Telomere Erosion and Chromosomal Instability in Cells Expressing the HPV Oncogene 16E6

Telomere erosion and chromosomal instability in cells expressing the HPV oncogene 16E6

Annemieke W Plug-DeMaggio*,1, Terri Sundsvold1, Michelle A Wurscher1, Jennifer I Koop1, Aloysius J Klingelhutz1,3 and James K McDougall1,2,4

1Cancer Biology Program, Fred Hutchinson Cancer Research Center, Seattle, WA 98109-1024, USA; 2Departmentof Pathology, University of Washington, Seattle, WA 98195, USA

Progression to advanced-stage cervical carcinomas is Introduction characterized by a recurrent pattern of chromosomal rearrangements. Structural chromosome rearrangements Human cancers are subject to ongoing chromosomal are generated through the fusion of broken chromosome changes as a result of defects in the checkpoints that ends. These chromosome breaks may be induced by normally ensure stability of the genome. Two types of mutagenic agents such as ionizing radiation, or chromo- chromosomal instability are recognized: (1) aneuploidy, some ends may be exposed through extensive telomere or change in chromosome copy number and (2) shortening. The human papilloma virus oncogene 16E6 structural aberrations of chromosomes. Chromosomal induces telomerase activity in human keratinocytes, a instability is an early event in the development of human model system for cervical tumor formation. The present (Heselmeyer et al., 1996, 1997; Kirchhoff et al., 1999; study explores the relationship between 16E6 expression, Matthews et al., 2000) papillomavirus (HPV) associated telomerase activity, and chromosomal instability. We anogenital carcinoma. Epidemiological studies have show that the frequency of anaphase bridges is dependent determined that high-risk type HPVs are the main on the level of telomerase activity in 16E6/E7-expressing etiological factors for cervical cancer (Zur Hausen, clones, and is the result of telomere shortening. High 2002). Immortalization of human keratinocytes, which frequencies of anaphase bridges, associated with low are the natural host cells of HPV infection, is dependent telomerase activity, correlate with increased chromosome on expression of the HPV oncogenes E6 and E7 instability. Anaphase bridge formation is also associated (Hawley-Nelson et al., 1989; Mu¨ nger et al., 1989). The with the presence of micronuclei, which are shown to E7 oncoprotein inactivates the retinoblastoma tumor contain unstable chromosomes frequently involved in suppressor (Rb) and the cyclin-dependent kinase (CDK) rearrangements. As anaphase bridges are observed in inhibitor p21 (Dyson et al., 1989; Helt et al., 2002). both high and low telomerase 16E6/E7 clones, but not Inactivation of Rb and p21 overrides cellular senescence in hTERT-expressing control clones, expression of 16E6 by allowing expression of genes required for entry and in these immortalized clones is not sufficient to stabilize transit through the S phase (Demers et al., 1996; Jones shortened telomeres completely. We suggest a model in et al., 1997). The E6 oncoprotein targets tumor which HPV-induced tumorigenesis may be dependent on suppressor p53 for degradation (Scheffner et al., 1990; persistent bridge–breakage–fusion cycles that allow for Werness et al., 1990). Lack of p53, a transcription factor continued genomic rearrangements. which mediates the expression of a variety of genes that Oncogene (2004) 23, 3561–3571. doi:10.1038/sj.onc.1207388 induce a growth arrest or apoptosis, abrogates the cellular Published online 12 April 2004 response to DNA damage (Lakin and Jackson, 1999). Structural chromosome rearrangements are generated Keywords: human papillomavirus; telomere erosion; through the fusion of broken chromosome ends. When HPV 16E6; chromosomal instability; tumorigenesis; both chromosome fragments include a centromere, the anaphase bridges resulting dicentric chromosome is broken again when the two centromeres are pulled in opposite directions by the mitotic spindle apparatus. Unless the resulting chromosome fragments are stabilized, this process will repeat itself in a breakage–fusion–bridge (BFB) cycle (McClintock, 1941). Chromosome breaks may be *Correspondence: AW Plug-DeMaggio, Fred Hutchinson Cancer induced by mutagenic agents such as ionizing radiation, Research Center, Cancer Biology Program, 1100 Fairview Avenue or chromosome ends may be exposed through extensive N, Seattle, WA 98109-1024, USA; E-mail: [email protected] telomere shortening (reviewed in Lundblad, 2000). 3Current address: Department of Microbiology, University of Iowa, Telomere dysfunction as a result of telomere erosion 3-403 BSB, Iowa City, IA 52242, USA 4In memory of Jim McDougall, our mentor and our friend has been shown to trigger extensive DNA fragmentation Received 28 July 2003; revised 9 October 2003; accepted 20 November and evolution of complex chromosome abnormalities in 2003; Published online 12 April 2004 human malignant tumors (Gisselsson et al., 2001a, b). In Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3562 addition, telomeric erosion induced BFB cycles, which genomic rearrangements, in addition to a failure in the were shown to play an important role in epithelial mitotic spindle checkpoint, which results in aneuploidy. carcinogenesis in mice (Chang et al., 2001). Stabilization of telomere length is a critical event in the immortalization of human cells and is associated Results with telomerase activity (McEachern et al., 2000). Regulation of telomerase activity is dependent on the Anaphase bridges and nuclear abnormalities in human reverse-transcriptase component of telomerase, hTERT keratinocytes expressing the HPV oncogenes 16E6 (Meyerson et al., 1997; Nakamura et al., 1997). and E7 Previously, it has been demonstrated that HPV 16E6 can upregulate hTERT transcription (Veldman et al., To study the role of HPV oncogenes in the induction of 2001). The present study explores the relationship genomic instability, human foreskin keratinocyte cul- between expression of HPV 16E6, telomerase activity, tures were infected with retroviral constructs that and genomic instability. We show that the frequency of expressed either HPV 16E6 alone, 16E7 alone, or 16E6 anaphase bridges is dependent on the level of telomerase and E7 together. Following selection, both pooled activity in 16E6/E7-expressing clones, and is a result of populations and clones were passaged in culture. HPV telomere shortening. High frequencies of anaphase 16E6-, 16E7- and 16E6/E7-expressing clones growing in bridges, associated with low telomerase activity, corre- plates were fixed, stained with DAPI to visualize DNA, late with increased chromosome instability. Anaphase and examined using an inverted fluorescent microscope. bridge formation is associated with the presence of Previously described mitotic abnormalities in 16E6/E7 micronuclei, which are shown to contain unstable cells include multipolar metaphases and metaphases chromosomes frequently involved in rearrangements. with lagging chromosomes (Duensing et al., 2000; Plug- As anaphase bridges were observed in both high and low deMaggio and McDougall, 2002). Cytological observa- telomerase 16E6/E7 clones, but not in hTERT-expres- tions also indicate the frequent presence of anaphase sing control clones, expression of 16E6 in these bridges in cells expressing HPV oncogenes. Anaphase immortalized clones is not sufficient to stabilize shor- bridges form between daughter nuclei when the cen- tened telomeres completely. We suggest a model in tromeres of a dicentric chromosome are pulled in which HPV-induced tumorigenesis may be dependent opposite directions by the mitotic spindle (Figure on persistent BFB cycles that allow for continued 1a, b). These chromatin bridges are usually resolved

