerns (OR = 1.9; p<0.01), and among individual sites it reached by age 36 months was documented for 85% (range: 61% significance (p<0.05) in six of the nine sites, with the three [Tennessee] to 94% [Arizona]). exceptions being Arkansas (OR = 1.8; p = 0.10), North Carolina (OR = 1.8; p = 0.07), and Tennessee (OR = 2.1; p = 0.09). Previously Documented ASD Classification The proportion of children with borderline intellectual ability Of the 5,473 children meeting the ADDM ASD surveillance (IQ = 71–85) did not differ between black and Hispanic case definition, 4,379 (80%) had either eligibility for autism children, although a lower proportion of white children (22%) special education services or a DSM-IV-TR, DSM-5, or ICD-9 were classified in the range of borderline intellectual ability autism diagnosis documented in their records (range among 11 compared to black (28.4%; OR = 0.7; p<0.01) or Hispanic sites: 58% [Colorado] to 92% [Missouri]). Combining data (28.7%; OR = 0.7; p<0.01) children. When combining data from all 11 sites, 81% of boys had a previous ASD classification from these nine sites, the proportion of white children (56%) on record, compared with 75% of girls (OR = 1.4; p<0.01).

10 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries

When stratified by race/ethnicity, 80% of white children FIGURE 2. Most recent intelligence quotient score as of age 8 years among children with autism spectrum disorder for whom test data had a previously documented ASD classification, compared were available, by sex and race/ethnicity — Autism and Developmental with nearly 83% of black children (OR = 0.9; p = 0.09) and Disabilities Monitoring Network, nine sites,* United States, 2014 76% of Hispanic children (OR = 1.3; p<0.01); a significant 100 difference was also found when comparing the proportion of black children with a previous ASD classification to that among 90 Hispanic children (OR = 1.5; p<0.01). 80 The median age of earliest known ASD diagnosis 70 documented in children’s records (Table 5) varied by diagnostic subtype (autistic disorder: 46 months; ASD/PDD: 56 months; 60 Asperger disorder: 67 months). Within these subtypes, the 50 median age of earliest known diagnosis did not differ by sex,

Percentage 40 nor did any difference exist in the proportion of boys and girls who initially received a diagnosis of autistic disorder (48%), 30 ASD/PDD (46%), or Asperger disorder (6%). The median 20 age of earliest known diagnosis and distribution of subtypes did vary by site. The median age of earliest known ASD 10 diagnosis for all subtypes combined was 52 months, ranging 0 FMFMFMFM from 40 months in North Carolina to 59 months in Arkansas. White, Black, Hispanic Asian or non-Hispanic non-Hispanic Paci c Islander Special Education Eligibility Race/Ethnicity Sites with access to education records collected information Average or above average (IQ >85) Borderline range (IQ 71–85) on the most recent eligibility categories under which children Intellectually disabled range (IQ ≤70) received special education services (Table 6). Among children Abbreviations: ASD = autism spectrum disorder; F = female; IQ = intelligence with ASD who were receiving special education services quotient; M = male. in public schools during 2014, the proportion of children * Includes nine sites (Arizona, Arkansas, Colorado, Georgia, Maryland, Minnesota, New Jersey, North Carolina, and Tennessee) that had intellectual ability data with a primary eligibility category of autism ranged from available for ≥70 of children who met the ASD case definition (n = 3,714). approximately 37% in Wisconsin to 80% in Tennessee. Most other sites noted approximately 60% to 75% of children with ASD having autism listed as their most recent primary special to 5% higher in four sites (Colorado, Missouri, New Jersey, education eligibility category, the exceptions being Colorado and North Carolina), approximately 8% higher in Maryland, (44%) and New Jersey (48%). Other common special and nearly 20% higher in Arkansas and Tennessee, where education eligibilities included health or physical disability, investigators were able to access education records throughout speech and language impairment, specific learning disability, most, but not all, of the surveillance area and received data from and a general developmental delay category that is used until their state Department of Education to evaluate the potential age 9 years in many U.S. states. All ADDM sites reported <10% impact on reported ASD prevalence estimates attributed to of children with ASD receiving special education services under missing records. a primary eligibility category of ID. The impact on prevalence estimates of reviewing records based on an expanded list of ICD-9 codes varied from site to site. Colorado, Georgia, and Missouri were the only three Sensitivity Analyses of Missing Records sites that identified more than 1% of ASD surveillance cases and Expanded ICD-9 Codes partially or solely on the basis of the expanded code list. In A stratified analysis of records that could not be located for Missouri, less than 2% of children identified with ASD had review was completed to assess the degree to which missing some of their records located on the basis of the expanded data might have potentially reduced prevalence estimates as code list, and none were identified exclusively from these reported by individual ADDM sites. Had all children’s records codes. In Colorado, approximately 2% of ASD surveillance identified in Phase 1 been located and reviewed, prevalence cases had some abstracted records identified on the basis of estimates would potentially have been <1% higher in four sites the expanded code list, and 4% had records found exclusively (Arizona, Georgia, Minnesota, and Wisconsin), between 1% from the expanded codes. In Georgia, where ICD-9 codes were

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 11 Surveillance Summaries requested for surveillance of five distinct conditions (autism, DSM-5 as DSM-IV-TR. Children with documentation of cerebral palsy, ID, hearing loss, and vision impairment), eligibility for autism special education services, and those approximately 10% of children identified with ASD had some with a documented diagnosis of ASD by age 3 years, were of their records located on the basis of the expanded code list, 2% more likely to meet DSM-5 than DSM-IV-TR. Slightly and less than 1% were identified exclusively from these codes. over 3% of children whose earliest ASD diagnosis was autistic disorder met DSM-5 criteria but not DSM-IV-TR, compared Comparison of Case Counts from with slightly under 3% of those whose earliest diagnosis DSM-IV-TR and DSM-5 Case Definitions was PDD-NOS/ASD-NOS and 5% of those whose earliest diagnosis was Asperger disorder. Children with no previous The DSM-5 analysis was completed for part of the overall ASD classification (diagnosis or eligibility) were 47% less likely ADDM 2014 surveillance area (Table 7), representing a total to meet DSM-5 than DSM-IV-TR. Combining data from all population of 263,775 children aged 8 years. This was 81% 11 sites, children with IQ scores in the range of ID were 3% of the population on which DSM-IV-TR prevalence estimates less likely to meet DSM-5 criteria compared with DSM-IV-TR were reported. Within this population, 4,920 children were (kappa = 0.89), those with IQ scores in the borderline range confirmed to meet the ADDM Network ASD case definition were 6% less likely to meet DSM-5 than DSM-IV-TR (kappa for either DSM-IV-TR or DSM-5. Of these children, 4,236 = 0.88), and children with average or above average intellectual (86%) met both case definitions, 422 (9%) met only the ability were 4% less likely to meet DSM-5 criteria compared DSM-IV-TR criteria, and 262 (5%) met only the DSM-5 with DSM-IV-TR (kappa = 0.86). criteria (Table 8). This yielded a DSM-IV-TR:DSM-5 prevalence ratio of 1.04 in this population, indicating that ASD prevalence was approximately 4% higher based on the Discussion historical DSM-IV-TR case definition compared with the new DSM-5 case definition. Among 4,498 children who met Changes in Estimated Prevalence DSM-5 case criteria, 3,817 (85%) met the DSM-5 behavioral The overall ASD prevalence estimate of 16.8 per 1,000 criteria (Box 2), whereas 681 (15%) qualified on the basis of an children aged 8 years in 2014 is higher than previously established ASD diagnosis but did not have sufficient DSM-5 reported estimates from the ADDM Network. An ASD case behavioral criteria documented in comprehensive evaluations. definition based on DSM-IV-TR criteria was used during the In six of the 11 ADDM sites, DSM-5 case counts were within entire period of ADDM surveillance during 2000–2014, as approximately 5% of DSM-IV-TR counts (range: 5% lower were comparable study operations and procedures, although [Tennessee] to 5% higher [Arkansas]), whereas DSM-5 case the geographic areas under surveillance have varied over counts were more than 5% lower than DSM-IV-TR counts time. During this period, ADDM ASD prevalence estimates in Minnesota and North Carolina (6%), New Jersey (10%), increased from 6.7 to 16.8 per 1,000 children aged 8 years, and Colorado (14%). Kappa statistics indicated strong an increase of approximately 150%. agreement between DSM-IV-TR and DSM-5 case status Among the six ADDM sites completing both the 2012 among children abstracted in Phase 1 of the study who were and 2014 studies for the same geographic area, all six showed reviewed in Phase 2 for both DSM-IV-TR and DSM-5 (kappa higher ASD prevalence estimates for 2012 compared to 2014, for all sites combined: 0.85, range: 0.72 [Tennessee] to 0.93 with a nearly 10% higher prevalence in Georgia (p = 0.06) [North Carolina]). and Maryland (p = 0.35), 19% in New Jersey (p<0.01), 22% Stratified analysis of DSM-IV-TR:DSM-5 ratios were very in Missouri (p = 0.01), 29% in Colorado (p<0.01), and 31% similar compared with the overall sample (Table 9). DSM-5 in Wisconsin (p<0.01). When combining data from these six estimates were approximately 3% lower than DSM-IV-TR sites, ASD prevalence estimates for 2014 were 20% higher counts for males, and approximately 6% lower for females for 2014 compared to 2012 (p<0.01). The ASD prevalence (kappa = 0.85 for both). Case counts were approximately 3% estimate from New Jersey continues to be one of the highest lower among white and black children on DSM-5 compared reported by a population-based surveillance system. The two with DSM-IV-TR, 5% lower among Asian children, and 8% sites with the greatest relative difference in prevalence are lower among Hispanic children. Children who received a noteworthy in that both gained access to children’s education comprehensive evaluation by age 36 months were 7% less likely records in additional geographic areas for 2014. Colorado was to meet DSM-5 than DSM-IV-TR, whereas those evaluated granted access to review children’s education records in one by age 4 years were 6% less likely to meet DSM-5, and those additional county for the 2014 surveillance year (representing initially evaluated after age 4 years were just as likely to meet nearly 20% of the population aged 8 years within the overall

12 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries

Colorado surveillance area), and Wisconsin was granted Variation in Prevalence Among access to review education records for more than a quarter of ADDM Sites its surveillance population, and 2014 marked the first time Wisconsin has included education data sources. Comparisons Findings from the 2014 surveillance year indicate that with earlier ADDM Network surveillance results should be prevalence estimates still vary widely among ADDM Network interpreted cautiously because of changing composition of sites, with the highest prevalence observed in New Jersey. sites and geographic coverage over time. For example, three Although five of the 11 ADDM sites conducting the 2014 ADDM Network sites completing both the 2012 and 2014 surveillance year reported prevalence estimates within a very surveillance years (Arizona, Arkansas, and North Carolina) close range (from 13.1 to 14.1 per 1,000 children), New covered a different geographic area each year, and two new sites Jersey’s prevalence estimate of 29.4 per 1,000 children was (Minnesota and Tennessee) were awarded funding to monitor significantly greater than that from any other site, and four sites ASD in collaboration with the ADDM Network. (Georgia, Maryland, Minnesota, and North Carolina) reported Certain characteristics of children with ASD were similar in prevalence estimates that were significantly greater than those 2014 compared with earlier surveillance years. The median age from any of the five sites in the 13.1–14.1 per 1,000 range. of earliest known ASD diagnosis remained close to 53 months Two of the sites with prevalence estimates of 20.0 per 1,000 in previous surveillance years and was 52 months in 2014. or higher (Maryland and Minnesota) conducted surveillance The proportion of children who received a comprehensive among a total population of <10,000 children aged 8 years. developmental evaluation by age 3 years was unchanged: Concentrating surveillance efforts in smaller geographic areas, 42% in 2014 and 43% during 2006–2012. There were a especially those in close proximity to diagnostic centers and number of differences in the characteristics of the population those covering school districts with advanced staff training and of children with ASD in 2014. The male:female prevalence programs to support children with ASD, might yield higher ratio decreased from 4.5:1 during 2002–2012 to 4:1 in 2014, prevalence estimates compared with those from sites covering driven by a greater relative increase in ASD prevalence among populations of more than 20,000 children aged 8 years. Of the girls than among boys since 2012. Also, the decrease in the six sites with prevalence estimates below the 16.8 per 1,000 ratios of white:black and white:Hispanic children with ASD estimate for all sites combined, five did not have full access continued a trend observed since 2002. Among sites covering to education data sources (Arkansas, Colorado, Missouri, a population of at least 20,000 children aged 8 years, New Tennessee, and Wisconsin), whereas only one of the six sites Jersey reported no significant race- or ethnicity-based difference will full access to education data sources had a prevalence in ASD prevalence, suggesting more complete ascertainment estimate below 16.8 per 1,000 (Arizona). Such differences among all children regardless of race/ethnicity. Historically, cannot be attributed solely to source access, as other factors ASD prevalence estimates from combined ADDM sites have (e.g., demographic differences and service availability) also been approximately 20%–30% higher among white children might have influenced these findings. In addition to variation as compared with black children. For surveillance year 2014, among sites in reported ASD prevalence, wide variation among the difference was only 7%, the lowest difference ever observed sites is noted in the characteristics of children identified with for the ADDM Network. Likewise, prevalence among white ASD, including the proportion of children who received children was almost 70% higher than that among Hispanic a comprehensive developmental evaluation by age 3 years, children in 2002 and 2006, and approximately 50% higher the median age of earliest known ASD diagnosis, and the in 2008, 2010, and 2012, whereas for 2014 the difference distribution by intellectual ability. Some of this variation might was only 22%. Data from a previously reported comparison be attributable to regional differences in diagnostic practices of ADDM Network ASD prevalence estimates from 2002, and other documentation of autism symptoms, although 2006, and 2008 (9) suggested greater increases in ASD previous reports based on ADDM data have linked much of prevalence among black and Hispanic children compared the variation to other extrinsic factors, such as regional and with those among white children. Reductions in disparities socioeconomic disparities in access to services (13,14). in ASD prevalence for black and Hispanic children might be attributable, in part, to more effective outreach directed Case Definitions to minority communities. Finally, the proportion of children Results from application of the DSM-IV-TR and DSM-5 with ASD and lower intellectual ability was similar in 2012 case definitions were similar, overall and when stratified by and 2014 at approximately 30% of males and 35% of females. sex, race/ethnicity, DSM-IV-TR diagnostic subtype, or level These proportions were markedly lower than those reported of intellectual ability. Overall, ASD prevalence estimates in previous surveillance years.

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 13 Surveillance Summaries based on the new DSM-5 case definition were very similar in rather than relying entirely on parent or caregiver report of a magnitude but slightly lower than those based on the historical previous ASD diagnosis, providing a unique contribution to DSM-IV-TR case definition. Three of the 11 ADDM sites the knowledge of ASD epidemiology and the impact of changes had slightly higher case counts using the DSM-5 framework in diagnostic criteria. Two surveys of children’s health, The compared with the DSM-IV-TR. Colorado, where the DSM- National Health Interview Survey (NHIS) and the National IV-TR:DSM-5 ratio was highest compared with all other sites, Survey of Children’s Health (NSCH), report estimates of ASD was also the site with the lowest proportion of DSM-IV-TR prevalence based on caregiver report of being told by a doctor cases having a previous ASD classification. This suggests that or other health care provider that their child has ASD, and, for the diagnostic component of the DSM-5 case definition, the NSCH, if their child was also reported to currently have whereby children with a documented diagnosis of ASD ASD. The most recent publication from NHIS indicated that might qualify as DSM-5 cases regardless of social interaction/ 27.6 per 1,000 children aged 3–17 years had ASD in 2016, communication and restricted/repetitive behavioral criteria, which did not differ significantly from estimates for 2015 or might have influenced DSM-5 results to a lesser degree in 2014 (24.1 and 22.4, respectively) (28). An estimate of 20.0 that site, as a smaller proportion of DSM-IV-TR cases would per 1,000 children aged 6–17 years was reported from the meet DSM-5 case criteria based solely on the presence of a 2011–2012 NSCH (29). The study samples for both surveys documented ASD diagnosis. This element of the DSM-5 are substantially smaller than the ADDM Network; however, case definition might carry less weight moving forward, as they were intended to be nationally representative, whereas fewer children aged 8 years in health and education settings the ADDM Network surveillance areas were selected through will have had ASD diagnosed under the DSM-IV-TR criteria. a competitive process and, although large and diverse, were It is also possible that persons who conduct developmental not intended to be nationally representative. Geographic evaluations of children in health and education settings will differences in ASD prevalence have been observed in both the increasingly describe behavioral characteristics using language ADDM Network and national surveys, as have differences in more consistent with DSM-5 terminology, yielding more ASD ASD prevalence by age (6–11,28,29). cases based on the behavioral component of ADDM’s DSM-5 All three prevalence estimation systems (NHIS, NSCH, case definition. Prevalence estimates based on the DSM-5 case and ADDM) are subject to regional and policy-driven definition that incorporates an existing ASD diagnosis reflect differences in the availability and utilization of evaluation the actual patterns of diagnosis and services for children in and diagnostic services for children with developmental 2014, because children diagnosed under DSM-IV-TR did not concerns. Phone surveys are likely more sensitive in identifying lose their diagnosis when the updated DSM-5 criteria were children who received a preliminary or confirmed diagnosis published and because professionals might diagnose children of ASD but are not receiving services (i.e., special education with ASD without necessarily recording every behavior services). The ADDM Network method based on analysis of supporting that diagnosis. In the future, prevalence estimates information contained in existing health and education records will align more closely with the specific DSM-5 behavioral enables the collection of detailed, case-specific information criteria, and might exclude some persons who would have reflecting children’s behavioral, developmental and functional met DSM-IV-TR criteria for autistic disorder, PDD-NOS, or characteristics, which are not available from the national phone Asperger disorder, while at the same time including persons surveys. This detailed case level information might provide who do not meet those criteria but who do meet the specific insight into temporal changes in the expression of ASD DSM-5 behavioral criteria. phenotypes, and offers the ability to account for differences based on changing diagnostic criteria. Comparison of Autism Prevalence Estimates Limitations The ADDM Network is the only ASD surveillance system The findings in this report are subject to at least three in the United States providing robust prevalence estimates for limitations. First, ADDM Network sites were not selected to specific areas of the country, including those for subgroups represent the United States as a whole, nor were the geographic defined by sex and race/ethnicity, providing information about areas within each ADDM site selected to represent that state geographical variation that can be used to evaluate policies as a whole (with the exception of Arkansas, where ASD is and diagnostic practices that might affect ASD prevalence. monitored statewide). Although a combined estimate is It is also the only comprehensive surveillance system to reported for the Network as a whole to inform stakeholders incorporate ASD diagnostic criteria into the case definition

14 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries and interpret the findings from individual surveillance years in Future Surveillance Directions a more general context, data reported by the ADDM Network should not be interpreted to represent a national estimate of Data collection for the 2016 surveillance year began in early the number and characteristics of children with ASD. Rather, 2017 and will continue through mid-2019. Beginning with it is more prudent to examine the wide variation among sites, surveillance year 2016, the DSM-5 case definition for ASD will between specific groups within sites, and across time in the serve as the basis for prevalence estimates. The DSM-IV-TR number and characteristics of children identified with ASD, case definition will be applied in a limited geographic area and to use these findings to inform public health strategies to offer additional data for comparison, although the DSM- aimed at removing barriers to identification and treatment, IV-TR case definition will eventually be phased out. and eliminating disparities among socioeconomic and racial/ CDC’s “Learn the Signs. Act Early” (LTSAE) campaign, ethnic groups. Data from individual sites provide even greater launched in October 2004, aims to change perceptions among utility for developing local policies in those states. parents, health care professionals, and early educators regarding Second, it is important to acknowledge limitations of the importance of early identification and treatment of autism 30 information available in children’s health and education records and other developmental disorders ( ). In 2007, the American when considering data on the characteristics of children with Academy of Pediatrics (AAP) recommended developmental ASD. Age of earliest known ASD diagnosis was obtained from screening specifically focused on social development and ASD 31 descriptions in children’s developmental evaluations that were at age 18 and 24 months ( ). Both efforts are in accordance Healthy People 2020 available in the health and education facilities where ADDM with the (HP2020) goal that children staff had access to review records. Some children might have with ASD be evaluated by age 36 months and begin receiving 12 had earlier diagnoses that were not recorded in these records. community-based support and services by age 48 months ( ). Likewise, some descriptions of historical diagnoses (i.e., those It is concerning that progress has not been made toward the not made by the evaluating examiner) could be subject to HP2020 goal of increasing the percentage of children with recall error by a parent or provider who described the historical ASD who receive a first evaluation by age 36 months to 47%; diagnosis to that examiner. Another characteristic featured however, the cohort of children monitored under the ADDM prominently in this report, intellectual ability, is subject to 2014 surveillance year (i.e., children born in 2006) represents measurement limitations. IQ test results should be interpreted the first ADDM 8-year-old cohort impacted by the LTSAE cautiously because of myriad factors that impact performance campaign and the 2007 AAP recommendations. The effect of on these tests, particularly language and attention deficits that these programs in lowering age at evaluation might become are common among children with ASD, especially when testing more apparent when subsequent birth cohorts are monitored. was conducted before age 6 years. Because children were not Further exploration of ADDM data, including those collected 32 examined directly nor systematically by ADDM staff as part on cohorts of children aged 4 years ( ), might inform how of this study, descriptions of their characteristics should not be policy initiatives, such as screening recommendations and other interpreted to serve as the basis for policy changes, individual social determinants of health, impact the prevalence of ASD treatments, or interventions. and characteristics of children with ASD, including the age at Third, because comparisons with the results from earlier which most children receive an ASD diagnosis. ADDM surveillance years were not restricted to a common geographic area, inferences about the changing number and characteristics of children with ASD over time should be Conclusion made with caution. Findings for each unique ADDM birth The latest findings from the ADDM Network provide cohort are very informative, and although study methods evidence that the prevalence of ASD is higher than previously and geographic areas of coverage have remained generally reported ADDM estimates and continues to vary among consistent over time, temporal comparisons are subject to certain racial/ethnic groups and communities. The overall multiple sources of bias and should not be misinterpreted as ASD prevalence estimate of 16.8 per 1,000 children aged representing precise measures that control for all sources of 8 years in 2014 is higher than previous estimates from the bias. Additional limitations to the records-based surveillance ADDM Network. With prevalence of ASD reaching nearly 3% methodology have been described extensively in previous in some communities and representing an increase of 150% ADDM and MADDSP reports (3,6–11). since 2000, ASD is an urgent public health concern that could benefit from enhanced strategies to help identify ASD earlier; to determine possible risk factors; and to address the growing

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 15 Surveillance Summaries behavioral, educational, residential and occupational needs of Chapel Hill; John Tapp, Vanderbilt University Medical Center, this population. Nashville, Tennessee; Nina Boss, Chuck Goehler, University of Implementation of the new DSM-5 case definition had Wisconsin, Madison. little effect on the overall number of children identified with Clinician review activities were guided by Lisa Wiggins, ASD for the ADDM 2014 surveillance year. This might be a PhD, Monica Dirienzo, MS, National Center on Birth Defects and Developmental Disabilities, CDC. Formative work on result of including documented ASD diagnoses in the DSM-5 operationalizing clinician review coding for the DSM-5 case surveillance case definition. Over time, the estimate might be definition was guided by Laura Carpenter, PhD, Medical University influenced (downward) by a diminishing number of persons of South Carolina, Charleston; and Catherine Rice, PhD, Emory who meet the DSM-5 diagnostic criteria for ASD based University, Atlanta, Georgia. solely on a previous DSM-IV-TR diagnosis, such as autistic Additional assistance was provided by project staff including disorder, PDD-NOS or Asperger disorder, and influenced data abstractors, epidemiologists, and others. Ongoing ADDM (upward) by professionals aligning their clinical descriptions Network support was provided by Anita Washington, MPH, Bruce with the DSM-5 criteria. Although the prevalence of ASD and Heath, Tineka Yowe-Conley, National Center on Birth Defects and characteristics of children identified by each case definition Developmental Disabilities, CDC; Ann Ussery-Hall, National Center were similar in 2014, the diagnostic features defined under for Chronic Disease Prevention and Health Promotion, CDC. DSM-IV-TR and DSM-5 appear to be quite different. The References ADDM Network will continue to evaluate these similarities 1. American Psychiatric Association. Diagnostic and statistical manual and differences in much greater depth, and will examine at of mental disorders. 5th ed. Arlington, VA: American Psychiatric least one more cohort of children aged 8 years to expand this Association; 2013. comparison. Over time, the ADDM Network will be well 2. Bertrand J, Mars A, Boyle C, Bove F, Yeargin-Allsopp M, Decoufle P. Prevalence of autism in a United States population: the Brick Township, positioned to evaluate the effects of changing ASD diagnostic New Jersey, investigation. Pediatrics 2001;108:1155–61. https://doi. parameters on prevalence. org/10.1542/peds.108.5.1155 3. Yeargin-Allsopp M, Rice C, Karapurkar T, Doernberg N, Boyle C, Acknowledgments Murphy C. Prevalence of autism in a US metropolitan area. JAMA 2003;289:49–55. https://doi.org/10.1001/jama.289.1.49 Data collection was guided by Lisa Martin, National Center 4. GovTrack H.R. 4365—106th Congress. Children’s Health Act of 2000. on Birth Defects and Developmental Disabilities, CDC, and Washington, DC: GovTrack; 2000. https://www.govtrack.us/congress/ coordinated at each site by Kristen Clancy Mancilla, University bills/106hr4365 of Arizona, Tucson; Allison Hudson, University of Arkansas for 5. Rice CE, Baio J, Van Naarden Braun K, Doernberg N, Meaney FJ, Medical Sciences, Little Rock; Kelly Kast, MSPH, Leovi Madera, Kirby RS; ADDM Network. A public health collaboration for the surveillance of autism spectrum disorders. Paediatr Perinat Epidemiol Colorado Department of Public Health and Environment, 2007;21:179–90. https://doi.org/10.1111/j.1365-3016.2007.00801.x Denver; Margaret Huston, Ann Chang, Johns Hopkins University, 6. Autism and Developmental Disabilities Monitoring Network Baltimore, Maryland; Libby Hallas-Muchow, MS, Kristin Hamre, Surveillance Year 2000 Principal Investigators. Prevalence of autism MS, University of Minnesota, Minneapolis; Rob Fitzgerald, PhD, spectrum disorders—Autism and Developmental Disabilities Monitoring Washington University in St. Louis, Missouri; Josephine Shenouda, Network, six sites, United States, 2000. MMWR Surveill Summ 2007;56(No. SS-1):1–11. MS, Rutgers University, Newark, New Jersey; Julie Rusyniak and 7. Autism and Developmental Disabilities Monitoring Network Paula Bell, University of North Carolina, Chapel Hill; Alison Vehorn, Surveillance Year 2002 Principal Investigators. Prevalence of autism MS, Vanderbilt University Medical Center, Nashville, Tennessee; spectrum disorders—Autism and Developmental Disabilities Monitoring Pamela Imm, MS, University of Wisconsin, Madison; and Lisa Network, 14 sites, United States, 2002. MMWR Surveill Summ Martin and Monica Dirienzo, MS, National Center on Birth Defects 2007;56(No. SS-1):12–28. 8. Autism and Developmental Disabilities Monitoring Network and Developmental Disabilities, CDC. Surveillance Year 2006 Principal Investigators. Prevalence of autism Data management/programming support was guided by Susan spectrum disorders—Autism and Developmental Disabilities Williams, National Center on Birth Defects and Developmental Monitoring Network, United States, 2006. MMWR Surveill Summ Disabilities, CDC; with additional oversight by Marion Jeffries, Eric 2009;58(No. SS-10):1–20. Augustus, Maximus/Acentia, Atlanta, Georgia, and was coordinated 9. Autism and Developmental Disabilities Monitoring Network Surveillance Year 2008 Principal Investigators. Prevalence of autism at each site by Scott Magee, University of Arkansas for Medical spectrum disorders—Autism and Developmental Disabilities Monitoring Sciences, Little Rock; Marnee Dearman, University of Arizona, Network, 14 sites, United States, 2008. MMWR Surveill Summ Tucson; Bill Vertrees, Colorado Department of Public Health and 2012;61(No. SS-3):1–19. Environment, Denver; Michael Sellers, Johns Hopkins University, 10. Autism and Developmental Disabilities Monitoring Network Baltimore, Maryland; John Westerman, University of Minnesota, Surveillance Year 2010 Principal Investigators. Prevalence of autism spectrum disorder among children aged eight years—Autism and Minneapolis; Rob Fitzgerald, PhD, Washington University in Developmental Disabilities Monitoring Network, 11 sites, United States, St. Louis, Missouri; Paul Zumoff, PhD, Rutgers University, 2010. MMWR Surveill Summ 2014;63(No. SS-2). Newark, New Jersey; Deanna Caruso, University of North Carolina,

16 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries

11. Christensen DL, Baio J, Van Naarden Braun K, et al. Prevalence 23. Hartley-McAndrew M, Mertz J, Hoffman M, Crawford D. Rates of and characteristics of autism spectrum disorder among children aged autism spectrum disorder diagnosis under the DSM-5 criteria compared eight years—Autism and Developmental Disabilities Monitoring to DSM-IV-TR criteria in a hospital-based clinic. Pediatr Neurol Network, 11 sites, United States, 2012. MMWR Surveill Summ 2016;57:34–8. https://doi.org/10.1016/j.pediatrneurol.2016.01.012 2016;65(No. SS-3):1–23. https://doi.org/10.15585/mmwr.ss6503a1 24. Yeargin-Allsopp M, Murphy CC, Oakley GP, Sikes RK. A multiple- 12. US Department of Health and Human Services. Healthy people 2020. source method for studying the prevalence of developmental disabilities Washington, DC: US Department of Health and Human Services; 2010. in children: the Metropolitan Atlanta Developmental Disabilities Study. https://www.healthypeople.gov Pediatrics 1992;89:624–30. 13. Jarquin VG, Wiggins LD, Schieve LA, Van Naarden-Braun K. Racial 25. US Department of Health and Human Services. Code of Federal disparities in community identification of autism spectrum disorders over Regulations. Title 45. Public Welfare CFR 46. Washington, DC: US time; Metropolitan Atlanta, Georgia, 2000–2006. J Dev Behav Pediatr Department of Health and Human Services; 2010. https://www.hhs. 2011;32:179–87. https://doi.org/10.1097/DBP.0b013e31820b4260 gov/ohrp/regulations-and-policy/regulations/45-cfr-46/index.html 14. Durkin MS, Maenner MJ, Meaney FJ, et al. Socioeconomic inequality in 26. CDC. Vintage 2016 bridged-race postcensal population estimates for the prevalence of autism spectrum disorder: evidence from a U.S. cross- April 1, 2010, July 1, 2010–July 1, 2016, by year, county, single-year sectional study. PLoS One 2010;5:e11551. https://doi.org/10.1371/ of age (0 to 85+ years), bridged-race, Hispanic origin, and sex. https:// journal.pone.0011551 www.cdc.gov/nchs/nvss/bridged_race.htm 15. Durkin MS, Maenner MJ, Baio J, et al. Autism spectrum disorder among 27. US Department of Education. Common core of data: a program of the US children (2002–2010): socioeconomic, racial, and ethnic disparities. U.S. Department of Education’s National Center for Education Statistics. Am J Public Health 2017;107:1818–26. https://doi.org/10.2105/ Washington, DC: US Department of Education; 2017. https://nces. AJPH.2017.304032 ed.gov/ccd/elsi/tableGenerator.aspx 16. Newschaffer CJ. Trends in autism spectrum disorders: the interaction 28. Zablotsky B, Black LI, Blumberg SJ. Estimated prevalence of children of time, group-level socioeconomic status, and individual-level with diagnosed developmental disabilities in the United States, 2014– race/ethnicity. Am J Public Health 2017;107:1698–9. https://doi. 2016. NCHS Data Brief, no 291. Hyattsville, MD: National Center org/10.2105/AJPH.2017.304085 for Health Statistics, 2017. 17. American Psychiatric Association. Diagnostic and statistical manual of 29. Blumberg SJ, Bramlett MD, Kogan MD, Schieve LA, Jones JR, Lu MC. mental disorders. 4th ed. Text revision. Washington, DC: American Changes in prevalence of parent-reported autism spectrum disorder Psychiatric Association; 2000. in school-aged U.S. children: 2007 to 2011–2012. National Health 18. Swedo SE, Baird G, Cook EH Jr, et al. Commentary from the DSM-5 Statistics Reports; no 65. Hyattsville, MD: National Center for Health Workgroup on Neurodevelopmental Disorders. J Am Acad Child Adolesc Statistics, 2013. Psychiatry 2012;51:347–9. https://doi.org/10.1016/j.jaac.2012.02.013 30. Daniel KL, Prue C, Taylor MK, Thomas J, Scales M. ‘Learn the signs. 19. Maenner MJ, Rice CE, Arneson CL, et al. Potential impact of Act early’: a campaign to help every child reach his or her full potential. DSM-5 criteria on autism spectrum disorder prevalence estimates. Public Health 2009;123(Suppl 1):e11–6. https://doi.org/10.1016/j. JAMA Psychiatry 2014;71:292–300. https://doi.org/10.1001/ puhe.2009.06.002 jamapsychiatry.2013.3893 31. Johnson CP, Myers SM; American Academy of Pediatrics Council on 20. Mehling MH, Tassé MJ. Severity of autism spectrum disorders: current Children With Disabilities. Identification and evaluation of children with conceptualization, and transition to DSM-5. J Autism Dev Disord autism spectrum disorders. Pediatrics 2007;120:1183–215. https://doi. 2016;46:2000–16. https://doi.org/10.1007/s10803-016-2731-7 org/10.1542/peds.2007-2361 21. Mazurek MO, Lu F, Symecko H, et al. A prospective study of the 32. Christensen DL, Bilder DA, Zahorodny W, et al. Prevalence and concordance of DSM-IV-TR and DSM-5 diagnostic criteria for autism characteristics of autism spectrum disorder among 4-year-old spectrum disorder. J Autism Dev Disord 2017;47:2783–94. https://doi. children in the Autism and Developmental Disabilities Monitoring org/10.1007/s10803-017-3200-7 Network. J Dev Behav Pediatr 2016;37:1–8. https://doi.org/10.1097/ 22. Yaylaci F, Miral S. A comparison of DSM-IV-TR and DSM-5 diagnostic DBP.0000000000000235 classifications in the clinical diagnosis of autistic spectrum disorder. J Autism Dev Disord 2017;47:101–9. https://doi.org/10.1007/ s10803-016-2937-8

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 17 Surveillance Summaries

TABLE 1. Number* and percentage of children aged 8 years, by race/ethnicity and site — Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2014 Asian or American Indian White, Black, Pacific Islander, or Alaska Native, Total non-Hispanic non-Hispanic Hispanic non-Hispanic non-Hispanic Site Site institution Surveillance area No. No. (%) No. (%) No. (%) No. (%) No. (%) Arizona University of Part of 1 county in 24,952 12,308 (49.3) 1,336 (5.4) 9,792 (39.2) 975 (3.9) 541 (2.2) Arizona metropolitan Phoenix† Arkansas University of All 75 counties in 39,992 26,103 (65.3) 7,705 (19.3) 5,012 (12.5) 843 (2.1) 329 (0.8) Arkansas for Arkansas Medical Sciences Colorado Colorado 7 counties in 41,128 22,410 (54.5) 2,724 (6.6) 13,735 (33.4) 2,031 (4.9) 228 (0.6) Department of metropolitan Public Health and Denver Environment Georgia CDC 5 counties 51,161 15,495 (30.3) 22,042 (43.1) 9,913 (19.4) 3,599 (7.0) 112 (0.2) including metropolitan Atlanta Maryland Johns Hopkins 1 county in 9,955 4,977 (50.0) 3,399 (34.1) 829 (8.3) 719 (7.2) 31 (0.3) University metropolitan Baltimore Minnesota University of Parts of 2 counties 9,767 3,793 (38.8) 2,719 (27.8) 1,486 (15.2) 1,576 (16.1) 193 (2.0) Minnesota including Minneapolis– St. Paul† Missouri Washington 5 counties 25,333 16,529 (65.2) 6,577 (26.0) 1,220 (4.8) 931 (3.7) 76 (0.3) University including metropolitan St. Louis New Jersey Rutgers University 4 counties 32,935 13,593 (41.3) 7,166 (21.8) 10,226 (31.0) 1,874 (5.7) 76 (0.2) including metropolitan Newark North Carolina University of 6 counties in 30,283 15,241 (50.3) 7,701 (25.4) 5,463 (18.0) 1,778 (5.9) 100 (0.3) North Carolina– central Chapel Hill North Carolina Tennessee Vanderbilt 11 counties in 24,940 15,867 (63.6) 4,896 (19.6) 3,324 (13.3) 799 (3.2) 54 (0.2) University Medical middle Center Tennessee Wisconsin University of 10 counties in 35,037 20,732 (59.2) 6,486 (18.5) 6,181 (17.6) 1,471 (4.2) 167 (0.5) Wisconsin– southeastern Madison Wisconsin All sites combined 325,483 167,048 (51.3) 72,751 (22.4) 67,181 (20.6) 16,596 (5.1) 1,907 (0.6) * Total numbers of children aged 8 years in each surveillance area were obtained from CDC’s National Center for Health Statistics Vintage 2016 Bridged-Race Population Estimates for July 1, 2014. † Denominator excludes school districts that were not included in the surveillance area, calculated from National Center for Education Statistics enrollment counts of third graders during the 2014–2015 school year.

18 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries

TABLE 2. Estimated prevalence* of autism spectrum disorder among children aged 8 years, by sex — Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2014 Sex Overall† Males Females Total Total no. Male-to-female Site population with ASD Prevalence 95% CI Prevalence 95% CI Prevalence 95% CI prevalence ratio§ Arizona 24,952 349 14.0 (12.6–15.5) 21.1 (18.7–23.8) 6.6 (5.3–8.2) 3.2 Arkansas 39,992 522 13.1 (12.0–14.2) 20.5 (18.6–22.5) 5.4 (4.5–6.5) 3.8 Colorado 41,128 572 13.9 (12.8–15.1) 21.8 (19.9–23.9) 5.5 (4.6–6.7) 3.9 Georgia 51,161 869 17.0 (15.9–18.2) 27.9 (25.9–30.0) 5.7 (4.8–6.7) 4.9 Maryland 9,955 199 20.0 (17.4–23.0) 32.7 (28.1–38.2) 7.2 (5.2–10.0) 4.5 Minnesota 9,767 234 24.0 (21.1–27.2) 39.0 (33.8–44.9) 8.5 (6.3–11.6) 4.6 Missouri 25,333 356 14.1 (12.7–15.6) 22.2 (19.8–25.0) 5.6 (4.4–7.0) 4.0 New Jersey 32,935 964 29.3 (27.5–31.2) 45.5 (42.4–48.9) 12.3 (10.7–14.1) 3.7 North Carolina 30,283 527 17.4 (16.0–19.0) 28.0 (25.5–30.8) 6.5 (5.3–7.9) 4.3 Tennessee 24,940 387 15.5 (14.0–17.1) 25.3 (22.6–28.2) 5.4 (4.2–6.9) 4.7 Wisconsin 35,037 494 14.1 (12.9–15.4) 21.4 (19.4–23.7) 6.4 (5.3–7.7) 3.4 All sites combined 325,483 5,473 16.8 (16.4–17.3) 26.6 (25.8–27.4) 6.6 (6.2–7.0) 4.0 Abbreviations: ASD = autism spectrum disorder; CI = confidence interval. * Per 1,000 children aged 8 years. † All children are included in the total regardless of race or ethnicity. § All sites identified significantly higher prevalence among males compared with females (p<0.01).

TABLE 3. Estimated prevalence* of autism spectrum disorder among children aged 8 years, by race/ethnicity — Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2014 Race/Ethnicity Prevalence ratio White Black Hispanic Asian/Pacific Islander White-to- White-to- Black-to- Site Prevalence 95% CI Prevalence 95% CI Prevalence 95% CI Prevalence 95% CI Black Hispanic Hispanic Arizona 16.2 (14.1–18.6) 19.5 (13.3–28.6) 10.3 (8.5–12.5) 10.3 (5.5–19.1) 0.8 1.6§ 1.9§ Arkansas 13.9 (12.6–15.5) 10.4 (8.3–12.9) 8.4 (6.2–11.3) 14.2 (8.1–25.1) 1.3† 1.7§ 1.2 Colorado 15.0 (13.5–16.7) 11.4 (8.0–16.2) 10.6 (9.0–12.5) 7.9 (4.8–12.9) 1.3 1.4§ 1.1 Georgia 17.9 (16.0–20.2) 17.1 (15.4–18.9) 12.6 (10.6–15.0) 11.9 (8.9–16.1) 1.1 1.4§ 1.4§ Maryland 19.5 (16.0–23.8) 16.5 (12.7–21.4) 15.7 (9.1–27.0) 13.9 (7.5–25.8) 1.2 1.2 1.1 Minnesota 24.3 (19.8–29.8) 27.2 (21.7–34.2) 20.9 (14.7–29.7) 17.8 (12.3–25.7) 0.9 1.2 1.3 Missouri 14.1 (12.4–16.0) 10.8 (8.6–13.6) 4.9 (2.2–10.9) 10.7 (5.8–20.0) 1.3† 2.9† 2.2 New Jersey 30.2 (27.4–33.3) 26.8 (23.3–30.9) 29.3 (26.2–32.9) 19.2 (13.9–26.6) 1.1 1.0 0.9 North Carolina 18.6 (16.5–20.9) 16.1 (13.5–19.2) 11.9 (9.3–15.2) 19.1 (13.7–26.8) 1.2 1.6§ 1.4† Tennessee 16.1 (14.3–18.2) 12.5 (9.7–16.0) 10.5 (7.6–14.7) 12.5 (6.7–23.3) 1.3 1.5† 1.2 Wisconsin 15.2 (13.6–17.0) 11.3 (8.9–14.2) 12.5 (10.0–15.6) 10.2 (6.1–16.9) 1.3† 1.2 0.9 All sites 17.2 (16.5–17.8) 16.0 (15.1–16.9) 14.0 (13.1–14.9) 13.5 (11.8–15.4) 1.1† 1.2§ 1.1§ combined Abbreviation: CI = confidence interval. * Per 1,000 children aged 8 years. † Pearson chi-square test of prevalence ratio significant at p<0.05. § Pearson chi-square test of prevalence ratio significant at p<0.01.

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 19 Surveillance Summaries

TABLE 4. Number and percentage of children aged 8 years* identified with autism spectrum disorder who received a comprehensive evaluation by a qualified professional at age ≤36 months, 37–48 months, or >48 months, and those with a mention of general delay concern by age 36 months — Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2014 Mention of Earliest age when child received a comprehensive evaluation general developmental delay ≤36 mos 37–48 mos >48 mos ≤36 mos Site No. (%) No. (%) No. (%) No. (%) Arizona 87 (34.1) 56 (22.0) 112 (43.9) 240 (94.1) Arkansas 117 (30.5) 98 (25.6) 168 (43.9) 354 (92.4) Colorado 200 (46.4) 66 (15.3) 165 (38.3) 383 (88.9) Georgia 240 (37.6) 126 (19.7) 273 (42.7) 549 (85.9) Maryland 96 (56.1) 19 (11.1) 56 (32.7) 158 (92.4) Minnesota 57 (33.5) 36 (21.2) 77 (45.3) 124 (72.9) Missouri 88 (32.1) 39 (14.2) 147 (53.6) 196 (71.5) New Jersey 318 (40.5) 174 (22.2) 293 (37.3) 645 (82.2) North Carolina 260 (66.2) 42 (10.7) 91 (23.2) 364 (92.6) Tennessee 80 (34.0) 47 (20.0) 108 (46.0) 144 (61.3) Wisconsin 194 (47.2) 87 (21.2) 130 (31.6) 368 (89.5) All sites combined 1,737 (41.9) 790 (19.0) 1,620 (39.1) 3,525 (85.0) * Includes children identified with autism spectrum disorder who were linked to an in-state birth certificate.

TABLE 5. Median age (in months) of earliest known autism spectrum disorder diagnosis and number and proportion within each diagnostic subtype — Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2014 Autistic disorder ASD/PDD Asperger disorder Any specified ASD diagnosis Site Median age No. (%) Median age No. (%) Median age No. (%) Median age No. (%) Arizona 55 186 (76.2) 61 50 (20.5) 74 8 (3.3) 56 244 (69.9) Arkansas 55 269 (63.0) 63 129 (30.2) 75 29 (6.8) 59 427 (81.8) Colorado 40 192 (61.7) 65 104 (33.4) 61 15 (4.8) 51 311 (54.4) Georgia 46 288 (48.1) 56 261 (43.6) 65 50 (8.3) 53 599 (68.9) Maryland 43 52 (32.3) 61 104 (64.6) 65 5 (3.1) 52 161 (80.9) Minnesota 51 50 (45.9) 65 54 (49.5) 62 5 (4.6) 56 109 (46.6) Missouri 54 81 (26.7) 55 197 (65.0) 65 25 (8.3) 56 303 (85.1) New Jersey 42 227 (32.7) 51 428 (61.6) 66 40 (5.8) 48 695 (72.1) North Carolina 32 165 (52.5) 49 130 (41.4) 67 19 (6.1) 40 314 (59.6) Tennessee 51 157 (57.1) 63 100 (36.4) 60 18 (6.5) 56 275 (71.1) Wisconsin 46 143 (40.2) 55 189 (53.1) 67 24 (6.7) 51 356 (72.1) All sites combined 46 1,810 (47.7) 56 1,746 (46.0) 67 238 (6.3) 52 3,794 (69.3) Abbreviations: ASD = autism spectrum disorder; PDD = pervasive developmental disorder–not otherwise specified.

20 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries

TABLE 6. Number and percentage of children aged 8 years identified with autism spectrum disorder with available special education records, by primary special education eligibility category* — Autism and Developmental Disabilities Monitoring Network, 10 sites, United States, 2014 Characteristic Arizona Arkansas Colorado Georgia Maryland Minnesota New Jersey North Carolina Tennessee Wisconsin Total no. of ASD cases 349 522 572 869 199 234 964 527 387 494 Total no. (%) of ASD cases with 308 (88.3) 327† (—§) 139† (—§) 708 (81.5) 149 (74.9) 188 (80.3) 822 (85.3) 420 (79.7) 218† (—§) 156† (—§) special education records Primary exceptionality (%) Autism 64.9 65.4 43.9 58.9 67.1 67.0 48.4 75.0 79.8 36.5 Emotional disturbance 2.9 0.9 7.2 2.0 2.7 3.7 1.6 2.6 0.5 5.8 Specific learning disability 6.8 3.7 13.7 4.0 12.8 1.1 8.2 2.9 0.9 2.6 Speech or language impairment 5.5 8.9 10.8 1.0 3.4 2.7 13.7 2.4 3.2 20.5 Hearing or visual impairment 0 0.3 0 0.1 0 1.1 0.6 0.5 0 0.6 Health, physical or other disability 6.8 13.5 14.4 3.5 8.1 15.4 18.5 11.2 3.2 14.7 Multiple disabilities 0.3 3.4 5.0 0 4.0 1.6 6.7 1.7 0 0 Intellectual disability 3.2 4.0 4.3 2.0 2.0 6.9 1.7 2.4 2.8 0.6 Developmental delay/Preschool 9.4 0 0.7 28.5 0 0.5 0.6 1.4 9.6 18.6 Abbreviation: ASD = autism spectrum disorder. * Some state-specific categories were recoded or combined to match current U.S. Department of Education categories. † Excludes children residing in school districts where educational records were not reviewed (proportion of surveillance population: 31% Arkansas, 67% Colorado, 12% Tennessee, 74% Wisconsin). § Proportion not reported because numerator is not comparable to other sites (excludes children residing in school districts where educational records were not reviewed).

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 21 Surveillance Summaries

TABLE 7. Number* and percentage of children aged 8 years, by race/ethnicity and site in the DSM-5 Surveillance Area — Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2014 Asian or American Indian or White, Black, Pacific Islander, Alaska Native, Total non-Hispanic non-Hispanic Hispanic non-Hispanic non-Hispanic Site Site institution Surveillance area No. No. (%) No. (%) No. (%) No. (%) No. (%) Arizona University of Part of 1 county in 9,478 5,340 (56.3) 321 (3.4) 3,244 (34.2) 296 (3.1) 277 (2.9) Arizona metropolitan Phoenix† Arkansas University of All 75 counties in 39,992 26,103 (65.3) 7,705 (19.3) 5,012 (12.5) 843 (2.1) 329 (0.8) Arkansas for Arkansas Medical Sciences Colorado Colorado 1 county in 8,022 2,603 (32.4) 1,018 (12.7) 4,019 (50.1) 322 (4.0) 60 (0.7) Department metropolitan Denver of Public Health and Environment Georgia CDC 5 counties including 51,161 15,495 (30.3) 22,042 (43.1) 9,913 (19.4) 3,599 (7.0) 112 (0.2) metropolitan Atlanta Maryland Johns Hopkins 1 county in 9,955 4,977 (50.0) 3,399 (34.1) 829 (8.3) 719 (7.2) 31 (0.3) University metropolitan Baltimore Minnesota University of Parts of 2 counties 9,767 3,793 (38.8) 2,719 (27.8) 1,486 (15.2) 1,576 (16.1) 193 (2.0) Minnesota including Minneapolis–St. Paul† Missouri Washington 1 county in 12,205 7,186 (58.9) 3,793 (31.1) 561 (4.6) 626 (5.1) 39 (0.3) University metropolitan St. Louis New Jersey Rutgers University 4 counties including 32,935 13,593 (41.3) 7,166 (21.8) 10,226 (31.0) 1,874 (5.7) 76 (0.2) metropolitan Newark North Carolina University of 6 counties in central 30,283 15,241 (50.3) 7,701 (25.4) 5,463 (18.0) 1,778 (5.9) 100 (0.3) North Carolina– North Carolina Chapel Hill Tennessee Vanderbilt 11 counties in middle 24,940 15,867 (63.6) 4,896 (19.6) 3,324 (13.3) 799 (3.2) 54 (0.2) University Tennessee Medical Center Wisconsin University of 10 counties in 35,037 20,732 (59.2) 6,486 (18.5) 6,181 (17.6) 1,471 (4.2) 167 (0.5) Wisconsin– southeastern Madison Wisconsin All sites combined 263,775 130,930 (49.6) 67,246 (25.5) 50,258 (19.1) 13,903 (5.3) 1,438 (0.5) Abbreviation: DSM-5 = Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition. * Total numbers of children aged 8 years in each surveillance area were obtained from CDC’s National Center for Health Statistics Vintage 2016 Bridged-Race Population Estimates for July 1, 2014. † Denominator excludes school districts that were not included in the surveillance area, calculated from National Center for Education Statistics enrollment counts of third graders during the 2014–2015 school year.

22 MMWR / April 27, 2018 / Vol. 67 / No. 6 US Department of Health and Human Services/Centers for Disease Control and Prevention Surveillance Summaries

TABLE 8. Number and percentage of children meeting DSM-IV-TR and/or DSM-5 surveillance case definition — Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2014 Met DSM-IV-TR Met both DSM-IV-TR or DSM-5 and DSM-5 Met DSM-IV-TR only Met DSM-5 only DSM-IV-TR vs. DSM-5 Site No. No. (%) No. (%) No. (%) Ratio Kappa Arizona 179 143 (79.9) 17 (9.5) 19 (10.6) 0.99 0.83 Arkansas 560 514 (91.8) 8 (1.4) 38 (6.8) 0.95 0.92 Colorado 116 92 (79.3) 19 (16.4) 5 (4.3) 1.14 0.79 Georgia 937 790 (84.3) 79 (8.4) 68 (7.3) 1.01 0.83 Maryland 207 187 (90.3) 12 (5.8) 8 (3.9) 1.02 0.89 Minnesota 254 200 (78.7) 34 (13.4) 20 (7.9) 1.06 0.79 Missouri 209 179 (85.6) 12 (5.7) 18 (8.6) 0.97 0.74 New Jersey 995 842 (84.6) 122 (12.3) 31 (3.1) 1.10 0.85 North Carolina 532 493 (92.7) 34 (6.4) 5 (0.9) 1.06 0.93 Tennessee 408 348 (85.3) 39 (9.6) 21 (5.1) 1.05 0.72 Wisconsin 523 448 (85.7) 46 (8.8) 29 (5.5) 1.04 0.83 All sites combined 4,920 4,236 (86.1) 422 (8.6) 262 (5.3) 1.04 0.85 Abbreviations: DSM-5 = Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition; DSM-IV-TR = Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision.

TABLE 9. Characteristics of children meeting DSM-IV-TR and/or DSM-5 surveillance case definition — Autism and Developmental Disabilities Monitoring Network, 11 sites, United States, 2014 Met DSM-IV-TR Met both DSM-IV-TR or DSM-5 and DSM-5 Met DSM-IV-TR only Met DSM-5 only DSM-IV-TR vs. DSM-5 Characteristic No. No. (%) No. (%) No. (%) Ratio Kappa Met ASD case definition under 4,920 4,236 (86.1) 422 (8.6) 262 (5.3) 1.04 0.85 DSM-IV-TR and/or DSM-5 Male 3,978 3,452 (86.8) 316 (7.9) 210 (5.3) 1.03 0.85 Female 942 784 (83.2) 106 (11.3) 52 (5.5) 1.06 0.85 White, non-Hispanic 2,486 2,159 (86.8) 193 (7.8) 134 (5.4) 1.03 0.85 Black, non-Hispanic 1,184 994 (84.0) 109 (9.2) 81 (6.8) 1.03 0.84 Hispanic, regardless of race 817 695 (85.1) 91 (11.1) 31 (3.8) 1.08 0.86 Asian/Pacific Islander, 207 188 (90.8) 14 (6.8) 5 (2.4) 1.05 0.88 non-Hispanic ≤36 months 1,509 1,372 (90.9) 115 (7.6) 22 (1.5) 1.07 0.89 37–48 months 723 640 (88.5) 61 (8.4) 22 (3.0) 1.06 0.86 >48 months 1,503 1,195 (79.5) 154 (10.2) 154 (10.2) 1.00 0.81 Autism special education 2,270 2,156 (95.0) 35 (1.5) 79 (3.5) 0.98 0.57 eligibility† ASD diagnostic statement§ Earliest ASD diagnosis 951 936 (98.4) 0 (0) 15 (1.6) 0.98 0.71 ≤36 months Earliest ASD diagnosis autistic 1,577 1,526 (96.8) 0 (0) 51 (3.2) 0.97 0.50 disorder Earliest ASD diagnosis PDD-NOS/ 1,564 1,525 (97.5) 0 (0) 39 (2.5) 0.98 0.72 ASD-NOS Earliest ASD diagnosis Asperger 221 210 (95.0) 0 (0) 11 (5.0) 0.95 0.72 disorder No previous ASD diagnosis or 950 484 (50.9) 369 (38.8) 97 (10.2) 1.47 0.62 eligibility on record Intellectual disability (IQ ≤70) 1,191 1,089 (91.4) 67 (5.6) 35 (2.9) 1.03 0.89 Borderline range (IQ 71–85) 881 778 (88.3) 74 (8.4) 29 (3.3) 1.06 0.88 Average or above average 1,620 1,391 (85.9) 143 (8.8) 86 (5.3) 1.04 0.86 (IQ >85) Abbreviations: ASD = autism spectrum disorder; DSM-5 = Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition; DSM-IV-TR = Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision; PDD-NOS = pervasive developmental disorder–not otherwise specified. * Includes children identified with ASD who were linked to an in-state birth certificate. † Includes children with autism as the Primary Exceptionality (Table 6) as well as children documented to meet eligibility criteria for autism special education services. § An ASD diagnosis documented in abstracted comprehensive evaluations, including DSM-IV-TR diagnosis of autistic disorder, PDD-NOS or Asperger disorder qualifies a child as meeting the DSM-5 surveillance case definition for ASD. ¶ Includes data from all 11 sites, including those with IQ data available for <70% of confirmed cases.

US Department of Health and Human Services/Centers for Disease Control and Prevention MMWR / April 27, 2018 / Vol. 67 / No. 6 23

The Morbidity and Mortality Weekly Report (MMWR) Series is prepared by the Centers for Disease Control and Prevention (CDC) and is available free of charge in electronic format. To receive an electronic copy each week, visit MMWR’s free subscription page at https://www.cdc.gov/mmwr/mmwrsubscribe.html. Paper copy subscriptions are available through the Superintendent of Documents, U.S. Government Printing Office, Washington, DC 20402; telephone 202-512-1800. Readers who have difficulty accessing this PDF file may access the HTML file at https://www.cdc.gov/mmwr/volumes/67/ss/ss6706a1.htm?s_ cid=ss6706a1_w. Address all inquiries about the MMWR Series, including material to be considered for publication, to Executive Editor, MMWR Series, Mailstop E-90, CDC, 1600 Clifton Rd., N.E., Atlanta, GA 30329-4027 or to [email protected]. All material in the MMWR Series is in the public domain and may be used and reprinted without permission; citation as to source, however, is appreciated. Use of trade names and commercial sources is for identification only and does not imply endorsement by the U.S. Department of Health and Human Services. References to non-CDC sites on the Internet are provided as a service to MMWR readers and do not constitute or imply endorsement of these organizations or their programs by CDC or the U.S. Department of Health and Human Services. CDC is not responsible for the content of these sites. URL addresses listed in MMWR were current as of the date of publication.

ISSN: 1546-0738 (Print)

Question 2

Relevant medical or scientific evidence pertaining to the disease or condition

Contents

Overview – 3

Autism Spectrum Disorder, National Institute of Mental Health - 4

Overview

Autism Spectrum Disorder (ASD) is a development disorder mostly characterized by differences in :

• Social skills • Communication • Behavior

The exact symptoms vary based on where an individual is on the spectrum. Some individuals with ASD are high functioning and can live very independent lives with little intervention. For some individuals though ASD is debilitating and they will never lead an independent life.

Treatments include:

• Behavioral Therapies • Pharmaceuticals o Risperidone – Approved by the FDA to treat irritability in patients with ASD o Non FDA approved drugs – Physicians sometimes recommend drugs that aren’t approved to treat autism but are known to help with a symptom.

Overall, treatment of autism focuses largely on therapies, with medication being used only to certain symptoms which are not present in everyone with ASD. Off-label medication is often used to address particular symptoms a patient may be experiencing.

