DOCSLIB.ORG

Amphiregulin Is a Critical Downstream Effector of Estrogen Signaling in Era-Positive Breast Cancer Esther A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Amphiregulin Is a Critical Downstream Effector of Estrogen Signaling in Era-Positive Breast Cancer Esther A Published OnlineFirst November 2, 2015; DOI: 10.1158/0008-5472.CAN-15-0709 Cancer Molecular and Cellular Pathobiology Research Amphiregulin Is a Critical Downstream Effector of Estrogen Signaling in ERa-Positive Breast Cancer Esther A. Peterson1, Edmund C. Jenkins1, Kristopher A. Lofgren1,2, Natasha Chandiramani1, Hui Liu1, Evelyn Aranda1, Maryia Barnett1,and Paraic A. Kenny1,2 Abstract Estrogen stimulation promotes epithelial cell proliferation in enriched in ERa-positive humanbreast tumor cells and required for estrogen receptor (ERa)-positive breast cancer. Many ERa target estrogen-dependent growth of MCF7 tumor xenografts. Further- genes have been enumerated, but the identities of the key effectors more, amphiregulin levels were suppressed in patients treated with mediating the estrogen signal remain obscure. During mouse endocrine therapy. Suppression of EGF receptor signaling appeared mammary gland development, the estrogen growth factor receptor necessary for the therapeutic response in this setting. Our (EGFR) ligand amphiregulin acts as an important stage-specific findings implicate amphiregulin as a critical mediator of the effector of estrogen signaling. In this study, we investigated the role estrogen response in ERa-positive breast cancer, emphasizing the of amphiregulin in breast cancer cell proliferation using human importance of EGF receptor signaling in breast tumor pathogenesis tissue samples and tumor xenografts in mice. Amphiregulin was and therapeutic response. Cancer Res; 75(22); 1–9. Ó2015 AACR. Introduction receptor (EGFR), is induced during the proliferative phase of mouse pubertal mammary growth, where it is a direct transcriptional Estrogen is an essential hormone for mammary gland devel- target of ERa (6, 7). Mammary glands of amphiregulin knockout opment and is a key driver of proliferation during the develop- þ mice have a striking defect in pubertal epithelial outgrowth but ment of estrogen receptor–positive (ERa ) breast tumors. The retain the ability to undergo differentiation during pregnancy, actions of estrogen are primarily mediated by its receptor, the ERa indicating a stage-specific requirement (8). This phenotype is transcription factor, which is required for mammary gland devel- À À rescued by cotransplantation of wild-type and Areg / mammary opment (1). Microarray and chromatin immunoprecipitation epithelialcells (6).Thus, amphiregulin appears tobea keymediator experiments have identified several hundred estrogen-responsive of estrogen action during normal mammary gland development. genes in breast cancer cells (2, 3); however, among these targets, Studies of human breast cancer cell lines indicate that the identity of the key effectors of this proliferative signal in breast amphiregulin is induced by estrogen treatment (9), and that cancer remains unclear. A more detailed understanding of the its experimental overexpression can confer EGF signaling self- mechanisms involved will provide insight into the processes þ sufficiency (10), but whether endogenous amphiregulin plays driving ERa breast tumor initiation and progression. an important role in the estrogen-dependent proliferation of Analysis of human mammary glands demonstrated that it is the þ þ human breast cancer cells remains unknown. In this study, we test epithelial cells adjacent to ERa cells (rather than the ERa cells the hypothesis that co-option of this key stage-specific mammary themselves) which enter the cell cycle following estrogen stimula- developmental pathway might be the primary driver of estrogen- tion (4), implicating an estrogen-responsive paracrine growth þ dependent proliferation of ERa human breast cancer cells. factor in proliferation control. In the mouse, mammary gland development from ERa-deficient cells can be rescued by cotrans- planting with wild-type mammary epithelial cells, supporting a role Materials and Methods for a paracrine factor (5). We and others have previously reported Cell culture that amphiregulin (AREG), a ligand of the estrogen growth factor MCF-7, T47D, and ZR751 were obtained from ATCC, and independently validated by STR profiling at our institution. These cell lines were cultured in DMEM (Cellgro) with 10% FBS 1Department of Developmental and Molecular Biology, Albert Einstein (Hyclone). Suppression of AREG expression was achieved by 2 College of Medicine, Bronx, New York. Oncology Research Labora- lentiviral infection with two independent pLKO.1 constructs with tory, Kabara Cancer Research Institute, Gundersen Medical Founda- tion, La Crosse, Wisconsin. the following sequences: shAREG-1, cactgccaagtcatagccata; shAREG-2, gaacgaaagaaacttcgacaa; or the empty vector control. Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). For three-dimensional (3D) culture and in vivo experiments, FACS sorting was used to enrich for cells from shRNA-transduced pools Corresponding Author: Paraic A. Kenny, Oncology Research Laboratory, which lacked cell surface amphiregulin. Kabara Cancer Research Institute, Gundersen Medical Foundation, La Crosse, WI 54601. Phone: 608-775-3918; Fax: 608-775-6602; E-mail: Quantitative reverse transcriptase PCR [email protected] Total RNA was isolated using the RNeasy Mini Kit (Qiagen) doi: 10.1158/0008-5472.CAN-15-0709 following the manufacturer's instructions. One microgram of Ó2015 American Association for Cancer Research. RNA was used for cDNA synthesis using the ImProm-II Reverse www.aacrjournals.org OF1 Downloaded from cancerres.aacrjournals.org on September 25, 2021. © 2015 American Association for Cancer Research. Published OnlineFirst November 2, 2015; DOI: 10.1158/0008-5472.CAN-15-0709 Peterson et al. Transcriptase (Promega) in a 20-mL total reaction volume. Rela- for MCF7 and 625 cells/cm2 for T47D and ZR751. Cells were tive expression levels were determined by qPCR assays performed seeded in DMEM supplemented with 1% charcoal/dextran- on a Bio-Rad IQ5 Multicolor Real-Time PCR Detection System stripped FBS (Gemini Bioproducts), 0.292 mg/mL L-glutamine, using primers for AREG (50-tgatcctcacagctgttgct-30 and 50-tggct- 1Â nonessential amino acids, 10.11 mg/mL sodium pyruvate, atgacttggcagtga-30), and GAPDH (50-cccactcctccacctttgac-30 and 100 IU/mL penicillin, 100 mg/mL of streptomycin (Hyclone), and 50-cataccaggaaatgagcttga-30). 6 ng/mL of human recombinant insulin (Calbiochem). Digital pictures of each well were taken and colony cross-sectional area ELISA was measured using ImageJ. The human amphiregulin DuoSet ELISA Development Sys- tem (R&D Systems) was used to analyze amphiregulin levels Microarray and clinical data according to the manufacturer's instructions, as previously Gene expression profiles of breast cancer cell lines in 3D culture described (11). (12) are available from ArrayExpress (#E-TABM-244). Gene expression profiles (NCBI accession number: GSE5462) from a study of paired tumor core biopsies taken before and after 14 days Tumor xenografts All xenografts were performed in athymic mice and were of treatment with letrozole (14, 15) were examined for the expression of amphiregulin and other ERBB ligands and receptors. approved by the Institutional Animal Use and Care Committee of the Albert Einstein College of Medicine (New York, NY). Two Of the 58 patients included in the study, response data were not available for 6 cases, resulting in a total of 52 paired samples series of AREG knockdown experiments were performed. In the included in our analysis. first, 14 nulliparous 5-week-old athymic mice were implanted with 0.72-mg 17b-estradiol 60-day release pellets, and injected orthotopically with 1 Â 106 MCF7 cells in a 1:1 mixture of DMEM Results and Matrigel in the right (AREG knockdown: shAREG-2) or left We examined the distribution of amphiregulin expression in (empty vector control) fourth inguinal mammary fat pad of each 295 breast cancer patients (16), which revealed a striking enrich- mouse. Tumor growth was monitored for 51 days. The second þ ment of AREG mRNA expression in ERa tumors (Fig. 1A). We series was performed identically, except 12 mice were used and further evaluated the quantitative relationship between AREG and monitored for 44 days. ERa (ESR1) mRNA levels in 13 luminal human breast cancer cell lines grown in 3D culture (12). The highest levels of AREG are Immunohistochemistry found in luminal cell lines with the highest levels of ERa expres- Breast tumor tissue microarrays (TMA) were provided by The sion (Fig. 1B). We confirmed the association between AREG and Ohio State University's Human Genetics Sample Bank. Slides ERa