Figure 1 Abnormalities in HPV 16E6/E7-expressing keratinocytes. Fixed cells were stained with DAPI and examined using an inverted ﬂuorescent microscope. (a, b) Anaphase bridge. (c) Micronuclei in interphase. (d) Chromatin string between interphase nuclei

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3563 through chromosome breaks; however, they may also crisis; (2) high telomerase activity precrisis, reduced or remain as chromatin strings between two interphase low activity postcrisis; (3) low telomerase activity pre- cells (Figure 1d). Anaphase bridges are present at varying frequencies in cells expressing both 16E6 and E7 together, and become prominent around passage 15 a (Figure 2a). Cells expressing 16E7 alone have a 20 signiﬁcantly higher frequency of anaphase bridges than 18 cells expressing 16E6 alone at passage 15 (Figure 2b). 16 Following selection, the frequency of anaphase bridges 14 varies between 0 and 3.5% at passage 4, similar to 12 control HFKs (Figure 2a). This suggests that the 10 * * expression of 16E6 may not have a direct effect on the 8 formation of anaphase bridges. If anaphase bridge 6 4 frequencies would have been equally high at this early % anaphase bridges 2 passage as compared to later passages, a direct effect of 0 HPV 16E6 on the formation of these bridges, for 24579262728381739 example by inducing chromosome breaks, could have HPV 16E6/E7-clones been suspected. However, our data clearly indicate that p4 (*p8) p15 this is not the case. b Cytological analysis of 16E6- and/or 16E7-expressing 30 clones also revealed the occurrence of micronuclei in interphase cells. Micronuclei are formed by nuclear 25 membrane formation around either a lagging chromo- 20 some or chromosomal fragments (Figure 1c). A strong correlation exists between the frequency of anaphase 15 bridges and the frequency of micronuclei in clones expressing both 16E6 and E7 (Figure 2c). Interestingly, 10 while cells expressing 16E7 alone have a high frequency % anaphase bridges of anaphase bridges, the frequency of micronuclei is low 5 compared to cells expressing 16E6 alone (Figure 2d). 0 12 13 24 43 49 6 12 21 43 47 48 Frequent anaphase bridges and micronuclei in cells with HPV 16E6 clones HPV 16E7 clones low telomerase activity c 12 Stabilization of telomere length is a critical event in the immortalization of human cells and is associated with 10 telomerase activity (McEachern et al., 2000). Expression of the HPV oncogene 16E6 induces telomerase activity 8 and extends telomere length in human keratinocytes 6 (Kiyono et al., 1998). However, levels of telomerase activity at early passage vary widely in E6-expressing 4 clones (Klingelhutz, unpublished data). To identify % micronuclei 2 16E6/E7-expressing clones with high or low telomerase activity, telomerase activity was measured both pre- and 0 postcrisis in 38 clones using the telomere repeat 0 5 10 15 20 ampliﬁcation protocol (TRAP). Based on this, indivi- % anaphase bridges dual clones could be assigned to one of the following HPV 16E6/E7 categories: (1) high telomerase activity pre- and post- d 12