Autism Spectrum Disorder What is autism spectrum disorder? Autism spectrum disorder (ASD) is a term for a group of developmental disorders described by:

• Lasting problems with social communication and social interaction in different settings

• Repetitive behaviors and/or not wanting any change in daily routines

• Symptoms that begin in early childhood, usually in the first 2 years of life

• Symptoms that cause the person to need help in his or her daily life The term “spectrum” refers to the wide range of symptoms, strengths, and levels of impairment that people with ASD can have. The diagnosis of ASD now includes these other conditions:

• Autistic disorder • Asperger’s syndrome • Pervasive developmental disorder not otherwise specified Although ASD begins in early development, it can last throughout a person’s lifetime. What are the signs and symptoms of ASD? Not all people with ASD will show all of these behaviors, but most will show several. People with ASD may:

• Repeat certain behaviors or have unusual behaviors • Have overly focused interests, such as with moving objects or parts of objects

• Have a lasting, intense interest in certain topics, such as numbers, details, or facts

• Be upset by a slight change in a routine or being placed in a new or overstimulating setting

• Make little or inconsistent eye contact • Tend to look and listen less to people in their environment • Rarely seek to share their enjoyment of objects or activities by pointing or showing things to others

• Respond unusually when others show anger, distress, or affection • Fail or be slow to respond to their name or other verbal attempts to gain their attention

• Have difficulties with the back and forth of conversations • Often talk at length about a favorite subject but won’t allow anyone else a chance to respond or notice when others react indifferently

• Repeat words or phrases that they hear, a behavior called echolalia • Use words that seem odd, out of place, or have a special meaning known only to those familiar with that person’s way of communicating

• Have facial expressions, movements, and gestures that do not match what they are saying

• Have an unusual tone of voice that may sound sing-song or flat and robot-like

• Have trouble understanding another person’s point of view, leaving him or her unable to predict or understand other people’s actions People with ASD may have other difficulties, such as sensory sensitivity (being sensitive to light, noise, textures of clothing, or temperature), sleep pr oblems, digestion problems, and irritability. People with ASD can also have many strengths and abilities. For instance, people with ASD may:

• Have above-average intelligence • Be able to learn things in detail and remember information for long periods of time

• Be strong visual and auditory learners • Excel in math, science, music, and art

NOTICING ASD IN YOUNG CHILDREN Some babies with ASD may seem different very early in their development. Others may seem to develop typically until the second or even third year of life, but then parents start to see problems. Learn more about developmental milestones that young children should reach at www.cdc.gov/ncbddd/ actearly/milestones. How is ASD diagnosed? Doctors diagnose ASD by looking at a child’s behavior and development. Young children with ASD can usually be reliably diagnosed by age 2. Older children and adolescents should be screened for ASD when a parent or teacher raises concerns based on observations of the child’s social, communicative, and play behaviors. Diagnosing ASD in adults is not easy. In adults, some ASD symptoms can overlap with symptoms of other mental health disorders, such as schizophrenia or attention deficit hyperactivity disorder (ADHD). However, getting a correct diagnosis of ASD as an adult can help a person understand past difficulties, identify his or her strengths, and obtain the right kind of help. Diagnosis in Young Children Diagnosis in young children is often a two-stage process: General Developmental Screening During Well-Child Checkups Every child should receive well-child check-ups with a pediatrician or an early childhood health care provider. Specific ASD screening should be done at the 18- and 24-month visits. Earlier screening might be needed if a child is at high risk for ASD or developmental problems. Those at high risk include those who:

• Have a sister, brother, or other family member with ASD • Have some ASD behaviors • Were born premature, or early, and at a low birth weight Parents’ experiences and concerns are very important in the screening process for young children. Sometimes the doctor will ask parents questions about the child’s behaviors and combine this information with his or her observations of the child. Read more about screening instruments at www.cdc.gov/ncbddd/autism/ hcp-screening.html. Children who show some developmental problems during this screening process will be referred for another stage of evaluation. Additional Evaluation This evaluation is with a team of doctors and other health professionals with a wide range of specialties who are experienced in diagnosing ASD. This team may include:

• A developmental pediatrician—a doctor who has special training in child development

• A child psychologist and/or child psychiatrist—a doctor who knows about brain development and behavior

• A speech-language pathologist—a health professional who has special training in communication difficulties The evaluation may assess: you’re if help for ask concerned. and signs the Learn

• Cognitive level or thinking skills • Language abilities • Age-appropriate skills needed to complete daily activities independently, such as eating, dressing, and toileting Because ASD is a complex disorder that sometimes occurs along with other illnesses or learning disorders, the comprehensive evaluation may include:

• Blood tests • A hearing test The outcome of the evaluation will result in recommendations to help plan for treatment. Diagnosis in Older Children and Adolescents Older children who begin showing symptoms of ASD after starting school are often first recognized and evaluated by the school’s special education team and can be referred to a health care professional. Parents may talk with their child’s pediatrician about their child’s difficulties with social interaction, including problems with subtle communication, such as understanding tone of voice or facial expressions, body language, and lack of understanding of figures of speech, humor, or sarcasm. Parents may also find that their child has trouble forming friendships with peers. At this point, the pediatrician or a child psychologist or psychiatrist who has expertise in ASD can screen the child and refer the family for further evaluation and treatment. Diagnosis in Adults Adults who notice the signs and symptoms of ASD should talk with a doctor and ask for a referral for an ASD evaluation. While testing for ASD in adults is still being refined, adults can be referred to a psychologist or psychiatrist with ASD expertise. The expert will ask about concerns, such as social interaction and communication challenges, sensory issues, repetitive behaviors, and restricted interests. Information about the adult’s developmental history will help in making an accurate diagnosis, so an ASD evaluation may include talking with parents or other family members. What are the treatments for ASD? Treating ASD early and getting proper care can reduce a person’s difficulties and increase his or her ability to maximize strengths and learn new skills. While there is no single best treatment for ASD, working closely with the doctor is an important part of finding the right treatment program. Medications There are a few classes of medications that doctors may use to treat some difficulties that are common with ASD. With medication, a person with ASD may have fewer problems with:

• Irritability • Aggression • Repetitive behaviors • Hyperactivity • Attention problems • Anxiety and depression Read more about the latest news and information on medication warnings, patient medication guides, or newly approved medications at the Food and Drug Administration’s (FDA) website at www.fda.gov. Who is affected by ASD? ASD affects many people, and it has become more commonly diagnosed in recent years. More boys than girls receive an ASD diagnosis. What causes ASD? Scientists don’t know the exact causes of ASD, but research suggests that genes and environment play important roles.

• Researchers are starting to identify genes that may increase the risk for ASD.

• ASD occurs more often in people who have certain genetic conditions, such as Fragile X syndrome or tuberous sclerosis.

• Many researchers are focusing on how genes interact with each other and with environmental factors, such as family medical conditions, parental age and other demographic factors, and complications during birth or pregnancy.

• Currently, no scientific studies have linked ASD and vaccines. Where can I find more information? To learn more about ASD, visit: Centers for Disease Control and Prevention http://www.cdc.gov/ncbddd/autism Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) http://www.nichd.nih.gov/health/topics/autism/Pages/default.aspx MedlinePlus (National Library of Medicine) https://medlineplus.gov (En Espanol: http://medlineplus.gov/spanish) National Institute on Deafness and Other Communication Disorders (NIDCD) http://www.nidcd.nih.gov/funding/programs/vsl/pages/autism.aspx National Institute of Neurological Disorders and Stroke (NINDS) http://www.ninds.nih.gov/disorders/autism/autism.htm For information on clinical trials, visit: ClinicalTrials.gov: http://www.clinicaltrials.gov For more information on conditions that affect mental health, resources, and research, go to MentalHealth.gov at http://www.mentalhealth.gov, the NIMH website at http://www.nimh.nih.gov, or contact us at: National Institute of Mental Health Office of Science Policy, Planning, and Communications Science Writing, Press, and Dissemination Branch 6001 Executive Boulevard Room 6200, MSC 9663 Bethesda, MD 20892-9663 Phone: 301-443-4513 or 1-866-615-NIMH (6464) toll-free TTY: 301-443-8431 or 1-866-415-8051 toll-free Fax: 301-443-4279 Email: [email protected] Website: http://www.nimh.nih.gov

National Institute of Mental Health

U.S. Department of Health and Human Services National Institutes of Health National Institute of Mental Health September 2015 NIH Publication Number QF 15-5511

Question 3

Consideration of whether conventional medical therapies are insufficient to treat or alleviate the disease or condition

Contents

Overview – 3

Comparative Effectiveness of Therapies for Children With Autism Spectrum Disorder – 4

Medication Treatment for Autism - 7

Overview

Autism Spectrum Disorder (ASD) is a behavioral disorder that has a wide range of impacts on patients. Traditional treatment options are largely limited to behavioral therapy.

Very few pharmaceuticals are FDA approved for the treatment of autism. Those that are, are limited to treating a narrow range of symptoms and not the condition itself. Most pharmaceuticals used in the treatment of autism are “off-label” meaning they are approved for related conditions, but the physician believes it could help a patient with ASD.

Evidence shows that behavioral therapy can be effective in treating those with mild to moderate ASD, but additional treatment options are needed for those with severe ASD or who exhibit certain symptoms.

Attached are two publication which seek to address current treatment options for ASD:

Comparative Effectiveness of Therapies for Children With Autism Spectrum Disorder – This publication reviews various behavior therapies and concludes that several are effective, particularly when introduced in early age, but for many this is insufficient evidence.

Medication Treatment for Autism – This publication seeks to provide clarity around what medications are used to treat symptoms of autism.

Clinician Research Summary Developmental Delays Autism Spectrum Disorder

Comparative Effectiveness of Therapies for Children With Autism Spectrum Disorder Key Clinical Issue What evidence is available regarding the effectiveness, benefits, and harms of therapies used to address the core and associated symptoms seen among children up to age 12 with autism spectrum disorder?

Background Information Clinical Bottom Line Autism spectrum disorder (ASD) is a neurodevelopmental disorder. Approximately 1 in every 68 children in the United Behavioral Interventions States has been diagnosed with ASD. Treatments for ASD ƒƒ Cognitive behavioral therapy reduces anxiety symptoms in school- focus on improving core deficits in social communication, aged children with average IQ and language skills.  addressing challenging behaviors, treating commonly ƒƒ Child-focused early intensive behavioral and developmental associated difficulties (e.g., anxiety, attention difficulties, interventions such as the UCLA/Lovaas Model and the Early Start Denver Model can improve cognitive and language outcomes for sensory difficulties), promoting functional independence, some children.  and improving quality of life. Individual goals for treatment ƒƒ Play- and interaction-based interventions improve joint attention vary by child, and a combination of therapies is used to skills in young children, who were also typically receiving early achieve these goals. Treatment choice may be influenced by intervention.  availability, time commitment required for the family, child ƒƒ Parent-focused early intensive behavioral interventions may characteristics such as cognitive skills and age, and costs. improve language skills for some children.  ƒƒ Social skills interventions may yield short-term improvements Conclusions in social interactions and emotion recognition for school-aged children with average reasoning and language skills.  Efforts toward early intervention for ASD have been encouraging. Research evidence on the effectiveness of Medical Interventions therapies for ASD has shown promise in some areas, but Benefits since this is a young field, these results need to be replicated ƒƒ Aripiprazole () and risperidone () reduce challenging and expanded. There is good evidence to support the use of and repetitive behaviors when compared with placebo. cognitive behavioral therapy to treat anxiety in school-aged ƒƒ Secretin does not improve language, cognition, behavior, children without cognitive or language delays. Moderate communication, autism symptom severity, or socialization.  ƒƒ The evidence is insufficient to understand the effectiveness and evidence exists that child-focused early intensive behavioral benefits from all other medical interventions, including serotonin- interventions can improve cognitive and language outcomes reuptake inhibitors and stimulant medications.  in young children. There is some evidence to guide choices Harms among medical interventions for challenging and repetitive ƒƒ Aripiprazole and risperidone are associated with significant weight behaviors. There is low evidence to support parent-focused gain, sedation, and extrapyramidal effects. and social skills interventions. For many other interventions, ƒƒ The evidence is insufficient to understand the adverse events from the evidence is insufficient to permit an estimate of their all other medical interventions, including serotonin-reuptake  benefits or harms. This does not mean that these interventions inhibitors and stimulant medications. are not associated with benefits or harms but that further Other Interventions study is required. Evidence suggests that there are undefined ƒƒ The evidence is insufficient to understand the effectiveness, benefits, subgroups of children for whom early and intensive or adverse events from any educational intervention.  behavioral interventions may elicit robust gains while others ƒƒ The evidence is insufficient to understand the effectiveness, benefits, may not demonstrate marked improvement. or adverse events from any allied health or complementary and alternative medicine (CAM) intervention.  Confidence Scale High:  There are consistent results from good-quality studies. Further research is very unlikely to change the conclusions. Moderate:  Findings are supported, but further research could change the conclusions. Low:  There are very few studies, or existing studies are flawed. Insufficient: Signifies that evidence is either unavailable or does not permit estimation of an effect. Literature Review Methods What To Discuss With Your Patients The 2011 systematic review of research included 159 articles ƒƒ Types of therapies and specialists to consider. written in English and published from 2000 through ƒƒ Treatment goals and realistic expectations. May 2010. In 2014, the review was updated to include an ƒƒ Timing of interventions. additional 65 studies on behavioral interventions. Studies ƒƒ Side effects of medications and longevity of side effects. involved children up to age 12 with ASD or ages 0–2 years at ƒ risk for diagnosis of ASD. All forms of treatment and study ƒ Daily routine, impact on the family, and the psychological designs, with the exception of individual case reports, were needs of the child and the family. reviewed. Studies of behavioral, educational, CAM, and ƒƒ Support groups, local services, and sources of trusted allied health interventions with fewer than 10 subjects were information. excluded, as were studies of medical interventions with fewer ƒƒ Experience of the treatment team in working with children than 30 subjects. A list of included and excluded articles is in with ASD. the full report. ƒƒ Re-evaluating potential treatments as research evolves. Note Regarding Possible Harms Resource for Patients Other than for risperidone and aripiprazole, there was not Therapies for Children With Autism Spectrum Disorder, A enough evidence to estimate the severity and frequency Review of the Research for Parents and Caregivers is a free of potential adverse events associated with any of the companion to this clinician guide. It can help parents and interventions. According to the United States Food and Drug caregivers talk with their health care professionals about Administration, there are serious safety issues associated treatment options. It provides information about: with the use of chelation products. Even when used under ƒƒ Types of programs and therapies available to children with medical supervision, these products can cause serious harm, ASD. including dehydration, kidney failure, and death. ƒƒ Available evidence on each program Gaps in Knowledge or therapy. ƒƒ What to ask when planning therapies There are no or few studies that describe the following: and programs for ASD. ƒƒ Direct comparisons of the effects of different treatment approaches (e.g., direct comparison of the UCLA/Lovaas Ordering Information Model and the Early Start Denver Model), and their For electronic copies of Therapies for practical effectiveness or feasibility beyond research Children With Autism Spectrum Disorder, studies. A Review of the Research for Parents ƒƒ Which children are likely to benefit from particular and Caregivers (AHRQ Pub. No.14- interventions. EHC036-A), this clinician guide, and the full systematic ƒƒ Generalization of treatment effects to contexts outside review, visit www.effectivehealthcare.ahrq.gov. To order free of the treatment context (e.g., settings), components of print copies, call the AHRQ Publications Clearinghouse at multicomponent therapies that drive effectiveness, and 800-358-9295. predictors of treatment success. Source ƒƒ Which specific treatment approaches to use in children under 2 years of age who are at high risk of developing The information in this summary is based on two Comparative ASD based on behavioral, medical, or genetic risk factors. Effectiveness Reviews (CERs) prepared by the Vanderbilt ƒƒ Whether there are any harms associated with behavioral, Evidence-based Practice Center for the Agency for Healthcare educational, allied health, or CAM interventions. Research and Quality (AHRQ): Comparative Effectiveness of Therapies for Children With Autism Spectrum Disorders, Future Research Needs CER No. 26, prepared under Contract No. 290-2007-10065-I, ƒƒ Continuing improvements in methodological rigor in the April 2011; and Therapies for Children with Autism Spectrum field, including: Disorder: Behavioral Interventions Update, CER No. 137, prepared under Contract No. 290-2012-00009-I, August 2014. ĂĂ Consistent use of standardized, validated outcome Available at: www.effectivehealthcare.ahrq.gov/autism1.cfm. measure(s) for each target of therapy. This summary was prepared by the John M. Eisenberg Center ĂĂ Thorough descriptions of study participants and for Clinical Decisions and Communications Science at Baylor interventions. College of Medicine, Houston, TX, and updated by AHRQ. ƒƒ Large, publicly funded, multisite studies of existing interventions across all treatment types and studies with extended followup times. ƒƒ Research on medical interventions for which no research has been conducted and on atypical antipsychotics that may be less associated with adverse events than are risperidone and aripiprazole.

AHRQ Pub No.14-EHC036-3 Replaces AHRQ Pub. No. 11-EHC029-3 September 2014 12/31/2018 Medication Treatment for Autism | NICHD - Eunice Kennedy Shriver National Institute of Child Health and Human Development

Medication Treatment for Autism

Currently, there is no medication that can cure autism spectrum disorder (ASD) or all of its symptoms. But some medications can help treat certain symptoms associated with ASD, especially certain behaviors.

NICHD does not endorse or support the use of any medications not approved by the FDA for treating symptoms of autism or other conditions.

Health care providers often use medications to deal with a specic behavior, such as to reduce self-injury or aggression. Minimizing a symptom so that it is no longer a problem allows the person with autism to focus on other things, including learning and communication. Research shows that medication is most eective when used in combination with behavioral therapies.1

In 2006, the U.S. Food and Drug Administration (FDA) approved the drug risperidone (pronounced rih-SPERR-ih-dohn) for treating irritability in children with autism who are between 5 years and 16 years of age.2 Risperidone is currently the only FDA-approved drug for the treatment of specic autism symptoms.

Other drugs are often used to help improve symptoms of autism, but they are not approved by the FDA for this specic purpose. Some medications on this list are not approved for those younger than 18 years of age. Please consult the FDA for complete information on the medications listed below.

All medications carry risks, some of them serious. Families should work closely with their children's health care providers to ensure safe use of any medication.3

Selective serotonin re-uptake inhibitors (SSRIs) (http://www.fda.gov/Drugs/DrugSafety/InformationbyDrugClass/ucm283587.htm) This group of antidepressants treats some problems that result from imbalances in the body's chemical systems. SSRIs might reduce the frequency and intensity of repetitive behaviors; decrease anxiety, irritability, tantrums, and aggressive behavior; and improve eye contact. Tricyclics These medications are another type of antidepressant used to treat depression and obsessive-compulsive behaviors. These drugs seem to cause more minor side eects than do SSRIs. They are sometimes more eective than SSRIs for treating certain people and certain symptoms. Psychoactive or anti-psychotic medications These types of medications aect the brain of the person taking them. The anti- psychotic drug risperidone is approved for reducing irritability in 5-to-16-year-olds https://www.nichd.nih.gov/health/topics/autism/conditioninfo/treatments/medication-treatment 1/4 12/31/2018 Medication Treatment for Autism | NICHD - Eunice Kennedy Shriver National Institute of Child Health and Human Development with autism. These medications can decrease hyperactivity, reduce stereotyped behaviors, and minimize withdrawal and aggression among people with autism. Stimulants This group of medications can help to increase focus and decrease hyperactivity in people with autism. They are particularly helpful for those with mild ASD symptoms. Anti-anxiety medications This group of medications can help relieve anxiety and panic disorders, which are often associated with ASD. Anticonvulsants These medications treat seizures and seizure disorders, such as epilepsy. (Seizures are attacks of jerking or staring and seeming frozen.) Almost one-third of people with autism symptoms have seizures or seizure disorders.

Autism Speaks, one of the leading autism science and family support organizations in the United States, oers a tool to help parents and caregivers make informed decisions about medication. Visit http://www.autismspeaks.org/science/resources-programs/autism- treatment-network/tools-you-can-use/medication-guide (http://www.autismspeaks.org/science/resources-programs/autism-treatment- network/tools-you-can-use/medication-guide) (/Pages/external-disclaimer.aspx) for more information.

Creating a Medication Plan

Health care providers usually prescribe a medication on a trial basis to see if it helps. Some medications may make symptoms worse at rst or take several weeks to work. Your child's health care provider may have to try dierent dosages or dierent combinations of medications to nd the most eective plan.

Families, caregivers, and health care providers need to work together to make sure that the medication plan is safe and that all medications have some benet.

Things to remember about medication: Health care providers and families should work together to help ensure safe use of medication. Not every medication helps every person with symptoms of autism. One person with autism might respond to medications dierently than another person with autism or than people who don't have autism. Some medications have serious risks involved with their use.

Citations

https://www.nichd.nih.gov/health/topics/autism/conditioninfo/treatments/medication-treatment 2/4 12/31/2018 Medication Treatment for Autism | NICHD - Eunice Kennedy Shriver National Institute of Child Health and Human Development 1. Aman, M. G., McDougle, C. J., Scahill, L., Handen, B., Arnold, L. E., Johnson, C., et al.; the Research Units on Pediatric Psychopharmacology Autism Network. (2009). Medication and parent training in children with pervasive developmental disorders and serious behavior problems: Results from a randomized clinical trial. Journal of the American Academy of Child & Adolescent Psychiatry, 48(12), 1143-1154. 2. FDA Approves the First Drug to Treat Irritability Associated with Autism, Risperdal. (2006). Retrieved January 28, 2011, from https://www.news-medical.net/news/2006/10/08/20437.aspx (https://www.news- medical.net/news/2006/10/08/20437.aspx) (/Pages/external-disclaimer.aspx) 3. Potenza, M., & McDougle, C. (1997). New ndings on the causes and treatment of autism. CNS Spectrums, Medical Broadcast Limited.

What are the symptoms of autism? (/health/topics/autism/conditioninfo/Pages/symptoms.aspx)

When do children usually show symptoms of autism? (/health/topics/autism/conditioninfo/Pages/symptoms-appear.aspx)

What causes autism? (/health/topics/autism/conditioninfo/Pages/causes.aspx)

How do health care providers diagnose autism? (/health/topics/autism/conditioninfo/Pages/diagnose.aspx)

What are the treatments for autism? (/health/topics/autism/conditioninfo/treatments/Pages/default.aspx)

Related A-Z Topics

Fragile X Syndrome (/health/topics/fragilex)

Intellectual and Developmental Disabilities (IDDs) (/health/topics/idds)

Prader-Willi Syndrome (PWS) (/health/topics/prader-willi)

NICHD News and Features

Media Advisory: NICHD chronicles its major research advances of 2018 (/newsroom/news/121918-research-advances-2018)

Spotlight: Selected NICHD Research Advances of 2018 (/newsroom/news/2018-year-in- review-showcase) https://www.nichd.nih.gov/health/topics/autism/conditioninfo/treatments/medication-treatment 3/4 12/31/2018 Medication Treatment for Autism | NICHD - Eunice Kennedy Shriver National Institute of Child Health and Human Development

Science Update: Folic acid, multivitamins before and during pregnancy may reduce autism risk, suggests NIH-funded study (/newsroom/news/011518-autism-risk)

All related news (/newsroom/news?topic=autism)

Content Owner Oce of Communications Last Reviewed Date 1/31/2017

https://www.nichd.nih.gov/health/topics/autism/conditioninfo/treatments/medication-treatment 4/4

Question 4

Evidence supporting the use of medical marijuana to treat or alleviate the disease or condition, including journal articles, peer-reviewed studies, and other types of medical or scientific documentation

Contents

Key Findings – 3

New Evidence –

Real life Experience of Medical Cannabis Treatment in Autism: Analysis of Safety and Efficacy – 6

Effects of cannabidivarin (CBDV) on brain excitation and inhibition systems in adults with and without Autism Spectrum Disorder (ASD): a single dose trial during magnetic resonance spectroscopy – 13

Cannabidivarin Treatment Ameliorates Autism-Like Behaviors and Restores Hippocampal Endocannabinoid System and Glia Alterations Induced by Prenatal Valproic Acid Exposure in Rats – 23

Previously Submitted Evidence –

The in vitro GcMAF effects on endocannabinoid system transcriptionomics, receptor formation, and cell activity of autism-derived macrophages – 38

Evidence for a Common Endocannabinoid-Related Pathomechanism in Autism Spectrum Disorders – 48

Cannabinoid Receptor Type 2, but not Type 1, is Up-Regulated in Peripheral Blood Mononuclear Cells of Children Affected by Autistic Disorders – 52

Consequences of Cannabinoid and Monoaminergic System Disruption in a Mouse Model of Autism Spectrum Disorders – 64

Can autism be triggered by acetaminophen activation of the endocannabinoid system? – 71

Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces – 77

An Open Label Study of the Use of Dronabinol (Marinol) in the Management of Treatment- Resistant Self-Injurious Behavior in 10 Retarded Adolescent Patients – 85

Use of dronabinol (delta-9-THC) in autism: A prospective single-case-study with an early infantile autistic child – 86

Brief Report: Cannabidiol-Rich Cannabis in Children with Autism Spectrum Disorder and Severe Behavioral Problems—A Retrospective Feasibility Study – 90

Oral cannabis extracts as a promising treatment for the core symptoms of autism spectrum disorder: Preliminary experience in Chilean patients – 96

Key Findings

Marijuana’s schedule I status makes studies on its medical use difficult to conduct. Because of this, evidence that medical marijuana is effective in treating autism spectrum disorder is more limited than that of an FDA approved pharmaceutical, but significant evidence of medical marijuana’s effectiveness can still be seen.

New Evidence

Real life Experience of Medical Cannabis Treatment in Aut ism: Analysis of Safety and Efficacy

Cannabis as a treatment for autism spectrum disorders patients appears to be well-tolerated, safe and seemingly effective option to relieve symptoms, mainly: seizures, tics, depression, restlessness and rage attacks.

Effects of cannabidivarin (CBDV) on brain excitation and inhibition systems in adults with and without Autism Spectrum Disorder (ASD): a single dose trial during magnetic resonance spectroscopy

Here we report that CBDV can ‘shift’ subcortical levels of the brain’s primary excitatory metabolite glutamate (measured as Glx) both in the neurotypical and autistic brain.

Cannabidivarin Treatment Ameliorates Autism -Like Behaviors and Restores Hippocampal Endocannabinoid System and Glia Alterations Induced by Prenatal Valproic Acid Exposure in Rats

This study provides preclinical evidence in support of the ability of CBDV to ameliorate behavioral abnormalities resembling the core and associated symptoms of ASD, a developmental condition for which no cure is available. Restoration of hippocampal endocannabinoid signaling and neuroinflammation are likely to contribute to CBDV’s beneficial effects toward ASD-like phenotypes induced by prenatal VPA exposure.

Previously Submitted Evidence

The in vitro GcMAF effects on endocannabinoid system transcriptionomics, receptor formation, and cell activity of autism-derived macrophages This study presents the first observations of GcMAF effects on the transcriptionomics of the endocannabinoid system and expression of CB2R protein. These data point to a potential nexus between endocannabinoids, vitamin D and its transporter proteins, and the immune dysregulations observed with autism.

Evidence for a Common Endocannabinoid-Related Pathomechanism in Autism Spectrum Disorders

Together with these findings, the data presented by Fo ̈ ldy et al. indicate that further analyses of the link between endocannabinoid signaling and ASDs may provide valuable insights into the pathophysiology and potential treatment strategies for ASDs.

Cannabinoid Receptor Type 2, but not Type 1, is Up-Regulated in Peripheral Blood Mononuclear Cells of Children Affected by Autistic Disorders

In conclusion, to our knowledge, this is the first study demonstrating an endocannabinoid-CB2 signalling dysregulation in autism, implying the endocannabinoid system may represent a new treatment opportunity for autism pharmacotherapy.

Consequences of Cannabinoid and Monoaminergic System Disruption in a Mouse Model of Autism Spectrum Disorders

While autism may be uniquely human, we have investigated the consequences of cannabinoid and monoaminergic system disruption in the BTBR T+tf/J mice that have been shown to exhibit autism-like behavioral phenotypes. We report that the BTBR mice exhibited an enhanced basal spontaneous locomotor behavior in the spontaneous wheel running (SWR) test, a measure of locomotor activity, that was reduced by the prototypic cannabinoid, 9-THC.

Can autism be triggered by acetaminophen activation of the endocannabinoid system?

The purpose of this report was to explore a possible correlation between acetaminophen and autism which acts through activation of the cannabinoid system. If this hypothesis is correct, it opens new avenues of investigation for possible autism treatment including agonists and antagonists of the CB1 and CB2 receptors.

Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces

These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing, such as ASC.

An Open Label Study of the Use of Dronabinol (Marinol) in the Management of Treatment-Resistant Self-Injurious Behavior in 10 Retarded Adolescent Patients

In a series of patients who presented with treatment resistant self-injurious behavior, eight of the 10 showed an improvement in their behavior when treated with Marinol without serious enough side effects to merit discontinuing the medication. At 6 month follow-up, seven of the 10 continued to benefit from the Marinol, and the eighth patient had discontinued the medicine due to a change in her living situation.

Use of dronabinol (delta-9-THC) in autism: A prospective single-case-study with an early infantile autistic child

This study showed that the use of dronabinol may be able to reduce the symptoms of autism.

Brief Report: Cannabidiol-Rich Cannabis in Children with Autism Spectrum Disorder and Severe Behavioral Problems—A Retrospective Feasibility Study

This is the first report on the impact of CBD-rich medical cannabis in children with ASD. Specifically, following the cannabis treatment, behavioral outbreaks were much improved or very much improved in 61% of patients.

Oral cannabis extracts as a promising treatment for the core symptoms of autism spectrum disorder: Preliminary experience in Chilean patients

In this small series of ASD patients, oral cannabis extracts were dramatically more effective than conventional medicines.

www.nature.com/scientificreports

OPEN Real life Experience of Medical Cannabis Treatment in Autism: Analysis of Safety and Efcacy Received: 23 August 2018 Lihi Bar-Lev Schleider 1,2, Raphael Mechoulam3, Naama Saban2, Gal Meiri4,5 & Accepted: 23 November 2018 Victor Novack1 Published: xx xx xxxx There has been a dramatic increase in the number of children diagnosed with autism spectrum disorders (ASD) worldwide. Recently anecdotal evidence of possible therapeutic efects of cannabis products has emerged. The aim of this study is to characterize the epidemiology of ASD patients receiving medical cannabis treatment and to describe its safety and efcacy. We analysed the data prospectively collected as part of the treatment program of 188 ASD patients treated with medical cannabis between 2015 and 2017. The treatment in majority of the patients was based on cannabis oil containing 30% CBD and 1.5% THC. Symptoms inventory, patient global assessment and side efects at 6 months were primary outcomes of interest and were assessed by structured questionnaires. After six months of treatment 82.4% of patients (155) were in active treatment and 60.0% (93) have been assessed; 28 patients (30.1%) reported a signifcant improvement, 50 (53.7%) moderate, 6 (6.4%) slight and 8 (8.6%) had no change in their condition. Twenty-three patients (25.2%) experienced at least one side efect; the most common was restlessness (6.6%). Cannabis in ASD patients appears to be well tolerated, safe and efective option to relieve symptoms associated with ASD.

Tere has been a 3-fold increase during the last 3 decades in the number of children diagnosed with autism spec- trum disorders worldwide1–5. No specifc treatments are currently available and interventions are focussing on lessening of the disruptive behaviors, training and teaching self-help skills for a greater independence6. Recently, CBD enriched cannabis has been shown to be benefcial for children with autism7. In this retrospec- tive study on 60 children, behavioural outbreaks were improved in 61% of patients, communication problems in 47%, anxiety in 39%, stress in 33% and disruptive behaviour in 33% of the patients. Te rationale for this treatment is based on the previous observations and theory that cannabidiol efects might include alleviation of psychosis, anxiety, facilitation of REM sleep and suppressing seizure activity8. A prospective single-case-study of Dronabinol (a THC-based drug) showed signifcant improvements in hyperactivity, lethargy, irritability, stereotypy and inappropriate speech at 6 month follow-up9. Furthermore, Dronabinol treatment of 10 ado- lescent patients with intellectual disability resulted in 8 patients showing improvement in the management of treatment-resistant self-injurious behaviour10. In 2007, Te Israel Ministry of Health began providing approvals for medical cannabis, mainly for symp- toms palliation. In 2014, Te Ministry of Health began providing licenses for the treatment of children with epilepsy. Afer seeing the results of cannabis treatment on symptoms like anxiety, aggression, panic, tantrums and self-injurious behaviour, in children with epilepsy, parents of severely autistic children turned to medical cannabis for relief. Although many with autism are being treated today with medical cannabis, there is a signifcant lack of knowl- edge regarding the safety profle and the specifc symptoms that are most likely to improve under cannabis treat- ment. Terefore, the aim of this study was to characterize the patient population receiving medical cannabis treatment for autism and to evaluate the safety and efcacy of this therapy.

1Clinical Cannabis Research Institute, Soroka University Medical Center and Faculty of Health Sciences, Ben-Gurion University of the Negev, Be’er-Sheva, Israel. 2Research Department, Tikun Olam LTD, Tel Aviv-Yafo, Israel. 3Institute for Drug Research, School of Pharmacy, The Hebrew University of Jerusalem, Jerusalem, Israel. 4Negev Autism Centre, Ben-Gurion University of the Negev, Beer Sheva, Israel. 5Soroka University Medical and Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer Sheva, Israel. Correspondence and requests for materials should be addressed to V.N. (email: [email protected])

SCIeNTIFIC REPorTS | (2019)9:200 | DOI:10.1038/s41598-018-37570-y 1 www.nature.com/scientificreports/

Total (188) Mean age (SD) 12.9 (7.0) Gender (male), No. (%) 154 (81.9) Mean body mass index (SD) 29.0 (5.3) Previous experience with cannabis (Yes), No. (%) 19 (10.1) Comorbidities: Epilepsy, No. (%) 27 (14.4) Attention Defcit Hyperactivity Disorder, No. (%) 7 (3.7) Tourette syndrome, No. (%) 4 (2.1) Celiac Disease, No. (%) 3 (1.6) Anxiety Disorder, No. (%) 3 (1.6)

Table 1. Demographic and clinical characteristics of patients at intake.

Change at six months Intake prevalence Symptom No change or Total (188) disappeared Improvement deterioration Restlessness, No. (%) 170 (90.4) 1 (1.2) 71 (89.8) 7 (8.8) Rage attacks, No. (%) 150 (79.8) 1 (1.3) 65 (89.0) 7 (9.5) Agitation, No. (%) 148 (78.7) 1 (1.4) 57 (83.8) 10 (14.7) Sleep problems, No. (%) 113 (60.1) 9 (19.5) 27 (58.6) 10 (21.7) Speech Impairment, No. (%) 113 (60.1) — 15 (30) 35 (70) Cognitive impairment, No. (%) 91 (48.4) — 15 (27.2) 40 (72.7) Anxiety, No. (%) 69 (36.7) — 24 (88.8) 3 (11.1) Incontinence, No. (%) 51 (27.1) 2 (9.0) 7 (31.8) 13 (59.0) Seizures, No. (%) 23 (12.2) 2 (15.3) 11 (84.6) — Limited Mobility, No. (%) 17 (9.0) 2 (18.1) — 9 (81.8) Constipation, No. (%) 15 (8.0) 1 (12.5) 6 (62.5) 2 (25) Tics, No. (%) 15 (8.0) 1 (20.0) 4 (80.0) — Digestion Problems, No. (%) 14 (7.4) 1 (12.5) 5 (62.5) 2 (25.0) Increased Appetite, No. (%) 14 (7.4) 1 (33.3) 1 (33.3) 1 (33.3) Lack of Appetite, No. (%) 14 (7.4) 2 (40.0) 1 (20.0) 2 (40.0) Depression, No. (%) 10 (5.3) — 5 (100.0) —

Table 2. Symptom prevalence and change. Symptom prevalence at intake in 188 patients assessed at intake and change at six months in patients responding to the six-month questionnaire.

Results Patient population. During the study period, 188 ASD patients initiated the treatment. Diagnosis of ASD was established in accordance with the accepted practice in Israel; six board certifed paediatric psychiatrists and neurologists were responsible for treatment of 125 patients (80.6%), the remaining 30 children were referred by 22 other physicians. Table 1 shows demographic characteristics of the patient population. Te mean age was 12.9 ± 7.0 years, with 14 (7.4%) patients being younger than the age of 5, 70 patients (37.2%) between 6 to 10 years and 72 (38.2%) aged 11 to 18. Most of the patients were males (81.9%). Twenty-seven patients (14.4%) sufered from epilepsy and 7 patients (3.7%) from Attention Defcit Hyperactivity Disorder (ADHD). At baseline parents of 188 patients reported on average of 6.3 ± 3.2 symptoms. Table 2 shows the prevalence of symptoms with most common being restlessness (90.4%), rage attacks (79.8%) and agitation 78.7%. Cannabis products recommended to the patients were mainly oil applied under the tong (94.7%). Seven patients (3.7%) received a license to purchase oil and inflorescence and three patients (1.5%) received a license to purchase only inforescence. Most patients consumed oil with 30% CBD and 1.5% THC, on average 79.5 ± 61.5 mg CBD and 4.0 ± 3.0 mg THC, three times a day (for a more detailed distribution of CBD/THC consumptions see Supplementary Fig. S1). Insomnia recorded in 46 patients (24.4%) was treated with an evening does of 3% THC oil with on average additional 5.0 ± 4.5 mg THC daily. All the products content was validated by HPLC (High Performance Liquid Chromatography) in each production cycle. Te cannabis dose was not signif- icantly associated with weight (r correlation coefcient = −0.13, p = 0.30), age (r correlation coefcient = −0.10, p = 0.38), or gender (p = 0.38).

Follow-up, one month. Afer one month, out of 188 patients, 8 (4.2%) stopped treatment, 1 (0.5%) switched to a diferent cannabis supplier, and 179 patients (94.6%) continued active treatment (Fig. 1). Of the latter group, 119 (66.4%) responded to the questionnaire with 58 patients (48.7%) reporting signifcant improvement, 37

SCIeNTIFIC REPorTS | (2019)9:200 | DOI:10.1038/s41598-018-37570-y 2 www.nature.com/scientificreports/

Screening 207

-17 Transferred 188 in from a different Intake treatment and supplier responded -2 refused treatment

119 responded 179 ongoing 1 switched -8 stopped One-month follow-up treatment supplier treatment

93 responded 155ongoing 9switched -15stopped Six-month follow-up treatment supplier treatment

Figure 1. Te study population in the three follow-up periods, at intake, afer one month and afer six months of medical cannabis treatment.

(31.1%) moderate improvement; 7 patients (5.9%) experienced side efects and 17 (14.3%) reported that the cannabis did not help them. Te reported side efects at one month were: sleepiness (1.6%), bad taste and smell of the oil (1.6%), restless- ness (0.8%), refux (0.8%) and lack of appetite (0.8%).

Follow-up, six months. Afer six months, of the 179 patients assessed in the one-month follow-up, 15 patients (8.3%) stopped treatment, 9 (4.9%) switched to a diferent cannabis supplier and 155 patients (86.6%) continued treatment (Fig. 1). Of the latter group, 93 (60.0%) responded to the questionnaire with 28 patients (30.1%) reporting a signifcant improvement, 50 patients (53.7%) moderate improvement, 6 patients (6.4%) slight improvement and 8 (8.6%) having no change in their condition. None of the variables entered to the multivariate analysis to predict treatment success was statistically signifcant. To assess the potential response bias, we have compared baseline characteristics between 93 respondents and 62 non-respondents to the 6-month questionnaire. Te former group was slightly older (13.7 ± 0.8 vs. 10.8 ± 0.5, p = 0.004).

Quality of Life. Quality of life, mood and ability to perform activities of daily living were assessed before the treatment and at six months. Good quality of life was reported by 31.3% of patients prior to treatment initiation while at 6 months good quality of life was reported by 66.8% (p < 0.001, Supplementary Fig. S2). Positive mood was reported by the parents on 42% before treatment and 63.5% afer 6 months of treatment (p < 0.001). Te ability to dress and shower independently was signifcantly improved from 26.4% reported no difculty in these activities prior to the treatment to 42.9% at six months (p < 0.001). Similarly, good sleep and good concentra- tion were reported by 3.3% and 0.0% (respectively) before the treatment and on 24.7% (p < 0.001) and 14.0% (p < 0.001) during an active treatment (Table 3). Te improved symptoms at 6 months included seizures, of the 13 patients on an active treatment at six months 11 patients (84.6%) reported disappearances of the symptoms and two patients reported improvement; restless- ness and rage attacks were improved in 72 patients (91.0%) and 66 (90.3%) respectively (Table 2).

Medications Use. Te most common concomitant chronic medications on the intake were antipsychotics (56.9%), antiepileptics (26.0%), hypnotics and sedatives (14.9%) and antidepressants (10.6%). Out of 93 patients responding to the follow-up questionnaire, 67 reported use of chronic medications at intake. Overall, six patients (8.9%) reported an increase in their drugs consumption, in 38 patients (56.7%) drugs consumption remained the same and 23 patients (34.3%) reported a decrease, mainly of the following families: antipsychotics, antiepileptics antidepressants and hypnotics and sedatives (Table 4). Antipsychotics, the most prevalent class of medications taken at intake (55 patients, 33.9%); at 6 months it was taken at the same dosage by 41 of them (75%), 3 patients (5.4%) decreased dosage and 11 patients (20%) stopped taking this medication (Table 4).

Side Efects. Te most common side efects, reported at six months by 23 patients (25.2%, with at least one side efect) were: restlessness (6 patients, 6.6%), sleepiness (3, 3.2%), psychoactive efect (3, 3.2%), increased appe- tite (3, 3.2%), digestion problems (3, 3.2%), dry mouth (2, 2.2%) and lack of appetite (2, 2.2%). Out of 23 patients who discontinued the treatment, 17 (73.9%) had responded to the follow-up questionnaire at six months. Te reasons for the treatment discontinuation were: no therapeutic efect (70.6%, twelve patients) and side efects (29.4%, fve patients). However, 41.2% (seven patients) of the patients who discontinued the treat- ment had reported on intentions to return to the treatment. Discussion Cannabis as a treatment for autism spectrum disorders patients appears to be well-tolerated, safe and seemingly efective option to relieve symptoms, mainly: seizures, tics, depression, restlessness and rage attacks. Te com- pliance with the treatment regimen appears to be high with less than 15% stopping the treatment at six months follow-up. Overall, more than 80% of the parents reported at signifcant or moderate improvement in the child global assessment.

SCIeNTIFIC REPorTS | (2019)9:200 | DOI:10.1038/s41598-018-37570-y 3 www.nature.com/scientificreports/

Sleep Eating with Appetite Concentration on daily tasks Bowel Activity Before During p value Before During p value Before During p value Before During p value Severe difculty 44 (47.3) 2 (2.2) 2 (2.2) 1 (1.1) 75 (80.6) 21 (22.6) 3 (3.2) 2 (2.2) Moderate difculty 18 (19.4) 27 (29.0) 6 (6.5) 13 (14.0) 11 (11.8) 41 (44.1) 13 (14.0) 17 (18.3) No difculty 28 (30.1) 39 (41.9) <0.001 59 (63.4) 47 (50.5) 0.751 2 (2.2) 11 (11.8) <0.001 71 (76.3) 54 (58.1) 0.242 Good 2 (2.2) 15 (16.1) 10 (10.8) 16 (17.2) 0 10 (10.8) 5 (5.4) 13 (14.0) Very Good 1 (1.1) 8 (8.6) 16 (17.2) 14 (15.1) 0 3 (3.2) 1 (1.1) 4 (4.3)

Table 3. Assessment of daily activities. Ability to perform activities of daily living was assessed prior to and six months afer initiation of cannabis treatment. Numbers in parenthesis represent the % of patients.

Intake Change at six months follow-up Stopped taking Dosage Has not Dosage New Medication family Total this medication decreased changed increased medication Antipsychotics, n (%) 55 11 (20) 3 (5) 41 (75) 0 0 Antiepileptics, n (%) 46 6 (13) 0 35 (76) 2 (4.5) 3 (6.5) Antidepressants, n (%) 10 3 (30) 0 4 (40) 1 (10) 2 (20) Hypnotics and sedatives, n (%) 10 2 (20) 1 (10) 7 (70) 0 0 Anxiolytics, n (%) 7 2 (28) 0 5 (72) 0 0

Table 4. Concomitant medications. Concomitant medications use at the baseline and six months follow up in patients responding to the six-month questionnaire.

Te exact mechanism of the cannabis efects in patients with ASD is not fully elucidated. Findings from ASD animal models indicate a possible dysregulation of the endocannabinoid (EC) system11–16 signalling behaviours, a dysregulation that was suggested to be also present in ASD patients17. Mechanism of action for the efect of cannabis on ASD may possibly involve GABA and glutamate transmission regulation. ASD is characterized by an excitation and inhibition imbalance of GABAergic and glutamatergic signalling in diferent brain structures18. Te EC system is involved in modulating imbalanced GABAergic19 and glutamatergic transmission20. Other mechanism of action can be through oxytocin and vasopressin, neurotransmitters that act as important modulators of social behaviours21. Administration of oxytocin to patients with ASD has been shown to facilitate processing of social information, improve emotional recognition, strengthen social interactions, reduce repetitive behaviours22 and increase eye gaze23. Cannabidiol was found to enhance oxytocin and vasopressin release during activities involving social interaction16. Two main active ingredients (THC and CBD) can have diferent psychoactive action mechanisms. THC was previously shown to improve symptoms characteristic to ASD patients in other treated populations. For example, patients reported lower frequency of anxiety, distress and depression24, following THC administration, as well as improved mood and better quality of life in general25. In patients sufering from anxiety, THC led to improved anxiety levels compared to placebo26 and in dementia patients, it led to reduction in nocturnal motor activi- ty,violence27,28 behavioural and severity of behavioural disorders29. Moreover, cannabis was shown to enhances interpersonal communication30 and decrease hostile feelings within small social groups31. In our study we have shown that a CBD enriched treatment of ASD patients can potentially lead to an improvement of behavioural symptoms. Tese fndings are consistent with the fndings of two double-blind, placebo-controlled crossover studies demonstrating the anxiolytics properties of CBD in patients with anxiety disorder32,33. In one, CBD had a signifcant efect on increased brain activity in the right posterior cingulate cor- tex, which is thought to be involved in the processing of emotional information32, and in the other, simulated pub- lic speaking test was evaluated in 24 patients with social anxiety disorder. Te CBD treated group had signifcantly lower anxiety scores than the placebo group during simulated speech, indicating reduction in anxiety, cognitive impairment, and discomfort factors33. Te cannabis treatment appears to be safe and side efects reported by the patients and parents were moderate and relatively easy to cope with. Te most prevalent side efects reported at six months was restlessness, appear- ing in less than 6.6% of patients. Moreover, the compliance with the treatment was high and only less than 5% have stopped the treatment due to the side efects. We believe that the careful titration schedule especially in the ASD paediatric population is important for maintaining a low side efects rate and increase of the success rate. Furthermore, we believe that a professional instruction and detailed parents’ training sessions are highly impor- tant for the increasing of efect to adverse events ratio. Te present fndings should be interpreted with caution for several reasons. Firstly, this is an observational study with no control group and therefore no causality between cannabis therapy and improvement in patients’ wellbeing can be established. Children of parents seeking cannabis therapy might not constitute a representative sample of the patient with the specifc disease (self-selection bias). We have not formally confrmed the ASD diag- nosis, however all the children included in the study were previously diagnosed with ASD by certifed neurologist or psychiatrist, as required by Ministry of Health prior to the initiation of the cannabis-based treatment. Tis study was based on a subjective self-report of the patient’s parent’s observation and not by the patients themselves. Tese reports, with subjective variables such as quality of life, mood, and general efects, may be

SCIeNTIFIC REPorTS | (2019)9:200 | DOI:10.1038/s41598-018-37570-y 4 www.nature.com/scientificreports/

biased by the parent’s opinion of the treatment. Moreover, even though the efect was assessed at six months, the possibility of the infated expectations of the novel treatment “miracle” efect cannot be excluded. Te ques- tionnaire response rate at 6 months was 60%, thus the estimates of the efcacy and safety of the treatment can be biased. However, high compliance (above 80%) with the treatment provides a good evidence of the patients and parents satisfaction with the treatment. While this study suggest that cannabis treatment is safe and can improve ASD symptoms and improve ASD patient’s quality of life, we believe that double blind placebo-controlled trials are crucial for a better understand- ing of the cannabis efect on ASD patients. Methods Study Population. Tere are currently over 35,000 patients approved for medical cannabis use in Israel and 15,000 (~42.8%) of them receive treatment at Tikun-Olam Ltd. (TO), the largest national provider of medical cannabis. Tis study included all patients receiving cannabis license at TO with the diagnosis of autism in the years 2015–2017. During the routine treatment process at the cannabis clinic, all willing patients underwent an extensive initial evaluation and their health status was periodically assessed by the treating team. At the intake session, the nurse assessed a complete medical history. Te patient’s parents were interviewed by the nurse and flled a medical questionnaire, which included the following domains: demographics, comorbidities, habits, concomitant medi- cations, measurements of quality of life and a detailed symptoms check-list. Following intake, the nurse advised on the treatment plan.

Treatment Regiment. Te treatment in majority of the patients was based on cannabis oil (an extract of a high CBD strain dissolve in olive oil in a ratio THC:CBD of 1:20, 30% CBD and 1.5% THC), and underwent an individualized titration. Te starting dose was one sublingual drop three times a day with one oil drop (0.05 ml) containing 15 mg CBD and 0.75 mg Δ9-THC. Oil contained 45% olive oil, 30% CBD, 1.5% THC, <1.5% CBC, 0.5% CBG, <0.5% CBDV and <0.1% CBN. Te remaining ingredients were terpenes, favonoids, waxes and chlorophyll In patients who reported high sensitivity to previously used medications, the treatment started with oil con- taining 1:20 15% CBD and 0.75% THC. In patients with severe sleep disturbances, following the initial treatment phase, 3% THC oil was added to the evening dose. In cases with a signifcant aggressive or violent behaviour, 3% THC oil was added. Te dose was increased gradually for each patient depending on the efect of the cannabis oil on the targeted symptoms according to the treatment plan and the tolerability of each patient. Finding of the optimal dose could take up to two months and dosage range is wide: from one drop three times a day to up to 20 drops three times a day of the same product. Afer one month, the treating team contacted the parents to follow-up on the treatment progression. At six months patients underwent an additional assessment of the symptom intensity, side efects and quality of life.

Study outcomes. For safety analysis we have assessed the frequency of the following side efects at one and at six months: physiological efects – headaches, dizziness, nausea, vomiting, stomach ache, heart palpitation, drop in blood pressure, drop in sugar, sleepiness, weakness, chills, itching, red/irritated eyes, dry mouth, cough, increased appetite, blurred vision, slurred speech; cognitive side efects – restlessness, fear, psycho-active efect, hallucinations, confusion and disorientation, decreased concentration, decreased memory or other. Te patient parents were asked to provide details of the incidence, duration and severity of the reported side efect. For the efcacy analysis we used the global assessment approach where the patient parents were asked: “How would you rate the general efect of cannabis on your child condition?” the options were: signifcant improve- ment, moderate improvement, slight improvement, no change, slight deterioration, moderate deterioration and signifcant deterioration. Autism symptoms severity assessment included the following items: restlessness, rage attacks, agitation, speech impairment, cognitive impairment, anxiety, incontinence, depression and more. Quality of life was assessed on a Likert scale ranging from very poor to poor, neither poor nor good and good to very good34. Te study was approved by Soroka University Medical Centre Ethics Committee and due to the nature of the data analysis based on the routinely obtained clinical data, it was determined that no informed consent is required. All methods were performed in accordance with the relevant institutional and international research guidelines and regulations.

Statistical analysis. Continuous variables with normal distribution were presented as means with standard deviation. Ordinary variables or continuous variables with non-normal distribution were presented as medians with an interquartile range (IQR). Categorical variables were presented as counts and percent of the total. We used t-test and paired t-test for the analysis of the continuous variables with normal distribution. Te non-parametric Mann-Whitney U test and paired Wilcoxon test was used whenever parametric assumptions could not be satisfed. We utilized logistic regression for the multivariate analysis of factors associated with treatment success. We have included the following variables into the models based on clinical considerations: age, gender, number of chronic medications, number of total symptoms, and the three most prevalent symptoms: restlessness, rage attacks and agitation (as a dichotomous variable- yes/no), as refected in the intake form. P value < 0.05 was considered to be statistically significant. All analyses were performed at the Clinical Research Centre, Soroka University Medical Centre, Beer-Sheva, Israel using IBM SPSS version 22 (SPSS, Chicago, IL).

SCIeNTIFIC REPorTS | (2019)9:200 | DOI:10.1038/s41598-018-37570-y 5 www.nature.com/scientificreports/

Declarations. Te study was approved by Soroka University Medical Center Ethics Committee (study num- ber: SCRC-0415-15) and the need for informed consent was waived due to the retrospective nature of the data analysis. Availability of Data Te data set generated and/or analysed during the current study are not publicly available due to medical conf- dentiality but are available from the frst author on reasonable request summarized form pending the approval of the IRB. References 1. Bax, M. Autism. Dev Med Child Neurol 36, 659–660 (1994). 2. Services, C. D. o. D. (California Health and Human Services Agency, Department of Developmental Services Sacramento, 1999). 3. Croen, L. A., Grether, J. K., Hoogstrate, J. & Selvin, S. Te changing prevalence of autism in California. Journal of autism and developmental disorders 32, 207–215 (2002). 4. Boyle, C. A. et al. Trends in the prevalence of developmental disabilities in US children, 1997–2008. Pediatrics 127, 1034–1042 (2011). 5. Lundström, S., Reichenberg, A., Anckarsäter, H., Lichtenstein, P. & Gillberg, C. Autism phenotype versus registered diagnosis in Swedish children: prevalence trends over 10 years in general population samples. bmj 350, h1961 (2015). 6. Masi, A., DeMayo, M. M., Glozier, N. & Guastella, A. J. An Overview of Autism Spectrum Disorder, Heterogeneity and Treatment Options. Neuroscience Bulletin 33, 183–193, https://doi.org/10.1007/s12264-017-0100-y (2017). 7. Aran, A., Cassuto, H. & Lubotzky, A. Cannabidiol Based Medical Cannabis in Children with Autism- a Retrospective Feasibility Study (P3.318). Neurology 90 (2018). 8. Anderson, C. L. et al. Cannabidiol for the treatment of drug-resistant epilepsy in children: current state of research. Journal of Pediatric Neurology 15, 143–150 (2017). 9. Kurz, R. & Blaas, K. Use of dronabinol (delta-9-THC) in autism: a prospective single-case-study with an early infantile autistic child. Cannabinoids 5, 4–6 (2010). 10. Kruger, T. & Christophersen, E. An open label study of the use of dronabinol (Marinol) in the management of treatment-resistant self-injurious behavior in 10 retarded adolescent patients. Journal of Developmental & Behavioral Pediatrics 27, 433 (2006). 11. Maccarrone, M. et al. Abnormal mGlu 5 receptor/endocannabinoid coupling in mice lacking FMRP and BC1 RNA. Neuropsychopharmacology 35, 1500 (2010). 12. Jung, K.-M. et al. Uncoupling of the endocannabinoid signalling complex in a mouse model of fragile X syndrome. Nature communications 3, 1080 (2012). 13. Busquets-Garcia, A. et al. Targeting the endocannabinoid system in the treatment of fragile X syndrome. Nature medicine 19, 603 (2013). 14. Liu, Q. R. et al. Species diferences in cannabinoid receptor 2 (CNR2 gene): identifcation of novel human and rodent CB2 isoforms, diferential tissue expression and regulation by cannabinoid receptor ligands. Genes, Brain and Behavior 8, 519–530 (2009). 15. Kerr, D., Downey, L., Conboy, M., Finn, D. & Roche, M. Alterations in the endocannabinoid system in the rat valproic acid model of autism. Behavioural brain research 249, 124–132 (2013). 16. Wei, D. et al. Endocannabinoid signaling mediates oxytocin-driven social reward. Proceedings of the National Academy of Sciences 112, 14084–14089 (2015). 17. Siniscalco, D. et al. Cannabinoid receptor type 2, but not type 1, is up-regulated in peripheral blood mononuclear cells of children afected by autistic disorders. Journal of autism and developmental disorders 43, 2686–2695 (2013). 18. Zamberletti, E., Gabaglio, M. & Parolaro, D. Te endocannabinoid system and autism spectrum disorders: insights from animal models. International journal of molecular sciences 18, 1916 (2017). 19. Piomelli, D. Te molecular logic of endocannabinoid signalling. Nature Reviews Neuroscience 4, 873 (2003). 20. Colizzi, M., McGuire, P., Pertwee, R. G. & Bhattacharyya, S. Efect of cannabis on glutamate signalling in the brain: A systematic review of human and animal evidence. Neuroscience & Biobehavioral Reviews 64, 359–381 (2016). 21. Meyer-Lindenberg, A., Domes, G., Kirsch, P. & Heinrichs, M. Oxytocin and vasopressin in the human brain: social neuropeptides for translational medicine. Nature Reviews Neuroscience 12, 524 (2011). 22. Green, J. J. & Hollander, E. Autism and oxytocin: new developments in translational approaches to therapeutics. Neurotherapeutics 7, 250–257 (2010). 23. Lin, I.-F. et al. Te efect of intranasal oxytocin versus placebo treatment on the autonomic responses to human sounds in autism: a single-blind, randomized, placebo-controlled, crossover design study. Molecular autism 5, 20 (2014). 24. Radbruch, L. & Nauck, F. A review of side efects and complications with cannabinoid treatment. Schmerz (Berlin, Germany) 17, 274–279 (2003). 25. Walsh, D., Nelson, K. A. & Mahmoud, F. Established and potential therapeutic applications of cannabinoids in oncology. Supportive Care in Cancer 11, 137–143 (2003). 26. Fabre, L. F. & Mclendon, D. Te efcacy and safety of nabilone (a synthetic cannabinoid) in the treatment of anxiety. Te Journal of Clinical Pharmacology 21 (1981). 27. Walther, S., Schüpbach, B., Seifritz, E., Homan, P. & Strik, W. Randomized, controlled crossover trial of dronabinol, 2.5 mg, for agitation in 2 patients with dementia. Journal of clinical psychopharmacology 31, 256–258 (2011). 28. Walther, S., Mahlberg, R., Eichmann, U. & Kunz, D. Delta-9-tetrahydrocannabinol for nighttime agitation in severe dementia. Psychopharmacology 185, 524–528 (2006). 29. Volicer, L., Stelly, M., Morris, J., McLAUGHLIN, J. & Volicer, B. J. Efects of dronabinol on anorexia and disturbed behavior in patients with Alzheimer’s disease. International journal of geriatric psychiatry 12, 913–919 (1997). 30. Salzman, C., Kochansky, G. E., Van Der Kolk, B. A. & Shader, R. I. Te efect of marijuana on small group process. Te American journal of drug and alcohol abuse 4, 251–255 (1977). 31. Salzman, C., Van der Kolk, B. A. & Shader, R. I. Marijuana and hostility in a small-group setting. Te American journal of psychiatry (1976). 32. Crippa, J. A. S. et al. Neural basis of anxiolytic efects of cannabidiol (CBD) in generalized social anxiety disorder: a preliminary report. Journal of Psychopharmacology 25, 121–130 (2011). 33. Bergamaschi, M. M. et al. Cannabidiol reduces the anxiety induced by simulated public speaking in treatment-naive social phobia patients. Neuropsychopharmacology 36, 1219 (2011). 34. Group, W. Development of the World Health Organization WHOQOL-BREF quality of life assessment. Psychological medicine 28, 551–558 (1998). Acknowledgements Tikun Olam LTD. supported the study.

SCIeNTIFIC REPorTS | (2019)9:200 | DOI:10.1038/s41598-018-37570-y 6 www.nature.com/scientificreports/

Author Contributions L.B.L.S., V.N. and R.M. planned the study; N.S. collected the data, L.B.L.S. and V.N. analysed the data, L.B.L.S. wrote the manuscript, V.N. and G.M. reviewed and approved the manuscript. Additional Information Supplementary information accompanies this paper at https://doi.org/10.1038/s41598-018-37570-y. Competing Interests: L.B.L.S. and N.S. are employees of Tikun-Olam Ltd. V.N. is a paid member of the Tikun Olam Ltd. scientifc advisory board. R.M. and G.M. have no conficts of interest pertaining to the current manuscript. Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional afliations. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre- ative Commons license, and indicate if changes were made. Te images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not per- mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

© Te Author(s) 2019

SCIeNTIFIC REPorTS | (2019)9:200 | DOI:10.1038/s41598-018-37570-y 7 Pretzsch et al. Translational Psychiatry (2019) 9:313 https://doi.org/10.1038/s41398-019-0654-8 Translational Psychiatry

ARTICLE Open Access Effects of cannabidivarin (CBDV) on brain excitation and inhibition systems in adults with and without Autism Spectrum Disorder (ASD): a single dose trial during magnetic resonance spectroscopy Charlotte M Pretzsch1, Bogdan Voinescu 1,DavidLythgoe 2, Jamie Horder1, Maria Andreina Mendez1, Robert Wichers 1, Laura Ajram1,GlynisIvin3, Martin Heasman3, Richard A. E. Edden4, Steven Williams 2, Declan G. M. Murphy 1, Eileen Daly1 and Gráinne M. McAlonan1

Abstract Autism spectrum disorder (ASD) is a high cost neurodevelopmental condition; and there are currently no effective pharmacological treatments for its core symptoms. This has led some families and researchers to trial alternative remedies – including the non-intoxicating Cannabis sativa-derived compound cannabidivarin (CBDV). However, how CBDV affects the human brain is unknown. Previous (pre)clinical evidence suggests that CBDV may modulate brain excitatory-inhibitory systems, which are implicated in ASD. Hence, our main aim was to test, for the first time, if CBDV shifts glutamate and/or GABA metabolites – markers of the brain’s primary excitatory and inhibitory system - in both the ‘typical’ and autistic brain. Our subsidiary aim was to determine whether, within ASD, brain responsivity to CBDV challenge is related to baseline biological phenotype. We tested this using a repeated-measures, double-blind,

1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; randomized-order, cross-over design. We used magnetic resonance spectroscopy (MRS) to compare glutamate (Glx = glutamate + glutamine) and GABA + (GABA + macromolecules) levels following placebo (baseline) and 600 mg CBDV in 34 healthy men with (n = 17) and without (n = 17) ASD. Data acquisition from regions previously reliably linked to ASD (dorsomedial prefrontal cortex, DMPFC; left basal ganglia, BG) commenced 2 h (peak plasma levels) after placebo/ CBDV administration. Where CBDV significantly shifted metabolite levels, we examined the relationship of this change with baseline metabolite levels. Test sessions were at least 13 days apart to ensure CBDV wash-out. CBDV significantly increased Glx in the BG of both groups. However, this impact was not uniform across individuals. In the ASD group, and not in the typically developing controls, the ‘shift’ in Glx correlated negatively with baseline Glx concentration. In contrast, CBDV had no significant impact on Glx in the DMPFC, or on GABA+ in either voxel in either group. Our findings suggest that, as measured by MRS, CBDV modulates the glutamate-GABA system in the BG but not in frontal regions. Moreover, there is individual variation in response depending on baseline biochemistry. Future studies should examine the effect of CBDV on behaviour and if the response to an acute dose of CBDV could predict a potential clinical treatment response in ASD.