Figure 2 (a) Frequency of anaphase bridges in 16E6/E7-expres- 8 sing clones. Fixed cells were stained with DAPI and examined using an inverted ﬂuorescent microscope. For each cell line, at least 6 200 anaphases were scored for abnormalities. Analysis of all cell lines was performed at an early passage p4 or p8, and at a later 4

passage (p15). (b) Frequency of anaphase bridges in keratinocyte % micronuclei clones expressing either 16E6 or 16E7. (c) Relationshipbetween 2 anaphase bridges and micronuclei in keratinocytes expressing both 0 16E6 and 16E7. A strong correlation is seen between the presence 0 5 10 15 20 25 30 of anaphase bridges and micronuclei (Pearson’s correlation % anaphase bridges quotient: r ¼ 0.93; Po0.0001). (d) Relationshipbetween anaphase bridges and micronuclei in keratinocytes expressing either 16E6 or HPV 16E7 16E7 HPV 16E6 hTERT

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3564 a 16E6/E7 clones: 4217 267 28 −+

b 25

15 Figure 4 Relative expression levels of hTERT and 16E6 measured

% by quantitative PCR in 16E6/E7 clones with either high (clones 2, 10 28, 38) or low (clones 4, 17, 26) telomerase activity. The cervical cancer cell line QGU was also included. As a control, GADPH expression was measured (data not shown) 5

0 low telomerase high telomerase clones, and appears to be dependent on the level of Anaphase Bridges Micronuclei telomerase activity (Figure 3b). Regulation of telomerase activity is dependent on the reverse-transcriptase Figure 3 (a) TRAP assay for telomerase activity in postcrisis (p15) component of telomerase, hTERT (Meyerson et al., HFK 16E6/E7 clones. Clones 4, 17, and 26 show significantly less 1997; Nakamura et al., 1997). Previously, it has been telomerase activity than clones 2, 28, and 38 (À negative control, þ positive control). (b). Comparison of the frequency of anaphase demonstrated that HPV 16E6 can upregulate hTERT bridges and micronuclei in either clones with low telomerase transcription (Veldman et al., 2001). Three low telomer- activity (clones 4, 17, 26) or clones with a high telomerase activity ase 16E6/E7 clones (clones 4, 17, 26), and three high (clones 2, 7, 28) telomerase 16E6/E7 clones (clones 2, 28, 38) were assayed for the level of expression of 16E6 and hTERT and postcrisis. Figure 3a shows the postcrisis TRAP by quantitative real-time PCR (Figure 4). The cervical assay results for six of these clones, which were found to cancer cell line QGU, which contains a single HPV16 have either a consistently low telomerase activity (clones integration site, was included as a control because the 4, 17, 26), or a consistently high telomerase activity level of 16E6 expression was expected to fall within the (clones 2, 7, 28). Significantly more anaphase bridges range of the 16E6/E7 clones. Clearly, 16E6/E7 with low and micronuclei are found in clones with low telomerase telomerase activity express significantly less hTERT activity as compared to the high telomerase clones than clones with high telomerase activity. Two of the (Figure 3b). low telomerase clones (clones 4, 17) also have the lowest level of 16E6 expression, indicating that low levels of 16E6 may be limiting the upregulation of hTERT Anaphase bridges are associated with low levels of expression. However, E6 expression appears to be hTERT expression and telomere shortening similar in some high (clones 2, 38) and low telomerase Figure 2a illustrates that the frequency of anaphase clones (clone 26), and the cervical cancer cell line QGU bridges varies widely in individual 16E6/E7-expressing has a relatively high telomerase activity despite having a

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3565 low level of 16E6 expression. These results suggest that telomere signal in a 16E6/E7 clone with low telomerase other factors may also play a role in telomerase activity (clone 17) was significantly reduced compared to activation. A previous study has shown an increase of that of a clone with high telomerase activity (clone 28; telomerase activation without an increase of E6 expres- Figure 5b, c; P ¼ 0.05). Telomere and centromere sion in cervical cells expressing 16E6 and E7 (Baege fluorescence intensity (in arbitrary units) was calculated et al., 2002). from digital images, as described before (O’Sullivan To confirm that anaphase bridges are associated with et al., 2002). Telomere intensity values were normalized telomere erosion in cells expressing HPV oncogenes, for centromere intensity, which is expected to be the telomere shortening was compared in 16E6/E7-expres- same in both cell lines analysed. sing clones with either high or low telomerase activity. Previous studies have shown that clones with high Expression of hTERT eliminates anaphase bridges telomerase activity have maintained telomere length, while clones with low telomerase activity show signifi- Anaphase bridge formation has been shown to be the cant shortening of telomeres (Klingelhutz et al., 1996). result of telomeric erosion (Gisselsson et al., 2001a, b); Telomere length was assayed by Southern blot analysis however, others have suggested that HPV 16E6 and E7 at passage 4 and passage 16. All clones that were can each induce anaphase bridge formation before a determined to have low telomerase activity pre- and critical reduction of telomere length (Duensing and postcrisis show a significant reduction in telomere length Mu¨ nger, 2002). To determine whether the observed (Figure 5a). Clones that were determined to have high anaphase bridges are a result of telomere shortening or telomerase activity pre- and postcrisis show no reduc- a direct effect of the expression of 16E6, low telomerase tion in overall telomere length. These results were 16E6/E7 clones were transfected with hTERT, and confirmed by telomere FISH analysis. On average, the analysed for the presence of anaphase bridges. Cells