Introduction Correspondence: Gráinne M. McAlonan ([email protected]) Autism spectrum disorder (ASD) is a complex neuro- 1Department of Forensic and Neurodevelopmental Sciences, Institute of Psychiatry, Psychology & Neuroscience, King’s College London, London, UK developmental condition estimated to affect up to 1 in 59 2Department of Neuroimaging Sciences, Institute of Psychiatry, Psychology & individuals1. ASD incurs a high cost. For instance, the ’ Neuroscience, King s College London, London, UK average life expectancy in individuals with high func- Full list of author information is available at the end of the article. These authors contributed equally: Declan G.M. Murphy, Eileen Daly, Gráinne tioning ASD is 12 years shorter than that in so-called M. McAlonan

© The Author(s) 2019 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a linktotheCreativeCommons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 2 of 10

‘neurotypicals’2. Despite this, there are no effective phar- desensitize these receptors. TRP receptors are located on macological treatments for the core symptoms of ASD. cortical and subcortical excitatory pyramidal cells7, inhi- Researchers are therefore increasingly exploring alter- bitory interneurons7, and microglia8, including in the native remedies, such as the non-intoxicating Cannabis basal ganglia (BG) and the dorsomedial prefrontal cortex – sativa-derived compounds cannabidiol (CBD) and can- (DMPFC)9 13. Thus, CBDV could potentially modulate nabidivarin (CBDV)3,4. For instance, in a recently pub- the activity of neurons and glia directly involved in E-I lished study using magnetic resonance spectroscopy regulation6 in key cortical and subcortical neural hubs. (MRS) we examined, for the first time, the effects of CBD This is especially relevant to ASD, where subtle E-I – on brain excitatory (E) glutamate and inhibitory (I) γ- alterations in several cortical-subcortical circuits14 16, aminobutyric acid (GABA) – given that E-I abnormalities including in the BG and DMPFC, have been linked to may be one of the key mechanisms underpinning ASD3. ASD symptoms17,18. Despite this, no study to date has We found that CBD modulated glutamate-GABA systems examined the effect of CBDV on cortical and/or sub- in both ASD and neurotypicals, but that prefrontal GABA cortical glutamate and/or GABA indices in-vivo in neu- systems responded differently in ASD. Specifically, CBD rotypical individuals, let alone those with ASD. decreased prefrontal GABA levels in ASD but not in Previous evidence suggests that autistic individuals may controls. These findings contributed to increasing evi- respond atypically to pharmacological challenge. For dence that an important effect of therapeutic compounds instance, in our recent study we discovered that, in the BG derived from Cannabis sativa may be the ‘shifting’ of and DMPFC, CBD elicited a similar response in glutamate brain E-I systems. systems, but an opposite effect in GABA systems in the There is a growing number of clinical trials of these neurotypical compared to the autistic adult brain3.In compounds, including the first trial in ASD, which addition to this between-group difference, our work has investigates the impact of CBDV on irritability in autistic also revealed that there is response variability to phar- children (clinicaltrials.gov, identifier: NCT03202303). macological challenge within the autistic population3,18. Unfortunately, however, most clinical trials which address These findings raise the question as to whether the bio- ‘core’ social and/or repetitive behaviour symptoms of ASD logical response to CBDV also varies within the autistic fail. There are many reasons for this – but principal population; and if so, which phenotypic measures may among them are that the candidate treatment may not help predict treatment response. However, whether biol- ‘shift’ key mechanisms implicated in the disorder, and/or ogy helps predict a (drug-induced) shift in E-I metabolite that they use an ‘all-comers’ approach (i.e., all patients concentrations in ASD remains to be investigated. meeting a broad set of eligibility criteria are included)5. Therefore, we examined for the first time: (1) the bio- This is relevant to ASD, which is a highly heterogeneous logical impact of CBDV on the typical and autistic brain, condition, where the response to candidate treatments (2) if the response to CBDV is uniform across groups, and may vary between individuals and where no single (3) the potential biological (baseline) correlates of approach is likely to succeed for everyone5. A pressing response variability within ASD. goal should therefore be to determine objectively how We tested this using a repeated-measures, randomized- candidate treatments, such as CBDV, impact upon the order, placebo-controlled, double-blind, cross-over typical and atypical (autistic) brain; and who may be design. We compared magnetic resonance spectroscopy (biologically) responsive prior to clinical trial. Establishing (MRS) measures of Glx (glutamate + glutamine) and an objective marker of biological response or ‘target GABA + (GABA+ macromolecules, see Methods) in engagement’ (e.g., using a marker of brain biochemistry) adult men with and without a diagnosis of ASD following may be useful when a change in a biological target is a single oral dose of 600 mg CBDV or a matched placebo. linked to a change in behaviour. This may improve the Data were collected from the BG and DMPFC because success of drug trials by helping to predict if someone will these regions have been reliably implicated in ASD, and respond – or not – to a pharmacological treatment with a alterations in E-I dynamics can be detected in these tar- – change in behaviour, i.e., it may inform stratification gets using MRS3,13 18. To explore variability of the drug approaches. This has not yet been achieved for CBDV. response (where CBDV significantly shifted metabolite We know from preclinical studies that CBDV may act levels), we examined the relationship of any CBDV on several neuroglial targets. Many of these effects are induced shift in metabolite with baseline metabolite levels. thought to converge to modulate glutamatergic and GABAergic pathways. For instance, CBDV binds to sev- Materials and Methods eral members of the Transient Receptor Potential (TRP) Procedure family, including vanilloid type 1 (TRPV1), vanilloid type This research was conducted in accordance with the 2 (TRPV2), and ankyrin type 1 (TRPA1) receptors6 and, Declaration of Helsinki, at the Institute of Psychiatry, upon binding, CBDV is thought to activate and rapidly Psychology, and Neuroscience (IoPPN) at De Crespigny Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 3 of 10

Park, SE5 8AF, London, UK (August 2016 to August demographics). Power analyses suggested that this sample 2018). All our participants provided written informed size was enough to detect a drug-induced 10% change in consent. Every participant took part in all aspects of this Glx (e.g. after ketamine administration20) at a power of 0.8 case-control, placebo-controlled, randomised, double- and a significance level of α = 0.05. All autistic partici- blind, repeated-measures, cross-over study. This research pants had a clinical diagnosis of ASD according to ICD10 – was conducted as part of a larger study into the role of research criteria21 23, and their severity of symptoms was phytocannabinoids in ASD (ethical approval provided by confirmed using standardised research diagnostic instru- the King’s College London Research Ethics Committee, ments where appropriate (ADOS Autism Diagnostic reference HR15/162744). Although the UK Medicines and Observation Schedule23; and ADI-R Autism Diagnostic Health Regulatory Authority (MHRA) confirmed that our Interview-Revised22). experimental design was not a Clinical Trial, for trans- parency the study was registered on clinicaltrials.gov Imaging data acquisition (identifier: NCT03537950, entry name: HR15-162744). We acquired all our imaging data on a 3 T GE Excite II Drugs (placebo, PLC; or CBDV) were allocated in a magnetic resonance imaging (MRI) scanner (GE Medical pseudo-randomised order so that approximately half in Systems, Milwaukee, WI, USA). Our scanning protocol each group attended a placebo visit before CBDV; and half included a structural MRI scan acquired using a 3D attended a CBDV visit before placebo. This randomisation inversion recovery prepared fast spoiled gradient recalled was conducted by Prof. McAlonan using a random (IR-FSPGR) sequence (slice thickness = 1.1 mm, spatial number generator (https://www.random.org/). All parti- positions = 124, flip angle = 20°, field of view (FoV) = cipants and researchers directing the study were blinded 280 mm, echo time (TE) = 2.844 ms, repetition time (TR) to the order of drug/placebo exposure. Participants = 7.068 ms, inversion time = 450 ms, matrix = 256 × attended for two visits, which were separated by a mini- 256). This structural scan was conducted to obtain mum of 13 days to allow for drug wash-out. On each visit, information used during the preprocessing of the spec- we collected urine samples to screen for illicit substances troscopy scan. The scanning protocol further included a (a full list is included below). Subsequently, participants spectroscopy scan based on the MEshcher-GArwood underwent a brief health check, received a liquid oral dose Point RESolved Spectroscopy (MEGA-PRESS) sequence. of the pharmacological probe (600 mg of CBDV; in line We acquired data (352 datapoints) from two voxels: the with previous single dose studies of non-psychoactive first was positioned in the BG (echo time (TE) = 68 ms, cannabinoids in adults (e.g., ref. 19) or a matched placebo, repetition time (TR) = 1800 ms, voxel size = 35 × 30 × both provided by GW Research Ltd, Cambridge, UK), and 25 mm3). The second voxel was positioned in the then underwent a second brief health check to test for DMPFC (TE = 68 ms, TR = 2000 ms, voxel size = 25 × potential acute adverse reactions/side effects. Participants 40 × 30 mm3). commenced scanning timed to coincide with peak plasma (2 h) concentration. After the scan, participants under- Urine test went a final health check to ensure they had experienced We performed liquid chromatography–mass spectro- no ill-effects and were fit to leave the department. Parti- metry (LC–MS) analysis on urine samples provided by cipants experienced no ill/unintended effects. each subject before the drug administration to evaluate presence or absence of illicit substances that could con- Participants found our results. Therefore, all participants that screened We excluded all potential participants that had a positive for any of the drugs tested, including Ampheta- comorbid major psychiatric or medical disorder affecting mines (Amphetamine, Methamphetamine, MDMA/ brain development (e.g. schizophrenia or epilepsy), a Ecstasy), Benzodiazepines, Cannabis, Cocaine (as ben- known genetic condition associated with ASD (e.g. Fragile zoylecgonine), Methadone and its metabolite EDDP, and X syndrome), a history of brain/head injury, a full-scale Opioids (6-monoacetylmorphine, morphine, codeine, intelligence quotient (FSIQ) below 70, or who were reliant dihydrocodeine) were excluded from further analysis. on receiving regular medication known to directly influ- This led to the exclusion of four subjects (two typically ence Glx or GABA levels+, such as benzodiazepines. developing controls, two ASD) from the original sample. Participants were asked to refrain from using cannabis and/or other illicit substances in the month before scan- Data processing ning, and from drinking alcohol on the day before testing. Structural data processing Data from all individuals that screened positive for illicit We inspected all T1-weighted structural MRI volumes substances in the urine drug screening were excluded. As manually to ensure adequate signal-to-noise ratio (SNR) a result, we retained data from 34 subjects (17 neuroty- and the absence of motion artefacts. Subsequently, we picals, 17 individuals with ASD) (see Table 1 for normalised our structural volumes to Montreal Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 4 of 10

Table 1 Participant demographics Summary of participant demographics for all subjects, unless otherwise specified.

Variable (SD) TD ASD F(Dof) P-value

N (M/F) 17 (17/0) 17 (17/0) Age (Y) 28.47 (6.55) 31.29 (9.94) F(1) = 0.956 0.335 Time between visits 28.15 (15.19) 32.43 (16.54) F(1) = 0.487 0.492 FSIQ 124.59 (12.7) 111.35 (18.80) F(1) = 5.781 0.022 ADI COM 8.10 (6.77) (n = 10) ADI SOC 9.30 (4.88) (n = 10) ADI RRSB 3.60 (2.17) (n = 10) ADOS COM 4.53 (2.79) (n = 17) ADOS IM 1.07 (0.80) (n = 15) ADOS SBRI 1.50 (1.51) (n = 16) ADOS SOC 7.94 (3.77) (n = 17)

ADI Autism diagnostic interview, (COM communication subscale, SOC social interaction subscale, RRSB restricted, repetitive, and stereotyped patterns of behavior subscale), ADOS Autism diagnostic observation schedule (COM communication subscale, IM imagination and creativity subscale, SOC reciprocal social interaction subscale, SBRI stereotyped behaviors and restricted interests subscale), ASD Autism spectrum disorder, F(Dof) F-value and degrees of freedom, F Female, FSIQ Full-scale intelligence quotient, M Male, N Number of subjects, SD Standard deviation, TD Typically developing controls, y years

Neurological Institute (MNI) space and segmented them Partial volume effects (different proportions of GM, into grey matter (GM), white matter (WM), and cere- WM, and CSF in the MRS voxels) are a potential confound brospinal fluid (CSF), to obtain percentage measures of in MRS, especially in light of previously reported volu- tissue composition in each individual MRS voxel, using metric differences between autistic and neurotypical indi- positional coordinates embedded in the raw spectra viduals26. Therefore, to account for partial volume effects, data files. we corrected all metabolite values for GM, WM, and CSF percentages. Assuming that CSF only contains negligible Magnetic resonance spectroscopy data processing quantities of the metabolites of interest, the calculations We pre-processed our MRS data using in-house scripts were as follows: LCModel assumes a voxel consists to 100% adapted from FID-A24, which prepared the data for of WM with a water concentration (WCONC) of reading into the main processing software. This pre- 35880 mM and corrects each metabolite value (where processing comprised converting data to the correct file F stands for fraction) using the factor: (43300 ∗ FGM + format, combining receiver channels, removing ‘bad’ 35880 ∗ FWM + 55556 ∗ FCSF)/(1 − FCSF). To correct for averages (>4 standard deviations), correcting frequency the value of water concentration being used in the pro- drift (alignment of averages), separating and visualizing cessing through LCModel, we divided values by an indi- the edit on/off spectra, and subtracting them to produce vidual correction factor (35880), arriving at (1.207 ∗ FGM + the difference spectrum. We further inspected all spectra FWM + 1.548 ∗ FCSF)/(1 − FCSF). Thus, our corrected manually to ensure adequate SNR as well as the absence metabolite values were obtained by multiplying the raw of artefacts25,27. metabolite values by this correction. Since we did not We processed our MRS data using LCModel v6.3-1L measure relaxation times for tissue water and metabolites, software (Stephen Provencher Incorporated, Oakville, these were not corrected for - with the exception of 27 Canada). This software uses a linear combination of assuming the tissue water relaxation time (T2 = 80 ms) . model spectra derived from metabolite solutions in vitro Moreover, to improve the robustness of our findings, we to analyse the major resonances of in vivo spectra. Here, excluded all measurements of Glx (glutamate + gluta- we used a basis set (mega-press-3T-1) to determine mine) and GABA+ where the Cramér-Rao lower bound concentrations of GABA + (40% of the GABA signal (CRLB) estimates exceeded 15% from further analysis represents macromolecules)25 and Glx (glutamate + glu- (LCModel manual, Stephen Provencher Incorporated, tamine). The spectra also included glutathione (GSH), N- Oakville, Canada). Based on this, we excluded eight data acetyl-aspartate (NAA), N-acetyl-aspartylglutamate points from three subjects (1 neurotypical, 2 ASD): neu- (NAAG), NAA + NAAG, and GSH + Glu + Gln in each rotypicals: 1: DMPFC GABA+CBDV; ASD: 2: BG GlxPLC; voxel; however, for the purposes of this study, we focused 3: DMPFC GABA+PLC & GlxPLC, DMPFC GABA+CBDV only on GABA+ and Glx. & GlxCBDV, and BG GABA+CBDV & GlxCBDV. Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 5 of 10

Statistical analysis CBDV WM (F(1) = 7.89, p = 0.010); but not for other We compared demographic measures (age, FSIQ) and tissues, as summarised in Table 2. This is in line with baseline levels of Glx and GABA+ in each region of previous studies that have demonstrated morphological interest using a one-way ANOVA (significance level differences in the BG in autistic compared to neurotypical p < 0.05). individuals26,28. Moreover, as the composition properties To examine our primary hypothesis that CBDV shifts of these tissues differed significantly at baseline and dur- Glx and/or GABA+ in our two brain regions of interest ing the drug condition, this difference was not induced (BG and DMPFC), we conducted 2 × 2 mixed-model through CBDV. In the statistical analysis we corrected all ANOVAs with group (neurotypicals, ASD) as the metabolite values accordingly. between-subject factor, and drug (PLC, CBDV) as the To ensure that the MRS data quality did not differ within-subject factor for each metabolite in each region between groups, we compared the LCModel Cramér-Rao separately. We included the following subject numbers: Lower Bound estimates for each metabolite (Glx, for Glx measures in BG, ASD n = 12, neurotypicals n = GABA+) in each voxel (excluding omitted spectra), using 11; for Glx measures in DMPFC, ASD n = 12, neuroty- a one-way ANOVA29. As predicted, there were no sig- picals n = 13; for GABA+ measures in BG, ASD n = 12, nificant differences (all F(1) ≤ 2.751, all p ≥ 0.107), as neurotypicals n = 13; and for GABA+ measures in the depicted in Table 3. DMPFC, ASD n = 11, neurotypicals n = 11. With the Extended MRS studies can be confounded by ‘drift’, caveat that Bonferroni correction can be overly con- where metabolite estimates on the same scanner change servative, we also report Bonferroni corrected p-values across long periods of time. Therefore, we compared the alongside any significant uncorrected results. inter-scan duration (days between PLC and CBDV scan) We examined the relationship between significant drug- between groups; and found no significant difference (F(1) induced shifts in metabolite levels (CBDV-PLC) and = 0.487, p = 0.492), as shown in Table 1. Moreover, scan baseline metabolite measures across the ASD group using date for each drug condition (PLC, CBDV) did not cor- Pearson’s correlation analyses (p < 0.05). relate with metabolite values at that drug condition (all Analyses were carried out using SPSS 24.00 software Pearson’s r ≤ 0.329, all p ≥ 0.087), confirming that data (SPSS, Chicago, IL, USA), and graphs were generated acquisition was stable over time. using GraphPad Prism version 7 for Mac, GraphPad Software, La Jolla, CA, USA, www.graphpad.com. Metabolite differences Glx (glutamate + glutamine) Results In the BG, we observed a significant effect of drug 2 Demographics (F(1, 21) = 7.268, puncorr = 0.014, η = 0.257). Across We retained data from 17 neurotypicals (three of groups, CBDV increased Glx compared to PLC, as dis- those only had a scan after placebo and not after CBDV), played in Fig. 1a, b. This effect survived correction for and from 17 individuals with ASD (four of those only multiple comparisons across voxels (pcorr = 0.03). In had a scan after placebo and not after CBDV). Groups contrast, there was no significant effect of group (F(1) = were similar in age (F(1) = 0.956, p = 0.335), but, as is 0.763, p = 0.392, η2 = 0.035), and no group × drug inter- commonly reported, autistic individuals had a slightly action effect (F(1, 21) = 0.235, p = 0.633, η2 = 0.011). In lower FSIQ than typically developing controls and this the DMPFC, there was no significant effect of drug or difference was significant (F(1) = 5.781, p = 0.022). group, and no group × drug interaction effect (Fig. 1a). However, FSIQ did not correlate with drug-induced metabolite shifts across groups (all r ≤ 0.34, all p ≥ GABA+ 0.122). FSIQ correlated with Glx shift in the BG within We observed no significant main or interaction effects the ASD group (r = 0.70, p = 0.016, n = 11), but this within either voxel (Fig. 1c). correlation was not significant in the neurotypicals (r = −0.10, p = 0.765, n = 11) and did not differ significantly Relationship to baseline metabolite measures between groups (p > 0.05). This suggests that the There was a significant negative correlation between the between-group difference in FSIQ did not influence our CBDV-induced BG Glx shift and baseline Glx levels in results (Table 1). ASD (r = −0.749, p = 0.005, n = 12), but not in the typi- cally developing controls (r = 0.014, p = 0.967, n = 11). Tissue composition and data quality This correlation differed significantly between groups Tissue percentages (not excluding omitted spectra) (p = 0.04). (Fig. 1d). In interpreting this result, we caution differed significantly between groups for BG PLC GM that recent studies suggest that correlations between (F(1) = 7.307, p = 0.011), BG PLC WM (F(1) = 9.345, p = baseline and change scores in randomized controlled 0.004), BG CBDV GM (F(1) = 6.70, p = 0.016), and for BG trials are common and may represent a regression to the Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 6 of 10

Table 2 Percentage of GM, WM, and CSF in voxels of interest Absolute values (and standard deviations).

Voxel Drug Tissue TD ASD F(dof) p-value

BG PLC GM (SD) 42.53% (3.03%) 45.43% (3.21%) F(1) = 7.307 0.011 WM (SD) 50.47% (3.39%) 46.54% (4.08%) F(1) = 9.345 0.004 CSF (SD) 6.92% (1.33%) 7.95% (1.95%) F(1) = 3.222 0.082 CBDV GM (SD) 41.65% (2.40%) 44.68% (3.47%) F(1) = 6.70 0.016 WM (SD) 51.71% (2.95%) 47.23% (4.94%) F(1) = 7.89 0.010 CSF (SD) 6.56% (1.36%) 8.01% (2.48%) F(1) = 3.42 0.077 DMPFC PLC GM (SD) 52.93% (2.21%) 52.38% (3.49%) F(1) = 0.299 0.589 WM (SD) 27.24% (3.36%) 28.11% (3.65%) F(1) = 0.527 0.473 CSF (SD) 19.73% (4.05%) 19.41% (2.57%) F(1) = 0.076 0.784 CBDV GM (SD) 52.68% (3.16%) 53.41% (3.67%) F(1) = 0.30 0.590 WM (SD) 27.94% (4.23%) 27.52% (4.13%) F(1) = 0.07 0.802 CSF (SD) 19.25% (5.13%) 18.97% (2.22%) F(1) = 0.03 0.857

ASD Autism spectrum disorder, BG Basal ganglia, CBDV Cannabidivarin, CSF Cerebrospinal fluid, DMPFC Dorsomedial prefrontal cortex, F(dof) F-value and degrees of freedom, GM Grey matter, PLC Placebo, SD Standard deviation, TD Typically developing controls, WM White matter

Table 3 Cramér-Rao Lower Bound estimates for each metabolite (Glx, GABA+) in each voxel Absolute values (and standard deviations).

Voxel Drug Metabolite TD ASD F(dof) p-value

BG PLC GABA+ 4.56 (0.66) 4.82 (0.81) F(1) = 1.095 0.303 Glx 7.50 (2.09) 7.56 (2.25) F(1) = 0.007 0.935 CBDV GABA+ 4.38 (0.51) 4.79 (0.80) F(1) = 2.371 0.136 Glx 6.77 (1.36) 7.21 (2.29) F(1) = 0.368 0.549 DMPFC PLC GABA+ 6.47 (0.87) 7.38 (2.06) F(1) = 2.751 0.107 Glx 5.68 (0.73) 5.88 (1.02) F(1) = 0.416 0.524 CBDV GABA+ 6.50 (0.67) 7.07 (1.73) F(1) = 1.153 0.294 Glx 5.85 (1.14) 5.57 (0.94) F(1) = 0.469 0.500

ASD Autism spectrum disorder, BG Basal ganglia, CBDV Cannabidivarin, CSF Cerebrospinal fluid, DMPFC Dorsomedial prefrontal cortex, F(dof) F-value and degrees of freedom, GABA+ gamma-aminobutyric acid + macromolecules, Glx glutamate + glutamine, PLC Placebo, SD Standard deviation, TD Typically developing controls mean, rather than the treatment effect30. To account for Discussion this effect in our analyses, we re-ran our repeated- We have demonstrated that a single acute dose of measures ANOVAs as ANCOVAs with baseline meta- CBDV ‘shifts’ subcortical levels of Glx, the brain’s primary bolite levels as a covariate and found that the direction- excitatory neurotransmitter, in the living adult human ality and significance of our results remained the same. brain. The direction of shift was the same across the We still observed an opposite direction of correlation neurotypical and autistic participants, i.e., CBDV induced between baseline levels and drug-induced changes in Glx a mean increase in BG Glx in both groups. However, the in the two groups. We emphasize that our study is not response to CBDV varied within the ASD group and designed to investigate the degree to which any correla- correlated negatively with baseline BG Glx levels. In tion with baseline reflects underlying neurobiology or a contrast, CBDV had no impact on Glx in DMPFC, nor on purely statistical effect. However, it is possible that a GABA+ levels in either voxel. Moreover, congruent with biological group differences at least partly contributes to some18,30, but not all previous MRS studies of glutamate the different relationships found in each group. and GABA in ASD18,31,32 in the BG and DMPFC, there Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 7 of 10

Fig. 1 a Glx (glutamate + glutamine) in the basal ganglia and dorsomedial prefrontal cortex for both groups in both drug conditions. Glx concentration (y-axis) represents the ratio of the Glx metabolite resonance area to the unsuppressed water resonance area. b Drug-induced shift in Glx in the basal ganglia. ΔGlx (y-axis) represents the cannabidivarin (CBDV)-induced shift in Glx concentration compared to placebo (PLC), i.e. CBDV- PLC. Group means are indicated by black horizonal bars. Error bars represent standard deviations. c gamma-aminobutyric acid + macromolecules (GABA+) in the basal ganglia and dorsomedial prefrontal cortex for both groups in both drug conditions. GABA+ concentration (y-axis) represents the ratio of the GABA+ metabolite resonance area to the unsuppressed water resonance area. d Correlation between Glx at baseline and CBDV- induced shift in Glx (ΔGlx) in the basal ganglia. ASD Autism spectrum disorder, BG Basal ganglia, CBDV Cannabidivarin, DMPFC Dorsomedial prefrontal cortex, Glx glutamate + glutamine, ns Not significant, PLC Placebo, TD Typically developing controls, * indicates a significance level at p ≤ 0.05. were no between-group differences in baseline metabo- excitatory pyramidal (and inhibitory projection) neu- lite levels. rons33, which are densely surrounded by TRP receptors Thus, our study suggests that CBDV targets subcortical (including TRPV1, TRPV2, and TRPA1)10,34,35. CBDV excitatory glutamate systems both in autistic and neuro- may have bound to and subsequently activated these typical adults; but that individual responses in autistic pyramidal neuron-bound TRP receptors, thereby brains vary depending on baseline Glx levels. increasing Glx in this region. This is supported by pre- vious evidence that CBDV may modulate excitatory Neurobiological underpinnings of the effect of CBDV on neurotransmission through a TRP receptor-dependent Glx in the BG mechanism6. The BG also contain a particularly high Our findings suggest that CBDV may serve as a tool to number of microglia36; and it is possible that CBDV shift Glx in specific subcortical regions (the left BG) both increased Glx levels here by activating microglial TRP in the neurotypical and autistic brain. The neurobiological receptors. Specifically, activation of TRP receptors has underpinnings of this effect, however, are not entirely been shown to upregulate microglial activity and migra- clear. Previous evidence suggests several possible neuro- tion8, which is known to enhance extracellular vesicular biological mechanisms through which CBDV may influ- shedding and subsequent glutamate release8,37. The pre- ence Glx pathways in the BG. For instance, preclinical frontal cortex has a different configuration of receptors studies have shown that the BG contain a wealth of and cells compared to the BG, which might explain a Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 8 of 10

different response to CBDV here. We have previously ability to discern intra- and extra-cellular metabolite reported that CBD causes a differential effect on pre- levels. Additional studies using more advanced technol- frontal GABA+ in the autistic compared to neurotypical ogies, such as (ultra-) high-field MRS are required to brain. Unfortunately, the cellular mechanisms under- address this limitation. pinning the effects of cannabinoids have not yet been fully MRS further has the disadvantage of relying on pre- uncovered. Consequently, we do not yet know which selected regions-of-interest to be defined before the study. cellular response differences contribute to their divergent Thus, we cannot know how CBDV might modulate effects on excitatory and inhibitory metabolites at ‘bulk metabolites in other parts of the brain. This may change tissue’ level. In sum, across groups, CBDV may have in the future with the development of sequences that shifted Glx through multiple neuroglial mechanisms. allow whole-brain scanning53. At this point however, we are not aware of a scanning sequence that allows whole- Drug-response variability in ASD in relation to baseline brain spectroscopy of glutamate and GABA in a reason- measures able time frame. Although the mean effect of CBDV on Glx was uniform Also, our sample size in this pilot study was modest. across groups, the drug response varied within groups. In This was due to (i) our strict inclusion and exclusion ASD (but not in the neurotypicals), the drug-induced shift criteria (e.g. exclusion of participants using glutamate and in BG Glx correlated significantly (negatively) with base- GABA-acting drugs); (ii) our time-intensive repeated- line Glx. Specifically, in the autistic individuals with the measures testing (involving drug administration), which lowest baseline Glx measures, CBDV increased Glx levels; was not always practical for participants; and (iii) our whereas the individuals with the highest baseline Glx rigorous data quality control, e.g. exclusion of datasets measures experienced a decrease in Glx. Thus, these based on head motion, which is known to be an issue in findings highlight the presence of intra-group response ASD. However, our repeated-measures design mitigated variability within ASD, where subjects may respond to against this by reducing inter-subject variability (each drug challenge not just to different extents but also in subject acted as their own ‘control’) and thus increasing opposite directions. Consequently, clinical trials of CBDV statistical power. Also, our sample size was comparable to may find that not every participant responds similarly to (or bigger than) that in previous MRS studies in ASD18,30. CBDV treatment. Further research efforts may need to Moreover, CBDV remains an under-investigated com- focus on identifying participant subgroups that will pound. For instance, although plasma levels of CBDV are respond to treatment in a similar way. thought to peak on average two hours after administra- tion, the exact times and concentrations may vary Implications of a BG Glx shift for cognition and behaviour between individuals depending on several factors such as The utility of this observed shift in BG Glx for pre- age, body-weight, size, genetics, absorption, distribution, dicting an individual’s long term (clinical) treatment and metabolism54. This made capturing the maximum response is unclear; and was not part of our study. Pre- drug effects for each participant challenging. Therefore, to vious research suggests that the BG are connected with minimize variability in drug levels, all efforts were made to other cortical and subcortical regions in the form of match participants (e.g. by age) and to keep study pro- subcortical-cortical-thalamic loops, which are regulated cedures and timings consistent. Nonetheless, future stu- and maintained by excitatory and inhibitory neuro- dies should explore in more detail the pharmacodynamics transmission38,39. These loops support a range of cogni- of CBDV (e.g. effects of acute vs steady-state/long-term tive functions and behaviours, such as reward, learning, dosing), origins of inter-subject variability, and how this – memory, and motor processing39 50, which can be can be accounted for in pharmacological studies. impaired in ASD51,52. Future studies should therefore Finally, this was a first study of potential tissue level examine the impact of CBDV on these cognitive processes changes in metabolites following CBDV. Achieving even and behaviours to determine if CBDV may offer clinical this modest sample size required a total of around benefits in specific autistic subgroups. 76 study visits. Therefore, we prioritized sample homo- geneity and applied strict exclusion criteria. However, this Limitations approach has the disadvantage of potentially limiting the Our findings must be considered alongside several generalizability of our findings. We hope that having limitations. We measured metabolite concentrations observed a biological response to CBDV in adult men using MRS, which is unable to distinguish between the with and without ASD (i.e. a Proof of Concept) will specific metabolite contributions to both the Glx and encourage subsequent studies to explore the effects of GABA+ signal. Moreover, the poor spatial resolution of CBDV in women, children, those with intellectual diffi- MRS only allows ‘bulk’ assessments, which limited our culties, and other groups. Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 9 of 10

Conclusions resonance spectroscopy in adults with and without autism spectrum disorder. Here we report that CBDV can ‘shift’ subcortical levels Neuropsychopharmacology 44, 1398–1405 (2019). ’ 4. Pretzsch C. M. et al. The effect of cannabidiol (CBD) on low-frequency of the brain s primary excitatory metabolite glutamate activity and functional connectivity in the brain of adults with and without (measured as Glx) both in the neurotypical and autistic autism spectrum disorder (ASD). J. Psychopharmacol. 269881119858306 brain; but that there may be significant response varia- 33, (2019). fi 5. Loth, E. et al. Identification and validation of biomarkers for autism spectrum bility in ASD. These ndings add to our understanding of disorders. Nat. Rev. Drug Discov. 15,70–73 (2016). the effects of CBDV in the adult human brain. None- 6. Iannotti, F. A. et al. Nonpsychotropic plant cannabinoids, cannabidivarin theless, future studies will need to explore (i) the (CBDV) and cannabidiol (CBD), activate and desensitize transient receptor potential vanilloid 1 (TRPV1) channels in vitro: potential for the treatment of mechanisms of action of CBDV; (ii) the impact of CBDV neuronal hyperexcitability. ACS Chem. Neurosci. 5, 1131–1141 (2014). on (ASD-related) cognition and behaviour; (iii) if single- 7. Gibson,H.E.,Edwards,J.G.,Page,R.S.,VanHook,M.J.&Kauer,J.A.TRPV1 dose responsivity could facilitate the identification of channels mediate long-term depression at synapses on hippocampal inter- neurons. Neuron 57,746–759 (2008). pharmacologically homogeneous sub-groups; and (iv) if 8. Miyake, T., Shirakawa, H., Nakagawa, T. & Kaneko, S. Activation of mitochondrial acute CBDV effects are indicative of the impact of long- transient receptor potential vanilloid 1 channel contributes to microglial term treatment in ASD. migration. Glia 63,1870–1882 (2015). 9. Liapi, A. & Wood, J. N. Extensive co-localization and heteromultimer formation of the vanilloid receptor-like protein TRPV2 and the capsaicin receptor TRPV1 Acknowledgements in the adult rat cerebral cortex. Eur. J. Neurosci. 22,825–34. (2005). This study was an Investigator Initiated Study (G.M.) which received funding 10. Musella, A. et al. TRPV1 channels facilitate glutamate transmission in the and product from GW Research Ltd (Cambridge, UK). GW Research Ltd striatum. Mol. Cell Neurosci. 40,89–97 (2009). (Cambridge, UK) had no role in the data collection or analysis of results, nor in 11. Toth, A. et al. Expression and distribution of vanilloid receptor 1 (TRPV1) in the the decision to publish. The authors also acknowledge infrastructure and adult rat brain. Brain Res. Mol. Brain Res. 135,162–168 (2005). training support from the National Institute for Health Research (NIHR) Mental 12. Fogaca,M.V.,Aguiar,D.C.,Moreira,F.A.&Guimaraes,F.S.Theendocanna- Health Biomedical Research Centre (BRC) at the South London and Maudsley binoid and endovanilloid systems interact in the rat prelimbic medial pre- NHS Foundation Trust and King’s College London. The views expressed are frontal cortex to control anxiety-like behavior. Neuropharmacology 63, those of the authors and not necessarily those of the NHS, the NIHR or the 202–210 (2012). Department of Health, UK. Additional sources of support included the Sackler 13. Lagatta,D.C.,Kuntze,L.B.,Ferreira-Junior,N.C.&Resstel,L.B.M.Medial Institute for Translational Neurodevelopment at King’s College London, prefrontal cortex TRPV1 and CB1 receptors modulate cardiac baroreflex Autistica, a Medical Research Council (MRC) Centre grant (MR/N026063/1), and activity by regulating the NMDA receptor/nitric oxide pathway. Pflug. Arch. EU-AIMS (European Autism Interventions)/EU AIMS-2-TRIALS, a European 470, 1521–42. (2018). Innovative Medicines Initiative Joint Undertaking under Grant Agreements No. 14. Nelson,S.B.&Valakh,V.Excitatory/inhibitorybalanceandcircuithomeostasis 115300 and 777394, the resources of which are composed of financial in autism spectrum disorders. Neuron 87,684–698 (2015). contributions from the European Union’s Seventh Framework Programme 15. Rubenstein, J. L. & Merzenich, M. M. Model of autism: increased ratio of (Grant FP7/2007–2013). R.A.E.E. receives salary support from NIH R01 excitation/inhibition in key neural systems. Genes Brain Behav. 2,255–267 MH106564 and U54 HD079123. (2003). 16. Yizhar, O. et al. Neocortical excitation/inhibition balance in information pro- Author details – 1 cessing and social dysfunction. Nature 477,171 178 (2011). Department of Forensic and Neurodevelopmental Sciences, Institute of 17. Cochran,D.M.etal.Relationshipamongglutamine,gamma-aminobutyric Psychiatry, Psychology & Neuroscience, King’s College London, London, UK. 2 acid, and social cognition in autismspectrumdisorders.J. Child Adolesc. Psy- Department of Neuroimaging Sciences, Institute of Psychiatry, Psychology & chopharmacol. 25,314–322 (2015). Neuroscience, King’s College London, London, UK. 3South London and 4 18. Horder, J. et al. Reduced subcortical glutamate/glutamine in adults with Maudsley NHS Foundation Trust Pharmacy, London, UK. Russel H Morgan autism spectrum disorders: a [(1)H]MRS study. Transl. Psychiatry 3, e279 (2013). Department of Radiology and Radiological Science, Johns Hopkins Medical 19. Bhattacharyya, S. et al. Cannabinoid modulation of functional connectivity Institutions, Baltimore, MD, USA within regions processing attentional salience. Neuropsychopharmacology 40, 1343–1352 (2015). Conflict of interest 20. Stone,J.M.etal.Ketamineeffectson brain GABA and glutamate levels with The authors declare that they have no conflict of interest. 1H-MRS: relationship to ketamine-induced psychopathology. Mol. Psychiatry 17,664–665 (2012). 21. World Health Organisation. International Statistical Classification of Diseases Publisher’s note and Related Health Problems. Geneva, Switzerland (2016). Springer Nature remains neutral with regard to jurisdictional claims in 22. Lord,C.,Rutter,M.&LeCouteur,A.AutismDiagnosticInterview-Revised:a published maps and institutional affiliations. revised version of a diagnostic interview for caregivers of individuals with possible pervasive developmental disorders. J. Autism Dev. Disord. 24, 659–685 (1994). Received: 31 May 2019 Revised: 2 October 2019 Accepted: 1 November 23. Lord, C. Autism diagnostic observation schedule: a standardized observation 2019 of communicative and social behavior. J. Autism Dev. Disord. 19,185–212 (1989). 24. Simpson,R.,Devenyi,G.A.,Jezzard,P.,Hennessy,T.J.&Near,J.Advanced processing and simulation of MRS data using the FID appliance (FID-A)An References open source, MATLAB-based toolkit. Magn. Reson Med. 77,23–33 (2017). 1. Baio J. et al. Prevalence of Autism Spectrum Disorder Among Children Aged 8 25. Rothman,D.L.,Petroff,O.A.,Behar,K.L.&Mattson,R.H.Localized1HNMR Years - Autism and Developmental Disabilities Monitoring Network, 11 Sites, measurements of gamma-aminobutyric acid in human brain in vivo. Proc. Natl United States, 2014 (vol 67, pg 1, 2018). Mmwr-Morbid Mortal W. 2018;67 Acad. Sci. USA 90,5662–5666 (1993). (19):564. 26. Hollander, E. et al. Striatal volume on magnetic resonance imaging and 2. Hirvikoski,T.etal.Prematuremortality in autism spectrum disorder. Br. J. repetitive behaviors in autism. Biol. Psychiatry 58, 226–232 (2005). Psychiatry 208,232–238 (2016). 27. Tong, Z. Y., Yamaki, T., Harada, K. & Houkin, K. In vivo quantification of the 3. Pretzsch C. M., et al. Effects of cannabidiol on brain excitation and inhibition metabolites in normal brain and brain tumors by proton MR spectroscopy systems; a randomised placebo-controlled single dose trial during magnetic using water as an internal standard. Magn. Reson. Imaging 22,735–742 (2004). Pretzsch et al. Translational Psychiatry (2019) 9:313 Page 10 of 10

28. Schuetze, M. et al. Morphological alterations in the thalamus, striatum, and 41. D’Mello, A. M. & Stoodley, C. J. Cerebro-cerebellar circuits in autism spectrum pallidum in autism spectrum disorder. Neuropsychopharmacology 41, disorder. Front Neurosci. 9, 408 (2015). 2627–2637 (2016). 42. Moseley R. L. et al. Lost for emotion words: what motor and limbic brain 29. Kreis, R. The trouble with quality filtering based on relative cramer-rao lower activity reveals about autism and semantic theory. Neuroimage. 104, 413–422 bounds. Magn. Reson Med. 75,15–18 (2016). (2015). 30. Ajram, L. A. et al. Shifting brain inhibitory balance and connectivity of the 43. Sepeta, L. et al. Abnormal social reward processing in autism as indexed by prefrontal cortex of adults with autism spectrum disorder. Transl. Psychiatry 7, pupillary responses to happy faces. J. Neurodev. Disord. 4, 17 (2012). e1137 (2017). 44. el Kaliouby, R., Picard, R. & Baron-Cohen, S. Affective computing and autism. 31. Bejjani, A. et al. Elevated glutamatergic compounds in pregenual anterior Ann. N. Y Acad. Sci. 1093,228–248 (2006). cingulate in pediatric autism spectrum disorder demonstrated by 1H MRS and 45. Kennedy,D.P.&Courchesne,E.Functionalabnormalitiesofthedefaultnet- 1H MRSI. PLoS ONE 7, e38786 (2012). work during self- and other-reflection in autism. Soc. Cogn. Affect Neurosci. 3, 32. Gaetz, W. et al. GABA estimation in the brains of children on the autism 177–190 (2008). spectrum: measurement precision and regional cortical variation. Neuroimage 46. Boucher J. & Bowler D. M. Memory in autism. Cambridge, UK; New York: 86,1–9 (2014). Cambridge University Press; 2008. xxiv, 358. 33. Conn, P. J., Battaglia, G., Marino, M. J. & Nicoletti, F. Metabotropic glutamate 47. Baron-Cohen,S.,Wheelwright,S.,Hill,J.,Raste,Y.&Plumb,I.The“Reading the receptors in the basal ganglia motor circuit. Nat. Rev. Neurosci. 6,787–798 Mind in the Eyes” Test revised version: a study with normal adults, and adults (2005). with Asperger syndrome or high-functioning autism. J. Child Psychol. Psychiatry 34. Cristino, L. et al. Immunohistochemical localization of cannabinoid type 1 and 42,241–51. (2001). vanilloid transient receptor potential vanilloid type 1 receptors in the mouse 48.Calabresi,P.,Picconi,B.,Tozzi,A.&Ghiglieri,V.Interactionbetweenbasal brain. Neuroscience 139, 1405–1415 (2006). ganglia and limbic circuits in learning and memory processes. Parkinsonism 35. Kunert-Keil C., Bisping F., Kruger J., Brinkmeier H. Tissue-specificexpressionof Relat. Disord. 22(Suppl 1), S65–S68 (2016). TRP channel genes in the mouse and its variation in three different mouse 49. Ikeda, H. et al. Investigating complex basal ganglia circuitry in the regulation of strains. BMC Genomics. 7, 159 (2006). motor behaviour, with particular focus on orofacial movement. Behav. Phar- 36. Lawson, L. J., Perry, V. H., Dri, P. & Gordon, S. Heterogeneity in the distribution macol. 26,18–32 (2015). and morphology of microglia in thenormaladultmousebrain.Neuroscience 50. Haber, S. N. & Knutson, B. The reward circuit: linking primate anatomy and 39,151–170 (1990). human imaging. Neuropsychopharmacology 35,4–26 (2010). 37. Marrone, M. C. et al. TRPV1 channels are critical brain inflammation detectors 51. Scott-Van Zeeland, A. A., Dapretto, M., Ghahremani, D. G., Poldrack, R. A. & and neuropathic pain biomarkers in mice. Nat. Commun. 8, 15292 (2017). Bookheimer, S. Y. Reward processing in autism. Autism Res. 3,53–67 (2010). 38. DeLong, M. & Wichmann, T. Changing views of basal ganglia circuits and 52. Delmonte, S. et al. Social and monetary reward processing in autism spectrum circuit disorders. Clin. EEG Neurosci. 41,61–67 (2010). disorders. Mol. Autism 3, 7 (2012). 39.DeLong,M.R.&Wichmann,T.Circuitsandcircuitdisordersofthebasal 53. Zhang, Y. et al. Comparison of reproducibility of single voxel spectroscopy and ganglia. Arch. Neurol. 64,20–24 (2007). whole-brain magnetic resonance spectroscopy imaging at 3T. NMR Biomed. 40. Jaramillo, T. C., Liu, S., Pettersen, A., Birnbaum, S. G. & Powell, C. M. Autism- 31, e3898 (2018). related neuroligin-3 mutation alters social behavior and spatial learning. Aut- 54. Luscombe, D. K. Factors influencing plasma drug concentrations. J. Int Med ism Res. 7, 264–272 (2014). Res. 5,82–97 (1977). fncel-13-00367 August 8, 2019 Time: 16:47 # 1

ORIGINAL RESEARCH published: 09 August 2019 doi: 10.3389/fncel.2019.00367

Cannabidivarin Treatment Ameliorates Autism-Like Behaviors and Restores Hippocampal Endocannabinoid System and Glia Alterations Induced by Prenatal Valproic Acid Exposure in Rats

Erica Zamberletti1*, Marina Gabaglio1, Marie Woolley-Roberts2, Sharon Bingham2, Tiziana Rubino1 and Daniela Parolaro1,3

1 Department of Biotechnology and Life Sciences, University of Insubria, Varese, Italy, 2 GW Research Ltd., Cambridge, United Kingdom, 3 Zardi-Gori Foundation, Milan, Italy

Autism spectrum disorder (ASD) is a developmental condition whose primary features include social communication and interaction impairments with restricted or repetitive motor movements. No approved treatment for the core symptoms is available and Edited by: considerable research efforts aim at identifying effective therapeutic strategies. Emerging Giovanni Cirillo, Second University of Naples, Italy evidence suggests that altered endocannabinoid signaling and immune dysfunction Reviewed by: might contribute to ASD pathogenesis. In this scenario, phytocannabinoids could hold Javier Fernández-Ruiz, great pharmacological potential due to their combined capacities to act either directly Complutense University of Madrid, Spain or indirectly on components of the endocannabinoid system and to modulate immune Viviana Trezza, functions. Among all plant-cannabinoids, the phytocannabinoid cannabidivarin (CBDV) Roma Tre University, Italy was recently shown to reduce motor impairments and cognitive deficits in animal *Correspondence: models of Rett syndrome, a condition showing some degree of overlap with autism, Erica Zamberletti [email protected] raising the possibility that CBDV might have therapeutic potential in ASD. Here, we investigated the ability of CBDV treatment to reverse or prevent ASD-like behaviors Specialty section: This article was submitted to in male rats prenatally exposed to valproic acid (VPA; 500 mg/kg i.p.; gestation day Cellular Neurophysiology, 12.5). The offspring received CBDV according to two different protocols: symptomatic a section of the journal (0.2/2/20/100 mg/kg i.p.; postnatal days 34–58) and preventative (2/20 mg/kg i.p.; Frontiers in Cellular Neuroscience postnatal days 19–32). The major efficacy of CBDV was observed at the dose of Received: 13 June 2019 Accepted: 29 July 2019 20 mg/kg for both treatment schedules. CBDV in symptomatic rats recovered social Published: 09 August 2019 impairments, social novelty preference, short-term memory deficits, repetitive behaviors Citation: and hyperlocomotion whereas preventative treatment reduced sociability and social Zamberletti E, Gabaglio M, Woolley-Roberts M, Bingham S, novelty deficits, short-term memory impairments and hyperlocomotion, without affecting Rubino T and Parolaro D (2019) stereotypies. As dysregulations in the endocannabinoid system and neuroinflammatory Cannabidivarin Treatment Ameliorates markers contribute to the development of some ASD phenotypes in the VPA model, Autism-Like Behaviors and Restores Hippocampal Endocannabinoid neurochemical studies were performed after symptomatic treatment to investigate System and Glia Alterations Induced possible CBDV’s effects on the endocannabinoid system, inflammatory markers and by Prenatal Valproic Acid Exposure in Rats. Front. Cell. Neurosci. 13:367. microglia activation in the hippocampus and prefrontal cortex. Prenatal VPA exposure doi: 10.3389/fncel.2019.00367 increased CB1 receptor, FAAH and MAGL levels, enhanced GFAP, CD11b, and TNFα

Frontiers in Cellular Neuroscience| www.frontiersin.org 1 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 2

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

levels and triggered microglia activation restricted to the hippocampus. All these alterations were restored after CBDV treatment. These data provide preclinical evidence in support of the ability of CBDV to ameliorate behavioral abnormalities resembling core and associated symptoms of ASD. At the neurochemical level, symptomatic CBDV restores hippocampal endocannabinoid signaling and neuroinflammation induced by prenatal VPA exposure.

Keywords: cannabidivarin, valproate, autism, endocannabinoid system, neuroinflammation

INTRODUCTION Melancia et al., 2018). Remarkably, recent studies have confirmed the presence of dysregulations of the endocannabinoid system in Autism spectrum disorder (ASD) represents a group of ASD patients (Brigida et al., 2017; Yeh and Levine, 2017; Karhson developmental disabilities whose primary symptoms include et al., 2018; Aran et al., 2019). A correlation between altered social communication and interaction impairments with endocannabinoid signaling and ASD traits is supported by the restricted or repetitive motor movements, frequently associated observation that enhancing AEA signaling through inhibition with general cognitive deficits (American Psychiatric Association of its degradation partially attenuated the behavioral phenotype [APA], 2013). About 1% of the global population receives an ASD induced by prenatal VPA exposure (Kerr et al., 2016; Servadio diagnosis (Baio et al., 2018), with a male to female ratio of 3:1 et al., 2016; Melancia et al., 2018), suggesting that modulation of (Loomes et al., 2017). Diagnosis can be made as early as 2 years of the endocannabinoid signaling could represent a novel strategy age and patients are expected to have a normal lifespan. Despite for mitigating ASD symptoms. Besides the endocannabinoid the critical medical need, no approved treatments for the core system, recent evidence suggests that modulation of immune symptoms of ASD are available; hence, reliable animal models dysfunction might be beneficial toward ASD symptomatology. are of fundamental importance for identifying and testing Indeed, signs of neuroinflammation have been reported in new therapeutic strategies. Although ASD is a typical human the brain of ASD patients, including microglia and astrocyte pathology, endophenotypes including impairments of social activation and increased expression of pro-inflammatory factors interaction, cognitive deficits, repetitive behaviors and motor (Vargas et al., 2005; Morgan et al., 2010; Suzuki et al., 2013; Kern dysfunctions can be reproduced in rodents by means of genetic et al., 2016), reinforcing the idea that immunological dysfunction and/or environmental manipulations (Ergaz et al., 2016; Kim might play a role in ASD. In line with human evidence, signs of et al., 2016). Environmentally based models are relevant when the neuroinflammation, including increased reactive oxygen species, same risk factor contributing to human autism produces similar pro-inflammatory cytokines, astrocyte and microglia activation, brain and behavioral alterations in the animal. The use of valproic have been observed in the VPA-induced ASD animal model acid (VPA) in pregnancy has been consistently associated with (Lucchina and Depino, 2014; Codagnone et al., 2015; Deckmann an increased risk to develop congenital malformations and et al., 2018; Kuo and Liu, 2018; Bronzuoli et al., 2019). The features of ASD in children (Duncan, 2007; Dufour-Rainfray administration of compounds able to reduce this inflammatory et al., 2011; Christensen et al., 2013; Roullet et al., 2013; Ornoy response resulted in neuroprotection and amelioration of et al., 2019). Similar to humans, rodents prenatally exposed to ASD-like phenotypes (Banji et al., 2011; Bambini-Junior et al., VPA show increased impaired social interactions and preference 2014; Pragnya et al., 2014; Al-Amin et al., 2015; Gao et al., 2016; for social novelty, stereotypic repetitive behaviors, learning and Kumar and Sharma, 2016; Morakotsriwan et al., 2016; Bertolino memory defects and hypersensitivity (Schneider and Przewłocki, et al., 2017; Deckmann et al., 2018; Fontes-Dutra et al., 2018), 2005; Dufour-Rainfray et al., 2010; Gandal et al., 2010; Kim suggesting that inflammatory dysfunction might play a role in et al., 2011; Mehta et al., 2011; Melancia et al., 2018). Therefore, the development of ASD symptoms. because of its strong construct and face validity, the VPA animal In this scenario, phytocannabinoids possess great and model has been one of the most widely used to understand the interesting pharmacological potentials. In addition to their neural underpinnings and to test novel therapeutic possibilities indirect actions on components of the endocannabinoid in the context of ASD (Mabunga et al., 2015; Ornoy et al., 2015; system, plant-derived cannabinoids possess a broad range of Tartaglione et al., 2019). pharmacological properties including proved anti-inflammatory Recent studies in the prenatal VPA exposure model have and anti-oxidant properties (Nagarkatti et al., 2009; Ligresti implicated the endocannabinoid system in the development et al., 2016; Morales et al., 2017; Maroon and Bost, 2018) of ASD-like features. Changes in components of this that may contribute to achieve an overall beneficial effect in neuromodulatory system were reported in different brain the context of ASD. regions as a consequence of in utero VPA exposure, including Recent studies have shown that the plant-derived cannabinoid alterations in 2-arachidonyilglycerol (2-AG) and anandamide Cannabidivarin (CBDV) exerts beneficial effects toward (AEA) signaling and abnormalities in CB1 receptor (Kerr et al., neurological and motor impairments as well as cognitive deficits 2013, 2016; Servadio et al., 2016; Melancia et al., 2018). Changes in two animal models of Rett syndrome (Vigli et al., 2018; in other targets including PPARα, PPARγ, and GPR55 receptors Zamberletti et al., 2019). CBDV’s simultaneous capacity to were also observed (Kerr et al., 2013; Servadio et al., 2016; ameliorate neurological and motor defects as well as cognitive

Frontiers in Cellular Neuroscience| www.frontiersin.org 2 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 3

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

impairment in these animal models raises the possibility that treatments and behavioral testing were carried out in 5–6 rats this phytocannabinoid might have interesting yet unexplored per litter during four separate experiments. Pure CBDV was therapeutic potential in ASD, prompting its evaluation in animal provided by GW Research Ltd. (Cambridge, United Kingdom) models of this disorder. and dissolved in ethanol, Kolliphor EL and saline (2:1:18) and Therefore, in this study we examined the ability of CBDV was administered according to the treatment schedules reported treatment to reverse or prevent sociability and preference for in Figures 1A, 2A. Symptomatic treatment with CBDV 0.2, 2, social novelty deficits, repetitive behaviors, hyperactivity and 20 or 100 mg/kg/day i.p. was performed starting from PND 34 recognition memory impairments in rats prenatally exposed to (early adolescence) to 58 (early adulthood) in the male offspring VPA (500 mg/kg i.p.; gestation day 12.5). To this aim, CBDV was of dams injected with VPA 500 mg/kg (or saline) on GD 12.5 administered using two treatment protocols in the male offspring (Figure 1A). Starting from PND 56, a series of behavioral tests of VPA-treated dams; a symptomatic treatment was performed was performed. The three chamber test was carried out at PND between postnatal day (PND) 34–58 to assess the ability of 56 in order to assess the effect of chronic CBDV on sociability CBDV to counteract VPA-induced autism-like behaviors whereas and social novelty preference, the novel object recognition (NOR) a preventative treatment was carried out from PND 19–32 to test test was performed at PND 57 to assess short-term memory, and CBDV’s ability to prevent the appearance of autism-like traits locomotion and stereotyped/repetitive behaviors were measured in the model. In addition to behavioral analysis, neurochemical in the activity cage at PND 58. Preventative treatment with CBDV studies were carried out after symptomatic CBDV treatment 2 or 20 mg/kg/day i.p. was performed starting from PND 19 (pre- to investigate its effect on the endocannabinoid system as well weaning) to 32 (post-weaning) in the male offspring of VPA- as on inflammatory markers and microglia activation in the and vehicle-treated dams (Figure 2A). Behavioral analysis was hippocampus and prefrontal cortex (PFC). carried out at PND 30 (three chamber test), 31 (NOR test), and 32 (repetitive behavior and locomotion). MATERIALS AND METHODS Behavioral Studies Three-Chamber Test Prenatal VPA Administration The three-chamber test was performed to measure social Pregnant Sprague-Dawley rats (Charles River, Calco, Italy) approach and social preference. In brief, animals were placed received a single intraperitoneal injection of sodium valproate into a novel arena (80 cm × 31.5 cm × 40 cm) composed 500 mg/kg (or saline) on gestation day (GD) 12.5. Sodium of three communicating chambers separated by Perspex walls valproate (Sigma Aldrich, Milan) was dissolved in saline at a with central openings allowing access to all chambers for 5 min. concentration of 250 mg/ml. Females were housed individually Distance moved (meters) and time spent (seconds) in the various and were allowed to raise their own litters. Gross toxic effects compartments were recorded during this time to evaluate general were not observed in VPA-exposed rats in both dams and pups. locomotor activity and ensure that animals did not have a No postnatal mortality was observed. Body weight was slightly preference for a particular side of the arena. Following this but significantly reduced in VPA-exposed pups with respect to acclimatization period, animals were briefly confined to the controls from PND 12–17. Eye opening was delayed in VPA- central chamber while an unfamiliar rat confined in a small wire exposed pups with respect to vehicles between PND 14 and 16. At cage was placed in one of the outer chambers. An identical empty PND 9, male pups from VPA-treated dams showed significantly wire cage was placed in the other chamber. The unfamiliar rat increased latencies in nest-seeking behavior compared to controls was randomly either assigned to the right or left chamber of the as well as impaired righting reflex (Supplementary Methods, arena. The test animal was then allowed to explore the arena for Supplementary Results and Supplementary Figure S1). Nine a further 5 min. The arena was cleaned between animals with vehicle- and 15 VPA-treated dams were used in this study. 0.1% acetic acid. Time spent engaging in investigatory behavior Litters were not culled and the offspring was weaned on with the rat was evaluated with the aid of ANY-maze program PND 21, separated by sex and the animals were kept four (Ugo Basile, Italy) in order to examine social approach. To to a cage, with controlled temperature and light conditions. investigate the preference for social novelty, a novel unfamiliar Rats had free access to food (standard laboratory pellets) rat was then placed in the empty cage and the test animal was and water. All the experiments were performed in the light allowed to explore the arena for a further 5 min. Time spent phase between 09:00 and 15:00. Experimental procedures were engaging in investigatory behavior with the novel unfamiliar rat performed in accordance with the guidelines released by the was evaluated with the aid of Anymaze program (Ugo Basile, Italian Ministry of Health (D.L. 2014/26) and the European Italy) in order to examine the preference for social novelty. Community directives regulating animal research (2010/63/EU). Sociability index and preference for social novelty index were Protocols were approved by the Italian Minister for Scientific calculated as the ratio of time spent exploring the stranger rat Research and all efforts were made to minimize the number of (sociability) or the unknown rat (preference for novelty) vs. the animals used and their suffering. total time of exploration × 100. CBDV Treatment Novel Object Recognition (NOR) Test A total of 54 rats from 9 vehicle-treated dams and 75 rats from The experimental apparatus used for the object recognition 15 VPA-treated dams were used in this study. Pharmacological test was an open-field box (43 cm × 43 cm × 32 cm)

Frontiers in Cellular Neuroscience| www.frontiersin.org 3 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 4

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

FIGURE 1 | Symptomatic CBDV treatment protocol. Pregnant Sprague-Dawley rats received a single injection of VPA 500 mg/kg i.p. (or vehicle) at GD 12.5. (A) Symptomatic treatment with CBDV 0.2, 2, 20, 100 mg/kg/day i.p. was performed from PND 34 and male offspring was tested at PND 56 (three chamber test), 57 (NOR test), and 58 (repetitive behavior and locomotion). Effect of symptomatic CBDV 0.2, 2, 20, 100 mg/kg/day treatment in male offspring of VPA- and vehicle-exposed rats on (B) sociability and (C) social novelty preference as measured through the three chamber test; (D) short-term memory as measured through the novel object recognition; (E) compulsive self-grooming and (F) locomotor activity as measured in the activity cage. Data represent mean ± SEM of n = 9 vehicle-vehicle, n = 6 vehicle-CBDV 0.2 mg/kg, n = 6 vehicle-CBDV 2 mg/kg, n = 8 vehicle-CBDV 20 mg/kg, n = 6 vehicle-CBDV 100 mg/kg, n = 15 VPA-vehicle, n = 5 VPA-CBDV 0.2 mg/kg, n = 10 VPA-CBDV 2 mg/kg, n = 13 VPA-CBDV 20 mg/kg, n = 10 VPA-CBDV 100 mg/kg. Results were analyzed by two-way ANOVA followed by Tukey’s post hoc test (∗∗∗p < 0.001, ∗∗p < 0.01, ∗p < 0.05 vs. vehicle-vehicle;◦◦◦p < 0.001,◦◦p < 0.01,◦p < 0.05 vs. VPA-vehicle).

made of Plexiglas, placed in a dimly illuminated room. During the test phase the time spent exploring the familiar The experiment was performed and analyzed as previously object (Ef) and the new object (En) was videotaped and described (Zamberletti et al., 2014). Animals performed each recorded separately by two observers blind to the treatment test individually. Briefly, each animal was placed in the groups and the discrimination index was calculated as follows: arena and allowed to explore two identical previously unseen [(En − Ef)/(En + Ef)] × 100. objects for 5 min (familiarization phase). After an inter- trial interval of 3 min one of the two familiar objects Activity Cage was replaced by a novel, previously unseen object and rats Locomotor activity was recorded in an activity cage were returned to the arena for the 5-min test phase. The (40 cm × 40 cm × 40 cm) for 20 min with the aid of Anymaze arena was cleaned between animals with 0.1% acetic acid. program (Ugo Basile, Italy). In this period, repetitive behaviors

Frontiers in Cellular Neuroscience| www.frontiersin.org 4 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 5

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

FIGURE 2 | Preventative CBDV treatment protocol. Pregnant Sprague-Dawley rats received a single injection of VPA 500 mg/kg i.p. (or vehicle) at GD 12.5. (A) Preventative treatment with CBDV 2 or 20 mg/kg/day i.p. was performed from PND 19 and animals were tested at PND 30 (three chamber test), 31 (NOR test), and 32 (repetitive behavior and locomotion). Effect of preventative CBDV 2, 20 mg/kg/day treatment in male offspring of VPA- and vehicle-exposed rats on (B) sociability and (C) social novelty preference as measured through the three chamber test; (D) short-term memory as measured through the novel object recognition test; (E) compulsive self-grooming and (F) locomotor activity as measured in the activity cage. Data represent mean ± SEM of n = 7 vehicle-vehicle, n = 6 vehicle-CBDV 2 mg/kg, n = 6 vehicle-CBDV 20 mg/kg, n = 6 VPA-vehicle, n = 8 VPA-CBDV 2 mg/kg, n = 8 VPA-CBDV 20 mg/kg and were analyzed using two-way ANOVA followed by Tukey’s post hoc test (∗∗∗p < 0.001, ∗p < 0.05 vs. vehicle-vehicle;◦◦◦p < 0.01,◦p < 0.05 vs. VPA-vehicle).