Figure 5 Telomere shortening in clones with low telomerase activity. (a) Southern analysis. Average telomere shortening is indicated with a red line and was determined by comparing the median of the telomere length. Low telomerase clones (4, 17, 27, 39) show a clear reduction in telomere length. (b) Telomere FISH. Cells from a low telomerase 16E6/E7 clone show a reduced telomere signal (green) compared to cells from a high telomerase 16E6/E7 clone. Cohybridization with a centromere-specific probe (red) provides a control for hybridization efficiently. (c) Telomere fluorescence intensity in low and high telomerase 16E6/E7 clone

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3566 expressing only 16E7 were also transfected with hTERT bridges will now go undetected/unrepaired and result in to determine the role of 16E7 in the formation of an increase of cells carrying broken chromosomes. This anaphase bridges. In addition, hTERT-expressing cell may very well be reflected by the minor increase in lines were transfected with 16E6 and monitored for the anaphase bridge formation. Keratinocytes expressing presence of anaphase bridges. The results of these 16E7 do not have any telomerase activity; however, experiments are summarized in Figure 6a. The expres- deactivation of Rb functioning allows these cells to sion of hTERT in low telomerase 16E6/E7 clones cycle, which is associated with a dramatic reduction in decreases the frequency of anaphase bridges signifi- telomere length (Kiyono et al., 1998), and a high cantly, consistent with a model in which low telomerase frequency of anaphase bridges (Figure 2b). Subsequent activity induces a bridge–breakage cycle. The real-time expression of hTERT in these cells reduces the rtPCR data in Figure 6b show that the expression of frequency of anaphase bridges significantly, again hTERT is significantly higher in the 16E6/E7-hTERT linking telomere functioning with the occurrence of cell line compared to the 16E6/E7-26 cells. The anaphase bridges. expression of 16E6 in hTERT-immortalized keratinocytes slightly increases the frequency of anaphase bridge formation to the levels observed in 16E6/E7-clones with Low levels of telomerase activity correlate with increased a high telomerase activity (approximately 3%). It is well chromosome instability documented that 16E6 targets the tumor suppressor p53 for degradation. Consequently, when 16E6 is expressed Anaphase bridges are formed when the centromeres of a in hTERT cells that have a low background level of dicentric chromosome are pulled towards opposite anaphase bridges, the DNA damage caused by anaphase spindle poles. Dicentric chromosomes were found in all E6/E7 clones examined (data not shown). The occurrence of anaphase bridges and dicentric chromosomes in these cells suggests ongoing chromosome fragmentation and accumulation of structural chromosome rearrangements in the presence of telomerase activity. To determine if there is a correlation between telomerase activity and accumulation of structural chromosome rearrangements, the frequency of chromosome rearrangements was measured in E6/E7 clones with varying levels of telomerase activity (as shown in Figure 3). Specific chromosome rearrangements were examined by interphase FISH using paired arm and centromere probes for chromosomes 7, 8, 11, and 17 (Figure 7a). Normal nuclei, or aneuploid nuclei that do not contain chromosomal rearrangements, will have a 1 : 1 centromere to arm ratio. Structural rearrangements will result in an abnormal centromere/arm ratio (Figure 7b). The percentage of abnormal centromere/ arm ratio was plotted against the frequency of anaphase bridges, a marker for excessive telomere erosion (Gisselsson et al., 2001a, b). A strong correlation between the frequency of anaphase bridges and frequency of chromosome rearrangements was found for chromosome 11 (r ¼ 0.97, P ¼ 0.003; Figure 7c) and 17 (r ¼ 0.88, P ¼ 0.04; Figure 7d); E6/E7 clones with a low frequency of anaphase bridges have fewer chromosomal abnormalities than clones with a high frequency of anaphase bridges. A good correlation between the percentage of anaphase bridges and chromosome rearrangements was also found for chromosome 8 (r ¼ 0.91, P ¼ 0.05; Figure 7e). Interestingly, E6/E7 Figure 6 (a) Expression of hTERT eliminates anaphase bridges. clones with a high frequency of anaphase bridges Low-telomerase 16E6/E7 clone #26 and a no-telomerase 16E7 showed an exceptionally high frequency of chromosome clone were transfected with hTERT, and analysed for the presence of anaphase bridges. Cells from a single clone were subjected to 8 rearrangements (40–50%). No correlation between the transfection. Following appropriate selection, the pooled cell percentage of anaphase bridges and chromosome population was examined for anaphase bridge frequencies. rearrangements was found for chromosome 7 (r ¼ 0.32, Expression of transfected genes was confirmed by rtPCR. P ¼ 0.32; Figure 7f). However, because the distance hTERT-expressing cell lines were transfected with 16E6 and monitored for the presence of anaphase bridges. The frequency between the centromere and the arm probe is short of anaphase bridges pre- and post-transfection is shown. (b) compared to the other probe pairs tested, fewer breaks Expression of hTERT and 16E6 was verified by real-time rtPCR are expected to occur between the two probes.

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3567 ab

11p11-q11 17p11-q11 11q13 17q21-q22

Chromosome 11 Chromosome17

7p12 8p11-q11 7p11-q11

8q24

Chromosome 8 Chromosome 7

P = 0.04 c Chromosome 11 P = 0.003 d Chromosome 17 r = 0.97 r = 0.88

15 ratio ratio 10

5 % abnormal centromere/arm % abnormal centromere/probe 0 0 5 10 15 20 0 5 10 15 20

% anaphase bridges % anaphase bridges

Chromosome 8 P = 0.05 Chromosome 7 e f P = 0.32 r = 0.91 r = 0.67 50 20 45 18 40 16 35 14 30 12 25 10 ratio 20 ratio 8 15 6 10 4 5 2 % abnormal centromere/arm % abnormal centromere/arm 0 0 0 51015 20 0 5 101520

% anaphase bridges % anaphase bridges Figure 7 Low telomerase activity correlates with increased chromosome instability in 16E6/E7-expressing clones. (a) Diagram of paired centromere/arm probes for chromosomes 11, 17, 8, and 7. (b) Interphase FISH with a centromere (green) and arm (red) probe for chromosome 11. Arrows indicate nuclei with abnormal centromere/arm ratio. (c–f) Percentages of cells with abnormal arm/ centromere ratio plotted against anaphase bridge frequency for individual 16E6/E7-expressing clones

Micronuclei contain chromosomes frequently involved and unstable chromosomes (Ford et al., 1988). There- in rearrangements fore, chromosomes that are more frequently involved in chromosomal rearrangements are likely to be over- Micronuclei are recognized as indicators of genomic represented in micronuclei. To determine the chromo- instability, and are associated with chromosome loss somal content of micronuclei in 16E6/E7-expressing

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3568 clones, cells were grown on slides and ﬁxed following involving chromosome 21 were found in both clones hypotonic treatment. For each slide, two areas were 17 and 26. Chromosomes 3 and 8 were found to be hybridized with two differentially labeled whole chro- involved in rearrangements in all three clones examined mosome paints. Micronuclei were scored by a blinded (Figure 9c, d). examiner as either negative, green, or red (Figure 9a, b; 200 micronuclei per chromosome pair were analysed for each cell line (clones 4, 17, and 26)). In addition, Discussion metaphases on the same slide were examined for chromosome rearrangements involving the painted The development of malignant tumors is associated with chromosomes. The data summarized in Figure 8a show the accumulation of genomic changes and is dependent that although all chromosomes can be contained in on the failure of mitotic checkpoints. Although in many micronuclei, some chromosomes are represented at a cases the outcome of an abnormal cell division may not signiﬁcantly higher frequency than others in at least two be compatible with cell survival, those cells that do of the clones examined. For example, chromosomes 3 continue to proliferate may have gained a selective and 4 are present in more than 10% of micronuclei in all advantage. Mechanisms such as the BFB cycle could three clones. Chromosomes 5, 8, and 21 are found in provide ongoing genomic instability allowing for the more than 10% of micronuclei in two of the three continuous generation and selection of cells with clones. These results suggest a nonrandom exclusion of increasingly tumorigenic characteristics. chromosomes or chromosome fragments into micro- The E6 and E7 oncogenes from the high-risk HPV nuclei. On average, chromosomes 3 and 8 are most likely types associated with anogenital neoplasia have been to be contained in micronuclei (15.5, 13.5%, respectively). Table 1 summarizes the frequency of involve- ment in chromosomal rearrangements for each chromosome. When comparing these data to the data presented in Figure 8a, it becomes apparent that chromosomes frequently found in micronuclei are also more frequently involved in chromosomal rearrangements. For example, chromosome 21 is detected at a high frequency in micronuclei in clones 17 and 26 (20.1 and 12.1%, respectively), but only in 4.5% of micronuclei in clone 4. In clone 4, chromosome 21 is not involved in chromosomal rearrangements; however, frequent rearrangements (45% of all metaphases)

#4 #17 #26 25

10 % of micronuclei 5

0 12345678910111213141516171819202122XY Figure 9 FISH analysis of micronuclei and metaphases. (a) Whole Figure 8 Micronuclei contain chromosomes frequently involved chromosome paint for chromosome 3; one micronucleus contains in rearrangements. (a) Chromosomal content of micronuclei in chromosome 3 material (red). (b) Whole chromosome paint for 16E6/E7-expressing clones with low telomerase activity (4, 17, 26) chromosome 8, opposing micronuclei both contain chromosome 8 was determined by FISH using whole chromosome paints for all material (red). (c) Chromosome 3 WCP (red) and chromosome 3 chromosomes. Two chromosomes per hybridization were analysed, centromere probe (yellow). Metaphase cell with three normal and micronuclei were scored as either red, green, or negative. (b) copies of chromosome 3 and one acentric fragment. (d) Chromo- Frequency of structural rearrangements for each chromosome in some 3 WCP (red) and chromosome 3 centromere probe (yellow). HPV 16E6/E7 clones with low telomerase activity. 1- -rare, o5% of Several rearrangements involving chromosome 3 (arrows), in all metaphases, 2 þ 45% of all metaphases addition to normal copies of chromosome 3 (arrowheads)