(compulsive self-grooming) were measured by an observer blind the brains were quickly removed and post-fixed in 4% to the treatment group. The cage was cleaned between animals paraformaldehyde in 100 mM phosphate buffer pH7.4, stored in with 0.1% acetic acid. fixative for 48 h, kept in 30% sucrose for 24 h. Coronal sections were serially collected using a Leica cryostat CM1510 set to 40 µm ◦ Biochemical Studies thickness and a −20 C chamber temperature. All animals underwent behavioral assessment. 24 h after the last CBDV (or vehicle) injection, all the animals were euthanized, Western Blotting their brain tissues collected and randomly assigned to different Cytosolic fractions from rat hippocampus and PFC were obtained procedures for subsequent biochemical analysis. For Western using a protocol published by Shen and Chen(2013), with slight blot analysis, PFC and hippocampi were dissected, frozen in modifications. In brief, animals were sacrificed and cerebral areas liquid nitrogen and stored at −80◦C; for immunohistochemistry, quickly dissected. Samples were homogenized by 25 strokes in a

Frontiers in Cellular Neuroscience| www.frontiersin.org 5 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 6

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

glass-glass homogenizer in 0.32 M sucrose solution containing 4◦C with rabbit anti-IBA1 antibody (1:1000, Wako, Neuss, 20 mM HEPES, 1 mM MgCl2, protease inhibition cocktail, and Germany) diluted in blocking solution. After blocking peroxidase 0.1 mM phenylmethylsulfonyl fluoride (PMSF) (pH 7.4). The activity with 0.3% H2O2 in TBS for 15 min, sections homogenized tissue was centrifuged at 500 × g for 2 min. were washed in TBS and incubated for 4 h at room Resultant pellets (P1) were resuspended in 500 µL of a solution temperature with HRP-conjugated goat anti-rabbit antibody containing HEPES 20 mM, MgCl2 1.5 mM, NaCl 420 mM, (1:500; Santa Cruz Biotechnology, United States). The peroxidase EDTA 0.2 mM, glycerol 25%, DTT 2 mM, PMSF 2 mM, protease activity was revealed with 0.05% diaminobenzidine and 0.03% inhibition cocktail and stored as nuclear fraction. The resulting hydrogen peroxide in PBS for 10 min. After several washes supernatant (S1) was centrifuged at 10,000 × g for 10 min to in PBS, sections were mounted on gelatin-coated slides, obtain a fraction containing mitochondria and synaptosome- dehydrated and cover slipped. For each animal, a complete enriched pellets (P2) and the supernatant (S2) containing soluble series of one-in-six sections (240 µm apart) through the proteins. S2 fraction was conserved as cytosolic fraction while hippocampus was analyzed. Digital Images were captured using the P2 fraction was resuspended in 0.32 M sucrose, layered onto Retiga R1 CCD camera (QImaging, Surrey, BC, Canada) 0.8 M sucrose and centrifuged at 4100 rpm for 15 min in a attached to an Olympus BX51 (Tokyo, Japan) polarizing/light swinging bucket rotor to obtain crude synaptosome fractions. microscope. Ocular imaging software (QImaging) was used The protein concentrations were determined according to the to import images from the camera. Images of microglia Micro-BCA assay kit (Pierce, Rockford, IL, United States). cells in the subgranular zone of the hippocampus were Equal amount of protein lysates from the cytosolic fractions acquired by first delineating the brain sections and the (30 µg) were run on a 10% SDS-polyacrylamide gel. The regions of interest at low magnification (×4 objective) and proteins were then transferred to polyvinylidene difluoride the region of interest outlines were further refined under a (PVDF) membranes, blocked for 2 h at room temperature ×40 objective. Three mice per each experimental group (four in 5% dry skimmed milk in TBS 1×, 0.1% tween-20 before sections/mouse) were analyzed. The morphometric analysis incubation overnight at 4◦C with the primary antibody. The was carried out in DAB-stained microglial cells labeled with following primary antibodies were used: rabbit polyclonal IBA-1 antibody. For this purpose, cells were selected and anti-CB1 (1:1000; Cayman Chemical, United States), rabbit cropped according to the following criteria: (i) random polyclonal anti-CB2 (1:1000; Cayman Chemical, United States), selection in the subgranular zone of the hippocampus; (ii) no rabbit polyclonal anti-FAAH (1:1000; Cayman Chemical, overlapping with neighboring cells; and (iii) complete soma United States), rabbit polyclonal anti-MAGL (1:1000; Cayman and branches (at least apparently). Selection was done blinded Chemical, United States), rabbit polyclonal anti-NAPE-PLD to the treatment. Eight cells from each animal were analyzed. (1:3000; Cayman Chemical, United States), goat polyclonal Each grayscale single cell cropped image was processed in anti-DAGLα (1:1000; AbCam, United Kingdom), rabbit a systematic way to obtain binary image using the same polyclonal anti-GFAP (1:1000; Sigma Aldrich, United States), threshold for all pictures. The binary image was edited to rabbit polyclonal anti-CD11b (1:1000; Novus Biologicals, clear the background and transformed into a filled shape and United States), rabbit polyclonal anti-TNF-α (1:2000; its pairwise outline shape that were used for morphological Millipore, United States). parameters measurements. Analysis was performed using FIJI Bound antibodies were detected with horseradish peroxidase free software (NIH, Bethesda, MD, United States). Four (HRP) conjugated secondary anti-rabbit, anti-mouse or anti- parameters, measured on the filled and outlined processed goat antibodies (1:1000–10000; Santa Cruz Biotechnology, images obtained as described previously (Fernández-Arjona United States) for 1 h at room temperature and visualized using et al., 2017), were analyzed: cell area, cell perimeter, roundness ECL Western Blotting Detection Reagents (Bio-Rad Laboratories, of the soma and soma area. Hercules, CA, United States). For detection of β-actin, the blots were stripped with Restore Western Blot Stripping Buffer Statistical Analysis (Thermo Scientific, Rockford, IL, United States) and re-blotted The Shapiro–Wilk normality test was first used to determine if with mouse monoclonal anti-β-actin (1:20000; Sigma Aldrich, ◦ the data were normally distributed. Results were then expressed United States) overnight at 4 C and visualized as described as mean ± SEM and quantitative normally distributed data were above. Bands were detected with G-Box (Syngene) instrument. analyzed by two-way ANOVA (VPA and CBDV as independent For densitometry, images were digitally scanned and optical variables), followed by Tukey’s post hoc test. The level of statistical density of the bands was quantified using ImageJ software (NIH, significance was set at p < 0.05. Bethesda, MD, United States) and normalized to controls. To allow comparison between different blots, the density of the bands was expressed as arbitrary units. RESULTS Immunohistochemistry Free-floating sections containing the dorsal hippocampus Behavioral Studies were washed three times in 0.05% Tryton X-100 in TBS, Symptomatic CBDV Treatment incubated with 3% normal goat serum, 0.05% Triton X-100 Figure 1 represents the effect of symptomatic CBDV treatment in TBS for 1 h at room temperature and then overnight at (0.2, 2, 20, and 100 mg/kg/day; PND 34–58; Figure 1A)

Frontiers in Cellular Neuroscience| www.frontiersin.org 6 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 7

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

on autism-like phenotypes in the male offspring of VPA- Compulsive self-grooming and locomotion exposed rats. The effect of chronic CBDV 0.2, 2, 20, and 100 mg/kg/day treatment on compulsive self-grooming and locomotor activity Sociability and social novelty preference is reported in Figures 1E,F respectively. In the three-chamber test (Figures 1B,C), no differences in the Statistical analysis showed significant effects of VPA time spent in each compartment of the apparatus were observed [F(1,75) = 17.06; p < 0.0001] and VPA × CBDV interaction during the habituation phase, suggesting that animals belonging [F(4,75) = 2.518; p = 0.0483] and a trend for CBDV’s effect to all the experimental groups did not show a preference [F(4,75) = 2.381; p = 0.0590] on self-grooming. VPA exposure for a particular side of the arena (data not shown). During significantly increased the time spent by male rats in compulsive the sociability test (Figure 1B), two-way ANOVA revealed self-grooming by about 121% with respect to vehicles. Chronic significant main effects of VPA [F(1,75) = 34.35; p < 0.0001] and CBDV administration at the dose of 20 mg/kg significantly VPA × CBDV interaction [F(4,75) = 2.636; p = 0.0405] on the normalized the time spent in repetitive behaviors in VPA-treated percentage of time spent exploring the stranger rat with respect rats without having any effect when administered to controls. to the empty cage. Indeed, the percentage of time spent by male CBDV 2 and 100 mg/kg showed a trend to ameliorate compulsive VPA-exposed rats in the chamber containing the unfamiliar rat self-grooming in VPA-vehicle rats. The lowest dose of CBDV was was significantly reduced compared to controls (58.673 ± 1.389% instead ineffective. in VPA-vehicle vs. 78.668 ± 3.069% in vehicle-vehicle). CBDV Main effects of VPA [F(1,75) = 17.52; p < 0.0001], CBDV at all doses tested did not affect sociability when administered to [F(4,75) = 5.527; p = 0.0006] and VPA × CBDV interaction control animals. CBDV treatment at doses of 20 and 100 mg/kg [F(4,75) = 2.485; p = 0.0500] were also found on locomotor significantly restored the impairment in sociability observed in activity. Indeed, VPA administration significantly increased VPA rats while doses of 0.2 and 2 mg/kg failed to reverse the locomotion by about 69% compared to controls and CBDV sociability deficit in VPA-treated rats. administration at the dose of 2, 20, and 100 mg/kg significantly Concerning the preference for social novelty (Figure 1C), normalized it. In contrast, CBDV 0.2 mg/kg failed to recover significant effects of VPA [F(1,75) = 21.54; p < 0.0001] and hyperlocomotion in VPA-exposed rats. None of the CBDV doses VPA × CBDV interaction [F(4,75) = 2.556; p = 0.0456] were tested affected locomotion in control animals. observed on the percentage of time spent exploring the unknown rat during the test. Control male rats spent a significantly Preventative CBDV Treatment higher percentage of time exploring the novel rat than the Figure 2 represents the effect of preventative CBDV treatment known rat (75.021 ± 3.301%). In contrast, VPA animals spent (2 and 20 mg/kg/day; PND 19–32; Figure 2A) on autism-like a similar time exploring the two stimuli (53.757 ± 2.072%). phenotypes in the male offspring of VPA-exposed rats. Treatment with CBDV 20 mg/kg completely reversed the deficit in social preference in VPA rats, as demonstrated by the fact Sociability and social novelty preference that VPA-CBDV rats spent significantly more time exploring the The effect of preventative CBDV 2 and 20 mg/kg/day treatment novel rats with respect to the familiar one (69.128 ± 2.900%). on sociability in the male offspring of VPA- and vehicle-exposed In contrast, CBDV 0.2, 2, and 100 mg/kg were not able to rats, as measured through the three chamber apparatus is restore social novelty preference in VPA rats. None of the doses shown in Figure 2B. During the habituation phase, VPA and tested had per se any effect on social novelty preference when CBDV administration did not affect the time spent in each administered to controls. compartment of the maze and all animals spent similar amounts of time exploring each compartment of the apparatus (data not Short-term recognition memory shown). During the sociability test, significant effects of VPA Figure 1D represents the effect of chronic CBDV 0.2, 2, [F(1,35) = 9.385; p = 0.0005] and VPA × CBDV interaction 20, and 100 mg/kg/day treatment on short-term memory as [F(2,35) = 11.78; p = 0.0001] were found. Vehicle-vehicle evaluated through the NOR test. Total exploration time during rats spent significantly more time exploring the unfamiliar rat the familiarization phase was similar in all the groups under compared to the empty cage (68.113 ± 2.345%). A similar investigation (data not shown). During the test phase, significant effect was also observed in vehicle animals treated with CBDV effects of VPA [F(1,75) = 17.47; p < 0.0001] and VPA × CBDV 2 mg/kg (67.773 ± 2.297%) and 20 mg/kg (64.861 ± 2.788%). interaction [F(4,75) = 4.565; p = 0.0024] were observed. Prenatal In contrast, male VPA-exposed rats spent similar amount of VPA administration significantly impaired short-term memory, time in the chamber containing the unfamiliar rat compared to as demonstrated by a significant reduction of the discrimination the time spent in the empty compartment when compared to index by about 81% with respect to controls. Statistical analysis controls (53.484 ± 3.220%), indicating a deficit in sociability. did not reveal any significant effect of CBDV when administered Chronic CBDV treatment at both doses significantly prevented in control rats. Interestingly, CBDV 2, 20, and 100 mg/kg the deficit in sociability in VPA rats without affecting sociability significantly reversed the short-term memory deficit in male in control animals. VPA rats, without affecting per se recognition memory when In the preference for social novelty trial (Figure 2C), administered to vehicles. In contrast, CBDV 0.2 mg/kg failed to statistical analysis showed a significant VPA × CBDV interaction counteract memory deficits in VPA rats, the discrimination index [F(2,35) = 4.426; p = 0.0196] and a trend for VPA [F(1,35) = 4.088; being still reduced by about 79% with respect to controls. p = 0.0511] and CBDV [F(2,35) = 3.174; p = 0.0545] effects.

Frontiers in Cellular Neuroscience| www.frontiersin.org 7 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 8

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

Control male rats spent a significantly greater percentage of time CBDV [F(1,12) = 13.32; p = 0.0033], and VPA × CBDV exploring the novel rat than the known rat (66.819 ± 1,995%). interaction [F(1,12) = 15.88; p = 0.0018] on CB1 receptor A similar effect was also present in vehicle animals treated expression. Prenatal VPA exposure significantly increased with CBDV 2 mg/kg (69.199 ± 6.227%) and 20 mg/kg CB1 receptor levels in the hippocampus compared to vehicle (61.095 ± 3.0147%). Conversely, VPA animals spent a similar littermates. CBDV treatment at the behaviorally efficacious dose percentage of time exploring the two stimuli (48.003 ± 4.535%). of 20 mg/kg significantly normalized CB1 receptor expression Treatment with CBDV 2 and 20 mg/kg significantly prevented without affecting its levels when administered to vehicles. the deficit in social novelty preference in VPA-exposed rats. A significant effect of VPA [F(1,12) = 10.31; p = 0.0075] was also found on CB2 receptor levels. Indeed, prenatal VPA exposure Short-term recognition memory alone did not affect receptor expression whereas a significant Figure 2D depicts the effect of preventative CBDV 2 and increase in CB2 receptor levels was observed in VPA-exposed 20 mg/kg/day treatment on short-term memory in vehicle- rats after chronic administration of CBDV 20 mg/kg. Statistical and VPA-treated rats evaluated through the NOR test. Total analysis revealed significant effects of VPA [F = 8.722; exploration time during the familiarization phase was similar in (1,12) p = 0.0121] and VPA × CBDV interaction [F = 5.830; all the groups under investigation (data not shown). (1,12) p = 0.0326] on FAAH protein levels within the hippocampus. Two-way ANOVA revealed significant effects of VPA FAAH expression was significantly enhanced in VPA exposed [F = 8.943; p = 0.0051] and VPA × CBDV interaction (1,35) rats and it was reduced by chronic CBDV treatment. A similar [F = 6.127; p = 0.0052] on short-term memory. Prenatal (2,35) effect was also found regarding MAGL expression. Indeed, VPA administration significantly impaired short-term memory, MAGL levels were increased by prenatal VPA exposure and as demonstrated by a significant reduction of the discrimination CBDV administration significantly restored MAGL expression in index by about 60.9% with respect to controls. Both doses of the hippocampus of VPA exposed rats without affecting its levels CBDV did not affect recognition memory when administered when administered in controls [VPA: F = 7.536; p = 0.0178; to vehicles. CBDV 20 mg/kg significantly prevented the short- (1,12) VPA × CBDV interaction: F = 4.499; p = 0.0564]. Neither term memory deficit in male VPA rats, whereas the lowest dose (1,12) VPA exposure nor CBDV treatment alone or in combination was ineffective. affected NAPE-PLD and DAGLα expression in this brain region. Compulsive self-grooming and locomotion Figures 2E,F represent the effect of preventative CBDV 2 and Effect of Symptomatic CBDV Treatment (20 mg/kg) 20 mg/kg/day treatment on repetitive behaviors (compulsive on Neuroinflammatory Markers and Microglia self-grooming) and locomotion, respectively. Morphology in the Hippocampus of Vehicle- and A significant main effect of VPA [F(1,35) = 13.64; p = 0.0008] VPA-Exposed Rats was found on self-grooming behavior. Indeed, VPA exposure Figure 4A shows the effects of prenatal VPA exposure and significantly increased the time spent by male rats in compulsive symptomatic CBDV treatment on the expression of the astrocyte self-grooming by about 133.9% with respect to vehicle-vehicle marker GFAP, the microglia marker CD11b and the pro- animals. CBDV treatment did not affect self-grooming in control inflammatory cytokine TNF-α in the hippocampus. Two-way rats and no dose of CBDV tested was able to prevent compulsive ANOVA showed significant effects of VPA [F(1,12) = 12.12; self-grooming in male VPA-exposed rats. p = 0.0045], CBDV [F(1,12) = 14.71; p = 0.0024] and × Significant VPA [F(1,35) = 7.301; p = 0.0106] and VPA CBDV interaction [F(1,12) = 8.361; p = 0.0135] on VPA × CBDV [F(2,35) = 7.554; p = 0.0019] effects were GFAP expression. Prenatal VPA exposure significantly increased observed on locomotor activity in male rats. VPA administration GFAP protein levels in the hippocampus. Symptomatic CBDV significantly increased locomotor activity by about 137.9% treatment completely restore GFAP expression in VPA rats compared to controls. Chronic CBDV treatment did not without affecting the levels of this marker in control animals. affect locomotion when administered to controls while Similarly, a significant increase in CD11b expression was found CBDV administration in VPA rats significantly prevented in the hippocampus after VPA exposure in utero and CBDV hyperlocomotion only at the dose of 20 mg/kg. administration showed a trend toward reducing the expression of this marker when given to VPA rats without having any effect Biochemistry per se in control animals [VPA: F(1,12) = 5.673; p = 0.0308]. All biochemical studies were performed 24 h after the last CBDV Significant effects of VPA [F(1,12) = 4.902; p = 0.0469] and (or vehicle) injection using the dose of CBDV more efficacious VPA × CBDV interaction [F(1,12) = 8.531; p = 0.0128] toward ASD-like phenotypes (i.e., 20 mg/kg). were observed on TNF-α, whose expression was significantly increased in the hippocampus of VPA pre-treated rats. CBDV Effect of Symptomatic CBDV Treatment (20 mg/kg) treatment significantly restored TNF-α levels when chronically on Components of the Endocannabinoid System in administered to VPA rats. the Hippocampus of Vehicle- and VPA-Exposed Rats Figures 4B,C shows the effects of prenatal VPA and Figure 3 shows the effects of CBDV on the protein levels symptomatic CBDV treatments on some parameters of microglia of components of the endocannabinoid system in the morphology, namely soma size and roundness as well as surface hippocampus of vehicle and VPA rats. Two-way ANOVA area and perimeter. Statistical analysis revealed main effects of revealed significant effects of VPA [F(1,12) = 8.198; p = 0.0143], VPA [F(1−8) = 17.55; p = 0.0030], CBDV [F(1−8) = 18.41;

Frontiers in Cellular Neuroscience| www.frontiersin.org 8 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 9

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

FIGURE 3 | Effect of symptomatic CBDV 20 mg/kg/day treatment on components of the endocannabinoid system in the hippocampus of the male offspring of VPA- and vehicle-exposed rats as measured by means of Western blot analysis in cytosolic fractions. Data represent mean ± SEM of n = 3 vehicle-vehicle, n = 3 vehicle-CBDV 20 mg/kg, n = 5 VPA-vehicle, n = 5 VPA-CBDV 20 mg/kg and were analyzed using two-way ANOVA followed by Tukey’s post hoc test (∗∗p < 0.01, ∗p < 0.05 vs. vehicle-vehicle;◦◦p < 0.01,◦p < 0.05 vs. VPA-vehicle).

p = 0.0026], and VPA × CBDV interaction [F(1−8) = 16.26; area and perimeter of microglia cells. Again, CBDV did not p = 0.0038] on soma size. Soma size was significantly increased affect either surface area or perimeter of Iba-1 positive cells in in rats prenatally exposed to VPA compared to controls. CBDV control animals but its administration significantly normalized treatment did not alter soma size in control animals but it both parameters in rats prenatally exposed to VPA. significantly restored soma area when administered to VPA- treated rats. Similarly, main effects of VPA [F(1−8) = 25.21; Effect of Symptomatic CBDV Treatment (20 mg/kg) p = 0.0010], CBDV [F(1−8) = 7.376; p = 0.0264], and on Components of the Endocannabinoid System and VPA × CBDV interaction [F(1−8) = 7.221; p = 0.0276] Neuroinflammatory Markers in the PFC of Vehicle- were observed on soma roundness. Prenatal VPA exposure and VPA-Exposed Rats significantly reduced roundness of the soma of Iba-1 positive As shown in Figure 5A, no effect of prenatal VPA and cells in the hippocampus with respect to controls. CBDV symptomatic CBDV treatments were found on CB1 and CB2 completely rescued this alteration without affecting soma receptor, FAAH, MAGL, and NAPE-PLD levels in the PFC. In roundness in control rats. contrast, statistical analysis revealed significant effects of VPA Statistical analysis also revealed main effects of VPA [F(1,12) = 11.02; p = 0.0041] and CBDV [F(1,12) = 13.39; [F(1−8) = 26.18; p = 0.0009], CBDV [F(1−8) = 11.98; p = 0.0086], p = 0.0033] on DAGLα expression. Prenatal VPA exposure and VPA × CBDV interaction [F(1−8) = 13.60; p = 0.0062] on significantly reduced DAGLα levels in this brain area and a surface area and perimeter [VPA: F(1−8) = 34.68; p = 0.0004, similar effect was observed after CBDV administration both in CBDV: F(1−8) = 17.28; p = 0.0032, and VPA × CBDV interaction: control and in VPA rats. Concerning the neuroinflammatory F(1−8) = 20.71; p = 0.0019]. Morphological analysis showed markers (Figure 5B), neither VPA nor CBDV affected GFAP, that prenatal VPA exposure significantly reduced both surface CD11b, and TNF-α levels in the PFC.

Frontiers in Cellular Neuroscience| www.frontiersin.org 9 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 10

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

FIGURE 4 | (A) Effects of prenatal VPA exposure and symptomatic CBDV 20 mg/kg/day treatment on the expression of the astrocyte marker GFAP, the microglia marker CD11b and the pro-inflammatory cytokine TNF-α in the hippocampus as measured by means of Western blot analysis in cytosolic fractions. Data represent mean ± SEM of n = 3 vehicle-vehicle, n = 3 vehicle-CBDV 20 mg/kg, n = 5 VPA-vehicle, n = 5 VPA-CBDV 20 mg/kg and were analyzed using two-way ANOVA followed by Tukey post hoc test. (B) Effect of prenatal VPA exposure and CBDV treatment (20 mg/kg/day; PND 34–58) on microglia morphology in the hippocampus as analyzed through Iba1 immunostaining. (C) Representative Iba-1 staining and microglia morphology at ×40 magnification (upper panels: grayscale images; lower panels: filled images). Data represent mean ± SEM of three animals per group (4 slices/animal, 240 µm apart; 8 cells/animals) and were analyzed using two-way ANOVA followed by Tukey’s post hoc test (∗∗∗p < 0.001,∗∗p < 0.01, ∗p < 0.05 vs. vehicle-vehicle;◦◦◦p < 0.001,◦◦p < 0.01,◦p < 0.05 vs. VPA-vehicle).

DISCUSSION in sociability and social novelty preference, repetitive self- grooming, recognition memory impairment and hyperactivity. This study was performed to determine whether CBDV treatment In contrast, doses of 2 and 100 mg/kg only partially affected could be beneficial toward ASD-like features induced by the phenotypes under investigation: CBDV 2 mg/kg recovered prenatal VPA exposure in rats. In particular, we evaluated short-term memory deficits and hyperlocomotion while, at the CBDV’s efficacy toward VPA-induced deficits in sociability dose of 100 mg/kg, CBDV’s activity against the deficit in social and social novelty preference, repetitive self-grooming behavior, novelty preference and stereotyped behaviors was lost. The recognition memory deficits and hyperactivity in the male lowest dose tested, 0.2 mg/kg, was instead ineffective. Hence, offspring of VPA-treated dams using either symptomatic (PND in this experimental model and at the doses tested in this 34–58) and preventative (PND 19–32) treatment protocols. study, CBDV does not show a linear dose-response curve, Results here presented show that chronic CBDV treatment being more effective at the intermediate dose of 20 mg/kg was able to ameliorate ASD-like signs induced by prenatal with respect to doses of 2 and 100 mg/kg. This could suggest VPA exposure in the male offspring. Treatment with CBDV that CBDV might display a bell shaped dose-response curve at the dose of 20 mg/kg in symptomatic rats rescued deficits as demonstrated for other phytocannabinoids in some animal

Frontiers in Cellular Neuroscience| www.frontiersin.org 10 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 11

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

FIGURE 5 | Effect of prenatal VPA exposure and symptomatic CBDV 20 mg/kg/day treatment on protein levels of (A) components of the endocannabinoid system and (B) the astrocyte marker GFAP, the microglia marker CD11b and the pro-inflammatory cytokine TNF-α in the PFC as measured by means of Western blot analysis in cytosolic fractions. Data represent mean ± SEM of n = 3 vehicle-vehicle, n = 3 vehicle-CBDV 20 mg/kg, n = 5 VPA-vehicle, n = 5 VPA-CBDV 20 mg/kg and were analyzed using two-way ANOVA followed by Tukey’s post hoc test. (∗∗p < 0.01, ∗p < 0.05 vs. vehicle-vehicle).

models (Pertwee, 2004; Mishima et al., 2005; Mechoulam et al., independent from the time window of administration, CBDV 2007; Campos and Guimarães, 2008; Zuardi, 2008; Zanelati et al., at all doses was devoid of any side effect when administered 2010; Campos et al., 2012). Alternatively, it could be possible that to control animals, further supporting the safety profile of this the experimental paradigm used in our study failed to identify a compound (Huizenga et al., 2019). linear dose response range. In the search for possible correlates of the effects observed Slightly different results were found in the preventative at the behavioral level, we performed neurochemical analysis treatment schedule. Preventative CBDV treatment at the dose in the PFC and hippocampus of VPA-exposed rats treated of 2 mg/kg significantly prevented sociability and social novelty with CBDV at the dose that showed the maximum behavioral preference deficits but failed to ameliorate repetitive behaviors, efficacy, i.e., 20 mg/kg. Neurochemical investigations were hyperactivity and short-term memory deficits. In contrast, CBDV carried out after symptomatic CBDV treatment only, as the 20 mg/kg prevented sociability and social novelty preference translational value of a preventative treatment in the context deficits, normalized locomotor activity and improved short- of ASD is quite limited at present. In fact, diagnosis of ASD term memory deficits but was ineffective toward repetitive self- is based on the identification of symptoms and a preventative grooming behavior. treatment could only be useful when reliable biomarkers are An aspect that emerges from these data is the different efficacy available. Identifying biomarkers for early disease detection, of CBDV depending on the time of administration. In fact, especially in high-risk populations, is therefore a primary while symptomatic treatment at the dose of 20 mg/kg appears need to allow for earlier pharmacological interventions, with to be efficacious in reverting most ASD-like phenotypes, none the intent of improving outcomes. Of note, results here of CBDV’s doses tested in this study completely prevented presented raise the intriguing possibility that early CBDV the behaviors under investigation when administered during treatment might partially prevent/attenuate the development early developmental period (i.e., peri-weaning). Nevertheless, of ASD symptoms.

Frontiers in Cellular Neuroscience| www.frontiersin.org 11 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 12

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

Recent data from human and animal studies suggest an of the endocannabinoid system and neuroinflammation co-exist involvement of the endocannabinoid system in the pathogenesis in the brain of VPA-treated rats, there is no evidence about of ASD. Lower circulating endocannabinoid levels and changes a possible correlation between the two events in the animal of endocannabinoid receptors and enzymes have been reported model at baseline. Indeed, the consequences of a modulation in ASD patients (Siniscalco et al., 2013, 2014; Brigida et al., of either the endocannabinoid system or inflammation have 2017; Karhson et al., 2018; Aran et al., 2019). Animal studies been evaluated in the VPA model but no study has checked support human data demonstrating the presence of alterations in whether modulating one of the two events affects the other. several components of the endocannabinoid system in the brain Starting from the observation that CBDV does not directly of both genetic and environmental ASD models (Maccarrone interact with the cannabinoid system at physiologically relevant et al., 2010; Jung et al., 2012; Foldy et al., 2013; Kerr et al., concentration, we speculate that restoration of the homeostatic 2013; Speed et al., 2015; Zamberletti et al., 2017). Remarkably, endocannabinoid tone by CBDV might be secondary to its pharmacological modulation of the endocannabinoid signaling effect on neuroinflammation. We hypothesize that CBDV might can ameliorate some ASD-like phenotypes in animals (Busquets- promote a shift from a pro-inflammatory state, also called the Garcia et al., 2013; Qin et al., 2015; Gomis-González et al., 2016; “M1 phenotype,” presenting neurotoxic activities and releasing Kerr et al., 2016; Servadio et al., 2016; Wei et al., 2016; Melancia pro-inflammatory signals, to a more neuroprotective profile et al., 2018), suggesting that interfering with the endocannabinoid called the “M2 phenotype” which involves anti-inflammatory system might be beneficial for relieving ASD symptomatology. In responses. Of note, upregulation of CB2 receptors has been line with literature data, we found that prenatal VPA exposure associated with a restoration of tissue homeostasis in pathological triggers endocannabinoid system alterations in the brain of the neuroinflammatory conditions (Miller and Devi, 2011) and male offspring. These changes are more pronounced in the our observation that CBDV increases the expression of CB2 hippocampus with respect to the PFC. Specifically, enhanced receptors in VPA rats further supports its anti-inflammatory FAAH and MAGL expression together with an up-regulation of action in this model. We speculate that microglia cells CB1 receptor were observed in the hippocampus while reduced shifted to an anti-inflammatory phenotype would then increase DAGLα levels were detected in the PFC. Increases in the enzymes endocannabinoid production (Mecha et al., 2015), which by responsible for AEA and 2-AG degradation in the hippocampus acting autocrinally and/or paracrinally could facilitate/amplify and the reduction of 2-AG synthesis in the PFC possibly support the M2 anti-inflammatory phenotype and might contribute to the the presence of a reduced endocannabinoid tone in the brain of restoration of endocannabinoid signaling. VPA-exposed animals, in line with previous findings (Kerr et al., 2013). Interestingly, FAAH, MAGL, and CB1 receptor protein levels returned to control level following CBDV treatment, CONCLUSION suggesting that CBDV’s ability to restore endocannabinoid system abnormalities might contribute to its beneficial effects on This study provides preclinical evidence in support of the ASD-like behaviors. In addition, we found that CBDV treatment ability of CBDV to ameliorate behavioral abnormalities also up-regulated CB2 receptor expression in the hippocampus of resembling the core and associated symptoms of ASD, a VPA-exposed rats. CB2 is emerging as an important regulator of developmental condition for which no cure is available. the inflammatory response in the central nervous system (Basu Restoration of hippocampal endocannabinoid signaling and Dittel, 2011). Although still debated, several authors suggest and neuroinflammation are likely to contribute to CBDV’s its immunosuppressive and neuroprotective potential (Ehrhart beneficial effects toward ASD-like phenotypes induced by et al., 2005; Palazuelos et al., 2009; Tumati et al., 2012; Zoppi prenatal VPA exposure. et al., 2014; Navarro et al., 2016). Its deletion in animals usually Although further work is required to determine the exacerbates the inflammatory phenotype in several models and mechanism(s) of action of CBDV and to evaluate its effect CB2 activation by cannabinoids can slow the progression of in other animal models, the present results identify for the first some diseases, in addition to reducing inflammation (Turcotte time CBDV as a suggested candidate for the treatment of ASD. et al., 2016), suggesting that modulation of CB2 receptor could be beneficial for relieving inflammation. Although our data does DATA AVAILABILITY not allow to establish a causal relationship, we observed that CBDV-induced up-regulation of hippocampal CB2 receptor was The raw data supporting the conclusions of this manuscript will associated with the rescue of the neuroinflammatory markers be made available on request, without undue reservation, to any GFAP, CD11b, and TNF-α in the same brain region. Further qualified researcher. supporting its either direct or indirect neuroprotective effects, we observed that CBDV treatment can restore microglia activation and consecutive morphological changes in terms of cell size and AUTHOR CONTRIBUTIONS soma shape in the hippocampus of VPA-treated animals. Hence, CBDV treatment restores the endocannabinoid system and EZ performed the histochemical and Western blot experiments reduces neuroinflammation in the VPA model but, based on the and wrote the first draft of the manuscript. MG performed present data, we cannot establish any causality between the two the pharmacological treatments and behavioral experiments. events. Although literature data clearly indicate that alterations MW-R and SB helped with the manuscript writing and English

Frontiers in Cellular Neuroscience| www.frontiersin.org 12 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 13

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

editing. TR helped with the data interpretation and manuscript (Milano, Italy). The funding source had no further writing. DP conceived the study, supervised the project, helped role in study design, in the collection, analysis and with the data interpretation and manuscript writing. All authors interpretation of data, decision to publish, and preparation of contributed and have approved the final draft of the manuscript. the manuscript.

FUNDING SUPPLEMENTARY MATERIAL

This work was supported by the GW Research Ltd. The Supplementary Material for this article can be found (Cambridge, United Kingdom). EZ has a postdoctoral online at: https://www.frontiersin.org/articles/10.3389/fncel. research fellowship funded by the Zardi-Gori Foundation 2019.00367/full#supplementary-material

REFERENCES Codagnone, M. G., Podestá, M. F., Uccelli, N. A., and Reinés, A. (2015). Differential local connectivity and neuroinflammation profiles in the medial prefrontal Al-Amin, M. M., Rahman, M. M., Khan, F. R., Zaman, F., and Mahmud Reza, cortex and hippocampus in the valproic acid rat model of autism. Dev. Neurosci. H. (2015). Astaxanthin improves behavioral disorder and oxidative stress in 37, 215–231. doi: 10.1159/000375489 prenatal valproic acid-induced mice model of autism. Behav. Brain Res. 286, Deckmann, I., Schwingel, G. B., Fontes-Dutra, M., Bambini-Junior, V., and 112–121. doi: 10.1016/j.bbr.2015.02.041 Gottfried, C. (2018). Neuroimmune alterations in autism: a translational American Psychiatric Association [APA] (2013). Diagnostic and Statistical Manual analysis focusing on the animal model of autism induced by prenatal of Mental Disorders, 5th Edn. Washington, DC: American Psychiatric exposure to valproic acid. Neuroimmunomodulation 25, 285–299. doi: 10.1159/ Publishing, Inc. 000492113 Aran, A., Eylon, M., Harel, M., Polianski, L., Nemirovski, A., Tepper, S., et al. Dufour-Rainfray, D., Vourc’h, P., Le Guisquet, A. M., Garreau, L., Ternant, D., (2019). Lower circulating endocannabinoid levels in children with autism Bodard, S., et al. (2010). Behavior and serotonergic disorders in rats exposed spectrum disorder. Mol. Autism. 10:2. doi: 10.1186/s13229-019-0256-6 prenatally to valproate: a model for autism. Neurosci. Lett. 470, 55–59. doi: Baio, J., Wiggins, L., Christensen, D. L., Maenner, M. J., Daniels, J., Warren, Z., et al. 10.1016/j.neulet.2009.12.054 (2018). Prevalence of autism spectrum disorder among children aged 8 years – Dufour-Rainfray, D., Vourc’h, P., Tourlet, S., Guilloteau, D., Chalon, S., res, C. R. autism and developmental disabilities monitoring network, 11 sites, United (2011). Fetal exposure to teratogens: evidence of genes involved in autism. States, 2014. MMWR Surveill. Summ. 67, 1–23. doi: 10.15585/mmwr.ss6706a1 Neurosci. Biobehav. Rev. 35, 1254–1265. doi: 10.1016/j.neubiorev.2010.12.013 Bambini-Junior, V., Zanatta, G., Della Flora Nunes, G., Mueller, de Melo, G., Duncan, S. (2007). Teratogenesis of sodium valproate. Curr. Opin. Neurol. 20, Michels, M., et al. (2014). Resveratrol prevents social deficits in animal model 175–180. doi: 10.1097/WCO.0b013e32805866fb of autism induced by valproic acid. Neurosci. Lett. 583, 176–181. doi: 10.1016/j. Ehrhart, J., Obregon, D., Mori, T., Hou, H., Sun, N., Bai, Y., et al. (2005). neulet.2014.09.039 Stimulation of cannabinoid receptor 2 (CB2) suppresses microglial activation. Banji, D., Banji, O. J., Abbagoni, S., Hayath, M. S., Kambam, S., and Chiluka, V. L. J. Neuroinflammation 2:29. doi: 10.1186/1742-2094-2-29 (2011). Amelioration of behavioral aberrations and oxidative markers by green Ergaz, Z., Weinstein-Fudim, L., and Ornoy, A. (2016). Genetic and non-genetic tea extract in valproate induced autism in animals. Brain Res. 1410, 141–151. animal models for autism spectrum disorders (ASD). Reprod Toxicol. 64, doi: 10.1016/j.brainres.2011.06.063 116–140. doi: 10.1016/j.reprotox.2016.04.024 Basu, S., and Dittel, B. N. (2011). Unraveling the complexities of cannabinoid Fernández-Arjona, M. D. M., Grondona, J. M., Granados-Durán, P., Fernández- receptor 2 (CB2) immune regulation in health and disease. Immunol. Res. 51, Llebrez, P., and López-Ávalos, M. D. (2017). Microglia morphological 26–38. doi: 10.1007/s12026-011-8210-5 categorization in a rat model of neuroinflammation by hierarchical cluster and Bertolino, B., Crupi, R., Impellizzeri, D., Bruschetta, G., Cordaro, M., principal components analysis. Front. Cell Neurosci. 11:235. doi: 10.3389/fncel. Siracusa, R., et al. (2017). Beneficial effects of co-ultramicronized 2017.00235 palmitoylethanolamide/luteolin in a mouse model of autism and in a case Foldy, C., Malenka, R. C., and Sudhof, T. C. (2013). Autism-associated neuroligin- report of autism. CNS Neurosci. Ther. 23, 87–98. doi: 10.1111/cns.12648 3 mutations commonly disrupt tonic endocannabinoid signaling. Neuron 78, Brigida, A. L., Schultz, S., Cascone, M., Antonucci, N., and Siniscalco, D. 498–509. doi: 10.1016/j.neuron.2013.02.036 (2017). Endocannabinod signal dysregulation in autism spectrum disorders: a Fontes-Dutra, M., Santos-Terra, J., Deckmann, I., Brum Schwingel, G., Della- correlation link between inflammatory state and neuro-immune alterations. Int. Flora Nunes, G., Hirsch, M. M., et al. (2018). resveratrol prevents cellular J. Mol. Sci. 18:E1425. doi: 10.3390/ijms18071425 and behavioral sensory alterations in the animal model of autism induced Bronzuoli, M. R., Facchinetti, R., Ingrassia, D., Sarvadio, M., Schiavi, S., Steardo, L., by valproic acid. Front. Synaptic. Neurosci. 10:9. doi: 10.3389/fnsyn.2018. et al. (2019). Neuroglia in the autistic brain: evidence from a preclinical model. 00009 Mol. Autism 9:66. doi: 10.1186/s13229-018-0254-0 Gandal, M. J., Edgar, J. C., Ehrlichman, R. S., Mehta, M., Roberts, T. P., and Busquets-Garcia, A., Gomis-Gonzalez, M., Guegan, T., Agustin-Pavon, C., Pastor, Siegel, S. J. (2010). Validating γ oscillations and delayed auditory responses as A., Mato, S., et al. (2013). Targeting the endocannabinoid system in the translational biomarkers of autism. Biol. Psychiatry 68, 1100–1106. doi: 10.1016/ treatment of fragile X syndrome. Nat. Med. 19, 603–607. doi: 10.1038/nm.3127 j.biopsych.2010.09.031 Campos, A. C., and Guimarães, F. S. (2008). Involvement of 5HT1A receptors Gao, J., Wang, X., Sun, H., Cao, Y., Liang, S., Wang, H., et al. (2016). in the anxiolytic-like effects of cannabidiol injected into the dorsolateral Neuroprotective effects of docosahexaenoic acid on hippocampal cell death periaqueductal gray of rats. Psychopharmacology 199, 223–230. doi: 10.1007/ and learning and memory impairments in a valproic acid-induced rat s00213-008-1168-x autism model. Int. J. Dev. Neurosci. 49, 67–78. doi: 10.1016/j.ijdevneu.2015. Campos, A. C., Moreira, F. A., Gomes, F. V., Del Bel, E. A., and Guimarães, 11.006 F. S. (2012). Multiple mechanisms involved in the large-spectrum therapeutic Gomis-González, M., Busquets-Garcia, A., Matute, C., Maldonado, R., Mato, S., potential of cannabidiol in psychiatric disorders. Philos. Trans. R. Soc. Lond. B and Ozaita, A. (2016). Possible therapeutic doses of cannabinoid type 1 receptor Biol. Sci. 367, 3364–3378. doi: 10.1098/rstb.2011.0389 antagonist reverses key alterations in fragile X syndrome mouse model. Genes Christensen, J., Grønborg, T. K., Sørensen, M. J., Schendel, D., Parner, E. T., 7:E56. doi: 10.3390/genes7090056 Pedersen, L. H., et al. (2013). Prenatal valproate exposure and risk of autism Huizenga, M. N., Sepulveda-Rodriguez, A., and Forcelli, P. A. (2019). Preclinical spectrum disorders and childhood autism. JAMA 309, 1696–1703. doi: 10.1001/ safety and efficacy of cannabidivarin for early life seizures. Neuropharmacology jama.2013.2270 148, 189–198. doi: 10.1016/j.neuropharm.2019.01.002

Frontiers in Cellular Neuroscience| www.frontiersin.org 13 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 14

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

Jung, K. M., Sepers, M., Henstridge, C. M., Lassalle, O., Neuhofer, D., Martin, H., Mishima, K., Hayakawa, K., Abe, K., Ikeda, T., Egashira, N., Iwasaki, K., et al. (2012). Uncoupling of the endocannabinoid signalling complex in a mouse et al. (2005). Cannabidiol prevents cerebral infarction via a serotonergic 5- model of fragile X syndrome. Nat. Commun. 3:1080. doi: 10.1038/ncomms2045 hydroxytryptamine1A receptor-dependent mechanism. Stroke 36, 1077–1082. Karhson, D. S., Krasinska, K. M., Dallaire, J. A., Libove, R. A., Phillips, J. M., Chien, doi: 10.1161/01.STR.0000163083.59201.34 A. S., et al. (2018). Plasma anandamide concentrations are lower in children Morakotsriwan, N., Wattanathorn, J., Kirisattayakul, W., and Chaisiwamongkol, with autism spectrum disorder. Mol Autism. 9:18. doi: 10.1186/s13229-018- K. (2016). Autistic-like behaviors, oxidative stress status, and histopathological 0203-y changes in cerebellum of valproic acid rat model of autism are improved by the Kern, J. K., Geier, D. A., Sykes, L. K., and Geier, M. R. (2016). Relevance of combined extract of purple rice and silkworm pupae. Oxid. Med. Cell. Longev. neuroinflammation and encephalitis in autism. Front. Cell. Neurosci. 9:519. 2016:3206561. doi: 10.1155/2016/3206561 doi: 10.3389/fncel.2015.00519 Morales, P., Hurst, D. P., and Reggio, P. H. (2017). Molecular targets of the Kerr, D. M., Downey, L., Conboy, M., Finn, D. P., and Roche, M. (2013). Alterations phytocannabinoids: a complex picture. Prog. Chem. Org. Nat. Prod. 103, 103– in the endocannabinoid system in the rat valproic acid model of autism. Behav. 131. doi: 10.1007/978-3-319-45541-9_4 Brain Res. 249, 124–132. doi: 10.1016/j.bbr.2013.04.043 Morgan, J. T., Chana, G., Pardo, C. A., Achim, C., Semendeferi, K., Buckwalter, J., Kerr, D. M., Gilmartin, A., and Roche, M. (2016). Pharmacological inhibition of et al. (2010). Microglial activation and increased microglial density observed fatty acid amide hydrolase attenuates social behavioural deficits in male rats in the dorsolateral prefrontal cortex in autism. Biol. Psychiatry 68, 368–376. prenatally exposed to valproic acid. Pharmacol. Res. 113, 228–235. doi: 10.1016/ doi: 10.1016/j.biopsych.2010.05.024 j.phrs.2016.08.033 Nagarkatti, P., Pandey, R., Rieder, S. A., Hegde, V. L., and Nagarkatti, M. (2009). Kim, K. C., Gonzales, E. L., Lázaro, M. T., Choi, C. S., Bahn, G. H., Yoo, H. J., Cannabinoids as novel anti-inflammatory drugs. Future Med. Chem. 1, 1333– et al. (2016). Clinical and neurobiological relevance of current animal models of 1349. doi: 10.4155/fmc.09.93 autism spectrum disorders. Biomol Ther. 24, 207–243. doi: 10.4062/biomolther. Navarro, G., Morales, P., Rodríguez-Cueto, C., Fernández-Ruiz, J., Jagerovic, 2016.061 N., and Franco, R. (2016). Targeting cannabinoid cb2 receptors in the Kim, K. C., Kim, P., Go, H. S., Choi, C. S., Yang, S. I., Cheong, J. H., et al. central nervous system. medicinal chemistry approaches with focus on (2011). The critical period of valproate exposure to induce autistic symptoms neurodegenerative disorders. Front. Neurosci. 10:406. doi: 10.3389/fnins.2016. in sprague-dawley rats. Toxicol Lett. 201, 137–142. doi: 10.1016/j.toxlet.2010. 00406 12.018 Ornoy, A., Weinstein-Fudim, L., and Ergaz, Z. (2015). Prenatal factors associated Kumar, H., and Sharma, B. (2016). Minocycline ameliorates prenatal valproic acid with autism spectrum disorder (ASD). Reprod Toxicol. 56, 155–169. doi: 10. induced autistic behaviour, biochemistry and blood brain barrier impairments 1016/j.reprotox.2015.05.007 in rats. Brain Res. 1630, 83–97. doi: 10.1016/j.brainres.2015.10.052 Ornoy, A., Weinstein-Fudim, L., and Ergaz, Z. (2019). Prevention or amelioration Kuo, H. Y., and Liu, F. C. (2018). molecular pathology and pharmacological of autism-like symptoms in animal models: will it bring us closer to treating treatment of autism spectrum disorder-like phenotypes using rodent models. human ASD? Int. J. Mol. Sci. 20, E1074. doi: 10.3390/ijms20051074 Front. Cell Neurosci. 12:422. doi: 10.3389/fncel.2018.00422 Palazuelos, J., Aguado, T., Pazos, M. R., Julien, B., Carrasco, C., Resel, E., Ligresti, A., De Petrocellis, L., and Di Marzo, V. (2016). From phytocannabinoids et al. (2009). Microglial CB2 cannabinoid receptors are neuroprotective in to cannabinoid receptors and endocannabinoids: pleiotropic physiological and Huntington’s disease excitotoxicity. Brain 132(Pt 11), 3152–3164. doi: 10.1093/ pathological roles through complex pharmacology. Physiol. Rev. 96, 1593–1659. brain/awp23 doi: 10.1152/physrev.00002.2016 Pertwee, R. G. (2004). “The pharmacology and therapeutic potential of Loomes, R., Hull, L., and Mandy, W. P. L. (2017). What Is the Male-to-female ratio cannabidiol,” in Cannabinoids, ed. V. Di Marzo (Kluwer: Academic/Plenum in autism spectrum disorder? A systematic review and meta-analysis. J. Am. Publishers), 32–83. Acad. Child Adolesc. Psychiatry 56, 466–474. doi: 10.1016/j.jaac.2017.03.013 Pragnya, B., Kameshwari, J., and Veeresh, B. (2014). Ameliorating effect of piperine Lucchina, L., and Depino, A. M. (2014). Altered peripheral and central on behavioral abnormalities and oxidative markers in sodium valproate induced inflammatory responses in a mouse model of autism. Autism Res. 7, 273–289. autism in BALB/C mice. Behav. Brain Res. 270, 86–94. doi: 10.1016/j.bbr.2014. doi: 10.1002/aur.1338 04.045 Mabunga, D. F., Gonzales, E. L., Kim, J. W., Kim, K. C., and Shin, C. Y. (2015). Qin, M., Zeidler, Z., Moulton, K., Krych, L., Xia, Z., and Smith, C. B. (2015). Exploring the validity of valproic acid animal model of autism. Exp. Neurobiol. Endocannabinoid-mediated improvement on a test of aversive memory in a 24, 285–300. doi: 10.5607/en.2015.24.4.285 mouse model of fragile X syndrome. Behav. Brain Res. 291, 164–171. doi: Maccarrone, M., Rossi, S., Bari, M., de Chiara, V., Rapino, C., Musella, A., et al. 10.1016/j.bbr.2015.05.003 (2010). Abnormal mGlu 5 receptor/endocannabinoid coupling in mice lacking Roullet, F. I., Lai, J. K., and Foster, J. A. (2013). In utero exposure to valproic acid FMRP and BC1 RNA. Neuropsychopharmacology 35, 1500–1509. doi: 10.1038/ and autism-a current review of clinical and animal studies. Neurotoxicol Teratol. npp.2010.19 36, 47–56. doi: 10.1016/j.ntt.2013.01.004 Maroon, J., and Bost, J. (2018). Review of the neurological benefits of Schneider, T., and Przewłocki, R. (2005). Behavioral alterations in rats prenatally phytocannabinoids. Surg. Neurol. Int. 9:91. doi: 10.4103/sni.sni_45_18 exposed to valproic acid: animal model of autism. Neuropsychopharmacology Mecha, M., Feliú, A., Carrillo-Salinas, F. J., Rueda-Zubiaurre, A., Ortega-Gutiérrez, 30, 80–89. doi: 10.1038/sj.npp.1300518 S., de Sola, R. G., et al. (2015). Endocannabinoids drive the acquisition of an Servadio, M., Melancia, F., Manduca, A., di Masi, A., Schiavi, S., Cartocci, V., et al. alternative phenotype in microglia. Brain Behav. Immun. 49, 233–245. doi: (2016). Targeting anandamide metabolism rescues core and associated autistic- 10.1016/j.bbi.2015.06.002 like symptoms in rats prenatally exposed to valproic acid. Transl. Psychiatry Mechoulam, R., Peters, M., Murillo-Rodriguez, E., and Hanus, L. O. (2007). 6:e902. doi: 10.1038/tp.2016.182 Cannabidiol–recent advances. Chem. Biodivers. 4, 1678–1692. doi: 10.1002/ Shen, C., and Chen, Y. (2013). Preparation of pre- and post-synaptic density cbdv.200790147 fraction from mouse cortex. Bio Protoc. 3:e880. doi: 10.21769/BioProtoc.880 Mehta, M. V., Gandal, M. J., and Siegel, S. J. (2011). mGluR5-antagonist mediated Siniscalco, D., Bradstreet, J. J., Cirillo, A., and Antonucci, N. (2014). The reversal of elevated stereotyped, repetitive behaviors in the VPA model of in vitro GcMAF effects on endocannabinoid system transcriptionomics, autism. PLoS One 6:e26077. doi: 10.1371/journal.pone.0026077 receptor formation, and cell activity of autism-derived macrophages. J Melancia, F., Schiavi, S., Servadio, M., Cartocci, V., Campolongo, P., Palmery, Neuroinflammation 11:78. doi: 10.1186/1742-2094-11-78 M., et al. (2018). Sex-specific autistic endophenotypes induced by prenatal Siniscalco, D., Sapone, A., Giordano, C., Cirillo, A., de Magistris, L., Rossi, F., exposure to valproic acid involve anandamide signalling. Br. J. Pharmacol. 175, et al. (2013). Cannabinoid receptor type 2, but not type 1, is up-regulated in 3699–3712. doi: 10.1111/bph.14435 peripheral blood mononuclear cells of children affected by autistic disorders. Miller, L. K., and Devi, L. A. (2011). the highs and lows of cannabinoid J. Autism. Dev. Disord. 43, 2686–2695. doi: 10.1007/s10803-013-1824-9 receptor expression in disease: mechanisms and their therapeutic implications. Speed, H. E., Masiulis, I., Gibson, J. R., and Powell, C. M. (2015). Increased cortical Pharmacol. Rev. 63, 461–470. doi: 10.1124/pr.110.003491 inhibition in autism-linked neuroligin-3R451C mice is due in part to loss of

Frontiers in Cellular Neuroscience| www.frontiersin.org 14 August 2019| Volume 13| Article 367 fncel-13-00367 August 8, 2019 Time: 16:47 # 15

Zamberletti et al. CBDV Relieves Autistic-Like Phenotypes in VPA-Treated Rats

endocannabinoid signaling. PLoS One 10:e0140638. doi: 10.1371/journal.,pone. exposure in rats. Neurobiol. Dis. 63, 35–47. doi: 10.1016/j.nbd.2013. 0140638 10.028 Suzuki, K., Sugihara, G., Ouchi, Y., Nakamura, K., Futatsubashi, M., Takebayashi, Zamberletti, E., Gabaglio, M., and Parolaro, D. (2017). The endocannabinoid K., et al. (2013). Microglial activation in young adults with autism system and autism spectrum disorders: insights from animal models. Int. J. Mol. spectrum disorder. JAMA Psychiatry 70, 49–58. doi: 10.1001/jamapsychiatry. Sci. 18:E1916. doi: 10.3390/ijms18091916 2013.272 Zamberletti, E., Gabaglio, M., Piscitelli, F., Brodie, J. S., Woolley-Roberts, M., Tartaglione, A. M., Schiavi, S., Calamandrei, G., and Trezza, V. (2019). Prenatal Barbiero, I., et al. (2019). Cannabidivarin completely rescues cognitive deficits valproate in rodents as a tool to understand the neural underpinnings of social and delays neurological and motor defects in male Mecp2 mutant mice. dysfunctions in autism spectrum disorder. Neuropharmacology doi: 10.1016/j. J. Psychopharmacol. 33, 894-907. doi: 10.1177/0269881119844184 expneurol.2017.04.017 [Epub ahead of print]. Zanelati, T. V., Biojone, C., Moreira, F. A., Guimarães, F. S., and Joca, S. R. (2010). Tumati, S., Largent-Milnes, T. M., Keresztes, A., Ren, J., Roeske, W. R., Vanderah, Antidepressant-like effects of cannabidiol in mice: possible involvement of 5- T. W., et al. (2012). Repeated morphine treatment-mediated hyperalgesia, HT1A receptors. Br. J. Pharmacol. 159, 122–128. doi: 10.1111/j.1476-5381.2009. allodynia and spinal glial activation are blocked by co-administration of a 00521.x selective cannabinoid receptor type-2 agonist. J. Neuroimmunol. 244, 23–31. Zoppi, S., Madrigal, J. L., Caso, J. R., García-Gutiérrez, M. S., Manzanares, J., doi: 10.1016/j.jneuroim.2011.12.021 Leza, J. C., et al. (2014). Regulatory role of the cannabinoid CB2 receptor in Turcotte, C., Blanchet, M. R., Laviolette, M., and Flamand, N. (2016). The CB2 stress-induced neuroinflammation in mice. Br. J. Pharmacol. 171, 2814–2826. receptor and its role as a regulator of inflammation. Cell. Mol. Life Sci. 73, doi: 10.1111/bph.12607 4449–4470. doi: 10.1007/s00018-016-2300-4 Zuardi, A. W. (2008). Cannabidiol: from an inactive cannabinoid to a drug with Vargas, D. L., Nascimbene, C., Krishnan, C., Zimmerman, A. W., and Pardo, C. A. wide spectrum of action. Rev. Bras. Psiquiatr. 30, 271–280. doi: 10.1590/S1516- (2005). Neuroglial activation and neuroinflammation in the brain of patients 44462008000300015 with autism. Ann. Neurol. 57, 67–81. doi: 10.1002/ana.20315 Vigli, D., Cosentino, L., Raggi, C., Laviola, G., Woolley-Roberts, M., and Conflict of Interest Statement: DP and TR received research grants from GW De Filippis, B. (2018). Chronic treatment with the phytocannabinoid Research Ltd. MW-R and SB are employees of GW Research Ltd. cannabidivarin (CBDV) rescues behavioural alterations and brain atrophy in a mouse model of Rett syndrome. Neuropharmacology 140, 121–129. doi: 10. The remaining authors declare that the research was conducted in the absence of 1016/j.neuropharm.2018.07.029 any commercial or financial relationships that could be construed as a potential Wei, D., Dinh, D., Lee, D., Li, D., Anguren, A., MorenoSanz, G., et al. (2016). conflict of interest. Enhancement of anandamide-mediated endocannabinoid signaling corrects autism-related social impairment. Cannabis Cannabinoid Res. 1, 81–89. doi: Copyright © 2019 Zamberletti, Gabaglio, Woolley-Roberts, Bingham, Rubino and 10.1089/can.2015.0008 Parolaro. This is an open-access article distributed under the terms of the Creative Yeh, M. L., and Levine, E. S. (2017). Perspectives on the role of endocannabinoids Commons Attribution License (CC BY). The use, distribution or reproduction in in autism spectrum disorders. OBM Neurobiol. 1:005. other forums is permitted, provided the original author(s) and the copyright owner(s) Zamberletti, E., Beggiato, S., Steardo, L. Jr., Prini, P., Antonelli, T., Ferraro, L., et al. are credited and that the original publication in this journal is cited, in accordance (2014). Alterations of prefrontal cortex GABAergic transmission in the complex with accepted academic practice. No use, distribution or reproduction is permitted psychotic-like phenotype induced by adolescent delta-9-tetrahydrocannabinol which does not comply with these terms.

Frontiers in Cellular Neuroscience| www.frontiersin.org 15 August 2019| Volume 13| Article 367 Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 JOURNAL OF http://www.jneuroinflammation.com/content/11/1/78 NEUROINFLAMMATION

RESEARCH Open Access The in vitro GcMAF effects on endocannabinoid system transcriptionomics, receptor formation, and cell activity of autism-derived macrophages Dario Siniscalco1,2,3*, James Jeffrey Bradstreet4,5, Alessandra Cirillo6 and Nicola Antonucci7

Abstract Background: Immune system dysregulation is well-recognized in autism and thought to be part of the etiology of this disorder. The endocannabinoid system is a key regulator of the immune system via the cannabinoid receptor type 2 (CB2R) which is highly expressed on macrophages and microglial cells. We have previously published significant differences in peripheral blood mononuclear cell CB2R gene expression in the autism population. The use of the Gc protein-derived Macrophage Activating Factor (GcMAF), an endogenous glycosylated vitamin D binding protein responsible for macrophage cell activation has demonstrated positive effects in the treatment of autistic children. In this current study, we investigated the in vitro effects of GcMAF treatment on the endocannabinoid system gene expression, as well as cellular activation in blood monocyte-derived macrophages (BMDMs) from autistic patients compared to age-matched healthy developing controls. Methods: To achieve these goals, we used biomolecular, biochemical and immunocytochemical methods. Results: GcMAF treatment was able to normalize the observed differences in dysregulated gene expression of the endocannabinoid system of the autism group. GcMAF also down-regulated the over-activation of BMDMs from autistic children. Conclusions: This study presents the first observations of GcMAF effects on the transcriptionomics of the endocannabinoid system and expression of CB2R protein. These data point to a potential nexus between endocannabinoids, vitamin D and its transporter proteins, and the immune dysregulations observed with autism. Keywords: GcMAF, Endocannabinoids, Gene expression, Macrophages, Autism

Introduction proposed as potential mechanisms [6-9]. The prevailing Autism and autism spectrum disorders (ASDs) are com- hypothesis is that some combination of immune factors plex heterogeneous neurodevelopmental conditions [1], including maternally-developed antibodies to fetal brain, arising from the interaction of genetic and environmen- prime microglia in such a way as to preclude their nor- tal factors [2]. The established symptom categories in- mal functions of directing neuronal migration and prun- clude dysfunctions in communication skills and social ing [10,11]. interactions, combined with repetitive, restrictive and The functional role of Vitamin D in the central nervous stereotypic verbal and non-verbal behaviors. Despite ex- system has recently been reviewed and includes neuro- tensive research efforts, the etiopathologies of ASDs re- genesis, neuroplasticity and a neuroprotection [12]. Vita- main inadequately understood [3-5]. Early inflammatory min D deficiency has been a demonstrated cause of processes, including maternal-fetal immune interactions recurrent pregnancy loss and supplementation with D3 and resultant immunological dysfunctions have been significantly reduces IFN-γ and TNF-α secretion from natural killer (NK) cells [13]. There is a complex inter- * Correspondence: [email protected] action between vitamin D and polymorphisms of the vita- 1Department of Experimental Medicine, Second University of Naples, via S. Maria di Costantinopoli, 16 - 80138 Naples, Italy min D receptor (VDR) and both the risk of autoimmunity 2Centre for Autism - La Forza del Silenzio, Caserta 81036, Italy and the responsiveness to vitamin D supplementation Full list of author information is available at the end of the article

© 2014 Siniscalco et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 2 of 11 http://www.jneuroinflammation.com/content/11/1/78

[14]. In autism, vitamin D deficiency in pregnancy or early individuals, respectively). The subjects with autism were childhood appears to contribute significantly to risk [15]. recruited into the study from the outpatient Biomedical Potentially related to these processes are the recent ob- Center for Autism Research and Treatment, Bari, Italy. servations of elevated N-acetylgalactosaminidase (Naga- Before entering the study, all of the children were ad- lase) levels in the blood of children with ASDs [16]. ministered the Autism Diagnostic Interview-Revised ver- Nagalase is an enzyme that catalyzes the deglycosylation sion [23], the Childhood Autism Rating Scales (CARS) of the Gc protein also known as vitamin D3 binding pro- [24], and the Autism Diagnostic Observation Schedule- tein (VDBP) rendering it incapable of being converted to Generic [25] to document the diagnosis of autism. All the regulatory protein, Gc Macrophage Activating Factor included patients met the Diagnostic and Statistical (GcMAF). GcMAF is an immunologically important pro- Manual of Mental Disorders-IV criteria for autism tein responsible for macrophage activation [17], thus (DSM-IV-TR) [1]. In addition to meeting the criteria for Nagalase diminishes the body’s macrophage activating autistic disorder, subject children were required to score capacity, and elevated Nagalase has been reported in at least 30 points on the CARS scale. Twenty healthy autoimmune disorders including systemic lupus erythe- children were recruited among staff family members. Po- matosus (SLE) [18]. tential subjects were excluded if they had any of the fol- We recently demonstrated that a cannabinoid receptor lowing: a neurological or comorbid psychiatric disorder, type 2 (CB2R) signalling was significantly upregulated in epilepsy, history of liver, renal or endocrine disorders, peripheral blood mononuclear cells (PBMCs) extracted current infection of any origin. Mental retardation or be- from autistic children, suggesting that endocannabinoid havioral disorders, including Pervasive Developmental (EC) system dysregulation could be involved in ASD- Disorder - Not Otherwise Specified (PDD-NOS), and in- mediated immune impairments [19]. clusion criteria for attention deficit-hyperactivity dis- Using a new methodology of radiolabeling, the CB2R order, were all considered exclusion criteria for control distribution was recently mapped using whole body children. Children diagnosed with Asperger’s syndrome, positron emission tomography (PET) [20]. In healthy fragile X syndrome and tuberous sclerosis were also subjects without brain related pathology, the CB2R was excluded from the study. IQ test was not performed. demonstrated to map to the peripheral lymphoid im- Neither autistic subjects nor controls were receiving mune system. Additionally, CB2R is expressed on both pharmacological interventions. Other exclusion criteria macrophages and microglial cells and activation of CB2R were celiac disease and/or other major diseases of the has been demonstrated to down-regulate ischemia- intestinal tract, such as inflammatory bowel disease or induced macrophage-microglial induced inflammation in hepatic disorders. an animal model [21]. Informed consent was obtained from the parents of all The body produces arachidonate-based lipids, an- children enrolled in this study and assent was obtained andamide (N-arachidonoylethanolamide, AEA) and 2- from the healthy controls in compliance with Italian le- arachidonoylglycerol (2-AG) which are binding ligands gislation and the Code of Ethical Principles for Medical for the cannabinoid receptors [22]. CB2R appears to Research Involving Human Subjects of the World Med- have primary immunomodulatory effects and CB2R- ical Association (Declaration of Helsinki). specific agonists and phytocannabinioids (for example, cannabidiol (CBD)) lack psychoactive properties [22]. Isolation of peripheral blood mononuclear cells (PBMCs) GcMAF treatment seems to ameliorate autistic symp- Mononuclear cells were extracted as previously de- toms in some children [16]; however, the cellular and scribed [9,19]. Briefly, less than 10 ml of fresh peripheral molecular pathways involved in the apparent therapeutic blood samples from autistic subjects and control donors effect are not understood. We hypothesized that a po- were drawn and collected in sterile EDTA tubes (Becton tential therapeutic mechanism of GcMAF is related to Dickinson, Franklin Lakes, NJ, USA). Peripheral blood transcriptional regulation of EC genes. We sought to in- mononuclear cells (PMBCs) were isolated by centrifugation vestigate this mechanism in vitro using blood monocyte- over Histopaque 1077 density gradient (Sigma Chemical, St derived macrophages (BMDMs) from autistic patients Louis, MO, USA). Briefly, blood was diluted 1:1 in PBS and controls. (Sigma, St. Louis, MO, USA), overlaid onto lymphocyte separation media (Lymphocyte Separation Medium -Lonza, Materials and methods Walkersville, MD, USA), centrifuged at 2,200 rpm for Subjects 30 minutes at room temperature and plasma was removed. We investigated 22 children with autism, and compared Mononuclear cell fraction was harvested and washed them to 20 age and sex matched healthy children used twice in PBS. The final pellet was re-suspended in as a control group (age ranging 3 to 11 years; mean age: RPMI 1640 complete medium (Lonza, Verviers, Belgium) 7.06 ± 1.52 versus 7.38 ± 2.33 in autistic and healthy containing 10% FBS (EuroClone-Celbio, Milan, Italy), Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 3 of 11 http://www.jneuroinflammation.com/content/11/1/78

2 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml The mRNA levels of the EC genes under analysis were streptomycin (all Lonza, Verviers, Belgium) and incubated measured by RT-PCR amplification, as previously reported at 37°C with 5% CO2. Lymphocytes (non-adherent cells) [19]. Reverse Transcriptase from Avian Myeloblastosis were removed. Virus (AMV-RT; Promega, Madison, WI, USA) was used. For first-strand cDNA synthesis, 200 ng total RNA, ran- Differentiation of macrophages from PBMCs dom hexamers, dNTPs (Promega, Madison, WI, USA), In order to obtain fully differentiated human blood AMV buffer, AMV-RT and recombinant RNasinribonu- monocyte-derived macrophages (BMDMs), PBMCs were clease inhibitor (Promega, Madison, WI, USA) were as- then cultured for about ten days in the presence of 25 ng/ sembled in diethyl-pyrocarbonate-treated water to a 20 μl mL recombinant human macrophage colony-stimulating final volume and incubated for ten minutes at 65°C and factor (Peprotech, London, UK) [26,27] (Figure 1). one hour at 42°C. RT minus controls were carried out to check potential genomic DNA contamination. These RT in vitro treatment minus controls were performed without using the reverse GcMAF was added at 0.1 ng/ml final concentration to transcriptase enzyme in the reaction mix. Aliquots of 2 μl BMDMs from healthy control and autistic patients. The cDNA were transferred into a 25 μl PCR reaction mixture dose of GcMAF was chosen on the basis of a previous containing dNTPs, MgCl2, reaction buffer, specific primers work demonstrating that maximal stimulation of PBMCs and GoTaq Flexi DNA polymerase (Promega, Madison, was achieved with 0.1 ng/ml [28]. GcMAF was kindly WI, USA), and amplification reactions using specific provided by Immuno Biotech (St. Peter Port, Guernsey, primers and conditions for human genes under analysis UK). Following incubation of the cells for 24 hours in were carried out. Sequences for the human mRNAs from the presence of GcMAF, some cells were lysed for the GeneBank (DNASTAR Inc., Madison, WI, USA) were extraction and analysis of RNA (Reverse Transcriptase- used to design specific primer pairs for RT-PCRs (OLIGO Polymerase Chain Reaction (RT-PCR)), and proteins via 4.05 software, National Biosciences Inc., Plymouth, MN, Western blot analysis; alternatively, other cells were USA) (Table 1) [19]. Each RT-PCR was repeated at least fixed for fluorescence-based immunocytochemistry ana- three times to achieve the best reproducibility data. The lysis. Comparisons between pre-post treatment levels of levels of mRNA measured were normalized with respect RNA and protein expression were made for both autistic to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), individuals and healthy controls. which was chosen as the housekeeping gene. Indeed GAPDH is one of the most stably expressed genes in hu- RNA extraction and RT-PCR man peripheral blood [29]. To our knowledge, there is no The RNA was extracted from BMDMs using a RNA Tri- molecular evidence of variation in GAPDH mRNAlevels Reagent (Molecular Research Center Inc., Cincinnati, OH, in autism disorders [19]. The gene expression values were USA) according to the manufacturer’s protocol. The total expressed as arbitrary units ± SEM. Amplification of the RNA concentration and integrity were determined by genes of interest and GAPDH was performed simultan- Nanodrop® ND-1000 UV spectrophotometer (Nano-Drop® eously. PCR products were resolved into 2% agarose gel. A Technologies, Thermo Scientific, Wilmington, DE, USA). semi-quantitative analysis of mRNA levels was carried out by the Gel Doc EZ UV System (Bio-Rad, Hercules, CA, USA).

Protein extraction and Western blot analysis For protein extraction, BMDMs were suspended in pro- tein lysis buffer (HEPES 25 mM; EDTA 5 mM; SDS 1%; TritonX-1001%;PMSF1mM;MgCl2 5 mM; Protease In- hibitor Cocktail (Roche, Mannheim, Germany); Phosphat- ase Inhibitor Cocktail (Roche, Mannheim, Germany)). Protein concentration was determined using the method described by Bradford [30]. For CB2R detection, each sample was loaded, electrophoresed in a 15% SDS- polyacrylamide gel and electroblotted onto a nitrocellulose membrane. The membrane was blocked in 5% milk, 1X Tris-buffered saline and 0.05% Tween-20. Primary anti- Figure 1 Representative optical photomicrograph of blood bodies to detect CB2R (Calbiochem-Merck, Darmstadt, in vitro monocyte-derived macrophages (BMDMs) culture from Germany) were used according to the manufacturer’sin- autistic children. structions at 1:250 dilutions [19]. The rabbit anti-CB2R Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 4 of 11 http://www.jneuroinflammation.com/content/11/1/78

Table 1 Primer sequences, annealing temperatures, and product sizes for RT-PCRs Gene Sense primer (5′-3′) Antisense primer (5′-3′) Annealing temperature (°C) Product sizes (bp) CB2R TTGGCAGCGTGACTATGACC AGGAAGGCGATGAACAGGAG 55 274 FAAH GGCCACACCTTCCTACAGAA GTTTTGCGGTACACCTCGAT 58 218 NAPE-PLD GAAGCTGGCTTAAGAGTCAC CCGCATCTATTGGAGGGAGT 60 178 GAPDH TCACCAGGGCTGCTTTTAAC GGACTCCACGACGTACTCAG 55 242 PCR primers were designed by using the computer program OLIGO 4.05 software (National Biosciences Inc., Plymouth, MN, USA) and were purchased from PRIMM (Milan, Italy). antibody detects endogenous levels of the human 45 kDa in PBS blocking buffer and slides were incubated over- fragment of CB2R protein. The antibody does not cross- night at 4°C in primary antibodies to human Notch (1:100; react with the CB1 receptor protein and, according to the Santa Cruz Biotechnology, Santa Cruz, CA, USA) or to manufacturer, was validated with a recombinant protein human Ki67 proliferation marker (1:200; Santa Cruz Bio- consisting of the first 33 amino acids of human CB2R used technology, Santa Cruz, CA, USA). Fluorescent-labeled as a positive control. For mannose receptor detection, secondary antibodies (1:1,000; Alexa Fluor 488, Molecular each sample was loaded, electrophoresed in a precast gra- Probe; Invitrogen, Carlsbad, CA, USA) specific to the IgG dient 4 to 12% SDS-polyacrylamide gel using Bolt® system species used as a primary antibody were used to locate the (Life Technologies, Monza, Italy) and electroblotted onto specific antigens in each slide. Cells were counterstained a nitrocellulose membrane. The membrane was blocked with bisbenzimide (Hoechst 33258; Hoechst, Frankfurt, in 5% milk, 1X Tris-buffered saline and 0.05% Tween-20. Germany) and mounted with mounting medium (90% gly- Primary antibodies to detect mannose receptor (ab64693 cerol in PBS). Fluorescently-labeled slides were viewed Abcam, Cambridge, UK) were used according to the with a fluorescence microscope (Leica, Wetzlar, Germany) manufacturer’s instructions at 1:1,000 dilutions. Immuno- and with a fluorescence confocal microscope (LSM 710, reactive signals were detected with a horseradish Zeiss, Oberkochen, Germany). Immunofluorescence im- peroxidase-conjugated secondary antibody and reacted ages were analyzed with Leica FW4000 software (Leica, with an ECL system (Amersham Pharmacia, Uppsala, Wetzlar, Germany) and with Zen Zeiss software (Zeiss, Sweden). To assess equal loading, protein levels were nor- Oberkochen, Germany). Quantification of Ki67-ir profiles malized with respect to the signal obtained with Coomas- was performed by an observer blind to the treatment. Cell sie Blue staining, as previously reported [31]. We used positive profile quantification was performed on each Coomassie Blue staining as equal loading control as this digitizedimage,andthereporteddataaretheintensity method overcomes the possibility that housekeeping pro- means ± SE on counterstained cells per group. Only bis- teins could vary in this pathology or be saturated at the benzimide counterstained cells were considered as posi- levels of loading [19]. However, we confirmed the signals tive profiles so as to avoid overcounting cells. obtained by Coomassie Blue staining with respect to the signal obtained with anti-β-tubulin monoclonal antibodies Statistical analysis (A2066 Sigma Chemical, St Louis, MO, USA; 1:1,000 dilu- Biomolecular data are expressed as means ± SEM. tion). The semi-quantitative analysis of protein levels was ANOVA, followed by Student-Neuman-Keuls post hoc carried out by the ChemiDoc-It 5000, using VisionWorks test, was used to determine the statistical significance Life Science Image Acquisition and Analysis software among groups. P < 0.05 was considered statistically (UVP, Upland, CA, USA). significant.

Immunocytochemistry Results For immunocytochemical analysis, BMDMs were re- GcMAF was able to normalize endocannabinoid suspended at 1x106 cell/mL in RPMI 1640 complete system gene dysregulation in blood monocyte-derived medium (Lonza, Verviers, Belgium) containing 10% FBS macrophages (BMDMs) in autistic children (EuroClone-Celbio, Milan, Italy), 2 mM L-glutamine, As we already demonstrated [19], studying EC system 100 U/ml penicillin, and 100 mg/ml streptomycin (all gene expression mainly by RT-PCR is far more sensitive Lonza, Verviers, Belgium), were plated on slides with a for the detection of gene expression than immunocy- 12-well plate and incubated at 37°C with 5% CO2. Cells tochemistry [9,32]. We evaluated the GcMAF effects were then fixed with 4% paraformaldehyde fixative. After on NAPE-PLD (N-acyl phosphatidylethanolamine phos- washing in PBS, non-specific antibody binding was pholipase D), a protein-coding gene [GC07M102742]. inhibited by incubation for 30 minutes in blocking solu- The gene codes for the enzyme which hydrolyzes N- tion (1% BSA in PBS). Primary antibodies were diluted acyl-phosphatidylethanolamines (NAPEs) to produce N- Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 5 of 11 http://www.jneuroinflammation.com/content/11/1/78

acylethanolamines (NAEs) and phosphatidic acid and, 0.04, P < 0.05, before and after GcMAF treatment in aut- specifically, the generation of anandamide (N-arachido- istic BMDMs, respectively), whereas the NAPE-PLD/ noylethanolamine), the ligand of cannabinoid receptors. FAAH ratio was significantly reduced (mean ± SE of ar- When compared to healthy controls, the semiquantita- bitrary units: 3.00 ± 0.84 versus 1.83 ± 0.19, before and tive analysis of BMDM-extracted mRNA levels, mea- after GcMAF treatment in autistic BMDMs, respect- sured by RT-PCR amplification, showed an increase in ively). The mRNA levels of CB2R gene were not affected the NAPE-PLD gene in BMDMs of autistic patients by GcMAF treatment (mean ± SE of arbitrary units: 0.40 (mean ± SE of arbitrary units: 1.20 ± 0.34 versus 0.71 ± ± 0.01 versus 0.54 ± 0.01, P > 0.05, before and after 0.11, P < 0.05, in BMDMs from autistic children and GcMAF treatment in autistic BMDMs, respectively). No healthy subjects, respectively). changes were observed in GcMAF treated BMDMs of We also evaluated the gene for fatty acid amide hydro- healthy control children with respect to untreated lase, (FAAH) [GC01P046860]. FAAH is a membrane as- BMDMs, except for a slight decrease in NAPE-PLD gene sociated enzyme which hydrolyzes bioactive amides, expression (not affecting NAPE-PLD/FAAH ratio) including the EC, anandamide. We observed that the (Figure 2). mRNA levels of the FAAH enzyme gene were decreased (mean ± SE of arbitrary units: 0.40 ± 0.08 versus 1.60 ± GcMAF affected CB2R protein levels in BMDMs 0.06, P < 0.05, in BMDMs from autistic children and GcMAF was also able to reduce the protein levels for healthy subjects, respectively); the NAPE-PLD/FAAH ra- CB2R in BMDMs from autistic children with respect to tio was significantly increased (mean ± SE of arbitrary treated BMDMs from healthy controls. Since CB2Rs are G units: 3.00 ± 0.84 versus 0.44 ± 0.07 in BMDMs from aut- protein-coupled receptors, they show post-translational istic children compared to healthy subjects, respectively); regulation [33]. We therefore determined the protein mRNA levels of CB2R gene (mean ± SE of arbitrary levels of CB2R by Western blot analysis. units: 0.40 ± 0.01 versus 0.43 ± 0.02, P > 0.05, in BMDMs Western blot analysis showed a strong decrease in from autistic children and healthy subjects, respectively) CB2R protein levels in GcMAF treated BMDMs from were not changed (Figure 2). autistic children as compared to untreated macrophages In BMDMs of autistic children, GcMAF treatment was (mean ± SE of arbitrary units: 3.24 ± 0.54 versus 1.66 ± able to significantly increase gene expressions both 0.39, P < 0.05, before and after GcMAF treatment in aut- NAPE-PLD (mean ± SE of arbitrary units: 1.20 ± 0.34 istic BMDMs, respectively). Interestingly, GcMAF was and 1.74 ± 0.18, P < 0.05, before and after GcMAF treat- also able to decrease CB2R protein levels in GcMAF ment in autistic BMDMs, respectively) and FAAH treated BMDMs from healthy controls as compared to (mean ± SE of arbitrary units: 0.40 ± 0.08 versus 0.95 ± untreated BMDMs (Figure 3) (mean ± SE of arbitrary

Figure 2 Expression of the enzymes NAPE-PLD and FAAH, and CB2R genes in blood monocyte-derived macrophages (BMDMs). The ratio NAPE/FAAH was also reported. The measured mRNA levels were normalized with respect to GAPDH (housekeeping gene) and gene expression values were expressed as a percentage of arbitrary units ± SEM. * indicates significant difference versushealthy controls; ° indicates significant difference versus GcMAF untreated autistic BMDMs. P-values <0.05 were considered statistically significant. CTL, healthy control subjects;AU, autistic patients. Values were reported in percentage versus healthy control values. Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 6 of 11 http://www.jneuroinflammation.com/content/11/1/78

Figure 3 Representative Western blot analysis of CB2R protein levels in the blood monocyte-derived macrophages (BMDMs) obtained from the autistic children and the healthy controls. (1) untreated BMDMs from healthy control subjects; (2) GcMAF-treated BMDMs from healthy control subjects; (3) untreated BMDMs from autistic disorder subjects; (4) Gc-MAF-treated BMDMs from autistic disorder subjects. The histograms indicate percentage variations in CB2R protein levels in the BMDMs. * indicates significant difference versus healthy controls; ° indicates significant difference versusGcMAF untreated autistic BMDMs.

units: 5.97 ± 0.34 versus 2.39 ± 0.43, P < 0.05, before and macrophage cells, as analyzed by fluorescence micros- after GcMAF treatment in healthy control BMDMs, copy (Figure 4). respectively). As macrophages possess proliferation capacity [38], we The difference between the unchanged CB2R mRNA investigated the effect of GcMAF on this cellular activity levels and the decrease in CB2R protein levels in autistic through Ki67 proliferation marker immunostaining. GcMAF treated cells is not surprising, as we have Interestingly, GcMAF treatment showed reduction in already shown [19]. Indeed, protein levels and functions the immunostaining profiles of the proliferation marker are affected by post-translational control. The levels of Ki67 in GcMAF treated monocyte-derived macrophages CB2R in the cell are strictly regulated in a multilevel sys- from autistic children, as compared to untreated macro- tem of regulation [34], and there is not a direct correl- phage cells (Figure 4). We quantified this reduction ation between mRNA transcripts and protein levels [19]. through confocal fluorescence microscopy, showing a decrease of 23% in GcMAF treated monocyte-derived GcMAF was able to trigger overall macrophage macrophages from autistic children as compared to un- deactivation in autistic samples treated macrophage cells (mean ± SE of arbitrary units: In order to check cellular activation, fluorescence-based 0.32 ± 0.04 versus 0.24 ± 0.06, P < 0.05, before and after immunocytochemical analysis on macrophage cell cul- GcMAF treatment in autistic BMDMs, respectively) ture was performed. In detail, Notch staining was early (Figure 5). GcMAF was also able to reduce Ki67 immu- carried out. Notch is a protein mainly involved in stem nostaining in BMDMs from healthy controls, as com- cell maintenance, cell differentiation and cellular pared to untreated macrophage cells (mean ± SE of homeostasis regulation [35]; however, Notch signaling arbitrary units: 0.17 ± 0.01 versus 0.012 ± 0.003, P < 0.05, pathway was reported in activated pro-inflammatory before and after GcMAF treatment in healthy control macrophages and it is involved in regulating the expres- BMDMs, respectively) (picture not shown). It is note- sion of il12p40 [36]. Recently, it has been proposed a worthy to consider that BMDMs from autistic children putative role of Notch signaling in autism [37]. We did were more activated than BMDMs from healthy controls not find any changes in Notch immunostaining profiles (mean ± SE of arbitrary units: 0.32 ± 0.04 versus 0.17 ± in GcMAF treated blood monocyte-derived macro- 0.01, P < 0.05, in BMDMs from autistic children and phages from autistic children as compared to untreated healthy subjects, respectively). Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 7 of 11 http://www.jneuroinflammation.com/content/11/1/78

Figure 4 Representative fluorescent photomicrograph of blood monocyte-derived macrophages (BMDMs) from autistic patients showing immunocytochemistry (green fluorescent) for Notch (top) and Ki67 markers (bottom). To correctly identify cells, their nuclei were counterstained with bisbenzimide (blue fluorescence). (A) untreated BMDMs; (B) GcMAF treated BMDMs.

GcMAF was able to reduce the protein levels of the for alternative activated phenotype M2 macrophages alternative activated phenotype M2 macrophage marker [39,40]. Western blot analysis showed a decrease in man- To further investigate the GcMAF effect in specific cel- nose receptor protein levels in GcMAF treated BMDMs lular activation in macrophages, we quantified the pro- from autistic children as compared to untreated macro- tein levels of mannose receptor by Western blot phages (mean ± SE of arbitrary units: 28.1 ± 0.41 versus analysis. The macrophage mannose receptor (alternative 16.7 ± 0.94, P < 0.05, before and after Gc-MAF treatment name CD206) mediates the endocytosis of glycoproteins in autistic BMDMs, respectively) (Figure 6). GcMAF was by macrophages and it is considered a specific marker also able to decrease mannose receptor protein levels in

Figure 5 Representative quantitative fluorescent confocal-photomicrograph of blood monocyte-derived macrophages (BMDMs) from autistic patients showing immunocytochemistry (green fluorescent) for Ki67 marker. To correctly identify cells, their nuclei were counterstained with bisbenzimide (blue fluorescence). (A) untreated BMDMs; (B) Gc-MAF treated BMDMs. Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 8 of 11 http://www.jneuroinflammation.com/content/11/1/78

Figure 6 Representative Western blot analysis of mannose receptor protein levels in the blood monocyte-derived macrophages (BMDMs) obtained from the autistic children and the healthy controls. (1) untreated BMDMs from healthy control subjects; (2) GcMAF-treated BMDMs from healthy control subjects; (3) untreated BMDMs from autistic disorder subjects; (4) GcMAF-treated BMDMs from autistic disorder subjects. The histograms indicate percentage variations in mannose receptor protein levels in the BMDMs. * indicates significant difference versus healthy controls; ° indicates significant difference versus GcMAF untreated autistic BMDMs.

GcMAF treated BMDMs from healthy controls as com- exerts anti-angiogenesis effects, creating an interesting pared to untreated BMDMs (mean ± SE of arbitrary units: potential nexus between vitamin D, GcMAF, and the 26.8 ± 0.21 versus 18.9 ± 0.47, P < 0.05, before and after EC system in the etiology and pathology of numerous GcMAF treatment in healthy control BMDMs, respect- immune-mediated disorders, including autism [46,47]. ively) (Figure 6). In relation to autism, the vitamin D deficiency hypoth- esis has been extensively investigated, with prenatal and/ Discussion or early postnatal vitamin D deficiency demonstrating In this study, we demonstrated for the first time a can- increased risks for development [48,49]. Autism is now nabinoid system mediated biomolecular mechanism and considered a multifactorial disease associated with com- cellular effect of GcMAF in cultured BMDMs from aut- plex genetic and environmental interactions contributing istic subjects. to various risk factors [2]. Moreover, dietary vitamin D Anti-cancer effects of GcMAF have been described seems to be involved in complex epigenetic events. Vita- since Yamamoto, et al., [41] first demonstrated the vita- min D, via its ligand-activated nuclear hormone receptor, min D binding protein macrophage activating effects is involved in the regulation of pro-inflammatory genes, and the linkage to specific glycosylation of the Gc pre- as well as key cellular events [2]. Nagalase activity is in- cursor protein [41]. It has been proposed that GcMAF creased in the serum of autistic children [16]. As we pre- possesses tumor killing activity through the activation of viously mentioned, Nagalase is the enzyme responsible macrophages [42]. GcMAF-activated macrophages are for deglycosylation of the vitamin D-binding protein indeed able to recognize the tumor cell surface abnor- (VDBP), also known as Gc-globulin (group-specific com- malities through a considerable variation of their recep- ponent). Gc-globulin is the precursor of GcMAF, so tors: in this way, they exert one potent tumoricidal effect Nagalase interferes with macrophage regulation by redu- [43]. cing GcMAF production [50]. A predictable conse- Kanda et al., [44] first described another anti-tumor quence of increased Nagalase activity in the serum of effect of GcMAF related to its inhibition of angiogenesis, children with autism is, therefore, immunosuppression presumably mediated through the CD36 receptor, while in a way similar to its observed effects in autoimmune Solinas et al., [45] observed the non-psychoactive CB2R- patients, for example, SLE [18]. binding cannabinoid, CBD also inhibited neoangiogen- It has been demonstrated that in PBMCs, GcMAF is esis. Similarly, calcitriol (1,25-dihydroxyvitamin D3), also able to increase the production of the second messenger Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 9 of 11 http://www.jneuroinflammation.com/content/11/1/78

cyclic AMP [28]. These data, when combined with our Macrophages are not static and can readily shift from im- current observations demonstrating GcMAF normalizes mature forms and between M1 and M2 states depending EC gene expression, enhance the hypothesis of a poten- on the local tissue signalling [57]. tial action of GcMAF on the EC system. Indeed, the EC Recently, a different cohort of Italian children was system is based on receptors coupled to G (i/o) proteins, assessed for anti-brain antibodies [58]. In that research, which are associated with inhibition of cyclic AMP for- the presence of specific anti-brain antibody profiles was mation [51]. In BMDMs from autistic children, we eval- associated with the severity of cognitive impairment in uated whether the involvement of EC signalling could autism. drive a decrease of cyclic AMP. We found an increase in The potential for either commensal or pathogenic mi- AEA-biosynthetic enzyme NAPE-PLD, together with a crobes to trigger immune dysregulation and autoimmunity decrease in the AEA catabolic enzyme FAAH expres- with resultant neuropsychiatric symptoms was recently sions, indicating an overall increase in the EC AEA reviewed by Hornig [59]. The CB2R profile observed in levels. AEA is a natural agonist of CB2R and down- this study is consistent with these mechanisms and could regulates cyclic AMP production. Agonist-induced in- be tied to either infection or alteration of the gut micro- hibition of adenylyl cyclase in cells expressing human biome as illustrated in a mouse model of autism [60]. In CB2Rs has been demonstrated [52]. Our findings sup- that murine study, alteration in short chain fatty acids as a port the influence of GcMAF on the EC system which consequence of valproate exposure, modelled autistic may result in normalized cycling AMP activity. characteristic in the mice. Our current findings further support the involvement EC are derived from dietary fatty acids. Several studies of the EC system in autism associated immunological illustrate the effect of diet on blood, tissue and brain EC disruptions. We previously found that CB2Rs were levels [61,62]. So, the measured differences in this study strongly up-regulated in PBMCs from autistic children in the CB2R may be the consequence of dietary and/or [19]. The observations in this present study agree with microbiome changes in the autism population when our hypothesis that the EC system in autism orchestrates compared to the controls. the apparent nexus of the peripheral and central neuro-immunologically mediated effects in autism. Conclusions Interestingly, while in our previous work, the CB2R was This study demonstrates a biomolecular effect of GcMAF over-activated in PBMCs from autistic children, in the in BMDMs from autistic patients, providing further evi- present study, we found a decrease in CB2R protein dence for a positive use of this molecule in autism treat- levels in BMDMs from autistic patients. Taking in ac- ment. It also seems likely that the CB2R is a potential count the difference between the two-cell systems, as therapeutic target for ASD interventions. These initial BMDM cells are derived, through differentiation, from findings will require further study in order to better eluci- PBMCs, this result could indicate a dual role of the date the molecular pathways involved in GcMAF effects. CB2R: activation in monocytes to trigger immune imbal- ance, and deactivation in differentiated macrophages to Abbreviations ASDs: autism spectrum disorder; AEA: N-arachidonoylethanolamide; 2-AG: further persist in the immune dysregulation [19]. 2-arachidonoylglycerol; BMDMs: blood monocyte-derived macrophages; The fact that GcMAF was able to reduce Ki67 prolifer- CBD: cannabidiol; CB2R: cannabinoid receptor type 2; DSM-IV-TR: Diagnostic ation marker staining together with a decrease in CD206 and Statistical Manual of Mental Disorders-IV criteria for autism; EC: endocannabinoid; FAAH: fatty acid amide hydrolase; FBS: fetal bovine positive profiles in BMDMs is not surprising. Indeed, it serum; NK: natural killer; GAPDH: glyceraldehyde-3-phosphate has been demonstrated that macrophages are altered in dehydrogenase; GcMAF: Gc Macrophage Activating Factor; IL: interleukin; autism and this pathology is accompanied by an activa- NAPE-PLD: N-acyl phosphatidylethanolamine phospholipase D; PET: positron emission tomography; PBMCs: peripheral blood mononuclear cells; tion of the macrophages, together with immune alter- PBS: Phosphate buffer saline; PDD-NOS: Pervasive Developmental Disorder - ations and pro-inflammatory cytokines (that is IL-1β) Not Otherwise Specified; RT-PCR: Reverse Transcriptase-Polymerase Chain over-production [53,54]. Specifically, Al-Ayadhi and Reaction; RPMI: Roswell Park Memorial Institute; SLE: systemic lupus Mostafa [55] found macrophage-derived chemokine erythematosus; VDBP: vitamin D3 binding protein. (MDC) and thymus and activation-regulated chemokine Competing interests (TARC), both were significantly elevated in ASD serum The authors declare that they have no competing interests. and further demonstrated the level of elevation of both markers directly correlated with the severity of autism Authors’ contributions DS designed the study, carried out the biochemical and [55]. Molloy et al., (2006) also demonstrated a predomin- immunocytochemical experiments, performed the statistical analysis and ately Th2 cytokine shift in the serum of children with aut- wrote the manuscript. JJB participated in the design of the study, wrote the ism [56]. In this study, our findings of pre/post Ki67 and manuscript and edited English language. AC carried out the biomolecular experiments. NA conceived of the study, participated in its design and CD206 are in agreement with the Th2/M2 macrophage provided funding support. All authors read and approved the final observations and of a tendency toward autoimmunity. manuscript. Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 10 of 11 http://www.jneuroinflammation.com/content/11/1/78

Acknowledgments 17. Yamamoto N, Naraparaju VR: Immunotherapy of BALB/c mice bearing First and foremost, we thank the many autism families who volunteered as Ehrlich ascites tumor with vitamin D-binding protein-derived participants in this research study. The authors gratefully thank Ms. Giovanna macrophage activating factor. Cancer Res 1997, 57(11):2187–2192. Gallone, Mr. Enzo Abate and the non-profit organizations ‘Cancellautismo’ 18. Yamamoto N, Naraparaju VR, Moore M, Brent LH: Deglycosylation of serum and ‘La Forza del Silenzio’ - Italy for their useful assistance. We thank David vitamin D3-binding protein by alpha-N-acetylgalactosaminidase Noakes and Immuno Biotech - St. Peter Port, Guernsey, for providing GcMAF. detected in the plasma of patients with systemic lupus erythematosus. Clin Immunol Immunopathol 1997, 82(3):290–298. Author details 19. Siniscalco D, Sapone A, Giordano C, Cirillo A, de Magistris L, Rossi F, Fasano 1Department of Experimental Medicine, Second University of Naples, via S. A, Bradstreet JJ, Maione S, Antonucci N: Cannabinoid receptor type 2, but Maria di Costantinopoli, 16 - 80138 Naples, Italy. 2Centre for Autism - La Forza not type 1, is up-regulated in peripheral blood mononuclear cells of del Silenzio, Caserta 81036, Italy. 3Cancellautismo- no profit association for children affected by autistic disorders. J Autism Dev Disord 2013, autism care, Florence 50132, Italy. 4Brain Treatment Center of Atlanta, Atlanta, 43(11):2686–2695. GA 30518, USA. 5Western University of Health Science, 309 E. Second St., 20. Ahmad R, Koole M, Evens N, Serdons K, Verbruggen A, Bormans G, Van Pomona, CA 91766, USA. 6Institute of Bioscience and Bioresources, National Laere K: Whole-body biodistribution and radiation dosimetry of the Research Council of Italy, Naples 80128, Italy. 7Biomedical Center for Autism cannabinoid type 2 receptor ligand [11C]-NE40 in healthy subjects. Research and Treatment, Bari 70126, Italy. Mol Imaging Biol 2013, 15(4):384–390. 21. Zarruk JG, Fernández-López D, García-Yébenes I, García-Gutiérrez MS, Received: 12 March 2014 Accepted: 2 April 2014 Vivancos J, Nombela F, Torres M, Burguete MC, Manzanares J, Lizasoain I, Published: 17 April 2014 Moro MA: Cannabinoid type 2 receptor activation downregulates stroke-induced classic and alternative brain macrophage/microglial activation concomitant to neuroprotection. Stroke 2012, 43(1):211–219. References 22. Pacher P, Bátkai S, Kunos G: The EC system as an emerging target of 1. American Psychiatric Association: Diagnostic and Statistical Manual of Mental pharmacotherapy. Pharmacol Rev 2006, 58(3):389–462. Disorders, Text Revision. 4th edition. Washington, DC, USA: American 23. Lord C, Rutter M, Le Couteur A: Autism Diagnostic Interview-Revised: a Psychiatric Association; 2000. revised version of a diagnostic interview for caregivers of individuals 2. Siniscalco D, Cirillo A, Bradstreet JJ, Antonucci N: Epigenetic findings in with possible pervasive developmental disorders. J Autism Dev Disord autism: new perspectives for therapy. Int J Environ Res Public Health 2013, 1994, 24(5):659–685. 10(9):4261–4273. 24. Schopler E, Reichler RJ, Renner BR: The Childhood Autism Rating Scale (CARS). 3. Siniscalco D: Current findings and research prospective in autism Los Angeles, CA: Western Psychological Services; 1993. spectrum disorders. Autism 2013, S2:e001. 4. Siniscalco D, Cubala-Kucharska M: Treatment of the child with 25. Lord C, Risi S, Lambrecht L, Cook EH Jr, Leventhal BL, DiLavore PC, Pickles A, autism-newest medical trends. Autism 2013, 3:110. Rutter M: The autism diagnostic observation schedule-generic: a standard 5. Siniscalco D, Sapone A, Cirillo A, Giordano C, Maione S, Antonucci N: measure of social and communication deficits associated with the – Autism spectrum disorders: is mesenchymal stem cell personalized spectrum of autism. J Autism Dev Disord 2000, 30(3):205 223. therapy the future? J Biomed Biotechnol 2012, 2012:480289. 26. Rossi F, Siniscalco D, Luongo L, De Petrocellis L, Bellini G, Petrosino S, Torella 6. Lyall K, Ashwood P, Van de Water J, Hertz-Picciotto I: Maternal M, Santoro C, Nobili B, Perrotta S, Di Marzo V, Maione S: The endovanilloid/ immune-mediated conditions, autism spectrum disorders, and endocannabinoid system in human osteoclasts: possible involvement in – developmental delay. J Autism Dev Disord 2013, Epub ahead of print. bone formation and resorption. Bone 2009, 44(3):476 484. 7. Siniscalco D, Bradstreet JJ, Antonucci N: Therapeutic role of hematopoietic 27. Crespo H, Reina R, Glaria I, Ramírez H, de Andrés X, Jáuregui P, Luján L, stem cells in autism spectrum disorder-related inflammation. Front Martínez-Pomares L, Amorena B, de Andrés DF: Identification of the ovine Immunol 2013, 4:140. mannose receptor and its possible role in Visna/Maedi virus infection. 8. Onore C, Careaga M, Ashwood P: The role of immune dysfunction in the Vet Res 2011, 42:28. pathophysiology of autism. Brain BehavImmun 2012, 26(3):383–392. 28. Pacini S, Morucci G, Punzi T, Gulisano M, Ruggiero M: Gc protein-derived 9. Siniscalco D, Sapone A, Giordano C, Cirillo A, de Novellis V, de Magistris L, macrophage-activating factor (GcMAF) stimulates cAMP formation in Rossi F, Fasano A, Maione S, Antonucci N: The expression of caspases is human mononuclear cells and inhibits angiogenesis in chick embryo enhanced in peripheral blood mononuclear cells of autism spectrum chorionallantoic membrane assay. Cancer Immunol Immunother 2011, – disorder patients. J Autism Dev Disord 2012, 42(7):1403–1410. 60(4):479 485. 10. Gesundheit B, Rosenzweig JP, Naor D, Lerer B, Zachor DA, Procházka V, 29. Stamova BS, Apperson M, Walker WL, Tian Y, Xu H, Adamczy P, Zhan X, Liu Melamed M, Kristt DA, Steinberg A, Shulman C, Hwang P, Koren G, Walfisch DZ, Ander BP, Liao IH, Gregg JP, Turner RJ, Jickling G, Lit L, Sharp FR: A, Passweg JR, Snowden JA, Tamouza R, Leboyer M, Farge-Bancel D, Identification and validation of suitable endogenous reference genes for Ashwood P: Immunological and autoimmune considerations of Autism gene expression studies in human peripheral blood. BMC Med Genomics Spectrum Disorders. J Autoimmun 2013, 44:1–7. 2009, 2:49. 11. Bauman MD, Iosif AM, Ashwood P, Braunschweig D, Lee A, Schumann CM, 30. Bradford MM: A rapid and sensitive method for the quantization of Van de Water J, Amaral DG: Maternal antibodies from mothers of children microgram quantities of protein utilizing the principle of protein-dye with autism alter brain growth and social behavior development in the binding. Anal Biochem 1976, 72:248–254. rhesus monkey. Transl Psychiatry 2013, 3:e278. 31. Li R, Shen Y: An old method facing a new challenge: re-visiting 12. DeLuca GC, Kimball SM, Kolasinski J, Ramagopalan SV, Ebers GC: Review: housekeeping proteins as internal reference control for neuroscience the role of vitamin D in nervous system health and disease. Neuropathol research. Life Sci 2013, 92(13):747–751. Appl Neurobiol 2013, 39(5):458–484. 32. Giordano C, Siniscalco D, Melisi D, Luongo L, Curcio A, Soukupova M, 13. Ota K, Dambaeva S, Han AR, Beaman K, Gilman-Sachs A, Kwak-Kim J: Palazzo E, Marabese I, De Chiaro M, Rimoli MG, Rossi F, Maione S, de Vitamin D deficiency may be a risk factor for recurrent pregnancy losses Novellis V: The galactosylation of N (ω)-nitro-L-arginine enhances its by increasing cellular immunity and autoimmunity. Hum Reprod 2014, anti-nocifensive or anti-allodynic effects by targeting glia in healthy and 29(2):208–219. neuropathic mice. Eur J Pharmacol 2011, 656(1–3):52–62. 14. Fletcher JM, Basdeo SA, Allen AC, Dunne PJ: Therapeutic use of vitamin D 33. Ardura JA, Friedman PA: Regulation of G protein-coupled receptor and its analogues in autoimmunity. Recent Pat Inflamm Allergy Drug Discov function by Na+/H + exchange regulatory factors. Pharmacol Rev 2011, 2012, 6(1):22–34. 63(4):882–900. 15. Cannell JJ, Grant WB: What is the role of vitamin D in autism? 34. Peralta L, Agirregoitia E, Mendoza R, Expósito A, Casis L, Matorras R, Dermatoendocrinol 2013, 5(1):199–204. Agirregoitia N: Expression and localization of cannabinoid receptors in 16. Bradstreet JJ, Vogelaar E, Thyer L: Initial observations of elevated human immature oocytes and unfertilized metaphase-II oocytes. Reprod alpha-N-acetylgalactosaminidase activity associated with autism and Biomed Online 2011, 23(3):372–379. observed reductions from Gcprotein-Macrophage Activating Factor 35. Van Camp JK, Beckers S, Zegers D, Van Hul W: Wnt signaling and the injections. Autism Insights 2012, 4:31–38. control of human stem cell fate. Stem Cell Rev 2014, 10(2):207–229. Siniscalco et al. Journal of Neuroinflammation 2014, 11:78 Page 11 of 11 http://www.jneuroinflammation.com/content/11/1/78

36. Boonyatecha N, Sangphech N, Wongchana W, Kueanjinda P, Palaga T: 58. Piras IS, Haapanen L, Napolioni V, Sacco R, Van de Water J, Persico AM: Involvement of Notch signaling pathway in regulating IL-12 expression Anti-brain antibodies are associated with more severe cognitive and via c-Rel in activated macrophages. Mol Immunol 2012, 51(3–4):255–262. behavioral profiles in Italian children with Autism Spectrum Disorder. 37. Zhang Y, Yuan X, Wang Z, Li R: The canonical Wntsignaling pathway in Brain Behav Immun 2014, 38:91–99. autism. CNS NeurolDisord Drug Targets 2013, [Epub ahead of print]. 59. Hornig M: The role of microbes and autoimmunity in the pathogenesis 38. Haase J, Weyer U, Immig K, Klöting N, Blüher M, Eilers J, Bechmann I, of neuropsychiatric illness. Curr Opin Rheumatol 2013, 25(4):488–795. Gericke M: Local proliferation of macrophages in adipose tissue during 60. De Theije CG, Wopereis H, Ramadan M, van Eijndthoven T, Lambert J, Knol obesity-induced inflammation. Diabetologia 2014, 57(3):562–71. J, Garssen J, Kraneveld AD, Oozeer R: Altered gut microbiota and activity 39. Kittan NA, Allen RM, Dhaliwal A, Cavassani KA, Schaller M, Gallagher KA, in a murine model of autism spectrum disorders. Brain Behav Immun Carson WF 4th, Mukherjee S, Grembecka J, Cierpicki T, Jarai G, Westwick J, 2014, 37:197–206. Kunkel SL, Hogaboam CM: Cytokine induced phenotypic and epigenetic 61. Wood JT, Williams JS, Pandarinathan L, Janero DR, Lammi-Keefe CJ, signatures are key to establishing specific macrophage phenotypes. PLoS Makriyannis A: Dietary docosahexaenoic acid supplementation alters One 2013, 8(10):e78045. select physiological endocannabinoid-system metabolites in brain and 40. Siniscalco D, Giordano C, Galderisi U, Luongo L, de Novellis V, Rossi F, plasma. J Lipid Res 2010, 51(6):1416–1423. Maione S: Long-lasting effects of human mesenchymal stem cell 62. Artmann A, Petersen G, Hellgren LI, Boberg J, Skonberg C, Nellemann C, systemic administration on pain-like behaviors, cellular, and Hansen SH, Hansen HS: Influence of dietary fatty acids on biomolecular modifications in neuropathic mice. Front Integr Neurosci endocannabinoid and N-acylethanolamine levels in rat brain, liver and 2011, 5:79. small intestine. Biochim Biophys Acta 2008, 1781(4):200–212. 41. Yamamoto N, Willett NP, Lindsay DD: Participation of serum proteins in the inflammation-primed activation of macrophages. Inflammation 1994, doi:10.1186/1742-2094-11-78 18(3):311–322. Cite this article as: Siniscalco et al.: The in vitro GcMAF effects on 42. Nonaka K, Onizuka S, Ishibashi H, Uto Y, Hori H, Nakayama T, Matsuura N, endocannabinoid system transcriptionomics, receptor formation, and Kanematsu T, Fujioka H: Vitamin D binding protein-macrophage activating cell activity of autism-derived macrophages. Journal of Neuroinflamma- factor inhibits HCC in SCID mice. J Surg Res 2012, 172(1):116–122. tion 2014 11:78. 43. Yamamoto N, Suyama H, Yamamoto N: Immunotherapy for prostate cancer with Gcprotein-derived Macrophage-Activating Factor. GcMAF TranslOncol 2008, 1(2):65–72. 44. Kanda S, Mochizuki Y, Miyata Y, Kanetake H, Yamamoto N: Effects of vitamin D (3)-binding protein-derived macrophage activating factor (GcMAF) on angiogenesis. J Natl Cancer Inst 2002, 94(17):1311–1319. 45. Solinas M, Massi P, Cantelmo AR, Cattaneo MG, Cammarota R, Bartolini D, Cinquina V, Valenti M, Vicentini LM, Noonan DM, Albini A, Parolaro D: Cannabidiol inhibits angiogenesis by multiple mechanisms. Br J Pharmacol 2012, 167(6):1218–1231. 46. Xu J, Li W, Ma J, Liu J, Sha H, Zhou S, Wang F, Ma Q: Vitamin D - pivotal nutraceutical in the regulation of cancer metastasis and angiogenesis. Curr Med Chem 2013, 20(33):4109–4120. 47. Pacini S, Morucci G, Punzi T, Gulisano M, Ruggiero M, Amato M, Aterini S: Effect of paricalcitol and GcMAF on angiogenesis and human peripheral blood mononuclear cell proliferation and signaling. J Nephrol 2012, 25(4):577–581. 48. Bakare MO, Munir KM, Kinney DK: Association of hypomelanotic skin disorders with autism: links to possible etiologic role of vitamin-D levels in autism? Hypothesis (Tor) 2011, 9(1):e2. 49. Mostafa GA, Al-Ayadhi LY: Reduced serum concentrations of 25-hydroxy vitamin D in children with autism: relation to autoimmunity. J Neuroinflammation 2012, 9:201. 50. Yamamoto N, Naraparaju VR, Asbell SO: Deglycosylation of serum vitamin D3-binding protein leads to immunosuppression in cancer patients. Cancer Res 1996, 56(12):2827–2831. 51. Börner C, Smida M, Höllt V, Schraven B, Kraus J: Cannabinoid receptor type 1- and 2-mediated increase in cyclic AMP inhibits T cell receptor-triggered signaling. J BiolChem 2009, 284(51):35450–35460. 52. Zheng C, Chen L, Chen X, He X, Yang J, Shi Y, Zhou N: The second intracellular loop of the human cannabinoid CB2 receptor governs G protein coupling in coordination with the carboxyl terminal domain. PLoS One 2013, 8(5):e63262. doi:10.1371/journal.pone.0063262. 53. Al-Ayadhi LY: Pro-inflammatory cytokines in autistic children in central Submit your next manuscript to BioMed Central Saudi Arabia. Neurosciences (Riyadh) 2005, 10(2):15515–15518. and take full advantage of: 54. Siniscalco D, Antonucci N: Possible use of Trichurissuis ova in autism spectrum disorders therapy. Med Hypotheses 2013, 81(1):1–4. • Convenient online submission 55. Al-Ayadhi LY, Mostafa GA: Elevated serum levels of macrophage-derived chemokine and thymus and activation-regulated chemokine in autistic • Thorough peer review children. J Neuroinflammation 2013, 10:72. • No space constraints or color figure charges 56. Molloy CA, Morrow AL, Meinzen-Derr J, Schleifer K, Dienger K, Manning-Courtney P, Altaye M, Wills-Karp M: Elevated cytokine levels in • Immediate publication on acceptance children with autism spectrum disorder. J Neuroimmunol 2006, • Inclusion in PubMed, CAS, Scopus and Google Scholar – – 172(1 2):198 205. • Research which is freely available for redistribution 57. Hume DA: Macrophages as APC and the dendritic cell myth. J Immunol 2008, 181:5829–5835. Submit your manuscript at www.biomedcentral.com/submit Neuron Previews

Jin, P., Zarnescu, D.C., Zhang, F., Pearson, C.E., Mori, K., Weng, S.M., Arzberger, T., May, S., Reddy, K., Zamiri, B., Stanley, S.Y., Macgregor, Lucchesi, J.C., Moses, K., and Warren, S.T. Rentzsch, K., Kremmer, E., Schmid, B., Kretzsch- R.B., Jr., and Pearson, C.E. (2013). J. Biol. Chem. (2003). Neuron 39, 739–747. mar, H.A., Cruts, M., Van Broeckhoven, C., et al. 288, 9860–9866. (2013). Science 339, 1335–1338. Khateb, S., Weisman-Shomer, P., Hershco-Shani, Napierala, M., Michalowski, D., de Mezer, M., and Todd, P.K., Oh, S.Y., Krans, A., He, F., Sellier, C., I., Ludwig, A.L., and Fry, M. (2007). Nucleic Acids Krzyzosiak, W.J. (2005). Nucleic Acids Res. 33, Res. 35, 5775–5788. Frazer, M., Renoux, A.J., Chen, K.C., Scaglione, 451–463. K.M., Basrur, V., et al. (2013). Neuron 78, this issue, 440–455. Lo´ pez Castel, A., Cleary, J.D., and Pearson, C.E. Oostra, B.A., and Willemsen, R. (2009). Biochim. (2010). Nat. Rev. Mol. Cell Biol. 11, 165–170. Biophys. Acta 1790, 467–477. Pearson, C.E. (2011). PLoS Genet. 7, e1002018. Zu, T., Gibbens, B., Doty, N.S., Gomes-Pereira, M., Lu, C., Lin, L., Tan, H., Wu, H., Sherman, S.L., Gao, Huguet, A., Stone, M.D., Margolis, J., Peterson, M., F., Jin, P., and Chen, D. (2012). Hum. Mol. Genet. Pearson, C.E., Nichol Edamura, K., and Cleary, Markowski, T.W., Ingram, M.A., et al. (2011). Proc. 21, 5039–5047. J.D. (2005). Nat. Rev. Genet. 6, 729–742. Natl. Acad. Sci. USA 108, 260–265.

Evidence for a Common Endocannabinoid-Related Pathomechanism in Autism Spectrum Disorders

Dilja D. Krueger1,* and Nils Brose1,* 1Department of Molecular Neurobiology, Max Planck Institute of Experimental Medicine, 37075 Go¨ ttingen, Germany *Correspondence: [email protected] (D.D.K.), [email protected] (N.B.) http://dx.doi.org/10.1016/j.neuron.2013.04.030

In this issue of Neuron, Fo¨ ldy et al. (2013) report that endocannabinoid-mediated signaling at inhibitory synapses is dysregulated in mouse models of autism-associated Neuroligin-3 mutations. These findings carry implications regarding the pathophysiology of autism spectrum disorders and the development of treatment strategies.