Table 1 Chromosome rearrangements in 45% of metaphases 1 2 3 4 5 6 7 8 9 10111213141516171819202122XY

À4 ÀÀ++++À + ÀÀ+ À + ÀÀ+ ÀÀÀÀÀÀÀÀ À17 À ++++ÀÀ++ÀÀÀÀÀÀ+ ÀÀÀÀ+ ÀÀÀ À26 ÀÀ+++ÀÀ+ ÀÀÀÀÀÀÀÀÀÀÀ++ÀÀÀ

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3569 clearly shown to abrogate the cell cycle checkpoints The results show, however, that even high levels of regulated by p53 and Rb (Zur Hausen, 2002). Cells telomerase activity in 16E6/E7 cells are not as protective infected by HPV can continue replication despite the of telomere integrity as is transfection of hTERT. The acquisition of genomic damage. A further contribution occasional formation of dicentric chromosomes in these to survival of the consequently abnormal cell is the cells may trigger a continuous BFB cycle, generating induction of telomerase activity, also a property of the chromosomal rearrangements at each subsequent cell E6 oncogene (Klingelhutz et al., 1996). Immortalization division. of human cells by expressing the HPV oncogenes has A clear correlation between telomerase activity and been described in detail (Mu¨ nger et al., 1989; Kiyono chromosomal rearrangements is found in 16E6/E7- et al., 1998); however, the mechanisms leading to expressing clones (Figure 7). While very low telomerase malignancy are still under investigation. activity in HPV-infected cells may not be sufficient to The current study identifies one mechanism by which overcome crisis as a result of critical telomere short- chromosomal rearrangements can occur in HPV trans- ening, a very high level of telomerase activity will fected cell lines as the BFB cycle, which is initiated completely stabilize telomere length and reduce chro- through excessive telomere shortening. The link between mosomal rearrangements. HPV-induced tumorigenesis chromosomal instability and telomere erosion has been may be dependent on a level of telomerase activity that well established (Maser and dePinho, 2002). Telomere will balance both cell survival and continued genomic erosion triggers chromosome fragmentation through changes allowing for the gradual accumulation of persistent bridge–breakage events in human malignant genetic changes in favor of tumor initiation and tumors (Gisselsson et al., 2000, 2001a, b). In p53 mutant progression, and selection of more aggressive traits such mice lacking the telomerase RNA component (mTerc), as the ability to invade surrounding tissues and excessive telomere shortening resulted in epithelial metastasize. cancers characterized by numerous complex unbalanced A previous report found that nuclear abnormalities translocations (Artandi et al., 2000). In those same mice, such as micronuclei and chromatin bridges are more a strong correlation between telomere erosion and the frequent in tumors that contain dicentric chromosomes number of anaphase bridges was found (Rudolph et al., and telomere associations than in tumors with only 2001). Correlation between chromosomal instability and stable chromosomal rearrangements (Gisselsson et al., telomere erosion was demonstrated in human fibroblasts 2001b). In irradiated cells, a strong correlation was expressing HPV 16E6 (Filatov et al., 1998). In human found between the frequencies of nuclear irregularities keratinocyte clones expressing the HPV oncogenes 16E6 and the proportion of cells exhibiting mitotically and 16E7, the frequency of anaphase bridges is unstable chromosomes and anaphase bridges. This dependent on the level of telomerase activity. Clones relationshipbetween nuclear abnormalities, for exam- with low telomerase activity display a high frequency of ple, micronuclei, and anaphase bridges is also evident in anaphase bridges, which is associated with telomere human keratinocytes expressing HPV 16E6/E7 shortening and chromosomal rearrangements. Ana- (Figure 2). It has been suggested that micronuclei may phase bridge frequencies are highest in cells expressing originate from acentric chromosome fragments, either HPV 16E7, which is not surprising considering no resulting from double-strand DNA damage before cell telomerase activity is detected in these cells. HPV 16E7- division, or after the breakage of anaphase bridges. expressing clones typically become senescent around Further studies will determine the origin and fate of passage 20. The expression of hTERT in a low the micronuclei observed in HPV oncogene-expressing telomerase 16E6/E7 clone reduced the number of keratinocytes. However, the observation that unstable anaphase bridges, confirming the link between bridge chromosomes are more likely to be contained in formation and telomere erosion. Thus, our data strongly micronuclei is consistent with a model in which a suggest that anaphase bridges are not a direct conse- continuous BFB cycle provides ongoing genomic quence of the expression of HPV oncogenes as has been instability at a level that does not affect overall viability. suggested previously (Duensing and Mu¨ nger, 2002), but In addition, the chromosomal abnormalities detected instead an indirect consequence of telomere shortening are highly heterogeneous and often nonclonal, consis- in cells with abrogated DNA damage checkpoints. An tent with an underlying cause of instability rather than argument could be made that the elimination of p53 by clonal expansion. 16E6, which allows for the continued passaging of cells with shortened telomeres, directly results in the forma- Materials and methods tion of anaphase bridges. Nevertheless, anaphase bridges only appear after continued passaging, and are Cell culture and retroviral transfections clearly associated with significant telomere shortening. Also, we show that 16E7 cells, which have normal p53 Normal human keratinocytes were prepared from human levels, have a very high frequency of anaphase bridges. foreskin samples and infected with amphotropic retroviruses as described previously (Klingelhutz et al., 1996). The These observations argue against a direct effect of the retroviral LXSN vector contained either HPV16E6 alone, lack of p53 in the formation of anaphase bridges. HPV 16E7 alone, HPV 16E6 and E7 together, or hTERT. Possibly, telomere erosion initiates the formation of Infected cells were selected with G418 (50 mg/ml) for 7–10 days. anaphase bridges, and the lack of p53 promotes Clones were isolated by cylinder isolation of colonies. continued chromosomal instability. Keratinocytes were maintained in Epilife (Cascade Biologics).

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3570 An HPV 16E7-expressing clone and an HPV 16E6/E7- scriptase according to manufactures protocol (ABI). Each real- expressing clone 26 were subsequently transfected with LXSH- time PCR was carried out with 20 ng of the reverse hTERT, and selected with hygromycin (8 mg/ml) for 7–10 days. transcription product in 34 cycles. The following primers and An hTERT clone was transfected with LXSH-16E6 and probes were used: selected with hygromycin (8 mg/ml) for 7–10 days. 16E6 probe: (6-FAM)-caggagcgacccagaaagttaccacagtt- Immunofluorescence (DQ) (Tm ¼ 691C) 1 Mitotic abnormalities were analysed by fixing cells growing in 16E6 forward: gagaactgcaatgtttcaggacc (Tm ¼ 59 C) 1 tissue culture plates with AFA (400 ml 70% ethanol, 40 ml 16E6 reverse: tgtatagtttgcagctctgtgc (Tm ¼ 60 C) 37% formaldehyde, 20 ml glacial acetic acid), rinsed with PBS, hTERT and GAPDH probes and primers were purchased and stained with DAPI (2 mg/ml). Cells were examined and from ABI. Reactions were carried out with 1 Â TaqMan imaged using a Nikon inverted fluorescent microscope Universal MasterMix (ABI) and 1 Â Target PrimerMix equipped with a computer-operated cooled CCD camera. (hTERT and GAPDH), or 1 Â TaqMan Universal MasterMix Images were manipulated using Metamorph (Universal and 300 nM forward and reverse 16E6 primer and 100 nM 16E6 Imaging Corporation) and/or Adobe Photoshop software. TaqMan probe. Assays were performed in duplicate using the GeneAmp9600. Data were analysed with the SDS 1.9.1 TRAP assay software. Telomerase activity of cell extracts was analysed by telomeric repeat amplification protocol (TRAP) assay using the TRA- Fluorescent in situ hybridization Peze telomerase detection kit (Intergen) and radioisotopic To determine changes in centromere/arm ratio the following detection of the TS primer. Reaction products were visualized chromosome arm probes were used according to the manu- by running samples on a 10% polyacrylamide gel using a facturer’s protocol (Vysis): PhosphoImager Screen. Chromosome arm probes: Telomere length assays LSI EGFR (7p12), LSI C-MYC (8q24.12–q24.13), LSI Cyclin For Southern blotting, genomic DNA from cultures cells was D1 (11q13), and LSI TOP2A (17q21–q22). isolated by standard methods. Telomere length was deter- Centromere probes: mined by telomere restriction fragment (TRF) Southern blot CEP 7, CEP 8, CEP 11, and CEP 17. analysis using a radioactive-labeled (TTAGGG) probe as To determine the chromosomal content of micronuclei and described previously (Klingelhutz et al., 1994). For telomere chromosomal rearrangements in metaphase cells, a whole fluorescence analysis, cultured cells were harvested and chromosome paintbox was used according to the manufac- incubated in 0.075 M KCl, fixed in methanol–acetic acid turer’s protocol (Vysis). In addition, a centromere probe (3 : 1), and dropped onto microscope slides. FISH was carried specific for chromosome 3 was used (Vysis). For both out as described before (O’Sullivan et al., 2002). Digitized interphase and metaphase FISH, cells were grown on slides images of the slides were obtained using a Leica confocal and exposed to a hypotonic medium consisting of 0.075 M KCl microscope; for all images the settings remained constant. To and 0.8% sodium citrate (1 : 1) for 25 min at 371C. Fixative quantitate the telomere FISH results, images were analysed (3 : 1 methanol : acetic acid) was added (0.5 vol of hypotonic using Optima software (Media Cybernetics). medium), and then replaced with 100% fixative after 5 min. Slides were kept in a fixative at 41C overnight and dried. Quantitative PCR Total RNA was extracted using the RNAqueous-4PCR kit Acknowledgements (Ambion). First-strand cDNA was synthesized from 2 mgof We thank Drs J O’Sullivan and K Gollahon, and M Pearlman total RNA by reverse transcriptase using MultiScribe tran- for assistance in performing telomere length FISH.