The correct wiring of the brain during related synaptic proteins in vivo, e.g., in promising treatment targets than the development is an extremely complex neuronal circuits that control autism- ASD-linked proteins discovered so far. biological process, during which a stag- relevant behavior. Second, many known One of the synaptic proteins associated gering number of synapses with often ASD-related proteins are structural pro- with ASDs is Neuroligin-3 (NLGN3), a very diverse characteristics have to be teins with adhesion or scaffold functions member of the Neuroligin family of post- formed and maintained in a precise and therefore poor targets for pharmaco- synaptic cell adhesion molecules that and delicate balance. Not surprisingly, logical intervention with small molecule interact with presynaptic Neurexins to therefore, numerous neurodevelopmental drugs. Third, many ASD-related muta- control synapse development and func- and psychiatric diseases appear to be tions lead to a loss of the corresponding tion. Two distinct mutations in NLGN3 disorders of aberrant synaptogenesis protein so that no target for pharmaco- have been linked to ASDs, a point muta- and synapse function, or ‘‘synaptopa- logical intervention remains. Finally, each tion resulting in an R451C substitution in thies.’’ Particularly in the context of autism individual ASD-related mutation is rare, the Neurexin-binding domain (Jamain spectrum disorders (ASDs), an ever- with the vast majority accounting for less et al., 2003) and a deletion of the NLGN3 growing number of mutations in genes than 1% of affected individuals each. In gene (Sanders et al., 2011). Studies encoding synaptic proteins have been view of these difficulties, the focus in the on the respective mouse models, a identified in affected individuals (Murdoch field of ASD biology has shifted toward Nlgn3R451C knockin (KI) and a Nlgn3 and State, 2013), and major research ef- the identification of cellular protein-pro- knockout (KO), showed that both muta- forts are currently focusing on strategies tein interactions or signaling pathways tions cause ASD-related behavioral phe- to transform this knowledge base into that are common to the various ASD- notypes (Radyushkin et al., 2009; Tabuchi viable treatment strategies. related proteins and therefore expected et al., 2007) but have strikingly different However, the corresponding chal- to be perturbed by a wide range of effects on synapse and network function, lenges are substantial. For example, very ASD-related mutations—with the hope with the Nlgn3R451C mutation resulting little is known about the role of ASD- that such pathways may represent more in a gain-of-function phenotype that is

408 Neuron 78, May 8, 2013 ª2013 Elsevier Inc. Neuron Previews

mice that might explain the similar ASD- related behavioral changes in these mouse lines and may therefore be partic- ularly relevant to ASDs (Fo¨ ldy et al., 2013). To this end, the authors investigated GABAergic synaptic transmission in the hippocampus of Nlgn3R451C KI and Nlgn3 KO mice, focusing on the synaptic connections between inhibitory basket cells and pyramidal neurons, which are known to play a fundamental role in the generation of the network oscillations that underlie a number of cognitive func- tions controlled by the hippocampus (Lisman and Buzsa´ ki, 2008). Two types of basket cells are particularly relevant for this process, parvalbumin-containing (PV) and cholecystokinin-containing (CCK) basket cells, and Fo¨ ldy et al. (2013) employed paired whole-cell re- cordings to monitor perisomatic synap- ses formed by each of these inhibitory cell types onto postsynaptic pyramidal neurons (Figure 1). The authors found that synaptic trans- mission is substantially impaired at PV basket cell synapses in Nlgn3R451C KI mice, with IPSC amplitudes reduced by 70%. No such alterations were observed in the Nlgn3 KOs, consistent with the previously published notion that the R451C substitution exerts its influence by a gain-of-function mechanism. Unex- pectedly in view of the postsynaptic local- ization of Nlgn3, this decrease in IPSC amplitude appears to be of presynaptic origin and due to a reduction in presynaptic transmitter release probability. In contrast, no evidence for changes in postsynaptic GABA receptor number or composition, in the total number of synapses, in quantal size or the number of release sites, or in the activation of presynaptic receptors that modulate release probability was ob- served. The authors conclude that the Figure 1. Potential Role of Nlgn3 at Perisomatic Inhibitory Synapses on CA1 Pyramidal Nlgn3R451C KI affects the presynaptic Neurons transmitter release machinery at PV PV and CCK basket cells form perisomatic inhibitory synapses onto pyramidal neurons. Boxed inserts summarize the data reported by Fo¨ ldy et al. (2013). Expanded views show a model of how Nlgn3 may basket cell synapses through gain-of- affect PV basket cell synapses (upper left) and CCK basket cell synapses (lower right) based on these function alterations in transsynaptic sig- findings. It should be noted that the presence of Nlgn3 at these synapses has not been investigated naling, although the precise mechanism and is inferred from the data. Abbreviations: Nlgn3, Neuroligin-3; PV, parvalbumin; CCK, cholecystokinin; SV, synaptic vesicle; MOR, m-opioid receptor; M2, M2 muscarinic acetylcholine receptor; CB1R, canna- has yet to be elucidated. binoid receptor type 1. While these experiments provided valu- able new insights into the mechanisms by which the R451C substitution might unrelated to the loss of function caused In a new study published in the current affect Nlgn3 function, they failed to by the Nlgn3 deletion (Baudouin et al., issue of Neuron,Fo¨ ldy and colleagues uncover common phenotypic features 2012; Etherton et al., 2011; Tabuchi searched for common phenotypic of the two Nlgn3 mutants that might be et al., 2007). changes in Nlgn3R451C KI and Nlgn3 KO related to pathways of particular relevance

Neuron 78, May 8, 2013 ª2013 Elsevier Inc. 409 Neuron Previews

for ASD pathophysiology. Hence, Fo¨ ldy the fundamental importance of synaptic a mouse model of fragile X syndrome et al. (2013) next investigated transmission context in understanding Neuroligin (Busquets-Garcia et al., 2013; Jung at CCK basket cell synapses. Unexpect- function. The function of Neuroligins and et al., 2012). Together with these findings, edly, the authors found that the Neurexins is not only diversified by ex- the data presented by Fo¨ ldy et al. indicate Nlgn3R451C KI phenotype at these CCK tensive alternative splicing, but also by that further analyses of the link between basket cell synapses was diametrically alternate transsynaptic binding partners endocannabinoid signaling and ASDs opposite to the one found at PV basket such as LRRTMs or N-cadherin (reviewed may provide valuable insights into the cell synapses, with IPSC amplitudes recently in Krueger et al., 2012). Accord- pathophysiology and potential treatment substantially increased rather than ingly, each synapse type may express strategies for ASDs. decreased. As with the PV basket cell syn- its own distinct transsynaptic signaling apses, this phenotypic change is again complex, dependent on the identity of REFERENCES likely the result of an alteration in presyn- both the presynaptic and the postsyn- aptic GABA release probability. However, aptic neuron. As Fo¨ ldy et al. (2013) dis- Auerbach, B.D., Osterweil, E.K., and Bear, M.F. (2011). Nature 480, 63–68. in the case of the CCK basket cell synap- cuss, it is conceivable that the Nlgn3R451C ses, the change in IPSC amplitude was substitution may exert distinct effects Baudouin, S.J., Gaudias, J., Gerharz, S., Hatstatt, L., Zhou, K., Punnakkal, P., Tanaka, K.F., Spooren, phenocopied in the Nlgn3 KO mouse, indi- on the binding affinity to various transsy- W., Hen, R., De Zeeuw, C.I., et al. (2012). Science cating that it represents a loss-of-function naptic partners, thereby differentially 338, 128–132. effect that is mechanistically distinct from shifting the composition of the transsy- Bear, M.F., Huber, K.M., and Warren, S.T. (2004). the one observed at PV basket cell synap- naptic signaling complex at PV basket Trends Neurosci. 27, 370–377. ses of Nlgn3R451C KI mice. cell and CCK basket cell synapses. The Busquets-Garcia, A., Gomis-Gonzalez, M., Gue- It was shown previously that GABA consequence of this complexity is that it gan, T., Agustin-Pavon, C., Pastor, A., Mato, S., release at CCK basket cell synapses can becomes challenging to predict the rele- Perez-Samartin, A., Matute, C., de la Torre, R., be suppressed by tonic endocannabi- vance of a given mutation for ASD-related and Dierssen, M. (2013). Nat. Med. Published online March 31, 2013. http://dx.doi.org/10.1038/ noid-mediated activation of presynaptic phenotypes without directly assessing nm.3127. CB1 receptors, most likely via constitutive its effects in a synapse-specific and Etherton, M., Fo¨ ldy, C., Sharma, M., Tabuchi, K., release of endocannabinoids from the circuitry-specific manner. The use of Liu, X., Shamloo, M., Malenka, R.C., and Su¨ dhof, postsynaptic neuron (Katona and Freund, genetic strategies to selectively target T.C. (2011). Proc. Natl. Acad. Sci. USA 108, 2012). The authors therefore tested if the individual types of synapses, as well 13764–13769. increase in GABA release probability as methods to elucidate the molecular Fo¨ ldy, C., Malenka, R.C., and Su¨ dhof, T.C. (2013). observed at CCK basket cell synapses identity of transsynaptic signaling com- Neuron 78, this issue, 498–509. R451C of Nlgn3 KI and Nlgn3 KO mice plexes in a synapse-specific manner, will Jamain, S., Quach, H., Betancur, C., Ra˚ stam, M., is caused by a deficiency in tonic endo- be essential to fully eludicate the role of Colineaux, C., Gillberg, I.C., Soderstrom, H., Giros, B., Leboyer, M., Gillberg, C., and Bourgeron, T.; cannabinoid signaling. In support of Neuroligins in normal synapse develop- Paris Autism Research International Sibpair Study. this notion, bath application of a CB1 ment and in disorders of the synapse. (2003). Nat. Genet. 34, 27–29. receptor antagonist resulted in an in- A second key implication arising from Jung, K.-M., Sepers, M., Henstridge, C.M., Las- crease in IPSC amplitudes at wild-type the present study is that dysregulation of salle, O., Neuhofer, D., Martin, H., Ginger, M., synapses, but failed to further enhance the endocannabinoid system may play Frick, A., DiPatrizio, N.V., and Mackie, K. (2012). Nat. Comm. 3, 1080. transmission at Nlgn3R451C KI or NL3 an important role in ASD pathophysio- KO or R451C KI synapses, indicating logy and may therefore represent a Katona, I., and Freund, T.F. (2012). Annu. Rev. 35 that CB1 receptor signaling was already target for pharmacological intervention. Neurosci. , 529–558. reduced in the two mutants. Interestingly, A similar strategy was previously em- Krueger, D.D., Tuffy, L.P., Papadopoulos, T., and Nlgn3 loss-of-function impaired tonic ployed to identify the metabotropic Brose, N. (2012). Curr. Opin. Neurobiol. 22, 412–422. endocannabinoid signaling at all CB1- glutamate receptor (mGluR) signaling containing GABAergic synapses through- pathway as a target for drug development Lisman, J., and Buzsa´ ki, G. (2008). Schizophr. Bull. 34, 974–980. out the hippocampus, but showed no in several mouse models of ASD-related effect on glutamatergic transmission or disorders, including fragile X syndrome Murdoch, J.D., and State, M.W. (2013). Curr. Opin. on phasic endocannabinoid signaling. (Bear et al., 2004), tuberous sclerosis Genet. Dev. Published online March 25, 2013. http://dx.doi.org/10.1016/j.gde.2013.02.003. These data led the authors to conclude complex (Auerbach et al., 2011), and that Nlgn3 is required to specifically Nlgn3 deletion (Baudouin et al., 2012), Radyushkin, K., Hammerschmidt, K., Boretius, S., Varoqueaux, F., El-Kordi, A., Ronnenberg, A., localize the release machinery for tonic and clinical trials based on these findings Winter, D., Frahm, J., Fischer, J., Brose, N., and endocannabinoid release to CB1-con- are underway. Whether targeting the Ehrenreich, H. (2009). Genes Brain Behav. 8, taining synapses. endocannabinoid system in the context 416–425. There are several interesting lessons to of ASDs will prove to be similarly prom- Sanders, S.J., Ercan-Sencicek, A.G., Hus, V., Luo, be learned from this study. First, the ising remains to be seen, and additional R., Murtha, M.T., Moreno-De-Luca, D., Chu, S.H., Moreau, M.P., Gupta, A.R., Thomson, S.A., et al. observation that the same Nlgn3 mutation research will be necessary to build upon (2011). Neuron 70, 863–885. can have such different effects on two this notion. Interestingly, however, aber- Tabuchi, K., Blundell, J., Etherton, M.R., Hammer, types of presynapses contacting the rant activation of the endocannabinoid R.E., Liu, X., Powell, C.M., and Su¨ dhof, T.C. (2007). same postsynaptic neuron highlights system was also recently reported in Science 318, 71–76.

410 Neuron 78, May 8, 2013 ª2013 Elsevier Inc. J Autism Dev Disord (2013) 43:2686–2695 DOI 10.1007/s10803-013-1824-9

ORIGINAL PAPER

Cannabinoid Receptor Type 2, but not Type 1, is Up-Regulated in Peripheral Blood Mononuclear Cells of Children Affected by Autistic Disorders

Dario Siniscalco • Anna Sapone • Catia Giordano • Alessandra Cirillo • Laura de Magistris • Francesco Rossi • Alessio Fasano • James Jeffrey Bradstreet • Sabatino Maione • Nicola Antonucci

Published online: 13 April 2013 Ó Springer Science+Business Media New York 2013

Abstract Autistic disorders (ADs) are heterogeneous of arbitrary units: 0.34 ± 0.03 vs. 0.23 ± 0.02 in autistic neurodevelopmental disorders arised by the interaction of children and healthy subjects, respectively), whereas CB1 genes and environmental factors. Dysfunctions in social and fatty acid amide hydrolase mRNA levels were interaction and communication skills, repetitive and ster- unchanged. mRNA levels of N-acylphosphatidylethanola eotypic verbal and non-verbal behaviours are common mine-hydrolyzing phospholipase D gene were slightly features of ADs. There are no defined mechanisms of decreased. Protein levels of CB-2 were also significantly pathogenesis, rendering curative therapy very difficult. increased in autistic children (mean ± SE of arbitrary Indeed, the treatments for autism presently available can be units: 33.5 ± 1.32 vs. 6.70 ± 1.25 in autistic children and divided into behavioural, nutritional and medical approa- healthy subjects, respectively). Our data indicate CB2 ches, although no defined standard approach exists. receptor as potential therapeutic target for the pharmaco- Autistic children display immune system dysregulation and logical management of the autism care. show an altered immune response of peripheral blood mononuclear cells (PBMCs). In this study, we investigated Keywords Autistic disorders Cannabinoid system the involvement of cannabinoid system in PBMCs from Gene expression PBMCs autistic children compared to age-matched normal healthy developing controls (age ranging 3–9 years; mean age: 6.06 ± 1.52 vs. 6.14 ± 1.39 in autistic children and heal- Introduction thy subjects, respectively). The mRNA level for cannabi- noid receptor type 2 (CB2) was significantly increased in Autistic disorders (ADs) are variable heterogeneous neuro- AD-PBMCs as compared to healthy subjects (mean ± SE developmental disorders defined by deficits in social

D. Siniscalco (&) C. Giordano F. Rossi S. Maione A. Cirillo Division of Pharmacology, Department of Experimental Division of Biotechnology and Molecular Biology ‘‘A. Medicine, Second University of Naples, via S. Maria di Cascino’’, Department of Experimental Medicine, Second Costantinopoli, 16, 80138 Naples, Italy University of Naples, Naples, Italy e-mail: [email protected] A. Fasano D. Siniscalco MassGeneral Hospital for Children, Boston, MA, USA Centre for Autism, La Forza del Silenzio, Caserta, Italy J. J. Bradstreet A. Sapone L. de Magistris International Child Development Resource Center, Cumming, Department of Internal and Experimental Medicine ‘‘Magrassi- GA, USA Lanzara’’, Second University of Naples, Naples, Italy N. Antonucci A. Sapone A. Fasano Biomedical Centre for Autism Research and Treatment, Bari, Center for Celiac Research and Mucosal Immunology and Italy Biology Research Center, Massachusetts General Hospital East, Charlestown, MA, USA

123 J Autism Dev Disord (2013) 43:2686–2695 2687 interaction, adaptive functioning, and communication skills, Schultz hypothesized acetaminophen contributes to the combined with repetitive and stereotypical behaviours risk of autism via activation of the endocannabinoid system (Diagnostic and Statistical Manual of Mental Disorders, 4th (Schultz 2010). To our knowledge, however, no studies Edition, Text Revision (DSM-IV-TR), American Psychiatric have specifically investigated the endocannabinoid system Association 2000; Levy et al. 2009). While autism patho- in the development of autism. Herein we address the issue genesis remains unclear, efforts to define valid treatments for of whether these disorders are associated with changes in ADs are being pursued. Numerous biochemical and cellular the expression of CB1/2 receptors and endocannabinoid events are associated with ADs (i.e. oxidative stress, mito- metabolism enzymes, the AEA biosynthetic enzyme N- chondrial dysfunction, intestinal dysbiosis and immune acylphosphatidylethanolamine-hydrolyzing phospholipase dysregulation) (Ashwood et al. 2006; de Magistris et al. D (NAPE-PLD) and the AEA degradative catabolic enzyme 2010). Among the immunological dysfunctions described in FAAH in PBMCs from AD patients. ADs, peripheral blood mononuclear cells (PBMCs) are reported (Enstrom et al. 2010; Siniscalco et al. 2012). AD- PBMCs show increased levels of pro-inflammatory cyto- Materials and Methods kines and interleukins with resultant long-term immune alterations (Molloy et al. 2006; Onore et al. 2009). Recently, Subjects it has been demonstrated that AD-PBMCs show altered expression and activation of several caspases (Siniscalco Informed consent was obtained from all subjects enrolled et al. 2012). These caspases are a phylogenetically conserved in this study in compliance with national legislation and the structurally-related family of aspartate-specific, cysteine- Code of Ethical Principles for Medical Research Involving dependent proteases (Lamkanfi et al. 2002). They regulate Human Subjects of the World Medical Association (Dec- apoptosis and inflammatory signalling pathways. However, laration of Helsinki). beyond apoptosis, these enzymes show other functions. We investigated 17 children with autism, and compared Caspases are pleiotropic enzymes, functioning in cell dif- them to 22 age and sex matched healthy children used as ferentiation and proliferation, as well as in activation and control group (age ranging 3–9 years; mean age: 6.06 ± nuclear reprogramming pathways (Algeciras-Schimnich 1.52 vs. 6.14 ± 1.39 in autistic and healthy individuals, et al. 2002). respectively). The 17 subjects with autism were recruited The endocannabinoid system consists of arachidonic into the study from the outpatient Centre for Autism of La acid derived compounds (endocannabinoids), their recep- Forza del Silenzio, Naples-Caserta, Italy. The cohort tors and the associated enzymes (Li et al. 2011). This included 14 boys and 3 girls. Before entering the study, all represents an intricate network of lipid signalling pathways of the children were administered the Autism Diagnostic (Barna and Zelena 2012). Accumulating evidence high- Interview-Revised version (Lord et al. 1994), the Child- lights that the endocannabinoid system is involved in hood Autism Rating Scales (Schopler et al. 1993), and the several psychiatric disorders (i.e. autism, anxiety, major Autism Diagnostic Observation Schedule-Generic (Lord depression, bipolar disorder and schizophrenia), as well as et al. 2000) to document the diagnosis of autism. All developmental disorders (Schneider and Koch 2005; included patients met the Diagnostic and Statistical Manual Ishiguro et al. 2010; Robinson et al. 2010; Garcia-Gutierrez of Mental Disorders-IV criteria for autism (DSM-IV-TR) and Manzanares 2011; Minocci et al. 2011). (American Psychiatric Association 2000). In addition to Endocannabinoids, such as N-arachidonoylethanol- meeting the criteria for autistic disorder (AD), subject amine (anandamide, AEA) and 2-arachidonoyl glycerol (2- children were required to score at least 30 points on the AG), are synthesized and released upon demand in a CARS scale. Twenty-two healthy children (females 4, receptor-dependent way (Mouslech and Valla 2009). They males 18) were recruited among staff family members. exert their effects through the G-protein-coupled cannabi- Potential subjects were excluded if they had any of the noid receptors CB1 and CB2, which, in turn, are negatively following: a neurological or comorbid psychiatric disorder, coupled to adenylate cyclase enzyme (Pertwee et al. 2010). epilepsy, history of liver, renal or endocrine disorders, After receptor binding, endocannabinoids are transported current infection of any origin. Mental retardation or into cells by a specific uptake system and degraded by the behavioural disorders, including Pervasive Developmental fatty acid amide hydrolase (FAAH). Disorder—not otherwise specified (PDD-NOS), inclusion Recent studies suggested that endocannabinoids exhibit criteria for attention deficit-hyperactivity disorder, were all potent anti-inflammatory and immunosuppressive proper- considered exclusion criteria for control children. Children ties. Therefore, this pathway presents therapeutic potential diagnosed with Asperger’s syndrome, fragile X syndrome for autoimmune and inflammatory diseases (Klein and and tuberous sclerosis were also excluded from the study. Cabral 2006; Nagarkatti et al. 2009). IQ test was not performed. Neither AD subjects nor 123 2688 J Autism Dev Disord (2013) 43:2686–2695 controls had special diets or other pharmacological inter- (DNASTAR INC., Madison, WI, USA) were used to ventions. Other exclusion criteria were coeliac disease and/ design specific primer pairs for RT-PCRs (OLIGO 4.05 or other major diseases of the intestinal tract, such as software, National Biosciences Inc., Plymouth, MN, USA) inflammatory bowel disease or hepatic disorders. (Table 1). Each RT-PCR was repeated at least three times to achieve the best reproducibility data. The mean of the Isolation of Peripheral Blood Mononuclear Cells inter-assay variability of each RT-PCR assay was 0.07. The (PBMCs) levels of mRNA measured were normalized with respect to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Fresh peripheral blood samples from AD subjects and which was chosen as the housekeeping gene. Indeed control donors were drawn and collected in sterile EDTA GAPDH is one of the most stably expressed genes in tubes (Becton–Dickinson, Franklin Lakes, NJ, USA). human peripheral blood (Stamova et al. 2009). To our Peripheral blood mononuclear cells (PMBCs) were isolated knowledge, there is no molecular evidence of variation in by centrifugation over Histopaque 1,077 density gradient GAPDH mRNA-levels in autism disorders (Siniscalco (Sigma Chemical, St Louis, MO, USA). Briefly, blood was et al. 2012). The gene expression values were expressed as diluted 1:1 in phosphate buffer saline (PBS) (Sigma, St. arbitrary units ± SEM. Amplification of the genes of Louis, MO, USA), overlaid onto lymphocyte separation interest and GAPDH was performed simultaneously. PCR media (Lymphocyte Separation Medium—Lonza, Walk- products were resolved into 2.0 % agarose gel. A semi- ersville, MD, USA), centrifuged at 2,200 rpm for 30 min at quantitative analysis of mRNA levels was carried out by room temperature and plasma was removed. Mononuclear the ‘‘Gel Doc 2000 UV System’’ (Bio-Rad, Hercules, CA, cell fraction was harvested and washed twice in PBS. The USA). final pellet was re-suspended in Tri-Reagent solution (Molecular Research Center Inc., Cincinnati, OH, USA) or Protein Extraction and Western Blot Analysis protein lysis buffer for further molecular analysis. For protein extraction, PBMCs were suspended in protein RNA Extraction and RT-PCR lysis buffer [HEPES 25 mM; EDTA 5 mM; SDS 1 %;

Triton X-100 1 %; PMSF 1 mM; MgCl2 5 mM; Protease The RNA was extracted from PBMCs using a RNA Tri- Inhibitor Cocktail (Roche, Mannheim, Germany); Phos- Reagent (Molecular Research Center Inc., Cincinnati, OH, phatase Inhibitor Cocktail (Roche, Mannheim, Germany)]. USA) according to the manufacturer’s protocol. The total Protein concentration was determined using the method RNA concentration and integrity were determined by described by Bradford (1976). Each sample was loaded, Nanodrop ND-1000 UV spectrophotometer (Nano-DropÒ electrophoresed in a 15 % SDS-polyacrylamide gel and Technologies, Thermo Scientific, Wilmington, DE, USA). electroblotted onto a nitrocellulose membrane. The mem- The mRNA levels of the endocannabinoid genes under brane was blocked in 5 % milk, 1X Tris-buffered saline analysis were measured by RT-PCR amplification, as pre- and 0.05 % Tween-20. Primary antibodies to detect CB2 viously reported (Siniscalco et al. 2012). Reverse Trans- (Calbiochem-Merck, Darmstadt, Germany) were used criptase from Avian Myeloblastosis Virus (AMV-RT; according to the manufacturer’s instructions at 1:250 Promega, Madison, WI, USA) was used. For first-strand dilutions. The rabbit anti-CB2 antibody detects endogenous cDNA synthesis 200 ng total RNA, random examers, levels of the human 45 kDa fragment of CB2 receptor dNTPs (Promega, Madison, WI, USA), AMV buffer, protein. The antibody does not cross-react with the CB1 AMV-RT and recombinant RNasin ribonuclease inhibitor receptor protein and, according to the manufacturer, was (Promega, Madison, WI, USA) were assembled in diethyl- validated with a recombinant protein consisting of the first pyrocarbonate-treated water to a 20 ll final volume and 33 amino acids of human CB2 receptor used as a positive incubated for 10 min at 65 °C and 1 h at 42 °C. RT minus control. Immunoreactive signals were detected with a controls were carried out to check potential genomic DNA horseradish peroxidase-conjugated secondary antibody and contamination. These RT minus controls were performed reacted with an ECL system (Amersham Pharmacia, without using the reverse transcriptase enzyme in the Uppsala, Sweden). To assess equal loading, protein levels reaction mix. Aliquots of 2 ll cDNA were transferred into were normalized with respect to the signal obtained with a25ll PCR reaction mixture containing dNTPs, MgCl2, Ponceau S staining, as previously reported (Alessio et al. reaction buffer, specific primers and GoTaq Flexi DNA 2010; Romero-Calvo et al. 2010; Zanichelli et al. 2012). polymerase (Promega, Madison, WI, USA), and amplifi- We used Ponceau S staining over actin as equal loading cation reactions using specific primers and conditions for control as this method has a better dynamic range and human genes under analysis cDNA were carried out. overcomes the possibility that housekeeping proteins could Sequences for the human mRNAs from GeneBank vary in this pathology or be saturated at the levels of 123 J Autism Dev Disord (2013) 43:2686–2695 2689

Table 1 Primer sequences, annealing temperatures, and product sizes for RT-PCRs Gene Sense primer Antisense primer Annealing Product sizes bp temperature °C

CB1 50-CAAGGAGAATGAGGAGAACA- 50-CCAGCGTGAGGGACAGGACT-30 55 318 30 CB2 50-TTGGCAGCGTGACTATGACC-30 50-AGGAAGGCGATGAACAGGAG- 55 274 30 FAAH 50-GGCCACACCTTCCTACAGAA-30 50-GTTTTGCGGTACACCTCGAT-30 58 218 NAPE- 50-GAAGCTGGCTTAAGAGTCAC-30 50-CCGCATCTATTGGAGGGAGT-30 60 178 PLD GAPDH 50-TCACCAGGGCTGCTTTTAAC-30 50-GGACTCCACGACGTACTCAG-30 55 242 PCR primers were designed by using the computer program OLIGO 4.05 software (National Biosciences Inc., Plymouth, MN, USA) and were purchased from PRIMM (Milan, Italy)

loading (Romero-Calvo et al. 2010). The semi-quantitative Statistical Analysis analysis of protein levels was carried out by the Chemi- Doc-It 5000, using VisionWorks Life Science Image Biomolecular data are expressed as mean ± SEM ANOVA, Acquisition and Analysis software (UVP, Upland, CA, followed by Student–Neuman–Keuls post hoc test, was used USA). to determine the statistical significance among groups, without correction for multiple test comparison. p \ 0.05 Immunocytochemistry was considered statistically significant.

For immunocytochemical analysis, PBMCs were extracted and plated as previously reported (Siniscalco et al. 2012). In Results brief, mononuclear cells were re-suspended at 1 9 106 cell/ mL in RPMI 1640 complete medium (Lonza, Verviers, AD- Related Changes in Endocannabinoid System Belgium) containing 10 % fetal bovine serum (FBS) (Eu- Gene Expressions roClone-Celbio, Milan, Italy), 2 mM L-glutamine, 100 U/ml penicillin, and 100 mg/ml streptomycin (all Lonza), We examined endocannabinoid system gene expression were plated on slides with a 12-well plate and incubated for mainly by RT-PCR, since this technique is a far more

4 days at 37 °C with 5 % CO2. Cells were then fixed with sensitive method for the detection of gene expression than 4 % paraformaldheyde fixative. After washing in PBS, non- immunocytochemistry (Giordano et al. 2011; Siniscalco specific antibody binding was inhibited by incubation for et al. 2012). In addition, the genes analysed showed a 30 min in blocking solution (1 % BSA in PBS). Primary transcriptional regulative mechanism (Galie`gue et al. antibodies were diluted in PBS blocking buffer and slides 1995; Maccarrone et al. 2001; Nong et al. 2002). When were incubated overnight at 4 °C in primary antibodies to compared to controls, the semiquantitative analysis of human CB1 receptor or to human CB2 receptor (either PBMC-extracted mRNA levels, measured by RT-PCR diluted at 1:200; Calbiochem-Merck, Darmstadt, Ger- amplification, showed an increase in the CB2 receptor many). Fluorescent-labeled secondary antibodies (1:1,000; gene in PBMCs of AD patients (mean ± SE of arbitrary Alexa Fluor 488 (for CB1) and 568 (for CB2), Molecular units: 0.34 ± 0.03 vs. 0.23 ± 0.02, p \ 0.05, in autistic Probe; Invitrogen, Carlsbad, CA, USA) specific to the IgG children and healthy subjects, respectively), whereas species used as a primary antibody were used to locate the mRNA levels of NAPE-PLD gene were slightly decreased specific antigens in each slide. Cells were counterstained (mean ± SE of arbitrary units: 0.25 ± 0.04 vs. 0.39 ± with bisbenzimide (Hoechst 33258; Hoechst, Frankfurt, 0.03, p \ 0.05, in autistic children and healthy subjects, Germany) and mounted with mounting medium (90 % respectively); mRNA levels of CB1 receptor (mean ± SE glycerol in PBS). Fluorescently labelled slides were viewed of arbitrary units: 0.51 ± 0.05 vs. 0.69 ± 0.07, p [ 0.05, with a fluorescence microscope (Leica, Wetzlar, Germany). in autistic children and healthy subjects, respectively) and Immunofluorescence images were analyzed with Leica FAAH enzyme gene (mean ± SE of arbitrary units: FW4000 software (Leica, Wetzlar, Germany). Only bis- 0.38 ± 0.10 vs. 0.48 ± 0.08, p [ 0.05, in autistic children benzimide counterstained cells were considered as positive and healthy subjects, respectively) were not different profiles so as to avoid overcounting cells. (Fig. 1; Table 2). 123 2690 J Autism Dev Disord (2013) 43:2686–2695

Fig. 1 Over-expression of CB2 receptor gene, but not of CB1 receptor and FAAH enzyme, and down-expression of NAPE- PLD gene in AD-PBMCs. The measured mRNA levels were normalized with respect to GAPDH (housekeeping gene) and gene expression values were expressed as a percentage of arbitrary units ± SEM open circle indicates significant difference versus healthy controls. p values \0.05 were considered statistically significant. CTL healthy control subjects, AD autistic patients

Table 2 The mRNA levels (mean ± SE) of the genes under analysis measured by RT-PCR amplification are reported

Gene Healthy subjects PCR coefficient of variation Autistic patients PCR coefficient of variation p value F(1–37)

CB-1/GAPDH 0.69 ± 0.07 0.08 0.51 ± 0.05 0.05 0.056 3.91 CB-2/GAPDH 0.23 ± 0.02 0.07 0.34 ± 0.03* 0.05 0.003 9.99 FAAH/GAPDH 0.48 ± 0.08 0.06 0.38 ± 0.10 0.08 0.434 0.63 NAPE-PLD/GAPDH 0.39 ± 0.03 0.05 0.25 ± 0.04* 0.07 0.007 8.17 Each RT-PCR was repeated at least three times. The semi-quantitative analysis of mRNA levels was carried out by the ‘‘Gel Doc 2000 UV System’’ (Bio-Rad, Hercules, CA, USA). The measured mRNA levels were normalized with respect to GAPDH (housekeeping gene) and gene expression values were expressed as arbitrary units ± SE. *p \ 0.05 versus the corresponding healthy controls, as analyzed by four separate ANOVAs, followed by Student–Neuman–Keuls test. The mean of the inter-assay variability of each RT-PCR assay was also reported as PCR coefficient of variation. The values of variance p and F rate are also reported (critical alpha is set to 0.05)

CB2 Protein Levels are Increased in AD-PBMCs system of regulation, that affects the levels of receptor in the cell (Ardura and Friedman 2011; Peralta et al. 2011; As G protein-coupled receptors, the cannabinoid receptors Toma´nkova´ and Myslivecek 2012). (CBs) also show post-translational regulation (Ardura and Moreover, the levels of cellular mRNAs can be regu- Friedman 2011; Peralta et al. 2011). To confirm gene lated by controlling the rate at which the mRNA decays expression change, we therefore determined the protein (Wilusz et al. 2001). It is noteworthy to consider that there levels of CB2 receptor by western blot analysis, as well as is not a direct correlation between mRNA transcripts and by fluorescence immunocytochemistry. protein levels. Gene expression is also regulated by the To confirm a lack of change in protein levels for CB1 control of mRNA degradation, since the steady-state con- receptor as implied by mRNA levels, we performed centration of mRNA is determined both by its rates of immunocytochemical analysis also for this receptor. Wes- synthesis and decay (Rajagopalan and Malter 1997; Meyer tern blot analysis showed a remarkable increase in CB2 et al. 2004). Changes in mRNA half-life do not reflect protein levels in AD children as compared to healthy changes in transcription (Ross 1996). More importantly, controls (Fig. 2) (mean ± SE of arbitrary units: the correlation between mRNA and protein abundances in 33.5 ± 1.32 vs. 6.70 ± 1.25, p \ 0.05, in autistic children the cell is insufficient to predict protein expression levels and healthy subjects, respectively). Protein level analysis in from quantitative mRNA data (Gygi et al. 1999; Maier AD patients and control groups was performed simulta- et al. 2009). Determining a direct relationship between neously. CB2 protein level was enhanced in all the AD mRNA and protein levels can be problematic (Pascal et al. children evaluated. The control group demonstrated no 2008). However, mRNA expression is informative in the intragroup variances of significance. prediction of protein expression (Guo et al. 2008). The difference between the increase in CB2 mRNA and Increasing in both mRNA and correspondent protein is in the increase in CB2 protein in AD group is not sur- indicative of a positive correlation between mRNA and prising. Post-translational control of protein function has protein expression levels (Guo et al. 2008; Yang et al. been described to affect protein levels. Indeed, the CB2 2013). Using several and different techniques (i.e. RT- protein, as G protein coupled receptor, show a multilevel PCR, Western blot, immunocytochemistry), as used here, 123 J Autism Dev Disord (2013) 43:2686–2695 2691

CB2 receptor protein, without cross-reacting with the CB1 receptor protein. Immunofluorescence staining confirmed that CB2 was over-expressed in the PBMCs in AD children as compared to healthy controls, while no difference in CB1 receptor related signals were observed in AD children respect to healthy controls (Fig. 3).

Discussion

In this study, we demonstrated for the first time the up- regulation of CB2 receptors in PBMCs from ADs subjects. No differences were observed for CB1 receptor regulation. Alterations in endocannabinoid levels are transient adaptive reactions which attempt to re-establish normal homeostasis disrupted by the disease. However, in some conditions, endocannabinoid systems appear to contribute to a chronic maladaptive disease state (Di Marzo and Petrosino 2007). Emerging studies highlight that endocannabinoid signalling through CB2 receptors could activate a protective system. Fig. 2 Representative western blot analysis of CB2 protein levels in CB2 receptor activation is known to trigger immune sup- the PBMCs obtained from the autistic children and the healthy pression (Hegde et al. 2010). After inflammation or tissue controls, respectively. CTL healthy control subjects, AD autistic disorder subjects. The histograms indicate percentage variations in injury, there is a rapid increase in local endocannabinoid CB2 protein levels in the PBMCs of AD children compared to the levels, which appears to mediate immune responses through healthy controls (CTL). open circle indicates significant differences down-regulation of cytokine expressions (Jean-Gilles et al. versus healthy subjects. p \ 0.05 was considered as the level of 2010; Pacher and Mechoulam 2011). The immunomodu- significance latory effects of endocannabinoids are mainly mediated by to study changes in gene expression is a valid tool to assess the CB2 receptor expressed on immune cells (Klein et al. the correlation between these macromolecules inside the 2003; Cencioni et al. 2010). The CB2 gene, which is not cell (Dong et al. 2012). expressed in the brain, is principally expressed in immune Immunofluorescence analysis was carried out using an tissues (Kenny 2011); whereas CB1 is abundant in the antibody able to detect endogenous levels of the human central nervous system (Galie`gue et al. 1995). It’s

Fig. 3 Representative fluorescent photomicrograph of PBMCs showing immunocytochemistry for CB1 receptor (bottom) and CB2 receptor (top). Top Arrows indicate CB2 positive staining (red fluorescent). Bottom Arrows indicate CB1 positive staining (green fluorescent). To correctly identify cells, their nuclei were counterstained with bisbenzimide (blue fluorescence), as shown in panel a. a healthy control subjects; b autistic disorder patients. Scale bars 15 lm

123 2692 J Autism Dev Disord (2013) 43:2686–2695 noteworthy that CB2 receptors regulate cannabinoid- these cells are key regulators of the immune pathways, and induced immune modulation (Tanikawa et al. 2011). Can- a dysregulation in the PBMC response could result in long- nabinoids are involved in B cell activation and maturation term immune alterations seen in AD (Enstrom et al. 2010). through the CB2 receptor. Importantly, B lymphocytes The CB2 receptor alterations we observed in AD-PBMCs express the highest level of CB2 mRNA relative to other indicate the endocannabinoid system may be functionally immune cells (Agudelo et al. 2008). In addition, CB2 involved in AD pathogenesis or maintenance. The fact that receptor is able to modulate development, migration, pro- in PBMCs from autistic children we observed only CB2 liferation, and effector functions of immune cells (Basu and receptor changes, but not CB1 and/or the anandamide cat- Dittel 2011). Alterations in immune system in autism abolic enzyme FAAH, could indicate that the main action pathogenesis have been reported (Gupta et al. 2010; Suzuki played by endocannabinoids in these cells is to regulate et al. 2011). Moreover, AD-PBMCs show increased acti- inflammation and immune responses. CB1 receptors do not vation of both Th1- and Th2- mediated immune response, seem involved in mediating these events. However, our data altered cytokine profiles, decreased lymphocyte numbers, cannot exclude CB1 receptor up-regulation in other cell imbalance of serum immunoglobulin levels and caspase- types or within the central nervous system. It is noteworthy mediated immune response changes (Ashwood et al. 2006; that pro-inflammatory stimuli suppress NAPE-PLD Li et al. 2009; Siniscalco et al. 2012). These observations, expression (Zhu et al. 2011). In fact, the slight down-reg- when combined with the present study data, are suggestive ulation we observed in mRNA levels for this biosynthetic that CB2 receptor up-regulation in PBMCs could be related enzyme could be related to the inflammatory state associ- to AD-immune dysregulation. It is well established that ated with autism immunopathology.

Fig. 4 Endocannabinoids, such as N-arachidonoylethanolamine turn, are negatively coupled to adenylyl cyclase enzyme. After the (anandamide, AEA) and 2-arachidonoyl glycerol (2-AG), are synthe- specific binding with their receptors, endocannabinoids are trans- sized and released upon demand in a receptor-dependent way, through ported into cells by a specific uptake system and degraded by the the AEA biosynthetic enzyme N-acylphosphatidylethanolamine- enzymes fatty acid amide hydrolase (FAAH). In peripheral blood hydrolyzing phospholipase D (NAPE-PLD) and the diacylglycerol mononuclear cells, autistic disorders trigger over-production of CB2 (DAG) lipase enzyme, respectively. They exert their effects through receptor gene expression, as well as protein levels, together with a the G-protein-coupled cannabinoid receptors CB1 and CB2, which, in down-expression of NAPE-PLD 123 J Autism Dev Disord (2013) 43:2686–2695 2693

Another hypothesis could be related to a CB2 protective like to thank Dr. Sarah Costantino, Second University of Naples, for response to AD-mediated inflammatory stimuli derived her useful assistance in image analysis. from the capacity of CB2 to inhibit pro-inflammatory References cytokine synthesis and release (Di Filippo et al. 2004). However, it has been demonstrated that pro-inflammatory Agudelo, M., Newton, C., Widen, R., Sherwood, T., Nong, L., cytokines are abundantly increased in the plasma of autistic Friedman, H., et al. (2008). Cannabinoid receptor 2 (CB2) patients (Ashwood et al. 2011). These data, when com- mediates immunoglobulin class switching from IgM to IgE in bined with our study’s observations, enhance the hypoth- cultures of murine-purified B lymphocytes. Journal of Neuro- esis of a correlation between CB2-mediated immune immune Pharmacology, 3(1), 35–42. Alessio, N., Squillaro, T., Cipollaro, M., Bagella, L., Giordano, A., & dysfunction and autism pathophysiology. This further Galderisi, U. (2010). The BRG1 ATPase of chromatin remod- indicates that the endocannabinoid system, through CB2 eling complexes is involved in modulation of mesenchymal stem receptors, could mediate a cross-talk between immune and cell senescence through RB-P53 pathways. Oncogene, 29(40), nervous systems. 5452–5463. Algeciras-Schimnich, A., Barnhart, B. C., & Peter, M. E. (2002). As previously mentioned, Schultz reviewed the possible Apoptosis independent functions of killer caspases. Current autism activation by endocannabinoid system (Schultz Opinion in Cell Biology, 14, 721–726. 2010). He reviewed data revealing sulfation deficits in American Psychiatric Association. (2000). Diagnostic and statistical acetaminophen (paracetamol) metabolism with the autism manual of mental disorders (4th ed.). Text Revision. Washing- ton, DC: American Psychiatric Press. population. Acetaminophen administration in the presence Ardura, J. A., & Friedman, P. A. (2011). Regulation of g protein- of a sulfation deficiency, creates a metabolic by-product, coupled receptor function by na ?/h ? exchange regulatory N-arachidonoylphenolamine (AM404), causing an indirect factors. Pharmacological Reviews, 63(4), 882–900. increase of endocannabinoids levels (Ho¨gesta¨tt et al. 2005; Ashwood, P., Krakowiak, P., Hertz-Picciotto, I., Hansen, R., Pessah, I., & Van de Water, J. (2011). Elevated plasma cytokines in Soukupova´ et al. 2010), which in turn activate CB1/2 autism spectrum disorders provide evidence of immune dys- receptors triggering autism. This hypothesis invites further function and are associated with impaired behavioral outcome. consideration of the endocannabinoid system regarding Brain, Behavior, and Immunity, 25(1), 40–45. autism pathogenesis However, acetaminophen was not Ashwood, P., Wills, S., & Van de Water, J. (2006). The immune response in autism: A new frontier for autism research. Journal routinely taken by any of the subjects of this investigation, of Leukocyte Biology, 80(1), 1–15. so its involvement with endocannabinoids remains specu- Barna, I., & Zelena, D. (2012). The biochemical complexity of the lative. Nevertheless, the question of the endocannabinoid endocannabinoid system with some remarks on stress and related system involvement in autism pathogenesis remains a disorders: A minireview. Endocrine Regulations, 46(2), 107–124. potentially important concept deserving further investiga- Basu, S., & Dittel, B. N. (2011). Unraveling the complexities of tion. Apart from the endocannabinoid system, other envi- cannabinoid receptor 2 (CB2) immune regulation in health and ronmental autism risk factors (i.e. environmental toxics disease. Immunologic Research, 51(1), 26–38. exposure, parental age, low birth weight, and maternal Bradford, M. M. (1976). A rapid and sensitive method for the quantization of microgram quantities of protein utilizing the infections during pregnancy) are under consideration. Any principle of protein-dye binding. Analytical Biochemistry, 72, of these may further interact with the endocannabinoid 248–254. system as well. Further experiments are needed in order to Cencioni, M. T., Chiurchiu`, V., Catanzaro, G., Borsellino, G., better characterize the endocannabinoid system’s involve- Bernardi, G., Battistini, L., et al. (2010). Anandamide suppresses proliferation and cytokine release from primary human T-lym- ment in AD. phocytes mainly via CB2 receptors. PLoS ONE, 5(1), e8688. In conclusion, to our knowledge, this is the first study de Magistris, L., Familiari, V., Pascotto, A., Sapone, A., Frolli, A., demonstrating an endocannabinoid-CB2 signalling dys- Iardino, P., et al. (2010). Alterations of the intestinal barrier in regulation in autism, implying the endocannabinoid system patients with autism spectrum disorders and in their first-degree relatives. Journal of Pediatric Gastroenterology and Nutrition, may represent a new treatment opportunity for autism 51(4), 418–424. pharmacotherapy (Fig. 4). While the therapeutic use of the Di Filippo, C., Rossi, F., Rossi, S., & D’Amico, M. (2004). endocannabinoid systems is inviting, extensive research Cannabinoid CB2 receptor activation reduces mouse myocardial will be required to further evaluate this complex regulatory ischemia-reperfusion injury: Involvement of cytokine/chemo- kines and PMN. Journal of Leukocyte Biology, 75(3), 453–459. pathway and the safety of pharmacological manipulation. Di Marzo, V., & Petrosino, S. (2007). Endocannabinoids and the regulation of their levels in health and disease. Current Opinion Acknowledgments First and foremost, we thank the many autism in Lipidology, 18(2), 129–140. families who volunteered as participants in this research study. The Dong, R., Dong, K., Wang, X., Chen, G., Shen, C., & Zheng, S. (2012). authors gratefully thank Mr. Enzo Abate, Ms. Giovanna Gallone and Interleukin-33 overexpression is associated with gamma-glutam- the no-profit organizations ‘‘La Forza del Silenzio’’ and ‘‘Cancel- yl transferase in biliary atresia. Cytokine, S1043–4666(12), lautismo’’—Italy for their useful assistance. We thank the Autism 00771–00775. Research Institute, USA (ARI grant ‘‘Research that makes a differ- Enstrom, A. M., Onore, C. E., Van de Water, J. A., & Ashwood, P. ence’’ 2010) for financial support of this study. The authors would (2010). Differential monocyte responses to TLR ligands in

123 2694 J Autism Dev Disord (2013) 43:2686–2695

children with autism spectrum disorders. Brain, Behavior, and schedule-generic: A standard measure of social and communi- Immunity, 24(1), 64–71. cation deficits associated with the spectrum of autism. Journal of Galie`gue, S., Mary, S., Marchand, J., Dussossoy, D., Carrie`re, D., Autism and Developmental Disorders, 30(3), 205–223. Carayon, P., et al. (1995). Expression of central and peripheral Lord, C., Rutter, M., & Le Couteur, A. (1994). Autism diagnostic cannabinoid receptors in human immune tissues and leukocyte interview-revised: A revised version of a diagnostic interview for subpopulations. European Journal of Biochemistry, 232(1), caregivers of individuals with possible Pervasive Developmental 54–61. Disorders. Journal of Autism and Developmental Disorders, Garcia-Gutierrez, M. S., & Manzanares, J. (2011). Overexpression of 24(5), 659–685. CB2 cannabinoid receptors decreased vulnerability to anxiety Maccarrone, M., De Petrocellis, L., Bari, M., Fezza, F., Salvati, S., Di and impaired anxiolytic action of alprazolam in mice. Journal of Marzo, V., et al. (2001). Lipopolysaccharide downregulates fatty Psychopharmacology, 25(1), 111–120. acid amide hydrolase expression and increases anandamide Giordano, C., Siniscalco, D., Melisi, D., Luongo, L., Curcio, A., levels in human peripheral lymphocytes. Archives of Biochem- Soukupova, M., et al. (2011). The galactosylation of N(x)-nitro- istry and Biophysics, 393(2), 321–328. L-arginine enhances its anti-nocifensive or anti-allodynic effects Maier, T., Gu¨ell, M., & Serrano, L. (2009). Correlation of mRNA and by targeting glia in healthy and neuropathic mice. European protein in complex biological samples. FEBS Letters, 583(24), Journal of Pharmacology, 656(1–3), 52–62. 3966–3973. Guo, Y., Xiao, P., Lei, S., Deng, F., Xiao, G. G., Liu, Y., et al. (2008). Meyer, S., Temme, C., & Wahle, E. (2004). Messenger RNA turnover How is mRNA expression predictive for protein expression? A in eukaryotes: Pathways and enzymes. Critical Reviews in correlation study on human circulating monocytes. Acta Biochi- Biochemistry and Molecular Biology, 39(4), 197–216. mica et Biophysica Sinica (Shanghai), 40(5), 426–436. Minocci, D., Massei, J., Martino, A., Milianti, M., Piz, L., Di Bello, Gupta, S., Samra, D., & Agrawal, S. (2010). Adaptive and innate D., et al. (2011). Genetic association between bipolar disorder immune responses in autism: rationale for therapeutic use of and 524A [ C (Leu133Ile) polymorphism of CNR2 gene, intravenous immunoglobulin. Journal of Clinical Immunology, encoding for CB2 cannabinoid receptor. Journal of Affective 30, S90–S96. Disorders, 134(1–3), 427–430. Gygi, S. P., Rochon, Y., Franza, B. R., & Aebersold, R. (1999). Molloy, C. A., Morrow, A. L., Meinzen-Derr, J., Schleifer, K., Correlation between protein and mRNA abundance in yeast. Dienger, K., Manning-Courtney, P., et al. (2006). Elevated Molecular and Cellular Biology, 19(3), 1720–1730. cytokine levels in children with autism spectrum disorder. Hegde, V. L., Nagarkatti, M., & Nagarkatti, P. S. (2010). Cannabinoid Journal of Neuroimmunology, 172(1–2), 198–205. receptor activation leads to massive mobilization of myeloid- Mouslech, Z., & Valla, V. (2009). Endocannabinoid system: An derived suppressor cells with potent immunosuppressive prop- overview of its potential in current medical practice. Neuro erties. European Journal of Immunology, 40(12), 3358–33571. Endocrinology Letters, 30(2), 153–179. Ho¨gesta¨tt, E. D., Jo¨nsson, B. A., Ermund, A., Andersson, D. A., Nagarkatti, P., Pandey, R., Rieder, S. A., Hegde, V. L., & Nagarkatti, Bjo¨rk, H., Alexander, J. P., et al. (2005). Conversion of M. (2009). Cannabinoids as novel anti-inflammatory drugs. acetaminophen to the bioactive N-acylphenolamine AM404 via Future Medicinal Chemistry, 1(7), 1333–1349. fatty acid amide hydrolase-dependent arachidonic acid conjuga- Nong, L., Newton, C., Cheng, Q., Friedman, H., Roth, M. D., & tion in the nervous system. Journal of Biological Chemistry, Klein, T. W. (2002). Altered cannabinoid receptor mRNA 280(36), 31405–31412. expression in peripheral blood mononuclear cells from marijuana Ishiguro, H., Horiuchi, Y., Ishikawa, M., Koga, M., Imai, K., Suzuki, smokers. Journal of Neuroimmunology, 127(1–2), 169–176. Y., et al. (2010). Brain cannabinoid CB2 receptor in schizo- Onore, C., Enstrom, A., Krakowiak, P., Hertz-Picciotto, I., Hansen, phrenia. Biological Psychiatry, 67(10), 974–982. R., Van de Water, J., et al. (2009). Decreased cellular IL-23 but Jean-Gilles, L., Gran, B., & Constantinescu, C. S. (2010). Interaction not IL-17 production in children with autism spectrum disorders. between cytokines, cannabinoids and the nervous system. Journal of Neuroimmunology, 216(1–2), 126–129. Immunobiology, 215(8), 606–610. Pacher, P., & Mechoulam, R. (2011). Is lipid signaling through Kenny, P. J. (2011). Macrophage cannabinoid receptor goes up in cannabinoid 2 receptors part of a protective system? Progress in smoke. Nature Neuroscience, 14, 1100–1102. Lipid Research, 50(2), 193–211. Klein, T. W., & Cabral, G. A. (2006). Cannabinoid-induced immune Pascal, L. E., True, L. D., Campbell, D. S., Deutsch, E. W., Risk, M., suppression and modulation of antigen-presenting cells. Journal Coleman, I. M., et al. (2008). Correlation of mRNA and protein of Neuroimmune Pharmacology, 1(1), 50–64. levels: Cell type-specific gene expression of cluster designation Klein, T. W., Newton, C., Larsen, K., Lu, L., Perkins, I., Nong, L., antigens in the prostate. BMC Genomics, 9, 246. et al. (2003). The cannabinoid system and immune modulation. Peralta, L., Agirregoitia, E., Mendoza, R., Expo´sito, A., Casis, L., Journal of Leukocyte Biology, 74(4), 486–496. Matorras, R., et al. (2011). Expression and localization of cannab- Lamkanfi, M., Declercq, W., Kalai, M., Saelens, X., & Vandenabeele, inoid receptors in human immature oocytes and unfertilized P. (2002). Alice in caspase land. A phylogenetic analysis of metaphase-II oocytes. Reprod Biomed Online, 23(3), 372–379. caspases from worm to man. Cell Death and Differentiation, 9, Pertwee, R. G., Howlett, A. C., Abood, M. E., Alexander, S. P., Di 358–361. Marzo, V., Elphick, M. R., et al. (2010). Cannabinoid receptors Levy, S. E., Mandell, D. S., & Schultz, R. T. (2009). Autism. Lancet, and their ligands: Beyond CB1 and CB2. Pharmacological 374(9701), 1627–1638. Reviews, 62(4), 588–631. Li, X., Chauhan, A., Sheikh, A. M., Patil, S., Chauhan, V., Li, X. M., Rajagopalan, L. E., & Malter, J. S. (1997). Regulation of eukaryotic et al. (2009). Elevated immune response in the brain of autistic messenger RNA turnover. Progress in Nucleic Acid Research patients. Journal of Neuroimmunology, 207(1–2), 111–116. and Molecular Biology, 56, 257–286. Li, C., Jones, P. M., & Persaud, S. J. (2011). Role of the Robinson, S. A., Loiacono, R. E., Christopoulos, A., Sexton, P. M., & endocannabinoid system in food intake, energy homeostasis Malone, D. T. (2010). The effect of social isolation on rat brain and regulation of the endocrine pancreas. Pharmacology & expression of genes associated with endocannabinoid signaling. Therapeutics, 129(3), 307–320. Brain Research, 1343, 153–167. Lord, C., Risi, S., Lambrecht, L., Cook, E. H., Jr, Leventhal, B. L., Romero-Calvo, I., Oco´n, B., Martı´nez-Moya, P., Sua´rez, M. D., DiLavore, P. C., et al. (2000). The autism diagnostic observation Zarzuelo, A., Martı´nez-Augustin, O., et al. (2010). Reversible

123 J Autism Dev Disord (2013) 43:2686–2695 2695

Ponceau staining as a loading control alternative to actin in Suzuki, K., Matsuzaki, H., Iwata, K., Kameno, Y., Shimmura, C., Kawai, Western blots. Analytical Biochemistry, 401(2), 318–320. S., et al. (2011). Plasma cytokine profiles in subjects with high- Ross, J. (1996). Control of messenger RNA stability in higher functioning autism spectrum disorders. PLoS ONE, 6(5), e20470. eukaryotes. Trends in Genetics, 12(5), 171–175. Tanikawa, T., Kurohane, K., & Imai, Y. (2011). Regulatory effect of Schneider, M., & Koch, M. (2005). Deficient social and play behavior cannabinoid receptor agonist on chemokine-induced lymphocyte in juvenile and adult rats after neonatal cortical lesion: Effects of chemotaxis. Biological and Pharmaceutical Bulletin, 34(7), chronic pubertal cannabinoid treatment. Neuropsychopharma- 1090–1093. cology, 30(5), 944–957. Toma´nkova´, H., & Myslivecek, J. (2012). Regulation of receptors Schopler, E., Reichler, R. J., & Renner, B. R. (1993). The childhood coupled to G proteins (GPCRs). Ceskoslovenska Fysiologie, autism rating scale (CARS). Los Angeles, CA: Western 61(1), 15–23. Psychological Services. Wilusz, C. J., Wormington, M., & Peltz, S. W. (2001). The cap-to-tail Schultz, S. T. (2010). Can autism be triggered by acetaminophen guide to mRNA turnover. Nature Reviews Molecular Cell activation of the endocannabinoid system? Acta Neurobiologiae Biology, 2(4), 237–246. Experimentalis, 70(2), 227–231. Yang, M., Liu, Y., Lu, S., Wang, Z., Wang, R., Zi, Y., et al. (2013). Siniscalco, D., Sapone, A., Giordano, C., Cirillo, A., de Novellis, V., Analysis of the expression levels of survivin and VEGF in de Magistris, L., et al. (2012). The expression of caspases is patients with acute lymphoblastic leukemia. Experimental and enhanced in peripheral blood mononuclear cells of autism Therapeutic Medicine, 5(1), 305–307. spectrum disorder patients. Journal of Autism and Developmen- Zanichelli, F., Capasso, S., Cipollaro, M., Pagnotta, E., Cartenı`, M., tal Disorders, 42(7), 1403–1410. Casale, F., et al. (2012). Dose-dependent effects of R-sulfora- Soukupova´, M., Palazzo, E., De Chiaro, M., Gatta, L., Migliozzi, A. phane isothiocyanate on the biology of human mesenchymal L., Guida, F., et al. (2010). Effects of URB597, an inhibitor of stem cells, at dietary amounts, it promotes cell proliferation and fatty acid amide hydrolase (FAAH), on analgesic activity of reduces senescence and apoptosis, while at anti-cancer drug paracetamol. Neuro Endocrinology Letters, 31(4), 507–511. doses, it has a cytotoxic effect. Age (Dordr), 34(2), 281–293. Stamova, B. S., Apperson, M., Walker, W. L., Tian, Y., Xu, H., Zhu, C., Solorzano, C., Sahar, S., Realini, N., Fung, E., Sassone- Adamczy, P., et al. (2009). Identification and validation of Corsi, P., et al. (2011). Proinflammatory stimuli control N- suitable endogenous reference genes for gene expression studies acylphosphatidylethanolamine-specific phospholipase D expres- in human peripheral blood. BMC Medical Genomics, 2, 49. sion in macrophages. Molecular Pharmacology, 79(4), 786–792.

123 Copyright of Journal of Autism & Developmental Disorders is the property of Springer Science & Business Media B.V. and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use. Current Neuropharmacology, 2011, 9, 209-214 209 Consequences of Cannabinoid and Monoaminergic System Disruption in a Mouse Model of Autism Spectrum Disorders

E.S. Onaivi1,2,*, R. Benno1, T. Halpern1, M. Mehanovic1, N. Schanz1, C. Sanders1, X. Yan1, H. Ishiguro2,3, Q-R Liu4, A.L. Berzal5, M.P. Viveros5 and S.F. Ali6

1William Paterson University, Wayne, USA; 2Molecular Neurobiology Branch, National Institute on Drug Abuse, NIH, Baltimore, USA; 3Ikeda Hospital, Happoukai Medical Corporation, Ryugasaki, Japan; 4Behavioral Neurobiology Branch, National Institute on Drug Abuse, NIH, Baltimore, USA; 5Departamento de Fisiología (Fisiología Animal II), 6 Facultad de Biología, Universidad Complutense, Madrid, Spain; Neurochemistry Laboratory, NCTR/FDA, Jefferson, AR, USA

Abstract: Autism spectrum disorders (ASDs) are heterogenous neurodevelopmental disorders characterized by impair- ment in social, communication skills and stereotype behaviors. While autism may be uniquely human, there are behavioral characteristics in ASDs that can be mimicked using animal models. We used the BTBR T+tf/J mice that have been shown to exhibit autism-like behavioral phenotypes to 1). Evaluate cannabinoid-induced behavioral changes using forced swim test (FST) and spontaneous wheel running (SWR) activity and 2). Determine the behavioral and neurochemical changes after the administration of MDMA (20 mg/kg), methamphetamine (10 mg/kg) or MPTP (20 mg/kg). We found that the BTBR mice exhibited an enhanced basal spontaneous locomotor behavior in the SWR test and a reduced depressogenic profile. These responses appeared to be enhanced by the prototypic cannabinoid,
9-THC. MDMA and MPTP at the doses used did not modify SWR behavior in the BTBR mice whereas MPTP reduced SWR activity in the control CB57BL/6J mice. In the hippocampus, striatum and frontal cortex, the levels of DA and 5-HT and their metabolites were differentially altered in the BTBR and C57BL/6J mice. Our data provides a basis for further studies in evaluating the role of the cannabinoid and monoaminergic systems in the etiology of ASDs. Keywords: Cannabinoid, Monoamines,
9-THC, Psychostimulants, MPTP, Behavior, Autism, BTBR T+tf/J mice.

INTRODUCTION documented in transgenic mouse models of ASDs. Specifi- cally mouse behavioral tests modeling some of the core Autism is a behaviorally defined neurodevelopmental symptoms of autism have now been established [11]. The disorder characterized by impairments in social interaction goal of this study, was to use the mouse model to determine and communication and repetitive/stereotyped behaviors [1, the role if any of the endocannabinoid system in autism. This 2]. The cause of autism is not completely understood and was accomplished using the BTBR T+tf/J mice with autism- there is no effective cure. However, genetic and environ- like behavioral phenotypes. The behavioral, morphological mental factors and the interaction between genes and envi- and neurochemical alterations in this model will allow us to ronment are known to play a role in Autism Spectrum Disor- test our hypothesis about the causes of autism, and may serve ders (ASDs) [3-7]. A common genetic variant on chromo- as an index for the evaluation of proposed treatment strate- some 5p14.1 was shown to associate with ASDs using ge- gies in combination with other transgenic models. The ra- nome-wide association studies [6] and there are currently a tionale for this novel hypothesis arises from the discovery number of other autism susceptibility candidate genes that the endocannabinoid system is one of the most abundant (ASCG) that may be involved [7]. New thinking and hy- physiological control systems in animals and humans. This pothesis have been generated to include epigenetic mecha- system is intricately involved with embryo development and nisms in ASDs [8, 9]. This is because of the complexity of growth with limitless interaction with most biological sys- ASDs and the understanding that alteration of gene function tems including the monoaminergic systems. The endocan- could be due to a polymorphism in DNA sequence or epige- nabinoid system consists of genes that encode cannabinoid netic programming changes of genes in the interaction with receptors, endogenous ligands that activate these receptors environment without change of DNA sequences [10]. and the enzymes that synthesize, degrade and perhaps re- We recognize that the symptoms of ASDs are difficult to uptake the endocannabinoids [12]. While the endocannabi- model in rodents because of the absence of verbal communi- noid system is ubiquitous and interacts with most biological cation and the variability of symptoms. Nevertheless, a systems, the role it plays in ASDs is unknown. We recently number of relevant behavioral and social changes have been observed that the basal level of CB2A gene expression in the BTBR T+tf/J mice was upregulated in the cerebellum com- pared to control mice [13]. Therefore, we have begun studies *Address correspondence to this author at the Department of Biology, to determine the behavioral effects of cannabinoid ligands in William Paterson University Wayne, NJ 07470, USA; Tel: +1 973-720-3453; Fax: +1 973-720-2338; E-mail: [email protected] the BTBR mice in comparison to control groups.

1570-159X/11 $58.00+.00 ©2011 Bentham Science Publishers Ltd. 210 Current Neuropharmacology, 2011, Vol. 9, No. 1 Onaivi et al.

MATERIALS AND METHODS Neurochemical Analysis of Dopamine (DA) and Serotonin (5HT) and their Metabolites in Selected Brain Animals Areas Adult male and female BTBR T+tf/J, C57BL/6J and Prior to preparation of animals for selected brain region 129SI/SvImJ (S129) mouse strains were housed in individual dissection for neurochemical analysis, animals were sched- cages with access to mouse chow 12 hr in the light and 12 hr uled for three saline or three drug injections that were given in the dark. Experiments were conducted according to stan- about 8 hrs apart for one day only. Mice in the different dard NIH guidelines and approved by Institutional Animal groups were injected with saline (n = 10) or these test com- Care and Use Committee. pounds (n = 10/per group): methamphetamine (10 mg/g); Drugs MDMA (20 mg/kg) or MPTP (20 mg/kg). After the comple- 9 tion of drug or vehicle administration, mice were housed one
-THC was obtained from our collaborators in NIDA per cage for two days before the animals were sacrificed two intra-mural program and it was made up in a 1:1:18 solution days later, and the striatum, frontal cortex and hippocampus of alcohol: emulphur: saline. MDMA, methamphetamine, were dissected and frozen at -80oC. All frozen samples were and MPTP were obtained from our FDA collaborators. Ani- shipped to the FDA for the neurochemical analysis. Briefly, mals were injected intra-peritoneal (i.p) using 1.0 and 10 9 tissues from the different groups were prepared for high per- mg/kg doses of
-THC and the control animals were in- formance liquid chromatography (HPLC) combined with jected with the vehicle. The doses of MDMA (20 mg/kg), electrochemical detection to determine dopamine (DA), 3, 4- methamphetamine (10 mg/kg), MPTP (20 mg/kg) or d- dihydroxyphenylacetic acid (DOPAC), homovanillic acid amphetamine (5 mg/kg) were used. In all experiments all (HVA), serotonin (5HT) and 5-hydroxyindole acetic acid drugs were injected in a volume of 1ml/kg. (5HIAA). EXPERIMENTAL PROCEDURE CANNABINOID GENOMIC ANALYSIS IN BTBR Motor Function Test MICE Spontaneous wheel running monitors were used to access In a previous study Liu et al., 2009, [13], during the motor activity and function. The standard wheel running analysis of CB2-R gene expression in different brain regions activity monitors measures the counts per revolution and was of C57BL/6 mice treated with the mixed cannabinoid agonist used to access the spontaneous wheel running behavior of WIN55212-2 (2mg/kg) for 7 days, we also analyzed CB2- naïve mice and following acute treatment with the test com- gene expression in non-injected BTBR mice. This was ac- pounds and corresponding vehicle used. The wheel running complished by the analysis of CB2A and CB2B gene expres- activity of the animals were monitored by the auto-counters, sion in brain regions, testis and the spleen. Briefly, RNA was for 10 minutes during the assessment of spontaneous wheel isolated using TRIzol reagent and cDNA synthesized using running activity following specific drug pretreatment times. SuperScript III first strand synthesis system for RT-PCR Data was obtained as total number of revolutions over the 10 (Invitrogen, Carlsbad, CA). The expression of CB2A and min evaluation period. The performance of the animals fol- CB2B genes were compared by TaqMan real-time PCR with lowing the acute administration of the test compounds to the an ABI PRISM 7900 HT Sequence Detection System, using mouse strains were compared to their respective vehicle custom designed Fam-labeled MGB probes and primers for treated controls. CB2A and CB2B (Applied Biosystems, Foster City, CA). The custom-designed mouse beta-actin Fam-labeled MGB Forced Swim Test probe was used for normalization [13]. The forced swim test (FST) paradigm was used. It con- Statistical Analysis sists of a glass cylinder (16 cm diameter and height 35 cm) filled to a depth 15 cm with water (23-25oC). One glass cyl- Prism-3 program, version 3.02 (Graphpad Software, Inc., inder was used for each mouse and we tested six mice at a San Diego, CA, USA) was used for statistical analyses, in- time using six glass cylinders and test observers. In this cluding t-tests and analysis of variance (ANOVA). Data study a two-day swim test procedure was utilized first to from motor function and forced swim tests were subjected to access the basal performance of the different mouse strains. analysis of variance for multiple comparisons followed by On the first day mice were placed in the glass cylinder with Turkey’s test where appropriate. For CB1 and CB2 gene water to the specified depth, and all animals were exposed expression analysis, unpaired t-test was used. The accepted for 15-min pre-swim test prior to the 5-min forced swim test level of significance is P < 0.05. on day 2. Fresh water was introduced prior to each test. The test sessions were recorded by trained observers for consis- RESULTS tent data recording. The observer used stop watches and Effects of
9-THC, Psychostimulants and Disruption of counters to record immobility times and counts respectively. Monoaminergic System by MPTP on Motor Activity in The data recorded during the 5-min test session were the the Mouse Model of ASD times the animals were immobile and also the number of immobility counts during the test session. Similar data was The naïve untreated BTBR mice exhibited an enhanced obtained for the vehicle treated naïve control animals. Dur- basal locomotor activity as recorded in the spontaneous ing the test session the duration of immobility was defined wheel running test. The BTBR males had slightly higher by the animal’s stationary position, and only made the mini- activity than the females and the motor activity of the males mal movements necessary to keep the head above water. of the C57BL/6J were significantly lower (p<0.05, N = 10) Consequences of Cannabinoid and Monoaminergic System Disruption Current Neuropharmacology, 2011, Vol. 9, No. 1 211 than the activity of the BTBR males as shown in Fig. (1A). those of the BTBR mice after treatment with the dopaminer- The effects of d-amphetamine treatment in the three mouse gic neurotoxin MPTP as shown in Fig. (1C). However, the strains varied, with the S129 mouse showing significant lo- motor activity of BTBR mice when compared to those of comotor activation compared to both BTBR and C57BL/6J C57BL/6J and S129 mice were significantly reduced and mice as shown in Fig. (1B). A similar response of male and more sensitive to the higher dose of 10 mg/kg
9-THC used female mice in motor activity was recorded following the in this study as shown in Fig. (2C). At the doses used in this acute treatment of BTBR and C57BL/6J, with metham- study
9-THC actually enhanced motor activity in the phetamine and MDMA (Fig. (1C)). The motor activity of C57BL/6J and S129 mice which were the control back- C57BL/6J male mice was significantly reduced compared to ground mice for the BTBR animals.

A 100 80

60 *

40

20 SWR Activity SWR min Counts/10

0 MMFF BTBR C57BL/6J

B

C 80 80 Control Meth MDMA MPTP Control Meth MDMA MPTP 70 70 60 60 ¶ 50 50 40 40 ¶ ¶ 30 30 * 20 20

SWR Activity SWR Counts/10 min 10 10 0 0 MFFFMMM F MFFFMMMF BTBR C57BL/6J

Fig. (1). The effects of psychostimulants (d-amphetamine, Methamphetamine and MDMA), and disruption of monoaminergic system by the neurotoxin (MPTP), in a mouse model of autism spectrum disorders. Panel A shows the basal motor activity of male and female BTBR and C57BL/J mice in the spontaneous wheel running (SWR) monitors; panel B is the effect of acute 10 min treatment with d-amphetamine (5.0 mg/kg) on the performance of male BTBR and the male controls, S129 and C57BL/6J mice. Panel C shows the effects of acute administra- tion of methamphetamine (10 mg/kg), MDMA (20.0 mg/kg) and MPTP (20 mg/kg) in both male and female BTBR and C57BL/6J mice in comparison to their respective controls. The duration of the wheel running behavior was accessed over a 10 min period in all animals tested. * or ¶ represents statistical significance at p<0.05 as compared to the same gender. 212 Current Neuropharmacology, 2011, Vol. 9, No. 1 Onaivi et al.

Behavioral Effects of BTBR, C57BL/6J and S129 methamphetamine, MDMA and MPTP. Data on striatal DA Mice in the Forced Swim Test after Treatment with a and 5HT levels and frontal cortex 5HT levels are presented Cannabinoid,
9-THC: in Fig. (3). In this preliminary neurochemical analysis of DA, 5HT and their metabolite levels in the striatum, frontal The naïve BTBR mice demonstrated reduced immobility cortex and hippocampus after the drug treatments, the levels time and increased immobility count when compared to of these monoamines and their metabolites were differen- C57BL/6J and S129 mice in the FST, as shown in Fig. (2A). tially altered in the BTBR and C57BL/6J mice used, see Fig. Surprisingly, in the FST,
9-THC at the doses used did not (3). The variable levels of monoamines made it difficult to modify the immobility time and counts of the BTBR mice define a specific association of these changes with the under- when compared to the C57BL/6J and S129 mice as shown in lying features in the mouse model of ASDs. There are how- Fig. (2B). ever some striking observations that can be gleaned from the Neurochemical Determination of DA and 5HT Levels effects of the doses used in drug treatments and the analyzed and their Metabolites after Treatment with comparative striatal data between BTBR and C57BL/6J Methamphetamine, MDMA and MPTP mice: Methamphetamine lowered BTBR DA levels relative to controls with no effect on C57BL/6J DA levels whereas The levels of dopamine, serotonin and their metabolites MPTP had no effect on DA levels in BTBR mice relative to were analyzed in the striatum, frontal cortex and the hippo- their controls, but lowered C57BL/6J DA levels. On the campus after the treatment of different strains of mice with other hand MDMA had little on no significant effect on ei-

Fig. (2). Behavioral effects of BTBR, C57BL/6J and S129 mouse strains in the FST. Panel A shows the basal levels of performance indicated by the time and number of immobility by the three mouse strains in the forced swim test model. Panel B is time and number of immobility after acute treatment of the mouse strains with
9-THC (1 and 10 mg/kg) in comparison to vehicle treated controls. Panel C shows the influence of acute treatment of the mouse strains with
9-THC (1 and 10 mg/kg) in the spontaneous wheel running activity monitors. * or + represents statistical significance at p<0.05 with strains and drug treatment in the behavioral measures. Consequences of Cannabinoid and Monoaminergic System Disruption Current Neuropharmacology, 2011, Vol. 9, No. 1 213 ther BTBR or C57BL/6J DA levels in comparison to their cannabinoids. This upregulation occurred usually only after respective controls. sub-acute treatment with a mixed cannabinoid agonist, WIN55212-2 in the C57BL/6J mice [13]. However, no sig-

nificant changes were observed in other brain regions includ- ing frontal cortex and striatum - brain areas evaluated in the current study and the hypothalamus (data not shown). The expression level of CB2B in the mouse brain is lower than CB2A and the mRNA levels could not be reliably measured by TaqMan assay (data not shown).

DISCUSSION While autism may be uniquely human, we have investi- gated the consequences of cannabinoid and monoaminergic system disruption in the BTBR T+tf/J mice that have been shown to exhibit autism-like behavioral phenotypes. We report that the BTBR mice exhibited an enhanced basal spontaneous locomotor behavior in the spontaneous wheel running (SWR) test, a measure of locomotor activity, that was reduced by the prototypic cannabinoid,
9-THC. In ad- dition, this enhanced spontaneous wheel running behavior was sexually dimorphic as the motor activity in the naïve male BTBR mice was significantly higher than those of the naïve male C57BL/6J mice without significant alteration in the female mice. Furthermore, the doses of the psychostimu- lants, d-amphetamine, methamphetamine and MDMA used in this study did not modify the SWR behavior in the BTBR mice whereas MPTP reduced SWR activity in the control CB57BL/6J mice. One characteristic of ASDs is stereotype behavior characterized by high levels of repetitive self- grooming behavior that has recently been shown to be re- duced in the BTBR mice by methyl-6-phenylethynl-pyridine (MPEP) – an mGluR5 antagonist [14]. It is tempting to sug- 9 gest the evaluation of
-THC or other cannabinoids with reduced psychoactivity in irritability, tantrums and self- injurious behavior associated with autistic individuals. This is because at the low doses used in this study, only the BTBR mice were sensitive to motor depressant effects of
9- THC when compared to those of C57BL/6J and S129 mice. This hypothesis is further supported by our data showing that the BTBR mice were also insensitive to the locomotor Fig. (3). Neurochemical analysis of dopamine (DA) and serotonin activation induced by psychostimulants and the neurotoxic (5HT) levels in striatum and frontal cortex in BTBR and C57BL/6J effects of MPTP when compared to those of C57BL/6J and male and female mice following a single day three times admini- S129 mice. stration of either saline, methamphetamine (10 mg/kg), MDMA (20 mg/kg) or MPTP (20 mg/kg). Regional brain areas were dissected 2 An unusual behavioral phenotype characterized by exag- days later. Since there were no significant sex differences the data gerated responses to stress in the BTBR mouse has been was collapsed on the variable sex. Panel A is the striatal dopamine demonstrated [15]. The study showed that the BTBR mice had level in BTBR relative to C57BL/6J mice. Panel B is the frontal increased levels of the stress hormone corticosterone follow- cortex dopamine level in the two strains of mice. Panel C is the ing tail suspension, and a heightened anxiety response in the striatal serotonin level. *Represents statistical significance at plus-maze test, when compared to C57BL/6J mice [15]. In p<0.05 using a least squares means analysis. Significance tests were our current study, there were marked strain differences in performed between the two strains of mice for each of the treat- immobility times and counts in the FST model of depression ments independently. and BTBR mice displayed a reduced immobility time and an enhanced immobility count compared to the control Cannabinoid CB2A Gene Expression is Upregulated in C57BL/6J and S129 mice. Curiously however,
9-THC at BTBR Mice the doses used in this study did not modify the immobility We have previously shown that naive BTBR mice time and counts in BTBR mice when compared to the that have been reported to have autism-like behavioral phe- C57BL/6J and S129 mice whose immobility times and counts 9 notypes have an upregulated higher levels of CB2A gene were differentially modified dose dependently by
-THC. expression in the cerebellum without treatment with 214 Current Neuropharmacology, 2011, Vol. 9, No. 1 Onaivi et al.

The cause of autism is unknown, but there has been much [3] Robinson, P.D., Schutz, C.K., Macciardi, F., White, B.N., Holden, progress and new knowledge with the environment, epige- J.A. Genetically determined low maternal serum dopamine b- hydroxylase levels and etiology of autism spectrum disorders. Am. netics and genetic factors all playing some role in the etiol- J. Med. Genet., 2001, 100, 30-36. ogy of ASDs. For example multiple gene variants and ge- [4] Yrigollen, C.M., Han, S.S., Kochetkova, A., Babitz, B., Chang, nome-wide copy number variations have been reported in J.T., Volkmar, F.R., Leckman, J.F., Grogorenko, E.L. Genes con- children with ASDs, but not in healthy controls [16]. Data trolling affiliative behavior as candidate genes for autism. Biol. Psychiatry., 2008, 63, 911-916. from comparative genomics of autism and schizophrenia [5] Page, D.T., Kuti, O.J., Prestia, C., Sur, M. Haploinsufficiency for support the hypothesis that autism and schizophrenia repre- pten and serotonin transporter cooperatively influences brain size and sent diametric conditions with regard to their genomic un- social behavior. Proc. Natl. Acad. Sci. USA, 2009, 106, 1989-1994. derpinnings and phenotypic manifestations [16]. Our data [6] Wang, K., Zhang, H., Ma, D., Bucan, M, Glessner, J.T., Abrahams, B.S., Salyakina, D., Imielinski, M., Bradfield, J.P., Sleiman, indicating that the BTBR mice have an abnormal regulation P.M.A, Kim, C.E., Hou, C., Frackelton, E. Hakonarson, H. Com- of DA functioning with an upregulated CB2A gene expres- mon genetic variants on 5p14.1 associate with autism spectrum sion in naïve BTBR mouse of ASDs [13], and our finding disorders. Nature, 2009, 459, 528-533. indicating an increased risk of schizophrenia in patients with [7] Bill, B.R., Geschwind, D.H. Genetic advances in autism: heteroge- neity and convergence on shared pathways. Curr. Opin. Genet. low CB2 receptor function [17], is in agreement with the Dev., 2009, 19, 271-278. hypothesis that autism and schizophrenia represent diametric [8] Mehler, M.F., Purpra, D.P. Autism, fever, epigenetics and the locus conditions [16]. Moreover, more research needs to be done coerulus. Brain Res. Rev., 2008, 59, 388-392. to understand the nature of the neurochemical changes re- [9] Jones, J.R., Skinner, C., Friez, M.J., Schwartz, C.E., Stevenson, R.E. Hypothesis: Dysregulation of methylation of brain expressed corded in our preliminary study in the hippocampus, striatum genes on the X chromosome and autism spectrum disorders. Am. J. and frontal cortex, where the levels of DA and 5-HT and Med. Genet. Part A., 2008, 146A, 2213-2220. their metabolites were differentially altered in the BTBR and [10] Szyf, M. Epigenetics, DNA methylation, and chromatin modifying C57BL/6J mice. Thus our data provides a basis for further drugs. Annu. Rev. Pharmacol. Toxicol., 2009, . 49, 243-263. [11] Crawley, J.N. Mouse behavioral assays relevant to the symptoms of studies in evaluating the role of the cannabinoid and mono- autism. Brain Pathol., 2007, 17, 448-459. aminergic systems in the etiology of ASDs and whether the [12] Onaivi, E.S. Cannabinoid receptors in brain: pharmacogenetics, BTBR mice can model both schizophrenia and ASDs. neuropharmacology, neurotoxicology, and potential therapeutic applications. Int. Rev. Neurobiol., 2009, 88, 335-369. ACKNOWLEDGEMENTS [13] Liu, Q.R., Pan, C.H., Hishimoto, A., Li, C.Y., Xi, Z.X, Llorente- Berzal, A., Viveros, M.P., Ishiguro, H., Arinami, T., Onaivi, E.S., ESO acknowledges financial support from William Uhl, G.R. Species differences in cannabinoid receptor 2 (CNR2 Paterson University center for research, the Dean, Dr. Sandra gene): identification of novel human and rodent CB2 isoforms, dif- ferential tissue expression and regulation by cannabinoid receptor DeYoung for continued student worker support and the Pro- ligands. Gene Brain Behav., 2009, 8, 519-530. vost office for release time. ESO acknowledges Guest Scien- [14] Silverman, J.L., Tolu, S.S., Barkan, C.L., Crawley, J.N. Repetitive tist support at NIDA-NIH. QRL is supported by NIDA-NIH. Self-Grooming Behavior in the BTBR Mouse Model of Autism is ALB and MPV acknowledges support from Red de Trastor- Blocked by the mGluR5 Antagonist MPEP. Neuropsychopharma- cology, 2009, 1-14. (Online ahead of print). nos adictivos RD06/0001/1013; GRUPOS UCM-BSCH: [15] Benno, R., Smirnova, Y., Vera, S., Liggett, A., Schanz, N. Exag- 951579; Plan Nacional sobre Drogas, Ministerio de Sanidad gerated responses to stress in the BTBR T+tf/J mouse: An unusual y Política Social 2010-2012. Ref.: PR10/09-16583 behavioral phenotype. Behav. Brain Res., 2009, 197, 462-465. [16] Crespi, B., Stead, P., Elliot, M. Comparative genomics of autism REFERENCES and schizophrenia. Proc. Natl. Acad. Sci. USA, 2009, 1-6. Online ahead of print). [1] King, B.H., Bostic, J.Q. An update on pharmacologic treatments [17] Ishiguro, H., Horiuchi, Y., Ishikawa, M., Koga, M., Imai, K., Su- for autism spectrum disorders. Child Adolesc. Psychiatr. Clin. N. zuki, Y., Morikawa, M., Inada, T., Watanabe, Y., Takahashi, M., Am., 2006, 15, 161-175. Someya, T., Ujike, H., Iwata, N., Ozaki, N., Onaivi, E.S, Kunugi, [2] Nickels, K.C., Katusic, S.K., Colligan, R.C., Weaver, M.S., Voigt, H., Sasaki, T., Itokawa, M., Arai, M., Niizato, K., Iritani, S., Naka, R.G., Barbaresi, W. J. Stimulant medication treatment of target I., Ohashi, J., Kakita, A., Takahashi, H., Nawa, H., Arinami, T. behaviors in children with autism: A population-based study. J. Brain cannabinoid CB2 receptor in schizophrenia. Biol. Psychiatry, Dev. Behav. Pediatr., 2008, 29, 75-81. 2010, 67, 974-982.

Received: October 01, 2009 Revised: April 17, 2010 Accepted: May 26, 2010

Review Acta Neurobiol Exp 2010, 70: 227–231

Can autism be triggered by acetaminophen activation of the endocannabinoid system?

Stephen T. Schultz

Rosalind Franklin University of Medicine and Science, North Chicago, IL, USA Email: [email protected]

Acetaminophen use in children has been associated with increased autism risk. Recent evidence suggests that acetaminophen’s analgesic actions result from activation of the endocannabinoid system, and activation of this system can have neuromodulatory consequences during development. This investigation was performed to determine if there is evidence to support the hypothesis that acetaminophen use can trigger autism by activation of the endocannabinoid system. Key words: autistic disorder, autism, acetaminophen, cannabinoid receptors, endocannabinoid system

INTRODUCTION nations, mercury exposure, and viral infections. Descriptive clinical studies have suggested a link Autism is a severe developmental disorder defined by between measles, mumps, rubella (MMR) vaccination social and communication deficits and ritualistic-repeti- and autism/pervasive developmental disorder tive behaviors that appear in early childhood (American (Kawashima et al. 2000, Wakefield et al. 2000, Furlano Psychiatric Association 1994). Autism can be comorbid et al. 2001, Singh et al. 2002, Uhlman et al. 2002, with tuberous sclerosis (1.2%), fragile X syndrome Singh and Jensen 2003). Epidemiological studies have (0.3%), and congenital rubella syndrome (0.3%), although not supported the relationship between prevalence of the attributable proportion of all medical disorders is autism and the MMR vaccine (Peltola et al. 1998, less than 10%, and in most cases the cause of autism is Taylor et al. 1999, Dales et al. 2001, Madsen et al. unknown (Fombonne 2003). Two of the prominent fea- 2002, Chen et al. 2004). tures of autism are immune system dysregulation The link between the MMR vaccine and an elevated (Pessah et al. 2008) and abnormal brain neuron organi- risk for autism is controversial. However, children are zation (Courchesne et al. 2007). In this report we present often given acetaminophen if they have symptoms evidence of a link to autism from acetaminophen use, such as fever or irritability, and the MMR vaccination evidence to show that acetaminophen produces analge- can cause these symptoms (Centers for Disease Control sia by activating cannabinoid receptors, and evidence and Prevention 2009). One study showed that adminis- that activation of the cannabinoid receptors may inter- tration of acetaminophen after the MMR vaccination fere with normal development to trigger autism. is associated with increased risk for autism (Schultz et al. 2008). A link to autism from A further report compared the features of autism acetaminophen use with asthma and suggested a link to acetaminophen use (Becker and Schultz 2009). In this report, events in There are several theories about possible environ- the history of acetaminophen use were compared with mental triggers for autism including childhood vacci- the number of eligible persons with autism from a 1999 report to the legislature by the California DDS Correspondence should be addressed to S.T. Schultz (Department of Developmental Services 1999). Email: [email protected] The three pathways for the metabolism of acet- Received 21 October 2009, accepted 08 March 2010 aminophen are glucuronidation, sulfation, and the

© 2010 by Polish Neuroscience Society - PTBUN, Nencki Institute of Experimental Biology 228 S.T. Schultz cytochrome P-450 system. One study of children with may produce persistent alterations in brain structure autism indicated that these children had a sulfation and cognition (Jager and Ramsey 2008). Animal mod- deficit which causes them to process acetaminophen els have revealed the danger of both cannabis abuse and differently from control children (Alberti et al. 1999). exposure to cannabinoid drugs during brain develop- Sulfation is the primary pathway for acetaminophen ment (Anavi-Goffer and Mulder 2009). Developmental metabolism until age 10–12 years (Defendi and Tucker problems associated with the endocannabinoid system 2009). It is possible that children predisposed to devel- may occur through either of the two known cannabi- oping autism have a sulfation deficit which may lead to noid receptors, CB1 or CB2. increased blood levels of acetaminophen after thera- CB1 receptors are located in the central nervous sys- peutic doses of acetaminophen are administered. tem (CNS), peripheral nervous system, and peripheral

organs. In the CNS, CB1 receptors are concentrated in Evidence that acetaminophen the cerebellum, hippocampus, and the basal ganglia produces analgesia by activating (Drysdale and Platt 2003) which are areas in the brain cannabinoid receptors implicated as dysfunctional in autism (Bauman and Kemper 2005, Courchesne et al. 2007). During fetal

Although acetaminophen has been used as an anal- life, CB1 receptors and their associated endocannabi- gesic for more than a hundred years, its mechanism of noids are important for neuron differentiation and action has remained elusive. It has recently been shown proper axonal migration (Fride et al. 2009). In addition, by two independent groups (Hogestatt et al. 2005, recent studies suggest that CB1 cannabinoid receptors Bertolini et al. 2006) that acetaminophen produces define synapse positioning (Harkany et al. 2008). analgesia by potentiating cannabinoid receptors in the Modulation of CB1 cannabinoid receptors could trigger brain. These observations have been confirmed by autism by interrupting normal brain development.

Mallet and colleagues (2008). CB2 receptors are primarily located in immune tis- Hogestatt and colleagues have shown that acetamin- sues and cells and may serve a regulatory function. ophen is deacetylated to p-aminophenol which is con- CB2 receptors have been shown to control the move- jugated with arachidonic acid in the brain and spinal ment of inflammatory cells to the site of injury, and cord by fatty acid amide hydrolase (FAAH). The result- CB2 receptors’ reverse agonists may serve as immune ing compound, N-arachidonoylphenolamine inhibits system modulators (Lunn et al. 2008). The activation the cellular uptake of anandamide, a naturally occur- of CB2 receptors stimulate beta-amyloid removal by ring endogenous cannabinoid or endocannabinoid. The macrophages which may slow the progression of result is increased levels of endocannabinoids which Alzheimer’s Disease (Tolon et al. 2009). CB2 receptor produce an analgesic effect (Hogestatt et al. 2005). agonists attenuate transendothelial migration of mono- Bertolini and colleagues (2006) noticed a similarity cytes and monocyte-endothelial adhesion (Rajesh et in the effect of acetaminophen and cannabinoids. al. 2007). Cannabinoids and acetaminophen both have an anal- Monocytes are one of the primary cells of the gesic action and lower body temperature. They were immune system and differentiate into macrophages and able to show that blockage of cannabinoid receptor 1 dendritic cells. If the evidence is correct that acetamin-

(CB1) completely prevents the analgesic activity of ophen acts as an activator of cannabinoid receptors, acetaminophen (Bertolini et al. 2006). then activating CB2 receptors could influence the growth of monocytes. Data from our lab indicates that Evidence that modulation of the acetaminophen in the media inhibits the cell division of cannabinoid system may interfere monocytes in a dose dependent manner as assayed with with normal development resazurin stain for mitochondrial dehydrogenase activ- ity. Inhibition of growth is noted even at the therapeutic The endocannabinoid system plays an important role concentration of 20 micrograms per milliliter. If as in the development of the central nervous system and proposed, children with autism are poor metabolizers its activation can induce long-lasting functional altera- of acetaminophen, higher than normal therapeutic lev- tions (Campolongo et al. 2009). Use of cannabis (an els could be possible with recommended doses which exogenous cannabinoid) in the still-maturing brain could lead to a greater inhibition of monocytes. Autism and the endocannabinoid system 229

It has been shown in several studies that children associated with autism (Schultz et al. 2006). This same with autism have immune system dysregulation (Warren study found an association between use of infant for- et al. 1996, Jyonouchi et al. 2005, Ashwood et al. 2006, mula without docosahexaenoic acid or arachidonic Molloy et al. 2006, Li et al. 2009, Entstrom et al. 2010). acid supplementation and autism. Arachidonic acid This dysregulation includes differential monocyte metabolism is an integral part of the endocannabinoid responses, abnormal T helper cytokine levels, decreased system and its disruption could be further evidence of T cell mitogen response, decreased numbers of lympho- a role for the endocannabinoid system in autism. cytes, and abnormal serum immunoglobulin levels. Many studies have shown that children with autism CONCLUSION exhibit autoimmunity, in particular antibodies against brain and central nervous system proteins (Singh et al. The purpose of this report was to explore a possible 1993, Connolly et al. 1999, Ashwood and Van De Water correlation between acetaminophen and autism which 2004, Cohly and Panja 2005, Kawashti et al. 2006, acts through activation of the cannabinoid system. If Wills et al. 2007, Martin et al. 2008). It is proposed that this hypothesis is correct, it opens new avenues of the immune dysregulation in children with autism is investigation for possible autism treatment including due to the influence of acetaminophen on CB2 receptors agonists and antagonists of the CB1 and CB2 receptors. during gestation or in early childhood. ACKNOWLEDGMENT HYPOTHESIS The views expressed in this article are those of the The hypothesis presented here is that the use of author and do not reflect the official policy or position acetaminophen may trigger autism by activating the of the Department of the Navy, Department of Defense, endocannabinoid system thereby interfering with nor- or the United States Government. mal development. Children who are poor metabolizers of acetaminophen may be at higher risk since normal REFERENCES therapeutic doses may lead to higher blood levels in these children. Alberti A, Pirrone P, Elia M, Waring RH, Romano C (1999) It has been proposed that the blockage of fever with Sulphation deficit in “low-functioning” autistic children: antipyretics (as acetaminophen) could lead to autism a pilot study. Biol Psychiatry 46: 420–424. by interfering with normal immunologic development American Psychiatric Association (1994) Diagnostic and (Torres 2003). Children with autism have reported to Statistical Manual of Mental Disorders (4th ed.). American have a decrease in autism symptoms when they have a Psychiatric Association, Washington, DC. fever (Sullivan 1980, Cotterill 1985, Torres 2003, Anavi-Goffer S, Mulder J (2009) The polarized life of the Curran et al. 2007). It is interesting to note that activa- endocannabinoid system in CNS development. tion of CB1 receptors, in addition to providing an anal- Chembiochem 10: 1591–1598. gesic effect, causes a decrease in body temperature Ashwood P, Van de Water J (2004) Is autism an autoimmune (Fraga et al. 2009). This type of effect may be further disease? Autoimmun Rev 3: 557–562. evidence of endocannabinoid disruption in children Ashwood P, Wills S, Van de Water J (2006) The immune with autism. response in autism: a new frontier for autism research. J Leukoc Biol 80: 1–15. LIMITATIONS Bauman ML, Kemper TL (2005) Neuroanatomic observa- tions of the brain in autism: a review and future direc- Other environmental factors may also be involved tions. Int J Dev Neurosci 23: 183–187. in triggering autism. For example, low levels of breast- Becker KG, Schultz ST (2009) Similarities in features of feeding could decrease immune protection in infants autism and asthma and a possible link to acetaminophen by decreasing mother to child transfer of IgA. Decreased use. Med Hypotheses 74: 7–11. immune protection could make a child more vulnera- Bertolini A, Ferrari A, Ottani A, Guerzoni S, Tacchi R, ble to viral infection which in theory could lead to Leone S (2006) Paracetamol: new vistas of an old drug. autism. Lack of breastfeeding has been shown to be CNS Drug Rev 12: 250–275. 230 S.T. Schultz

Campolongo P, Trezza V, Palmery M, Trabace L, Cuomo V Fraga D, Zanoni CI, Rae GA, Prada CA, Souza GE (2009) (2009) Developmental exposure to cannabinoids causes Endogenous cannabinoids induce fever through the acti- subtle and enduring neurofunctional alterations. Int Rev vation of CB1 receptors. Br J Pharmacol 157: 1494– Neurobiol 85: 117–133. 1501. Centers for Disease Control and Prevention (2009) Fride E, Gobshtis FE, Dahan H, Weller A, Giuffrida A, Ben- Epidemiology and Prevention of Vaccine-Preventible Shabat S (2009) The endocannabinoid system during Diseases (11th ed.). Centers for Disease Control and development: emphasis on Perinatal events and delayed Prevention, Atlanta, GA. effects. Vitam Horm 81: 139–158. Chen W, Landau S, Sham P, Fombonne E (2004) No evi- Furlano RI, Anthony A, Day R, Brown A, McGarvey L, dence for links between autism, MMR and measles virus. Thomson MA, Davies SE, Berelowitz M, Forbes A, Psychol Med 34: 543–553. Wakefield AJ, Walker-Smith JA, Murch SH (2001) Cohly HH, Panja A (2005) Immunological findings in Colonic CD8 and gamma delta T-cell infiltration with autism. Int Rev Neurobiol 71: 317–341. epithelial damage in children with autism. J Pediatr 138: Connolly AM, Chez MG, Pestronk A, Arnold ST, Mehta S, 366–372. Deuel RK (1999) Serum autoantibodies to brain in Harkany T, Mackie K, Doherty P (2008) Wiring and firing Landau-Kleffner variant, autism, and other neurologic neuronal networks: endocannabinoids take center stage. disorders. J Pediatr 134: 607–613. Cur Opin Neurobiol 18: 338–345. Cotterill RM (1985) Fever in autistics. Nature 313: 426. Högestätt ED, Jönsson BA, Ermund A, Andersson DA, Courchesne E, Pierce K, Schumann CM, Redcay E, Björk H, Alexander JP, Cravatt BF, Basbaum AI, Zygmunt Buckwalter JA, Kennedy DP, Morgan J (2007) Mapping PM (2005) Conversion of acetaminophen to the bioactive early brain development in autism. Neuron 56: 399–413. N-acylphenolamine AM404 via fatty acid amide hydro- Curran LK, Newschaffer CJ, Lee LC, Crawford SO, Johnston lase-dependent arachidonic acid conjugation in the ner- MV, Zimmerman AW (2007) Behaviors associated with vous system. J Biol Chem 280: 31405–31412. fever in children with autism spectrum disorders. Jager G, Ramsey NF (2008) Long-term consequences of Pediatrics 120: e1386–1392. adolescent cannabis exposure on the development of cog- Defendi GL, Tucker JR (2009) Overview: toxicity, acet- nition, brain structure and function: an overview of animal aminophen. [Available at: http://emedicine.medscape. and human research. Curr Drug Abuse Rev 1: 114–123. com/article/1008683-overview; accessed March 8, 2010]. Jyonouchi H, Geng L, Ruby A, Zimmerman-Bier B (2005) Dales L, Hammer SJ, Smith NJ (2001) Time trends in autism Dysregulated innate immune responses in young children and MMR immunization coverage in California. JAMA with autism spectrum disorders: their relationship to gas- 285: 1183–1185. trointestinal symptoms and dietary intervention. Department of Developmental Services, California Health Neuropsychobiology 51: 77–85. and Human Services Agency (1999) Changes in the Kawashima H, Mori T, Kashiwagi Y, Takekuma K, Hoshika population of persons with autism and pervasive develop- A, Wakefield A (2000) Detection and sequencing of mental disorders in California’s Developmental Services measles virus from peripheral mononuclear cells from System: 1987 through 1998. A Report to the Legislature patients with inflammatory bowel disease and autism. March 1, 1999. California Health and Human Services Dig Dis Sci 45: 723–729. Agency, Sacramento, CA. [Available at: http://www.dds. Kawashti MI, Amin OR, Rowehy NG (2006) Possible ca.gov/Autism/docs/autism_report_1999.pdf]. immunological disorders in autism: concomitant autoim- Drysdale AJ, Platt B (2003) Cannabinoids: mechanisms and munity and immune tolerance. Egypt J Immunol 13: therapeutic applications in the CNS. Curr Med Chem 10: 99–104. 2719–2732. Li X, Chauhan A, Sheikh AM, Patil S, Chauhan V, Li XM, Entstrom AM, Onore CE, Van de Water JA, Ashwood P Ji L, Brown T, Malik M (2009) Elevated immune (2010) Differential monocyte responses to TLR ligands in response in the brain of autistic patients. J Neuroimmun children with autism spectrum disorders. Brain Behav 207: 111–116. Immun 24: 64–71. Lunn CA, Reich E-P, Fine JS, Lavey B, Kozlowski JA, Fombonne E (2003) Epidemiological surveys of autism and Hipkin RW, Lundell DJ, Bober L (2008) Biology and other pervasive developmental disorders: an update. J therapeutic potential of cannabinoid CB2 receptor inverse Autism Dev Disord 33: 365–382. agonists. Br J Pharmacol 153: 226–239. Autism and the endocannabinoid system 231

Madsen KM, Hviid A, Vestergaard M, Schendel D, Wohlfahrt Singh VK, Warren RP, Odell JD, Warren WL, Cole P J, Thorsen P, Olsen J, Melbye M (2002) A population- (1993) Antibodies to myelin basic protein in children based study of measles, mumps, and rubella vaccination with autistic behavior. Brain Behav Immun 7: and autism. N Engl J Med 347: 1477–1482. 97–103. Mallet C, Daulhac L, Bonnefont J, Ledent C, Etienne M, Singh VK, Lin SX, Newell E, Nelson C (2002) Abnormal Chapuy E, Libert F, Eschalier A (2008) Endocannabinoid measles-mumps-rubella antibodies and CNS autoim- and serotonergic systems are needed for acetaminophen- munity in children with autism. J Biomed Sci 9: 359– induced analgesia. Pain 139: 190–200. 364. Martin LA, Ashwood P, Braunschweig D, Cabanlit M, Van Singh VK, Jensen RL (2003) Elevated levels of measles anti- de Water J, Amaral DG (2008) Stereotypies and hyperac- bodies in children with autism. Pediatr Neurol 28: 292–294. tivity in rhesus monkeys exposed to IgG from mothers of Sullivan RC (1980) Why do autistic children...? J Autism children with autism. Brain Behav Immun 22: 806–816. Dev Disord 10: 231–241. Molloy CA, Morrow AL, Meinzen-Derr J, Schleifer K, Taylor B, Miller E, Farrington P, Petropoulos MC, Favot- Dienger K, Manning-Courtney P, Altaye M, Wills-Karp M Mayaud I, Li J, Waight PA (1999) Autism and measles, (2006) Elevated cytokine levels in children with autism mumps, and rubella vaccine: no epidemiological evi- spectrum disorder. J Neuroimmunol 172: 198–205. dence for a causal association. Lancet 353: 2026–2029. Peltola H, Patja A, Leinikki P, Valle M, Davidkin I, Paunio Tolon RM, Nunez E, Pazos MR, Benito C, Castillo AI, M (1998) No evidence for measles, mumps, and rubella Martínez-Orgado JA, Romero J (2009) The activation of vaccine-associated inflammatory bowel disease or autism cannabinoid CB2 receptors stimulates in situ and in vitro in a 14-year prospective study. Lancet 351: 1327–1328. beta-amyloid removal by human macrophages. Brain Res Pessah IN, Seegal RF, Lein PJ, LaSalle J, Yee BK, Van De 1283: 148–154. Water J, Berman RF (2008) Immunologic and neurode- Torres AR (2003) Is fever suppression involved in the etiol- velopmental susceptibilities of autism. Neurotoxicology ogy of autism and neurodevelopmental disorders? BMC 29: 532–545. Pediatrics 3: 9. Rajesh M, Mukhopadhyay P, Bátkai S, Haskó G, Liaudet L, Uhlmann V, Martin CM, Sheils O, Pilkington L, Silva I, Huffman JW, Csiszar A, Ungvari Z, Mackie K, Chatterjee Killalea A, Murch SB, Walker-Smith J, Thomson M, S, Pacher P (2007) CB2-receptor stimulation attenuates Wakefield AJ, O’Leary JJ (2002) Potential viral patho- TNF-alpha-induced human endothelial cell activation, genic mechanism for new variant inflammatory bowel transendothelial migration of monocytes, and monocyte- disease. Mol Pathol 55: 84–90. endothelial adhesion Am J Physiol Heart Circ Physiol Wakefield AJ, Anthony A, Murch SH, Thomson M, Montgomery 293: H2210–H2218. SM, Davies S, O’Leary JJ, Berelowitz M, Walker-Smith JA Schultz ST, Klonoff-Cohen HS, Wingard DL, Akshoomoff (2000) Enterocolitis in children with developmental disor- NA, Macera CA, Ji M, Bacher C (2006) Breastfeeding, ders. Am J Gastroenterol 95: 2285–2295. infant formula supplementation, and Autistic Disorder: Warren RP, Singh VK, Averett RE, Odell JD, Maciulis A, the results of a parent survey. Int Breastfeed J 1: 16. Burger RA, Daniels WW, Warren WL (1996) Schultz ST, Klonoff-Cohen HS, Wingard DL, Akshoomoff Immunogenetic studies in autism and related disorders. NA, Macera CA, Ji M (2008) Acetaminophen (paraceta- Mol Chem Neuropathol 28: 77–81. mol) use, measles-mumps-rubella vaccination, and autis- Wills S, Cabanlit M, Bennett J, Ashwood P, Amaral D, Van tic disorder: the results of a parent survey. Autism 12: de Water J (2007) Autoantibodies in autism spectrum 293–307. disorders (ASD). Ann N Y Acad Sci 1107: 79–91. Chakrabarti and Baron-Cohen Molecular Autism 2011, 2:10 http://www.molecularautism.com/content/2/1/10

RESEARCH Open Access Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces Bhismadev Chakrabarti1,2* and Simon Baron-Cohen2

Abstract Background: From an early age, humans look longer at preferred stimuli and also typically look longer at facial expressions of emotion, particularly happy faces. Atypical gaze patterns towards social stimuli are common in autism spectrum conditions (ASC). However, it is unknown whether gaze fixation patterns have any genetic basis. In this study, we tested whether variations in the cannabinoid receptor 1 (CNR1) gene are associated with gaze duration towards happy faces. This gene was selected because CNR1 is a key component of the endocannabinoid system, which is involved in processing reward, and in our previous functional magnetic resonance imaging (fMRI) study, we found that variations in CNR1 modulate the striatal response to happy (but not disgust) faces. The striatum is involved in guiding gaze to rewarding aspects of a visual scene. We aimed to validate and extend this result in another sample using a different technique (gaze tracking). Methods: A total of 30 volunteers (13 males and 17 females) from the general population observed dynamic emotional expressions on a screen while their eye movements were recorded. They were genotyped for the identical four single-nucleotide polymorphisms (SNPs) in the CNR1 gene tested in our earlier fMRI study. Results: Two SNPs (rs806377 and rs806380) were associated with differential gaze duration for happy (but not disgust) faces. Importantly, the allelic groups associated with a greater striatal response to happy faces in the fMRI study were associated with longer gaze duration at happy faces. Conclusions: These results suggest that CNR1 variations modulate the striatal function that underlies the perception of signals of social reward, such as happy faces. This suggests that CNR1 is a key element in the molecular architecture of perception of certain basic emotions. This may have implications for understanding neurodevelopmental conditions marked by atypical eye contact and facial emotion processing, such as ASC.

Background us about normative variation in the visual processing of Vision is the primary sensory modality in primates, stimuli but also is relevant to the understanding of com- reflected by the visual cortex being the largest of all the plex neurodevelopmental conditions such as autism sensory cortices. Our eyes perform quick orienting spectrum conditions (ASC), which are characterised by movements (’saccades’) towards interesting features of atypical gaze fixation patterns [7,8]. This has led to the stimuli in the external world [1]. In general, we tend to suggestion that gaze fixation patterns could constitute look longer at more rewarding stimuli [2]. This rationale potential endophenotypes for such conditions. Gaze pat- lies behind the ‘preferential looking’ technique in infancy terns show high test-retest reliability as well as a moder- research, where gaze duration and direction are assumed ate to high heritability when tested in twins [9-11], to reflect visual preference [2-6]. Gaze not only informs suggesting a significant genetic contribution. This raises the possibility that variation in candidate genes underlie * Correspondence: [email protected] normative variation in gaze patterns. 1Centre for Integrative Neuroscience and Neurodynamics, School of The measure of particular interest to us is the dura- Psychology and Clinical Language Sciences, University of Reading, tion of gaze fixation, given the evidence that people with Whiteknights, Reading RG6 6AL, UK Full list of author information is available at the end of the article ASC show reduced gaze fixation towards social stimuli

© 2011 Chakrabarti and Baron-Cohen; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Chakrabarti and Baron-Cohen Molecular Autism 2011, 2:10 Page 2 of 7 http://www.molecularautism.com/content/2/1/10

[8,12-15]. Research in primates suggests that the striatal this was closely matched to the original fMRI experi- region plays a major role in directing gaze [16]. The ment, we also analysed gaze fixation duration for disgust striatum is thought to encode a ‘value map’ of the visual expressions as a function of CNR1 genetic variation. stimuli. Both ventral striatal neurons as well as a subpo- Disgust faces are potential signals of ‘nonreward’,in pulation of caudate neurons encode reward magnitude contrast to rewarding happy faces, and hence provide a of the stimuli [17,18]. This ‘value map’, in addition to high-level control condition (that is, matched for face- further frontal cortical inputs, is then passed to the lat- specific qualities, such as configural features, as well as eral intraparietal area (LIP), where a fine-tuned map of more general visual qualities of the stimuli, such as col- ‘relative expected subjective value’ is created. The LIP our, shape and luminosity) for our experiment. We pre- projects to the frontal eye fields, which send excitatory dicted that variation (single-nucleotide polymorphisms projections to the caudate nucleus. A subset of neurons (SNPs)) in the CNR1 gene would be significantly asso- from the caudate nucleus inhibit the substantia nigra ciated with individual variability in gaze duration and consequently disinhibit the superior colliculus, towards happy but not disgust faces. whichinturncontrolsthegazecontrolnucleiinthe brainstem, leading to a gaze shift [19]. Methods One of the key molecular systems involved in the func- Participants tioning of the striatal circuit is the endocannabinoid sys- A total of 30 student volunteers (13 males and 17 tem. It is a neuropeptidergic circuit involved in reward females; 29 right-handed and 1 left-handed; mean age ± processing and works in tandem with the mesolimbic SD, 24.1 ± 3.41 years old) were recruited by advertise- dopaminergic system [20]. Expressed selectively in the ment from the local universities. Participants were brain, the cannabinoid receptor 1 (CNR1) is the best-stu- included only if all four grandparents were of Caucasian died molecule of this system. Immunolocalisation studies European ancestry to avoid genetic heterogeneity in rats and humans have indicated high CNR1 expression between different populations. Participants were also levels in the striatum, a region known for its central role excluded if they reported any history of psychiatric diag- in reward processing [20-24]. CNR1 is believed to modu- noses or regular drug abuse. They were equated for edu- late striatal dopamine releasethroughatrans-synaptic cational background in that all had completed high mechanism involving both GABAergic and glutamatergic school and were studying towards a college degree. All synapses and is expressed strongly in the caudate, puta- had normal (or corrected to normal) vision. The study men, globus pallidus internal and substantia nigra, as was approved by the Psychology Research Ethics Com- well as in the shell of the nucleus accumbens [25]. Phasic mittee of the University of Cambridge. release of striatal dopamine is the primary mechanism Buccal swabs were collected from all participants, and encoding for reward [26]. DNA was extracted. The four SNPs of choice were iden- Recent studies have suggested abnormalities in ASC in tical to those selected in our earlier fMRI study striatal volume [27,28], connectivity [29] and activity in (rs1049353, rs806377, rs806380 and rs6454674), chosen response to social stimuli [30]. In addition, a gene to ensure a minor allele frequency > 0.2 in a Caucasian expression study of postmortem brain tissue of people population and to cover as much of the gene as possible with ASC found reduced expression of CNR1 [31]. In (see Figure 1) [32]. The DNA was genotyped by Gene- view of the atypical gaze behaviour of people with ASC, service, Inc. (Cambridge, UK) using standard TaqMan™ together with the observed striatal atypicalities, it is rea- assays (Applied Biosystems, Inc., California, USA). Gen- sonable to examine the phenotype of gaze patterns as a otyping for these SNPs failed for two of these partici- function of variation in genes expressed in the striatum. pants, resulting in a sample size of 28 participants for As gaze fixation is linked to striatal activity [16,17,19], the final analysis. we might expect that molecular variation in the genes involved in striatal function would be associated with Procedure differences in gaze towards socially rewarding stimuli. The stimuli were taken from the Mindreading™ set Using functional magnetic resonance imaging (fMRI), developed by Baron-Cohen et al. [34], since dynamic we previously found genetic variation in CNR1 modu- facial expressions of emotion are assumed to be more lated activity in the striatal region while watching happy ecologically valid than static photographs. The Mind- (but not disgust) faces [32]. This result has been inde- reading set consists of video, audio and textual examples pendently replicated in larger samples [33]. In the cur- for 412 different emotions arranged into 24 emotion rent study, we aimed to conduct an identical experiment groups and organised according to six different develop- using gaze-tracking in a new sample of volunteers. Spe- mental levels (based on emotions recognised in child- cifically, we tested whether CNR1 genetic variation influ- hood through adulthood). These stimuli have been ences gaze duration towards happy faces. To ensure that validated in typical populations and in people with ASC Chakrabarti and Baron-Cohen Molecular Autism 2011, 2:10 Page 3 of 7 http://www.molecularautism.com/content/2/1/10

uses reflected low-frequency infrared rays (l =880nm)   to map macrosaccades and fixation times at each point.  The data were preprocessed using GazeTracker™ soft- ware. To ensure that the measured gaze duration was specific to the socially informative regions of the emotion expressions [35], ‘look zones’ were manually drawn around the eyes (the eyebrows and lower eyelids) and mouth region (the region from the bottom of the nose to the bottom of the lower lip) of all stimuli (see Figure 2). All look zones were ‘dynamic’; that is, they tracked the eyes and the mouth regions while allowing for head movement of the actors. The sum of duration of all fixations was recorded for each look zone. A fixation was defined as a continuous gaze for 100 ms within a 40-pixel diameter (correspond- ing to a 1.3° visual angle), which was in line with para- meters used in similar studies [15]. Gaze duration for each expression was calculated by summing the mean Figure 1 Schematic structure of the cannabinoid receptor fixation time for eyes and mouth regions. Different CNR1 gene with all four genotyped single-nucleotide regions of the face (that is, eyes and mouth) are relevant polymorphisms indicated. Top: White boxes indicate untranslated for processing different basic emotions [12,42-44]. Thus regions, black boxes indicate translated regions and intervening straight line indicates an intronic region. Bottom: The linkage it is not ideal to compare the fixation time to the eyes disequilibrium structure of the gene in the Caucasian (CEU) region for happy and disgust faces, since disgust faces population is shown (using the publicly available HapMap version 3, are associated with greater gaze duration to the mouth release R2, database available at http://hapmap.ncbi.nlm.nih.gov/. region. Hence, total fixation time across eyes and mouth regions was used as the dependent variable.