References

Artandi SE, Chang S, Lee SL, Alson S, Gottlieb GJ, Chin L Ford JH, Schultz CJ and Correll AT. (1988). Am. J. Hum. and DePinho RA. (2000). Nature, 406, 641–645. Genet., 43, 733–740. Baege AC, Berger A, Schlegel R, Veldman T and Schlegel R. Gisselsson D, Bjork J, Hoglund M, Mertens F, Dal Cin P, (2002). Am. J. Pathol., 160, 1251–1257. Akerman M and Mandahl N. (2001a). Am. J. Pathol., 158, Chang SC, Khoo C and DePinho RA. (2001). Sem. Cancer 199–206. Biol., 11, 227–238. Gisselsson D, Jonson T, Petersen A, Strombeck B, Dal Cin P, Demers GW, Espling E, Harry JB, Etscheid BG and Galloway Hoglund M, Mitelman F, Mertens F and Mandahl N. D. (1996). J. Virol., 70, 6862–6869. (2001b). Proc. Natl. Acad. Sci. USA, 98, 12683–12688. Duensing S and Mu¨ nger K. (2002). Cancer Res., 62, Gisselsson D, Pettersson L, Hoglund M, Heidenblad M, 7075–7082. Gorunova L, Wiegant J, Mertens F, Dal Cin P, Mitelman F and Duensing S, Lee LY, Duensing A, Basile J, Piboonniyom S, Mandahl N. (2000). Proc.Natl.Acad.Sci.USA, 97, 5357–5362. Gonzalez S, Crum CP and Mu¨ nger K. (2000). Proc. Natl. Hawley-Nelson P, Vousden KH, Hubbert NL, Lowy DR and Acad. Sci. USA, 97, 10002–10007. Schiller JT. (1989). EMBO J., 8, 3905–3910. Dyson N, Howley PM, Mu¨ nger K and Harlow E. (1989). Helt AM, Funk JO and Galloway DA. (2002). J. Virol., 76, Science, 243, 934–937. 10559–10568. Filatov L, Golubovskaya V, Hurt JC, Byrd LL, Heselmeyer K, Macville M, Schrock E, Blegen H, Hellstrom Phillips JM and Kaufmann WK. (1998). Oncogene, 16, A-C, Shah K, Auer G and Ried T. (1997). Genes 1825–1838. Chromosomes Cancer, 19, 233–240.

Oncogene Chromosomal instability in the development of HPV AW Plug-DeMaggio et al 3571 Heselmeyer K, Schrock E, du Manoir S, Blegen H, Shah K, Meyerson M, Counter CM, Eaton EN, Elissen LW, Steiner P, Steinbeck R, Auer G and Ried T. (1996). Proc. Natl. Acad. Caddle SD, Ziaaugra L, Beijersbergen RL, Davidoff MJ, Sci. USA, 93, 479–484. Liu Q, Bacchetti S, Haber DA and Weinberg RA. (1997). Jones DL, Alani RM and Mu¨ nger K. (1997). Genes Dev., 11, Cell, 90, 785–795. 2101–2111. Mu¨ nger K, Phelps WC, Bubb V, Howley PM and Schlegel R. Kirchhoff M, Rose H, Petersen BL, Maahr J, Gerdes T, (1989). J. Virol., 63, 4417–4421. Lundsteen C, Bryndorf T, Kryger-Baggesen N, Christensen Nakamura TM, Morin GB, Chapman KB, Weinrich SL, L, Engelholm SA and PhilipJ. (1999). Genes Chromosomes Andrews WH, Lingner J, Harley CB and Cech TR. (1997). Cancer, 24, 144–150. Science, 277, 955–959. Kiyono T, Foster SA, KoopJI, McDougall JK, Galloway DA O’Sullivan JN, Bronner MP, Brentnall TA, Finley JC, Shen and Klingelhutz AJ. (1998). Nature, 396, 84–88. WT, Emerson S, Emond MJ, Gollahon KA, Moskovitz AH, Klingelhutz AJ, Barber SA, Smith PP, Dyer K and McDougall Crispin DA, Potter JD and Rabinovitch PS. (2002). Nat. JK. (1994). Mol. Cell. Biol., 14, 961–969. Genet., 32, 280–284. Klingelhutz AJ, Foster SA and McDougall JK. (1996). Nature, Plug-deMaggio AW and McDougall JK. (2002). Oncogene, 21, 380, 79–82. 7507–7513. Lakin ND and Jackson SP. (1999). Oncogene, 18, 7644– Rudolph KL, Millard M, Bosenberg MW and DePinho RA. 7655. (2001). Nat. Genet., 28, 155–159. Lundblad V. (2000). Mutat. Res., 451, 227–240. Scheffner M, Werness BA, Huibregtse JM, Levine AJ and Maser RS and DePinho RA. (2002). Science, 297, 565–569. Howley PM. (1990). Cell, 63, 1129–1136. Matthews CP, Shera KA and McDougall JK. (2000). Proc. Veldman T, Horikawa I, Barrett JC and Schlegel R. (2001). Soc. Exp. Biol. Med., 223, 316–321. J. Virol., 75, 4467–4472. McClintock B. (1941). Genetics, 26, 234–282. Werness BA, Levine AJ and Howley PM. (1990). Science, 248, McEachern MJ, Krauskopf A and Blackburn EH. (2000). 76–79. Annu. Rev. Genet., 34, 331–358. Zur Hausen H. (2002). Nat. Rev. Cancer, 2, 342–350.

Oncogene