[35-38]. These stimuli were chosen over other existing Results available stimuli because Mindreading stimuli comprise Both happy and disgust expressions were recognised dynamic emotional expressions whilst alternatives (such with > 80% accuracy. Genetic association was measured as the Ekman and Friesen set [39], the Karolinska Direc- using the UNPHASED programme (http://www.mrc- ted Emotional Faces set [40] and the NimStim set [41]) bsu.cam.ac.uk/personal/frank/software/unphased), which comprise static expressions. The Mindreading stimuli computes the retrospective likelihood, that is, the have excellent interrater reliability and external validity probability of observing different genotypes given an [36,38] (stimuli are available at http://www.jkp.com/ observed distribution of a quantitative trait [45]. The mindreading/). two dependent variables (gaze duration for all happy Participants were seated comfortably at a fixed dis- and all disgust faces) and the genotypes for all four tanceof60cmfromthescreen and were instructed to SNPs were included in a single analysis. This analysis keep movement to a minimum. Participants watched 80 revealed a significant association of the gaze duration videoclips (three seconds each and sixteen clips for each for happy faces with rs806377 (c2 = 8.88, df =2,P = of the five emotions) presented in a pseudorandom 0.011) and rs806380 (c2 = 8.46, df =2,P = 0.014). No order using GazeTracker™ software (DynaVox Inc., Vir- significant associations (at P ≤ 0.05) were noted for ginia, USA) with an interstimulus interval of six seconds. gaze duration for disgust faces (nominal prs806377 = Participants were shown a fixation cross during the 0.104 and nominal prs806380 =0.086).Totestwhether interstimulus interval. All stimuli were centred on a 19- the observed lack of significant association with disgust inch monitor and occupied 70% of the screen area. To faces was due to one video clip that was misclassified ensure that participants were attending to the stimulus, by a majority of the participants, the data were reana- they were asked to say aloud what emotion they thought lysed after removing all fixation data associated with was being displayed (choosing one of five emotion this one video clip. This revealed an identical pattern words: ‘happy’, ‘sad’, ‘angry’, ‘disgust’ or ‘fear’). Their of results, with a nominal prs806377 = 0.111 and a nom- responses were recorded by the experimenter. inal prs806380 = 0.105. The Eye Response Interface Computer Aid camera However, when multiple SNPs are in linkage disequili- (ERICA; http://www.eyeresponse.com/) was used to brium (LD), hypothesis tests in single-locus analyses are measure fixation time at each point at 60 Hz. ERICA not independent. To take this into account, Li and Ji Chakrabarti and Baron-Cohen Molecular Autism 2011, 2:10 Page 4 of 7 http://www.molecularautism.com/content/2/1/10

Figure 2 Example gaze trail from a single participant and group mean gaze durations for happy faces classified by genotype. (a) Example gaze trail from a single participant on a still frame from a video stimulus showing a happy expression. The black circles represent fixation points and the amount of time (in seconds) spent in each. The dotted lines demarcate each look zone (eyes region and mouth region). (b) Gaze duration for happy faces grouped by genotype for rs806380 (top) and rs806377 (bottom), respectively. Unfilled circles indicate mean gaze duration, and error bars represent ± 1 SEM. From the Mindreading™ set developed by Baron-Cohen et al. [34]

[46] proposed a method for estimating the true number significantly associated with the gaze duration for happy of independent tests (Meff), which takes into considera- faces in both females (P = 0.021) and males (P =0.004). tion the LD between SNPs. This method was implemen- Additionally, in males, rs806380 (P = 0.019) and ted using the SNPSpD software programme [47], which rs1049353 (P = 0.004) were found to be associated with revealed that Meff was 3 in the current sample. The gaze duration for happy faces. Bonferroni correction for three independent tests gave a corrected P = 0.033 for rs806377 and a corrected P =of Discussion 0.042 for rs806380 for association with gaze duration for In this experiment, we predicted that CNR1 genetic var- happy faces. iations would be associated with differences in gaze fixa- To further analyse genotypic differences for each SNP tion duration towards happy faces. This prediction was that were significantly associated with gaze duration for confirmed: two SNPs in this gene (rs806377 and happy faces, post hoc t-tests were conducted. In rs806380) were associated with differences in gaze dura- rs806377, the CC genotype was associated with longer tion for happy (but not disgust) faces. This finding fits gaze duration than the CT genotype (t = 2.92, P < 0.025 well with the established role of the CNR1 gene in with the Bonferroni correction). In rs806380, the GG reward processes [20] and is consistent with the results genotype was associated with longer gaze duration than of fMRI studies [32,33] in showing that this gene is a the AA genotype (t = 2.78, P < 0.05 with the Bonferroni component of the molecular architecture of social correction) (see Figure 2). reward processing. Social reward processing has been The main effects of all possible haplotypes were tested suggested to be impaired in people with ASC [48-50], with various possible window sizes (two, three and four particularly as reflected in atypical gaze patterns towards marker combinations) using UNPHASED software. social stimuli. Hence the current results could be rele- None of these haplotypic association tests were signifi- vant to understanding the genetic underpinning of the cant at P < 0.05. While the small sample size did not social behavioural symptoms in people with ASC. allow for a robust test of sex differences in this genetic A comparison of these results with those from our association, we report the nominal P values for these earlier fMRI study reveals that for the SNP rs806377, tests for the sake of completeness. rs806377 was the allelic group (CC) associated with the highest striatal Chakrabarti and Baron-Cohen Molecular Autism 2011, 2:10 Page 5 of 7 http://www.molecularautism.com/content/2/1/10

response is also associated with the longest gaze dura- [55]. We speculate that these genes have an additive tion for happy faces. For rs806380, the allelic group effect and might potentially underlie complex traits associated with the highest striatal response (GG) is also related to social functioning [56]. In a larger population- associated with the longest gaze duration for happy based genetic association study of empathy, we found a faces. rs806377 is located in an untranslated region nominally significant association of CNR1 genetic varia- (UTR) of the gene (Figure 1), and rs806380 was found tion with the Empathy Quotient [55,57]. Additionally, to be in significant LD with a 5’-UTR SNP (rs78074274) reduced expression of CNR1 was found in postmortem using CandiSNPer [51]. The observed effects can thus brain tissue of individuals with ASC [31]. Together, be mediated by either or both of these UTR SNPs by these findings further support the implication that varia- potentially altering gene transcription and/or mRNA tion in the CNR1 gene modulates the response to social stability. Since the fMRI and gaze duration data come stimuli such as happy faces. from largely independent samples (only three of thirty However, the current findings should be interpreted participants were common to both studies), it is likely with caution, since, in the absence of any expression that the observed genetic differences reflect real effects. data, any functional role for the SNPs can only be spec- We interpret the genetically linked biasing of visual ulative; that is, the observed SNP effects may be caused perception in terms of individual differences in the by being in LD with other functional polymorphisms reward circuitry. The two processes of increased visual and/or through mechanisms that affect mRNA stability preference (indicated by longer gaze duration) and or splicing as mentioned earlier. However, the observa- increased striatal response for happy faces are linked in tion of genetic differences in two separate (albeit small) a positive feedback loop [5]. We tend to look longer at samples using an identical paradigm with two different preferred stimuli, which in turn increases our prefer- techniques points towards a putative role played by ence/’reward value’ for these stimuli. Consequently, we CNR1 in the response to happy faces. interpret the observed effect in biasing visual perception of social stimuli in terms of differences in the individual Conclusions reward circuitry. Whether such intrinsic differences in In this study, we tested whether common variants in the reward circuitry change the formation and nature of CNR1 gene modulate gaze duration towards happy ‘saliency/value maps’ formed during gaze fixation is a faces. We found that two SNPs in this gene were signifi- question for future research [19,52]. cantly associated with gaze duration for happy (but not A second broader question for future research is disgust) faces. This result is consistent with that of our whether the observed CNR1 genotypic differences in previous fMRI study [32]. Specifically, the allelic groups fixation duration for happy faces is specific to social that were found to be associated with the strongest rewardsorwhetherthisholdstrueforallclassesof striatal response in our fMRI study were associated with rewards. Variation in CNR1 has been linked to polysub- the longest gaze duration for happy faces in the current stance abuse and associated with increased activity in sample. This finding suggests a role for CNR1 in social reward-processing areas of the brain in response to reward processing and could have significance for clini- drug cues for both marijuana and alcohol addicts cal conditions such ASC, which are marked by a deficit [53,54]. Hence it is possible that the observed genoty- in social reward processing as well as atypical responses pic differences in the general population may extend to facial expressions of emotion [35,36,49]. to other classes of rewards. Crucially, however, a reduced experience of rewards in response to social Abbreviations stimuli such as happy faces (as has been suggested by CNR1: cannabinoid receptor 1; mRNA: messenger RNA; SNP: single- Dawson et al.[48]toapplytoASC)hasmorefar- nucleotide polymorphism. reaching consequences, since if an infant is looking Acknowledgements less at happy faces and is finding them less rewarding, We are grateful to Zanna Szlachta, Siamac Rezaiezadeh, Kathleen Maura this will make social interactions less reinforcing, Linnane, and Stefania Cannella for help with the experiment and to Carrie which in turn can exacerbate the social difficulties Allison and Sally Wheelwright for volunteer database management. During the period of this work, BC was funded by a scholarship from Trinity College observed in people with ASC. Cambridge and held a Research Fellowship at Darwin College Cambridge. SBC It is possible that a number of genes, each of small to was funded by Target Autism Genome, the Nancy Lurie Marks Family medium effect size, determine the striatal response to Foundation and the Medical Research Council, UK during the period of this work. This work was submitted in partial fulfilment of the doctoral degree by BC social stimuli such as happy faces. Other potential can- to the University of Cambridge and was conducted in association with the didate genes might include those involved in the oxyto- National Institute for Health Research Collaboration, Collaboration for Leadership cin-vasopressin system (OXTR, AVPR1A and AVPR1B) in Applied Health Research and Care for Cambridgeshire and Peterborough, NHS Mental Health Foundation Trust. We are also grateful to Lindsey Kent, Frank as well as those coding for key proteins involved in neu- Dudbridge, Ofer Golan, Tom Hutchinson, Mike Lombardo, Caroline Robertson, trotransmission (for example, MAOA and GABRB3) Bonnie Auyeung and Chris Ashwin for valuable discussions. Chakrabarti and Baron-Cohen Molecular Autism 2011, 2:10 Page 6 of 7 http://www.molecularautism.com/content/2/1/10

Author details 18. Cai X, Kim S, Lee D: Heterogeneous coding of temporally discounted 1Centre for Integrative Neuroscience and Neurodynamics, School of values in the dorsal and ventral striatum during intertemporal choice. Psychology and Clinical Language Sciences, University of Reading, Neuron 2011, 69:170-182. Whiteknights, Reading RG6 6AL, UK. 2Autism Research Centre, Department of 19. Trommershäuser J, Glimcher PW, Gegenfurtner KR: Visual processing, Psychiatry, University of Cambridge, Douglas House, 18B Trumpington Road, learning and feedback in the primate eye movement system. Trends Cambridge CB2 8AH, UK. Neurosci 2009, 32:583-590. 20. Gardner EL, Vorel SR: Cannabinoid transmission and reward-related Authors’ contributions events. Neurobiol Dis 1998, 5:502-533. BC designed and ran the experiment, analysed the data and wrote the 21. Freund TF, Katona I, Piomelli D: Role of endogenous cannabinoids in paper. SBC provided intellectual input at all stages and cowrote the paper. synaptic signaling. Physiol Rev 2003, 83:1017-1066. Both authors read and approved the final manuscript. 22. Fusco FR, Martorana A, Giampà C, De March Z, Farini D, D’Angelo V, Sancesario G, Bernardi G: Immunolocalization of CB1 receptor in rat Competing interests striatal neurons: a confocal microscopy study. Synapse 2004, 53:159-167. The authors declare that they have no competing interests. 23. Hurley MJ, Mash DC, Jenner P: Expression of cannabinoid CB1 receptor mRNA in basal ganglia of normal and parkinsonian human brain. J Received: 26 January 2011 Accepted: 29 June 2011 Neural Transm 2003, 110:1279-1288. Published: 29 June 2011 24. Haber SN, Knutson B: The reward circuit: linking primate anatomy and human imaging. Neuropsychopharmacology 2010, 35:4-26. References 25. van der Stelt M, Di Marzo V: The endocannabinoid system in the basal 1. Moschovakis A, Highstein SM: The anatomy and physiology of primate ganglia and in the mesolimbic reward system: implications for neurons that control rapid eye movements. Annu Rev Neurosci 1994, neurological and psychiatric disorders. Eur J Pharmacol 2003, 480:133-150. 17:465-488. 26. Schultz W: Getting formal with dopamine and reward. Neuron 2002, 2. Calvo M, Avero P: Time course of attentional bias to emotional scenes in 36:241-263. anxiety: gaze direction and duration. Cogn Emot 2005, 19:433-451. 27. Langen M, Schnack HG, Nederveen H, Bos D, Lahuis BE, de Jonge MV, van 3. Butterworth G, Jarrett N: What minds have in common is space: spatial Engeland H, Durston S: Changes in the developmental trajectories of mechanisms serving joint visual attention in infancy. Br J Dev Psychol striatum in autism. Biol Psychiatry 2009, 66:327-333. 1991, 9:55-72. 28. Estes A, Shaw DW, Sparks BF, Friedman S, Giedd JN, Dawson G, Bryan M, 4. Calvo M, Lang P: Gaze patterns when looking at emotional pictures: Dager SR: Basal ganglia morphometry and repetitive behavior in young motivationally biased attention. Motiv Emot 2004, 28:221-243. children with autism spectrum disorder. Autism Res . 5. Shimojo S, Simion C, Shimojo E, Scheier C: Gaze bias both reflects and 29. DiMartinoA,KellyC,GrzadzinskiR,ZuoXN,MennesM,MairenaMA, influences preference. Nat Neurosci 2003, 6:1317-1322. Lord C, Castellanos FX, Milham MP: Aberrant striatal functional 6. Connellan J, Baron-Cohen S, Wheelwright S, Batki A, Ahluwalia J: Sex connectivity in children with autism. Biol Psychiatry 2011, differences in human neonatal social perception. Infant Behav Dev 2001, 69:847-856. 23:113-118. 30. Weng SJ, Carrasco M, Swartz JR, Wiggins JL, Kurapati N, Liberzon I, Risi S, 7. Fletcher-Watson S, Leekam SR, Benson V, Frank MC, Findlay JM: Eye- Lord C, Monk CS: Neural activation to emotional faces in adolescents movements reveal attention to social information in autism spectrum with autism spectrum disorders. J Child Psychol Psychiatry 2011, disorder. Neuropsychologia 2009, 47:248-257. 52:296-305. 8. Klin A, Jones W, Schulz R, Volkmar F, Cohen DJ: Visual fixation patterns 31. Purcell A, Jeon O, Zimmerman A, Blue M, Pevsner J: Postmortem brain during viewing of naturalistic social situations as predictors of social abnormalities of the glutamate neurotransmitter system in autism. competence in individuals with autism. Arch Gen Psychiatry 2002, Neurology 2001, 57:1618-1628. 9:809-816. 32. Chakrabarti B, Kent L, Suckling J, Bullmore E, Baron-Cohen S: Variations in CNR1 9. Katsanis J, Taylor J, Iacono WG, Hammer MA: Heritability of different the human cannabinoid receptor ( ) gene modulate striatal measures of smooth pursuit eye tracking dysfunction: a study of normal responses to happy faces. Eur J Neurosci 2006, 23:1944-1948. twins. Psychophysiology 2000, 37:724-730. 33. Domschke K, Dannlowski U, Ohrmann P, Lawford B, Bauer J, Kugel H, 10. Iacono WG: Eye tracking in normal twins. Behav Genet 1982, 12:517-526. Heindel W, Young R, Morris P, Arolt V, Deckert J, Suslow T, Baune BT: CNR1 11. Greenwood TA, Braff DL, Light GA, Cadenhead KS, Calkins ME, Dobie DJ, Cannabinoid receptor 1 ( ) gene: impact on antidepressant Freedman R, Green MF, Gur RE, Gur RC, Mintz J, Nuechterlein KH, treatment response and emotion processing in major depression. Eur Olincy A, Radant AD, Seidman LJ, Siever LJ, Silverman JM, Stone WS, Neuropsychopharmacol 2008, 18:751-759. Swerdlow NR, Tsuang DW, Tsuang MT, Turetsky BI, Schork NJ: Initial 34. Baron-Cohen S, Golan O, Wheelwright S, Hill JJ: Mindreading: The Interactive heritability analyses of endophenotypic measures for schizophrenia: Guide to Emotions London: Jessica Kingsley Ltd; 2004. the Consortium on the Genetics of Schizophrenia. Arch Gen Psychiatry 35. El Kaliouby R, Robinson P, Keates S: Temporal context and the recognition 2007, 64:1242-1250. of emotion from facial expression. Proceedings of HCI International 12. Baron-Cohen S, Wheelwright S, Jolliffe T: Is there a “language of the Conference 2003, Springer-Verlag. eyes"? Evidence from normal adults and adults with autism or Asperger 36. Golan O, Baron-Cohen S: Systemizing empathy: teaching adults with ’ syndrome. Vis Cogn 1997, 4:311-331. Asperger s syndrome/high functioning autism to recognize emotions 13. Joliffe T, Mortimore C, Robertson M: Another advanced test of theory of using interactive multimedia. Dev Psychopathol 2006, 18:591-617. mind: evidence from very high functioning adults with autism or 37. Chakrabarti B, Bullmore E, Baron-Cohen S: Empathizing with basic Asperger syndrome. J Child Psychol Psychiatry 1997, 38:813-822. emotions: common and discrete neural substrates. Soc Neurosci 2006, 14. Swettenham J, Baron-Cohen S, Charman T, Cox A, Baird G, Drew A, Rees L, 1:364-384. Wheelwright S: The frequency and distribution of spontaneous attention 38. Golan O, Baron-Cohen S, Hill J: The Cambridge Mindreading (CAM) Face- shifts between social and non-social stimuli in autistic, typically Voice Battery: testing complex emotion recognition in adults with and developing, and non-autistic developmentally delayed infants. J Child without Asperger syndrome. J Autism Dev Disord 2006, 36:169-183. Psychol Psychiatry 1998, 9:747-753. 39. Ekman P, Friesen W: Pictures of Facial Affect Palo Alto: Consulting 15. Senju A, Southgate V, White S, Frith U: Mindblind eyes: an absence of Psychologists Press; 1976. spontaneous theory of mind in Asperger syndrome. Science 2009, 40. Lundqvist D, Flykt A, Öhman A: The Karolinska Directed Emotional Faces- 325:883-885. KDEF, CD ROM from Department of Clinical Neuroscience, Psychology 16. Hikosaka O: Basal ganglia mechanisms of reward-oriented eye section, Karolinska Institutet. Stockholm: Karolinska Institutet; 1998. movement. Ann N Y Acad Sci 2007, 1104:229-249. 41. Tottenham N, Tanaka JW, Leon AC, McCarry T, Nurse M, Hare TA, 17. Lau B, Glimcher PW: Action and outcome encoding in the primate Marcus DJ, Westerlund A, Casey BJ, Nelson C: The NimStim set of facial caudate nucleus. J Neurosci 2007, 27:14502-14514. expressions: judgments from untrained research participants. Psychiatry Res 2009, 168:242-249. Chakrabarti and Baron-Cohen Molecular Autism 2011, 2:10 Page 7 of 7 http://www.molecularautism.com/content/2/1/10

42. Chakrabarti B: Individual differences in human emotion perception: neuroimaging, genetic and behavioural investigations. PhD thesis Department of Psychiatry, School of Clinical Medicine, University of Cambridge; 2007. 43. Gamer M, Büchel C: Amygdala activation predicts gaze toward fearful eyes. J Neurosci 2009, 29:9123-9126. 44. Kliemann D, Dziobek I, Hatri A, Steimke R, Heekeren HR: Atypical reflexive gaze patterns on emotional faces in autism spectrum disorders. J Neurosci 2010, 30:12281-12287. 45. Dudbridge F: Likelihood-based association analysis for nuclear families and unrelated subjects with missing genotype data. Hum Hered 2008, 66:87-98. 46. Li J, Ji L: Adjusting multiple testing in multilocus analyses using the eigenvalues of a correlation matrix. Heredity 2005, 95:221-227. 47. Nyholt DR: A simple correction for multiple testing for SNPs in linkage disequilibrium with each other. Am J Hum Genet 2004, 74:765-769. 48. Dawson G, Carver L, Meltzoff AN, Panagiotides H, McPartland J, Webb SJ: Neural correlates of face and object recognition in young children with autism spectrum disorder, developmental delay, and typical development. Child Dev 2002, 73:700-717. 49. Scott-Van Zeeland AA, Dapretto M, Ghahremani DG, Poldrack RA, Bookheimer SY: Reward processing in autism. Autism Res 2010, 3:53-67. 50. Kohls G, Peltzer J, Herpertz-Dahlmann B, Konrad K: Differential effects of social and non social reward on response inhibition in children and adolescents. Dev Sci 2009, 12:614-625. 51. Schmitt AO, Aßmus J, Bortfeldt RH, Brockmann GA: CandiSNPer: a web tool for the identification of candidate SNPs for causal variants. Bioinformatics 2010, 26:969-970. 52. Henderson J: Human gaze control during real-world scene perception. Trends Cogn Sci 2003, 7:498-504. 53. Filbey FM, Schacht JP, Myers US, Chavez RS, Hutchison KE: Individual and additive effects of the CNR1 and FAAH genes on brain response to marijuana cues. Neuropsychopharmacology 2009, 35:967-975. 54. Hutchison KE, Haughey H, Niculescu M, Schacht J, Kaiser A, Stitzel J, Horton WJ, Filbey F: The incentive salience of alcohol: translating the effects of genetic variant in CNR1. Arch Gen Psychiatry 2008, 65:841-850. 55. Chakrabarti B, Dudbridge F, Kent L, Wheelwright S, Hill-Cawthorne G, Allison C, Banerjee-Basu S, Baron-Cohen S: Genes related to sex steroids, neural growth, and social-emotional behavior are associated with autistic traits, empathy, and Asperger syndrome. Autism Res 2009, 2:157-177. 56. Ebstein RP, Israel S, Chew SH, Zhong S, Knafo A: Genetics of human social behavior. Neuron 2010, 65:831-844. 57. Baron-Cohen S, Wheelwright S: The Empathy Quotient: an investigation of adults with Asperger syndrome or high functioning autism, and normal sex differences. J Autism Dev Disord 2004, 34:163-175.

doi:10.1186/2040-2392-2-10 Cite this article as: Chakrabarti and Baron-Cohen: Variation in the human cannabinoid receptor CNR1 gene modulates gaze duration for happy faces. Molecular Autism 2011 2:10.

Submit your next manuscript to BioMed Central and take full advantage of:

• Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit Abstracts 433

Abstract # 14 practitioner and social worker. A standardized protocol was applied, An Open Label Study of the Use of Dronabinol (Marinol) in the utilizing the Behavior Assessment System for Children, Second Edition Management of Treatment-Resistant Self-Injurious Behavior in 10 (BASC-2), Structured Developmental History (SDH), the Parent Rating Retarded Adolescent Patients, Tarah Kruger, Ed Christophersen; Scale - Preschool (PRS-P) or the Infant-Toddler Social and Emotional Children’s Mercy Hospital, Kansas City, MO. Assessment (ITSEA), depending on age. Physical examination findings were entered directly into a database with criteria established to identify critical findings. The Developmental Assessment of Young Children Purpose/Background: In the treatment of severely disturbed children, the (DAYC) was administered by interview and observation. Findings were control of self-injurious behavior (SIB) which occurs in a small entered into algorithms that directed recommendations for next steps such percentage of these children, must be given a high priority (Powers, as comprehensive evaluation, developmental therapy services, or parent 2001). Lorenz (2004) reported on the therapeutic use of cannabis (in a support. A brief report was mailed to the parents and referring physician. liquid preparation) in children with combinations of neurological Results: Mid-level assessments were completed on 116 patients with a disorders (6 of the 8 also had epilepsy), with improvements. Methods: mean age of 47.7 months (SD 14.9 months); 70% of the patients were Ten patients (ages 11 to 17) with SIB from a convenience sample, with male. The average time from date of referral to date of appointment was varying degrees of retardation and autism, received Marinol 2.5 mg bid up 26 days. The average total time for assessment was 110 minutes (SD 33.6 to 5 mg qid. The patients had failed to respond to a number of minutes). A majority of the children evaluated (75%) manifested at least medications, ranging from 4 previous medications to 17, including four one area of developmental delay on the DAYC (SS 9 1 SD). Delays were who had tried naltrexone (two of whom were still on it and two who had most frequent in the Social-Emotional domain (46%), followed by discontinued it due to negative side effects). Results: Seven of the ten had Cognitive (37%), and Functional Communication (34%). Fifty five a significant improvement in the SIB and their overall mood/well being as percent of children were reported to have clinically significant External- reported by caregivers. Two experienced agitation from the Marinol and it izing Problems on the BASC PRS-P, while 25 percent were reported to was discontinued. Five of the seven who responded had no change in their have Internalizing Problems. For the 11 children administered the ITSEA, appetites, and the two that did, benefited from that effect. At follow up to clinical deficits were most prevalent in the area of Dysregulation. 6 months out, patients continued to respond favorably to the Marinol. Satisfaction surveys were obtained from 31 referring physicians and 99 Conclusions: In a series of patients who presented with treatment- parents. On the physician survey 6 of 8 items were endorsed as Bagree[ or resistant self-injurious behavior, eight of the 10 showed an improvement Bstrongly agree[ by more than 80% of respondents; however, only 52 in their behavior when treated with Marinol without serious enough side percent endorsed the item, BI was able to implement the recommendations effects to merit discontinuing the medication. At 6 month follow-up, without difficulty.[ Parent satisfaction ratings of Bagree[ or Bstrongly seven of the 10 continued to benefit from the Marinol, and the eighth agree[ were reported by over 75% of respondents, including the critical patient had discontinued the medicine due to a change in her living item, BThe assessment was helpful in understanding my child_s develop- situation. The tolerability of Marinol in this study is consistent with the ment.[ Conclusions: The mid-level assessment model was proven to be experience of Lorenz (2004) whose patients presented with a variety of feasible and was well accepted by parents and referring physicians. The neurological disorders but not specifically SIB. majority of children referred with ill-defined developmental and behavioral concerns were found to have externalizing behavioral Outcome of Marinol in adolescents with SIB and MR problems and social-emotional developmental delays. # Previous Dose Age Gender Co-Morbid Diagnoses Medications (mg/kg/d) Outcome Abstract # 16 11 M Visual impairment 17 0.6 + Managing Demand: The Role of a Medical Social Worker in Improving 13 M Aphasia 9 0.2 + 13 M PDD-NOS 14 0.24 +/j Access to Services in a Multidisciplinary Child Development Clinic, Angelman Syndrome, Lorrie Ufkin, Paula C. Horner; Mayo Clinic, Rochester, MN. 17 M Aggression 9 0.09 agitation 16 F Autism, Hearing Impaired 12 0.36 + Purpose/Background: Would a change in the intake process shorten wait 17 M Autism, Hearing Impaired 4 0.3 + time for local and regional patients with developmental and behavioral 14 M Autism 11 0.14 agitation problems? Patients residing locally, regionally and nationally are referred 13 F Hyperactivity 13 0.15 + *** to the Mayo Clinic Dana Child Development and Learning Disorders 16 M Autism, Hyperactivity 8 0.3 + Program for multidisciplinary evaluations for a variety of behavioral and Fragile  Syndrome, developmental problems. This program typically serves children ages 3 to 14 M Aggression 11 0.2 + 18 years. All new patients are mailed an intake packet as the first step to ***Marinal was discontinued due to a change in her living situation. accessing the program. This intake packet consists of a number of forms regarding presenting concerns, medical history, developmental history, Abstract # 15 family history, school history, interventions and behaviors. Previous Feasibility Study of a Mid-Level Developmental-Behavioral Pediatric outside medical records and school records are also requested. This Assessment, Desmond P. Kelly, Mark C. Clayton, Nancy R. Powers, information is summarized and reviewed for appointment scheduling. William H. Wiist, Anna L. Cass, Jeannine Jacobs; Division of Wait time for appointments is typically 5 to 6 months. A large percentage Developmental-Behavioral Pediatrics, Children’s Hospital, Greenville of our patients live within a one hour drive of the Mayo Clinic. Methods: Hospital System, Greenville, SC. All patients who live within a one hour drive of Mayo Clinic were sent the same intake packet described above plus The ANSER System School Purpose/Background: The limited availability of developmental- Questionnaire developed by Dr. Mel Levine. When these were returned, behavioral pediatric services has created long wait times, potentially an interview with a medical social worker was scheduled, typically within delaying much-needed interventions. A secondary screening and triage one to two weeks of receipt of the packet. The child and parent/guardian model, termed Bmid-level assessment,[ was developed for preschool-aged came to this interview. The stated purpose of the visit was to determine children referred to a tertiary care center with non-specific developmental- what additional appointments and services needed to be provided (i.e., a behavioral concerns. Methods: Decision rules were applied to information comprehensive evaluation through the Dana Program, referral to a provided by referring physicians. Patients aged birth through five years developmental pediatrician or psychologist for a single consultation, who met inclusion criteria were scheduled for evaluation by a nurse referral elsewhere in the Mayo medical system, a community referral, or

Copyright © Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited. Cannabinoids 2010;5(4):4-6

Case report Use of dronabinol (delta-9-THC) in autism: A prospective single-case-study with an early infantile autistic child

René Kurz, Kurt Blaas

Lindengasse 27/10, 1070 Wien, Vienna/Austria

Abstract

Objective: To evaluate the effectiveness of dronabinol (delta-9-THC) as supplementary therapy in a child with autistic disorder. Methods: A child who met the DSM-IV (Diagnostic and Statistical Manual of Mental Disorders) criteria for a diagnosis of autistic disorder and who took no other medication during the observa- tion time was included in an open and uncontrolled study. Symptom assessment was performed using the Aberrant Behavior Checklist (ABC) before and after six months of medical treatment. Result: Compared to baseline, significant improvements were observed for hyperactivity, leth- argy, irritability, stereotypy and inappropriate speech at follow-up (p=0.043). Conclusion: This study showed that the use of dronabinol may be able to reduce the symptoms of autism. Keywords: early infantile autism, autistic disorder, dronabinol, cannabinoid

This article can be downloaded, printed and distributed freely for any non-commercial purposes, provided the original work is prop- erly cited (see copyright info below). Available online at www.cannabis-med.org

Author's address: René Kurz, [email protected]

Introduction nitive Behavioural Therapy is the gold standard in treating children with early infant autism and is sup- Autistic Disorder (also referred to as early infantile ported by occupational therapy, physical therapy and autism, childhood autism, Kanner-Syndrome) is a per- pharmacological intervention (e.g. antipsychotic drugs) vasive developmental disorder characterized by marked [4][9][12][13][17][18]. impairment in social interaction, delayed language, and Dronabinol, or tetrahydrocannabinol / ∆-9-THC, is a restricted repertoire of activity and interests (DSM-IV purified cannabinoid. The main accepted field of use is criteria for diagnosis of autistic disorder, 2007) [8][14]. in oncology to reduce nausea and in AIDS to increase Beside these core symptoms autistic children often appetite, but has also been used in chronic pain pa- show aggression against others and self-injurious be- tients, inflammatory bowel diseases (Crohn´s disease, haviour, also have sleep problems and eating disorders. ulcerative colitis) and multiple sclerosis for muscle Early infant autism affects 1 of 2000 children, with relaxation and neuropathic pain [9]. It may also be used boys affected three times more often than girls. Autism for major depression and Tourette’s syndrome does not equate with mental retardation, but intelli- [1][6][11]. gence is frequently limited (intelligence quotient (IQ) To date there have been no reports of the use of can- below 70). One quarter of autistic children achieve nabinoids in autism. However, in internet blogs and good results on IQ tests, termed ‘high functional au- discussion forums there are many reports of parents tism’. The cause of autism is still not fully explored, who have tried THC for their autistic children, but but seems to be multifactorial (including genetic, envi- without medical monitoring and inappropriate admini- ronmental and neurobiochemical disorders) [19]. Cog- stration.

4 © International Association for Cannabinoid Medicines Kurz & Blaas

Table 1. Wilcoxon Rank Sum Test for samples / pre- & 4th Edition) and confirmed by ADOS (Autism Diag- post-values nostic Observation Schedule) and ADI (Autism Diag- Subscales Before After nostic Interview) [2][3]. During the six months of fol- (May 2009) (November low-up the child did not start any new therapies or 2009) change existing assistance measures. Irritability 38 13 At beginning and end of this study symptom severity Lethargy 23 11 was determined by using the ABC (Aberrant Behavior Stereotype 16 9 Checklist) [7]. This is a questionnaire consisting of 52 Hyperactivity 47 20 questions with a rating scale from zero to three (0 ... no Inappropriate speech 6 0 problem, 3 ... severe problem) filled out by an exam- P-value for Wilcoxon iner together with the parents. Results are stratified in 0.04311 rank sum test five subscales "hyperactivity" (min.0/max.48), "leth- argy"(min.0/max.48), "stereotype"(min.0/max.21), There are well known alterations of neurotransmitters "irritability"(min.0/max.45) and "inappropriate in autistic people especially in the cerebral cannabinoid speech"(min.0/max.12). Analysis was done with SPSS receptor system [5]. We therefore asked whether dron- (SPSS 2002-10) by using the Wilcoxon Rank Sum abinol could safely be used in autism and what out- Test. Statistical significance was set with p≤ 0.05. comes can be achieved within an observation period of The therapy used was dronabinol drops (dronabinol six months. solved in sesame oil). Initial dosage was one drop (0.62mg) in the morning which was gradually in- Methods creased from day to day.

This study involved a six year old boy with early infant Results autism (F84.0), who was diagnosed in the Pediatric Clinic Graz at the age of three. The diagnosis had been During the six months follow-up the subject received made using DSM-IV criteria (American Psychiatric only dronabinol therapy. The maximum tolerated dose Association, Diagnostic Manuel of Mental Disorders, effect was reached at 2-1-3 (two drops in the morning,

Figure 1. Change of ABC subscales within six months. one drop midday, three drops in the evening), total creased by 7 points and inappropriate speech improved daily dose of 3,62 mg dronabinol. No adverse effects by 6 points (see Figure 1). were reported during treatment. The ABC subscales significantly changed over six Discussion month (p= 0.04) (see Table 1). Hyperactivity decreased by 27 points, lethargy was reduced by 25 points and This uncontrolled single case study suggests that dro- irritability by 12 points. Stereotypic behaviour de- nabinol may reduce symptoms in early infant autism.

Cannabinoids ΠVol 5, No 4 ΠNovember 21, 2010 5 Case report

This may have been achieved by modifying cannabi- parison controlled study. Behav Modif 2007; noid levels in the central nervous system. Larger con- 31(3):264-78. trolled studies are needed to explore this effect. Dro- 10. Grotenhermen F. Cannabinoids in cancer pain. nabinol will likely not replace cognitive behavioural Cannabinoids 2010;5(1):1-3 therapy with early intervention, but we believe that as 11. Hasan A, Rothenberger A, Münchau A, Wobrock an additional support it may be effective and better T, Falkai P, Roessner V. Oral Delta 9- tolerated than many existing antipsychotic drugs. tetrahydrocannabinol improved refractory Gilles de la Tourette syndrome in an adolescent by in- References creasing intracortical inhibition: a case report. J 1. Bisogno T, Di Marzo V. Cannabinoid Receptors Clin Psychopharmacol 2010;30(2):190-2. and Endocannabinoids: Role in Neuroinflamma- 12. Kurz R, Muchitsch E, Feucht M. Cognitive Be- tory and Neurodegenerative Disorders. CNS Neu- havioral Therapy in Children with Autistic Dis- rol Disord Drug Targets. 2010 [in press] order A Prospective Long-time Observational 2. Bölte S, Poustka F. Diagnostic Observation Scale Study. 2010, [in press] for Autistic Disorders: initial results of reliability 13. Myers SM, Johnson CP; American Academy of and validity. Z Kinder Jugendpsychiatr Psycho- Pediatrics Council on Children With Disabilities. ther 2004;32(1):45-50. Management of children with autism spectrum 3. Bölte S, Poustka F. Psychodiagnostic instruments disorders. Pediatrics 2008;121(4):828-30. for the assessment of autism spectrum disorders. 14. Pardo CA, Eberhart CG. The neurobiology of Z Kinder Jugendpsychiatr Psychother 2005; autism. Brain Pathol 2007;17(4):434-47. 33(1):5-14 15. Patterson SY, Smith V, Jelen M. Behavioural 4. Campbell JM. Efficacy of behavioral interven- intervention practices for stereotypic and repeti- tions for reducing problem behavior in persons tive behaviour in individuals with autism spec- with autism: a quantitative synthesis of single- trum disorder: a systematic review. Dev Med subject research. Res Dev Disabil 2003;24(2): Child Neurol 2010;52(4):318-27. 120-38. 16. Posey DJ, McDougle CJ. Pharmacotherapeutic 5. Chakrabarti B, Kent L, Suckling J, Bullmore E, management of autism. Expert Opin Pharmaco- Baron-Cohen S. Variations in the human can- ther 2001;2(4):587-600. nabinoid receptor (CNR1) gene modulate striatal 17. Remington B, Hastings RP, Kovshoff H, degli responses to happy faces. Eur J Neurosci 2006; Espinosa F, Jahr E, Brown T, Alsford P, Lemaic 23(7):1944-8. M, Ward N. Early intensive behavioral interven- 6. Crippa JA, Zuardi AW, Hallak JE. Therapeutical tion: outcomes for children with autism and their use of the cannabinoids in psychiatry. Rev Bras parents after two years. Am J Ment Retard Psiquiatr 2010;32 Suppl 1:S56-66. 2007;112(6):418-38. 7. Demb HB, Brier N, Huron R, Tomor E. The 18. Sallows GO, Graupner TD. Intensive behavioral Adolescent Behavior Checklist: normative data treatment for children with autism: four-year out- and sensitivity and specificity of a screening tool come and predictors. Am J Ment Retard 2005; for diagnosable psychiatric disorders in adoles- 110(6):417-38. cents with mental retardation and other develop- 19. Trottier G, Srivastava L, Walker CD. Etiology of ment disabilities. Res Dev Disabil 1994;15(2): infantile autism: a review of recent advances in 151-65. genetic and neurobiological research. J Psychiatry 8. Dover CJ, Le Couteur A. How to diagnose au- Neurosci 1999;24(2):103-15.Di Marzo V, De Pet- tism. Arch Dis Child 2007;92(6):540-5. rocellis L. Plant, synthetic, and endogenous can- 9. Eikeseth S, Smith T, Jahr E, Eldevik S. Outcome nabinoids in medicine. Annu Rev Med 2006; for children with autism who began intensive be- 57:553-74. havioral treatment between ages 4 and 7: a com-

6 Cannabinoids ΠVol 5, No 4 ΠNovember 21, 2010 Journal of Autism and Developmental Disorders https://doi.org/10.1007/s10803-018-3808-2

BRIEF REPORT

Brief Report: Cannabidiol-Rich Cannabis in Children with Autism Spectrum Disorder and Severe Behavioral Problems—A Retrospective Feasibility Study

Adi Aran1 · Hanoch Cassuto2 · Asael Lubotzky1 · Nadia Wattad1 · Esther Hazan1

© Springer Science+Business Media, LLC, part of Springer Nature 2018

Abstract Anecdotal evidence of successful cannabis treatment in autism spectrum disorder (ASD) are accumulating but clinical studies are lacking. This retrospective study assessed tolerability and efficacy of cannabidiol-rich cannabis, in 60 children with ASD and severe behavioral problems (age = 11.8 ± 3.5, range 5.0–17.5; 77% low functioning; 83% boys). Efficacy was assessed using the Caregiver Global Impression of Change scale. Adverse events included sleep disturbances (14%) irritability (9%) and loss of appetite (9%). One girl who used higher tetrahydrocannabinol had a transient serious psychotic event which required treatment with an antipsychotic. Following the cannabis treatment, behavioral outbreaks were much improved or very much improved in 61% of patients. This preliminary study supports feasibility of CBD-based cannabis trials in children with ASD.

Keywords Cannabidiol · Medical cannabis · Medical marijuana · Autism spectrum disorder · Disruptive behavior

Introduction The cannabis plant contains two main cannabinoids: tet- rahydrocannabinol (THC) and cannabidiol (CBD). THC is About 50% of children with autism spectrum disorder psychoactive and can cause anxiety and psychosis. CBD is (ASD) suffer from behavioral problems such as tantrums, not psychoactive and has potential anxiolytic, antipsychotic, self-injury and violence (Maskey et al. 2013). These behav- anti-inflammatory and antioxidant properties with a rela- ioral difficulties increase their social isolation, limit their tively high toxicity threshold (Campos et al. 2017). Recently, ability to benefit from intervention efforts and often cause CBD is emerging as a therapeutic option for refractory epi- more distress to caregivers than the core autistic symptoms. lepsy (Devinsky et al. 2017, 2018; Thiele et al. 2018) and Unfortunately, about 40% of children with ASD and disrup- a CBD compound (Epidiolex, GW pahrmaceuticals) was tive behavior do not respond well to standard behavioral approved by the U.S. Food and Drug Administration to and medical treatment (Adler et al. 2015). Consequently, an treat severe forms of epilepsy (Lennox Gastaut and Dravet exceptionally high percentage of parents are seeking help syndromes). These findings are of specific importance for through unproven methods (Hofer et al. 2017), including the people with ASD, as 10–30% of people with ASD have use of compounds made of the cannabis plant. comorbid epilepsy (Ballaban-Gil and Tuchman 2000) and several synaptic plasticity pathways appear to be involved in both disease processes (Lee et al. 2015). Moreover, alerted activation of the endocannabinoid sys- Electronic supplementary material The online version of this article (https​://doi.org/10.1007/s1080​3-018-3808-2) contains tem (ECS) was found in various animal models of epilepsy supplementary material, which is available to authorized users. (Rosenberg et al. 2017) and ASD (Zamberletti et al. 2017). In some of these models, activating of the ECS or admin- * Adi Aran istrating CBD (Kaplan et al. 2017; Gururajan et al. 2012) [email protected] ameliorated the social deficits. 1 Neuropediatric Unit, Shaare Zedek Medical Center, 12 Bayit A recent study demonstrated reduced concentration of Street, 91031 Jerusalem, Israel the endocannabinoid anandamide in children with ASD 2 Clallit HMO (Kupat Holim), Jerusalem, Israel (Karhson et al. 2018). However, to our knowledge, there

Vol.:(0123456789)1 3 Journal of Autism and Developmental Disorders is no previous report on the impact of medical cannabis in characteristics of the group are summarized in Table S1, children with ASD. available online. All children attended special education programs for chil- dren with ASD and at the time of the treatment met DSM-5 criteria for ASD. All had severe behavioral problems, based Methods on a Clinical Global Impression Scale—Severity (CGI-S) score of 6 or 7. Patients Treatment All children with ASD and refractory disruptive behaviors, in a single national referral center (Shaare Zedek Medi- The initial treatment for all patients was a whole plant extract cal Center, Jerusalem, Israel), to whom medical approval that contains CBD and THC in a 20:1 ratio. In 29 patients to use cannabis was issued for this indication, between with an insufficient response (CGI-S scores ≥ 5 despite treat- 4/2016 and 1/2017, were systematically investigated after ment), strains with lower CBD:THC ratios were tried (up 7–13 months of treatment (August 2017). Prior to the ret- to a 6:1; maximal CBD dose was 5 mg/kg/day). The lower rospective collection of data, written informed consent CBD:THC ratio was reported to be much better by parents was obtained from parents of all children. of 13 patients, slightly better in 7 patients, no change in 6 and worse in 3. The mean total daily dose was 3.8 ± 2.6 mg/ Treatment kg/day CBD and 0.29 ± 0.22 mg/kg/day THC for children who received three daily doses (n = 44) and 1.8 ± 1.6 mg/kg/ day CBD and 0.22 ± 0.14 mg/kg/day THC for children who The cannabis was given as an adjuvant therapy, upon received two daily doses (n = 16). parental request, following specific individual approval of the Israeli Ministry of Health. All children were prescribed whole plant extracts that contain CBD and THC in a 20:1 Retention Rates ratio, dissolved in olive oil (CHP, ™Better, Israel; Avide- kel, Tikun Olam Ltd, Israel, Topaz BOL Pharma, Israel). By the end of this study, forty-four children (73%) were still The cannabis oil was given sublingual two to three times on cannabis treatment (mean treatment duration: 10.9 ± 2.3 a day with doses up-titrated over 2–4 weeks, to effect and months). Sixteen children (27%) stopped the cannabis treat- tolerability (starting CBD dose was 1 mg/kg/day, maximal ment after 4.1 ± 2.6 months due to the following reasons: CBD dose was 10 mg/kg/day). Three were treated for less than 2 weeks due to marked irri- tability in two and unsuccessful attempts to give the oil in the third. These 3 were excluded from the efficacy assess- Outcome Measures ments below. Five children stopped the treatment (after 6 ± 2 months) due to low efficacy, seven (after 4.0 ± 2.1 months) Patients were assessed using the following question- due to a combination of low efficacy and side effects and one naires: a modified Liverpool Adverse Events Profile, the adolescent girl stopped the treatment after 6 months due to Caregiver Global Impression of Change (CGIC) scale, the a transient psychotic event. Home Situations Questionnaire–Autism Spectrum Disor- der (HSQ-ASD) and the Autism Parenting Stress Index Adverse Events (APSI). More details on the instruments and statistical analysis are described in the Supplementary Material. Adverse events were reported by parents (n = 57) through- out the treatment period and were systematically assessed at each patient visit and at the end of the study (Table 1). Results Hypervigilance leading to aggravation of sleep problems was reported in 14% of the patients but usually resolved by Patients omitting or adjusting the evening dose. Other common side effects included restlessness, irritability and loss of appe- The sample consisted of 60 children, 5–18 years old. Mean tite. Three children (5%) stopped the treatment due to side age was 11.8 ± 3.5 years; 77% had low cognitive function- effects that included marked irritability after treatment onset ing based on preexisting psychological evaluations [Autism in 2 cases and a psychotic event in one adolescent girl. This Diagnostic Observation Schedule (ADOS) or Childhood 13 years old girl received 6.5 mg/kg/day CBD and no other Autism Rating Scale (CARS)]; 83% were boys. Clinical

1 3 Journal of Autism and Developmental Disorders

Table 1 Adverse events reported by parents during the treatment with Improvement in Disruptive Behavior Assessed cannabis by the HSQ‑ASD and APSI Adverse event No of patients (%) HSQ scores improved by 29% from 4.74 ± 1.82 at baseline Any adverse event 29 (51%) to 3.36 ± 1.56 following the cannabis treatment. The mean Sleep disturbances 8 (14%) improvement was 1.38 ± 1.79 (median = 0.81). Restlessness 5 (9%) APSI scores improved by 33%, from 2.04 ± 0.77 at base- Nervousness 5 (9%) line to 1.37 ± 0.59 following the cannabis treatment. The Loss of appetite 5 (9%) mean improvement was 0.66 ± 0.74 (median = 0.53). Gastrointestinal symptoms 4 (7%) Unexplained laugh 4 (7%) Concomitant Use of Medications Mood changes 3 (5%) Fatigue 3 (5%) Nocturnal enuresis 2 (3.5%) Forty nine children (82%) were treated with medications and Gain of appetite 2 (3.5%) cannabis concomitantly: 43 children (72%) used antipsychot- Weight loss 2 (3.5%) ics 10 (17%) received mood stabilizers, 7 (12%) received Weight gain 2 (3.5%) benzodiazepines, 4 (7%)—SSRIs and 4 (7%) received stimu- Dry mouth 2 (3.5%) lants (details appear in the Supplementary Material, online). Tremor 2 (3.5%) Following the cannabis treatment, 16 (33%) received fewer Sleepiness 1 (2%) medications or lower dosage, 12 (24%) stopped taking med- Anxiety 1 (2%) ications and 4 (8%) received more medications or higher Confusion 1 (2%) dose. Cough 1 (2%) Serious adverse event No of Discussion patients (%)

Psychotic event 1 (2%) To our knowledge, this is the first report on the impact of CBD-rich medical cannabis in children with ASD. Spe- cifically, following the cannabis treatment, behavioral medications. She gradually increased the THC dose and outbreaks were much improved or very much improved when she reached 0.72 mg/kg/day, she developed an abrupt in 61% of patients. Moreover, 16 children (33%) received behavioral change that included unusual vocalization and less medications or lower dosage and 12 (24%) stopped refusal to eat and sleep for 48 h. She stopped the CBD and taking medications (all received at least 1 antipsychotic), THC and started Ziprasidone 1.4 mg/kg/day. The symptoms while 4 children (8%) received more medications or higher resolved after 9 days. dose. However, strains with a relatively high THC concen- tration (6:1-CBD to THC ratio) might lead to a serious Global Impression of Change in Behavior, Anxiety psychotic episode that would require treatment with an and Communication Following Cannabis Treatment antipsychotic. Based on these promising results, we have launched a Figure 1 demonstrates the overall improvement in behavior, placebo controlled cross-over trial that will assess CBD-rich anxiety and communication as rated by parents on the CGIC cannabis in 150 children with ASD and disruptive behavior scale. Considerable improvement in behavior problems (NCT02956226). Another large placebo controlled study (‘much improved’ or ‘very much improved’) was reported (NCT03202303) will assess Cannabidivarin (CBDV), a in 61% of the children. Considerable improvement in anxi- homolog of CBD, in 100 children with ASD. ety and communication problems was reported in 39% and CBD-rich cannabis might help children with ASD via 47% of the children respectively. CGIC ratings were not several possible mechanisms including its anxiolytic and correlated with age, functional level, severity of behavioral antipsychotic properties (Campos et al. 2017) as well as its problems at baseline and comorbidity with epilepsy. immunomodulatory effect and its impact on the endocan- nabinoid system (ECS). Several human studies revealed associations between polymorphisms in the gene encoding CB1 endocannabinoid receptor and social reward process- ing (Chakrabarti and Baron-Cohen 2011).

1 3 Journal of Autism and Developmental Disorders

A Behavior

40% All (n=57) 30%

y 20% r Boys with Idiopathic o

g 10% ASD (n=39) e t

a 0% c very much improovedmuch improoved slightly improoved no change worse (3 categories) h c a

e B Anxiety n

i 40% s t 30% n a 20% p i c

i 10% t r

a 0% p very much much improoved slightly improovedno changeworse (3 categories) f

o improoved e g

a C Communication t n

e 40% c r

e 30%

P 20% 10% 0% very much much improoved slightly improoved no change worse (3 categories) improoved

Fig. 1 Caregivers global impression of change in behavior anxiety and communication following cannabis treatment

These preclinical data and the results of the current study revised manuscript and gave final approval. EH: Study design; acquisi- render worthwhile further exploration of this treatment ave- tion, analysis and interpretation of data; drafted manuscript; critically revised manuscript and gave final approval. nue in controlled studies. Until such evidence is available, physicians should be cautious in the use of medical cannabis Funding The authors received no financial support for the research, in children with ASD since initial reports of promising treat- authorship, and/or publication of this article. ment in children with ASD are often found, in controlled studies, to result from a pure placebo response (King et al. Compliance with Ethical Standards 2013). Furthermore, the use of recreational cannabis in ado- lescents is associated with several risks including decreased Ethical Approval All procedures performed in studies involving human motivation, addiction, mild cognitive decline, and schizo- participants were in accordance with the ethical standards of the insti- tutional and/or national research committee and with the 1964 Helsinki phrenia. However, these complications are all attributed to declaration and its later amendments or comparable ethical standards. THC, while we used CBD-rich compounds. Nevertheless, as safety data in children are sparse, it is recommended that clinical use be withheld until ongoing randomized trials are References published. Finally, this study has several limitations. It is an uncon- Adler, B. A., Wink, L. K., Early, M., Shaffer, R., Minshawi, N., trolled retrospective study of a subgroup of children with McDougle, C. J., et al. (2015). Drug-refractory aggression, self- severe and refractory behavioral problems. The participants injurious behavior, and severe tantrums in autism spectrum dis- used various cannabis strains from different growers and orders: A chart review study. Autism, 19(1), 102–106. https://doi.​ a broad range of CBD and THC dose, and the number of org/10.1177/13623​61314​52464​1. Ballaban-Gil, K., & Tuchman, R. (2000). Epilepsy and epilepti- participants was not large enough to evaluate the impact on form EEG: Association with autism and language disorders. different ASD subgroups. Mental Retardation and Developmental Disabilities Research Reviews, 6(4), 300–308, https​://doi.org/10.1002/1098- Author Contributions AA: Study conception and design; acquisi- 2779(2000)6:4%3C300​::aid-mrdd9​%3E3.0.co;2-r. tion, analysis and interpretation of data; drafted manuscript; criti- Campos, A. C., Fogaca, M. V., Scarante, F. F., Joca, S. R. L., Sales, cally revised manuscript and gave final approval. CH and LA: Study A. J., Gomes, F. V., et al. (2017). Plastic and neuroprotective conception; interpretation of data; critically revised manuscript and mechanisms involved in the therapeutic effects of cannabidiol in gave final approval. WN: Study design; acquisition of data; critically

1 3 Journal of Autism and Developmental Disorders

psychiatric disorders. Frontiers in Pharmacology, 8, 269. https://​ disorder. Molecular Autism, 9, 18. https​://doi.org/10.1186/s1322​ doi.org/10.3389/fphar​.2017.00269​. 9-018-0203-y. Chakrabarti, B., & Baron-Cohen, S. (2011). Variation in the human King, B. H., Dukes, K., Donnelly, C. L., Sikich, L., McCracken, J. cannabinoid receptor CNR1 gene modulates gaze dura- T., Scahill, L., et al. (2013). Baseline factors predicting placebo tion for happy faces. Molecular Autism, 2(1), 10. https​://doi. response to treatment in children and adolescents with autism org/10.1186/2040-2392-2-10. spectrum disorders: A multisite randomized clinical trial. JAMA Devinsky, O., Cross, J. H., Laux, L., Marsh, E., Miller, I., Nabbout, Pediatrics, 167(11), 1045–1052. https​://doi.org/10.1001/jamap​ R., et al. (2017). Trial of Cannabidiol for drug-resistant seizures ediat​rics.2013.2698. in the dravet syndrome. The New England Journal of Medicine, Lee, B. H., Smith, T., & Paciorkowski, A. R. (2015). Autism spec- 376(21), 2011–2020. https​://doi.org/10.1056/NEJMo​a1611​618. trum disorder and epilepsy: Disorders with a shared biology. Epi- Devinsky, O., Patel, A. D., Cross, J. H., Villanueva, V., Wirrell, E. C., lepsy & Behavior, 47, 191–201. https​://doi.org/10.1016/j.yebeh​ Privitera, M., et al. (2018). Effect of Cannabidiol on drop sei- .2015.03.017. zures in the lennox-gastaut syndrome. The New England Journal Maskey, M., Warnell, F., Parr, J. R., Le Couteur, A., & McConachie, of Medicine, 378(20), 1888–1897. https://doi.org/10.1056/NEJMo​ ​ H. (2013). Emotional and behavioural problems in children with a1714​631. autism spectrum disorder. Journal of Autism and Developmen- Gururajan, A., Taylor, D. A., & Malone, D. T. (2012). Cannabidiol tal Disorders, 43(4), 851–859. https​://doi.org/10.1007/s1080​ and clozapine reverse MK-801-induced deficits in social inter- 3-012-1622-9. action and hyperactivity in Sprague-Dawley rats. The Jour- Rosenberg, E. C., Patra, P. H., & Whalley, B. J. (2017). Therapeutic nal of Psychopharmacology, 26(10), 1317–1332. https​://doi. effects of cannabinoids in animal models of seizures, epilepsy, org/10.1177/02698​81112​44186​5. epileptogenesis, and epilepsy-related neuroprotection. Epilepsy Hofer, J., Hoffmann, F., & Bachmann, C. (2017). Use of complemen- & Behavior, 70(Pt B), 319–327. https​://doi.org/10.1016/j.yebeh​ tary and alternative medicine in children and adolescents with .2016.11.006. autism spectrum disorder: A systematic review. Autism, 21(4), Thiele, E. A., Marsh, E. D., French, J. A., Mazurkiewicz-Beldzin- 387–402. https​://doi.org/10.1177/13623​61316​64655​9. ska, M., Benbadis, S. R., Joshi, C., et al. (2018). Cannabidiol Kaplan, J. S., Stella, N., Catterall, W. A., & Westenbroek, R. E. (2017). in patients with seizures associated with Lennox-Gastaut syn- Cannabidiol attenuates seizures and social deficits in a mouse drome (GWPCARE4): A randomised, double-blind, placebo- model of Dravet syndrome. Proceedings of the National Acad- controlled phase 3 trial. Lancet, 391(10125), 1085–1096. https​:// emy of Sciences of the United States of America, 114(42), 11229– doi.org/10.1016/s0140​-6736(18)30136​-3. 11234. https​://doi.org/10.1073/pnas.17113​51114​. Zamberletti, E., Gabaglio, M., & Parolaro, D. (2017). The endocan- Karhson, D. S., Krasinska, K. M., Dallaire, J. A., Libove, R. A., nabinoid system and autism spectrum disorders: Insights from Phillips, J. M., Chien, A. S., et al. (2018). Plasma anandamide animal models. International Journal of Molecular Sciences. https​ concentrations are lower in children with autism spectrum ://doi.org/10.3390/ijms1​80919​16.

1 3 932 Abstracts / Journal of the Neurological Sciences xxx (2017) 757–944

2591 WCN17-2750 SHIFT 7 - CHILD NEUROLOGY Etiology and clinical study of basal ganglionic disorders in a sample of Egyptian children H. Zehrya, S. Darwishb, H. Gadb, H. Emamb, M.E.D. Tharwatb,S.El Zayatb, M. Abd Elmoteyc. aMinistry of Health, neurology, Mansoura, Egypt; bFaculty of Medicine- Al-Azhar University, Neurology, Cairo, Egypt; cFaculty of Medicine- Al-Azhar University, Radiology, Cairo, Egypt

Background: In childhood, the metabolic activity of the basal ganglia is greater and they are particularly prone to injury. Many disease entities may present as basal ganglia abnormalities. Damage to the basal ganglia cells may cause problems controlling speech, move- ment, consciousness, muscle tone, posture and cognition. Objective: To determine the etiology of basal ganglionic disorders in a sample of Egyptian children. Patients and Methods/Material and Methods: A cross-sectional observational study was utilized on 23 patients attended at the Pediatric Neurology Outpatient Unit of Neurology department at Al- Azhar University Hospitals during a period of one year from beginning of November 2014 to end of October 2015. A specialized pediatric neurological sheet, Cognitive assessment in children using Stanford-Binet Intelligence Scale: Fourth Edition and Laboratory investigations were performed. Results: The frequency of male patients was slightly higher than the female patients, males were 13 (56.5% ) and females were 10 (43.5%) acute ischemic stroke was the most frequent cause, which was founded in 8 (34.8%) cases, followed by 7 (30.4%) had metabolic cases , 6 (26.1%) infectious causes, and lastly 2 (8.7%) cases toxic doi:10.1016/j.jns.2017.08.2622 causes. According to brain MRI imaging ,bilateral cases were 16 (69.70%), unilateral cases Putamen were 2 (8.7%), Caudate and putamen were 1 (4.3%), Caudate and lentiform nucleolus were 1 2592 (4.3%), Caudate were 2 (8.7%), Globus pallidus were 1 (4.3%). WCN17-3478 Conclusion: Acute ischemic stroke was the most frequent cause of SHIFT 7 - FUNCTIONAL DISORDERS AND BEHAVIORAL NEUROLOGY basal ganglionic lesion in a sample of Egyptian children. Oral cannabis extracts as a promising treatment for the core symptoms of autism spectrum disorder: Preliminary experience in Chilean patients G. Kuestera, K. Vergarab, A. Ahumadab, A.M. Gazmurib. aFundación Daya, Direccion de Investigacion y Estudios Clinicos, Santiago, Chile; bFundación Daya, Fundación Daya, Santiago, Chile

Background: Preclinical studies and several anecdotal case reports suggest a dysfunctional endocannabinoid system implicated in Autism Spectrum Disorder (ASD). Objective: To report our preliminary findings in patients with ASD treated with oral cannabis extracts. Patients and Methods/Material and Methods: We retrospectively reviewed all consecutive patients seen between June 2016-March 2017, with ASD diagnosis according to DSM-V, treated with sublingual whole plant cannabis extracts for at least three months. We reviewed demographic/clinical data, neuroimaging/EEG studies, vision/audition/ genetic/metabolic tests, and parental/school/neuropsychological reports. Type of cannabis strain, CBD:THC ratio, daily dose of CBD/THC/CBN, and adverse events were documented. Clinical changes were estimated using Clinical Global Impression of Improvement (CGI-I) and Autism Parenting Stress Index (APSI). Informed consent was obtained. Results: 20 children and one adult patients were selected. Mean age: 9 years, 10 months (range: 26 mo-22 yo), 15 males. Mean follow-up: 7,6 mo (range: 3-12). 66,7% of patients had significant improvement according to CGI-I and APSI. Most cases improved at least one of the core symptoms of ASD, including social communication, language, or repetitive behaviors. Additionally, sensory difficulties, food acceptance, Abstracts / Journal of the Neurological Sciences xxx (2017) 757–944 933 feeding and sleep disorders, and/or seizures were improved in most Medellín, Colombia; bNeuroCentro, Institute of Epilepsy and Movements cases. 71,5% of patients received balanced CBD:THC extracts; 19,0% Disorders, Pereira, Colombia; cUniversity of Antioquia, Neurology, high-CBD; and 9,5% high-THC extracts. Oral cannabis extracts were well Medellin, Colombia; dUniversity of Saskatchewan, Division of Neurology, tolerated. Two patients had more agitation and one had more Saskatoon, Canada; eNeurology, Sheffield, United Kingdom irritability, effects that were solved by changing the strain. Conclusion: In this small series of ASD patients, oral cannabis Background: Psychogenic nonepileptic seizures (PNES) represent a extracts were dramatically more effective than conventional medi- diagnostic challenge. This is particularly the case in developing cines. Large randomized controlled trials are needed to establish countries. fi ef cacy and safety of medicinal cannabis in ASD. Objective: Our objective is to describe the current medical care in Latin America, identify patterns of practice and service gaps doi:10.1016/j.jns.2017.08.2623 Patients and Methods/Material and Methods: The PNES Task Force of ILAE devised a questionnaire for health professionals to investigate how they diagnose and treat PNES. Using this questionnaire, we 2593 conducted a 36-questions survey among health professionals to gain WCN17-2124 an overview of diagnostic and treatment services in Latin America. SHIFT 7 - FUNCTIONAL DISORDERS AND BEHAVIORAL NEUROLOGY Results: 118 eligible questionnaires were analyzed. Responses were fi Astudyoncomparativeefcacy and adverse effects of received from 12 countries. Most respondents were young neurol- methylphenidate versus atomoxetine ogists (81%), 60% female. A large proportion of respondents stated to M. Kunju, M. Sreedharan, M. Iype, C.V. V, S. Jaykrishnan, K. know how to diagnose (81%) however many of them would not Devadathan. Trivandrum Medical college-, Pediatric neurology, actually make the diagnosis (42%), or are inexperienced in arranging TRIVANDRUM, India and offering treatment (56%). Most do not provide follow-up (75%) on patients without epilepsy. Although 81% of respondents feel that Background: Methylphenidate and atomoxetine are used n children individualized psychological therapy is the most effective treatment, fi with Attention deficit hyperactivity disorder (ADHD) for control of 70% of them are not well informed or suf ciently familiar with core symptoms. psychotherapy, and the actual availability of the service is very low As Methylphenidate is a restricted medicine availability is problem- (29%). Additionally, a large minority of participants reported not – atic. Atomoxetine which is available without restriction is useful but having access to the gold standard inpatient video-EEG (34%). long term effect in ADHD in developing countries is not studied . Conclusion: Diagnostic and treatment service for patients with PNES fi Objective: To compare the comparative efficacy of methylphenidate in Latin America is de cient. Some gaps remain regarding technical and atomoxetine in children with Attention deficit hyperactivity resources, training and treatment. There is a high level of uncertainty disorder (ADHD). regarding psychotherapy among neurologists, for which further education is needed. A better access to video EEG may improve Patients and Methods/Material and Methods: Randomized con- PNES diagnosis and treatment. trolled trial was conducted in 80 patients (age 6-12 y) with a diagnosis of ADHD, receiving methylphenidate or atomoxetine in pediatric neurology OPD of a tertiary care hospital of-SAT hospital, medical doi:10.1016/j.jns.2017.08.2625 college, Trivandrum. Children were randomized to open-label atomoxetine or methylphenidiate group for 8 weeks. the baseline score of attention 2595 deficit hyperactivity disorder rating scale (ADHD-RS) and clinical WCN17-2024 global impression severity of illness(CGI-SI)are noted,efficacy is compared from the difference in mean score of ADHD -RS scale and SHIFT 7 - FUNCTIONAL DISORDERS AND BEHAVIORAL NEUROLOGY CGII-SI scale after 8 weeks. Individuals who experience an initial attack of urticaria during adolescence are at a higher risk for developing depression: A Results: Most of the patients were of age 8-9 years, and more database study proportion were boys from rural area;duration of illness was 1-2 years,58.8%were below average in their current intellectual func- C.H. Liao, Y.R. Lin. Changhua Christian Hospital, Emergency tioning, with poor school performance.7.5% were having family Department, Changhua City, Taiwan R.O.C. histroy of ADHD,16.3% of patients were undergoing special education programmes. A greater proportion of children were having ADHD Background: Urticaria is a common ailment encountered in hospital. fi subtype combined: the mean ef cacy index for methylphenidate Although the symptoms of urticaria may increase stress, this was 2 and 1.7 for atomoxetine group. Majority patients were with association is not fully understood. medium or high medication adherence. Objective: Our aim was to analyze the risk of depression following a Conclusion: Methylphenidate and atomoxetine are equally effective diagnosis of urticaria using a nationwide population-based study In treatment of ADHD. Patients and Methods / Material and Methods: We examined the doi:10.1016/j.jns.2017.08.2624 Taiwan Longitudinal Health Insurance Database. A total of 6742 adolescents (aged 13-18 years) who were hospitalized for a first- attack urticaria between 2006 and 2009 were recruited as a study 2594 group, together with 20,226 matched nonurticaria enrollees as a control group. Each patient was prospectively followed for 1 year to WCN17-3112 identify episodes of depression. Cox proportional hazards models SHIFT 7 - FUNCTIONAL DISORDERS AND BEHAVIORAL NEUROLOGY were used to compare the risk of depression between the study and Psychogenic nonepileptic seizures in Latin America: Approach of control groups, making adjustments for the patients' places of the healthcare professionals residence and sociodemographic characteristics. Depression-free L.D. Ladinoa, V. Benjumea-Cuartasb, R. Lopez-Gonzalezc, J.F. Tellez- survival curves were also analyzed. Finally, the risks of depression Zentenod, M. Reubere. aHospital Pablo Tobon Uribe, Neurology, were analyzed between various age groups.

Question 5

Letters of support provided by physicians with knowledge of the disease or condition. DocuSign Envelope ID: 7BEB1890-1114-412F-A006-3B1266040D9F

To Whom It May Concern,

We, the undersigned physicians, support adding autism to the qualifying conditions list under Ohio’s Medical Marijuana Control Program.

We believe the science, research and information available on treating autism with medical marijuana is sufficient to conclude that it is an effective treatment and that the benefits outweigh the risks.

Autism is a spectrum, with some patients being more severely impacted than others. Treatment of the condition is largely focused on behavioral therapies, which are insufficient for individuals exhibiting moderate to severe symptoms. Current pharmaceutical options to treat symptoms of autism are highly limited and providing physicians another treatment option in medical marijuana will lead to better patient outcomes.

We believe the evidence supports medical marijuana as a treatment option for autism, and we ask that the State Medical Board of Ohio add autism as a qualifying condition under Ohio’s Medical Marijuana Control Program.

Sincerely,

Cynthia Taylor

do DocuSign Envelope ID: D6D51530-0821-4177-A1BA-100C86A3772A

To Whom It May Concern,

We, the undersigned physicians, support adding autism to the qualifying conditions list under Ohio’s Medical Marijuana Control Program.

We believe the science, research and information available on treating autism with medical marijuana is sufficient to conclude that it is an effective treatment and that the benefits outweigh the risks.

Autism is a spectrum, with some patients being more severely impacted than others. Treatment of the condition is largely focused on behavioral therapies, which are insufficient for individuals exhibiting moderate to severe symptoms. Current pharmaceutical options to treat symptoms of autism are highly limited and providing physicians another treatment option in medical marijuana will lead to better patient outcomes.

We believe the evidence supports medical marijuana as a treatment option for autism, and we ask that the State Medical Board of Ohio add autism as a qualifying condition under Ohio’s Medical Marijuana Control Program.

Sincerely,

Daniel Neides

MD