expression in an independent cohort of 118 breast cancer were dewaxed in histoclear and rehydrated by serial incubations patients by immunostaining for amphiregulin on tumor tissue þ in 100% to 70% ethanol. Slides were rinsed with water and then microarrays (Fig. 1C). Analysis of AREG levels in 88 ERa and 30 À þ with TBS. Antigen retrieval was performed by incubation of slides ERa tumors showed that ERa tumors most frequently express in a steamer for 20 minutes in a preboiled solution of 10 mmol/L high levels of the amphiregulin protein (P ¼ 0.0194). Represen- sodium citrate (pH 6.0). Slides were washed in TBS and incubated tative examples of staining intensity are provided and additional for 30 minutes in a solution of 2% hydrogen peroxide in 1:1 sections can be seen in the Supplementary Materials and Methods. methanol:PBS. Slides were washed in TBS, blocked (5% rabbit As previously reported (9), we found that AREG mRNA is serum in PBS), and
Load more

Recommended publications
  • Reproductionresearch
    REPRODUCTIONRESEARCH Bone morphogenetic protein 15 and fibroblast growth factor 10 enhance cumulus expansion, glucose uptake, and expression of genes in the ovulatory cascade during in vitro maturation of bovine cumulus–oocyte complexes Ester S Caixeta, Melanie L Sutton-McDowall1, Robert B Gilchrist1, Jeremy G Thompson1, Christopher A Price2, Mariana F Machado, Paula F Lima and Jose´ Buratini Departamento de Fisiologia, Instituto de Biocieˆncias, Universidade Estadual Paulista, Rubia˜o Junior, Botucatu, Sa˜o Paulo 18618-970, Brazil, 1The Robinson Institute, Research Centre for Reproductive Health, School of Paediatrics and Reproductive Health, The University of Adelaide, Adelaide, South Australia 5005, Australia and 2Centre de Recherche en Reproduction Animale, Faculte´ de Me´decine Ve´te´rinaire, Universite´ de Montre´al, St-Hyacinthe, Quebec, Canada J2S 7C6 Correspondence should be addressed to J Buratini; Email: [email protected] Abstract Oocyte-secreted factors (OSFs) regulate differentiation of cumulus cells and are of pivotal relevance for fertility. Bone morphogenetic protein 15 (BMP15) and fibroblast growth factor 10 (FGF10) are OSFs and enhance oocyte competence by unknown mechanisms. We tested the hypothesis that BMP15 and FGF10, alone or combined in the maturation medium, enhance cumulus expansion and expression of genes in the preovulatory cascade and regulate glucose metabolism favouring hyaluronic acid production in bovine cumulus–oocyte complexes (COCs). BMP15 or FGF10 increased the percentage of fully expanded COCs, but the combination did not further stimulate it. BMP15 increased cumulus cell levels of mRNA encoding a disintegrin and metalloprotease 10 (ADAM10), ADAM17, amphiregulin (AREG), and epiregulin (EREG) at 12 h of culture and of prostaglandin (PG)-endoperoxide synthase 2 (PTGS2), pentraxin 3 (PTX3) and tumor necrosis factor alpha-induced protein 6 (TNFAIP6 (TSG6)) at 22 h of culture.
    [Show full text]
  • Heparin-Binding Epidermal Growth Factor-Like Growth Factor in Hippocampus: Modulation of Expression by Seizures and Anti- Excitotoxic Action
    The Journal of Neuroscience, January 1, 1999, 19(1):133–146 Heparin-Binding Epidermal Growth Factor-Like Growth Factor in Hippocampus: Modulation of Expression by Seizures and Anti- Excitotoxic Action Lisa A. Opanashuk,1 Robert J. Mark,1,2 Julie Porter,1 Deborah Damm,3 Mark P. Mattson,1,2 and Kim B. Seroogy1 1Department of Anatomy and Neurobiology and 2Sanders-Brown Research Center on Aging, University of Kentucky, Lexington, Kentucky 40536, and 3Scios Inc., Mountain View, California 94043 The expression of heparin-binding epidermal growth factor-like around hippocampal pyramidal CA3 and CA1 neurons. At 48 hr growth factor (HB-EGF), an EGF receptor ligand, was investi- after kainate treatment, HB-EGF mRNA remained elevated in gated in rat forebrain under basal conditions and after kainate- vulnerable brain regions of the hippocampus and amygdaloid induced excitotoxic seizures. In addition, a potential neuropro- complex. Western blot analysis revealed increased levels of tective role for HB-EGF was assessed in hippocampal cultures. HB-EGF protein in the hippocampus after kainate administra- In situ hybridization analysis of HB-EGF mRNA in developing tion, with a peak at 24 hr. Pretreatment of embryonic hippocam- rat hippocampus revealed its expression in all principle cell pal cell cultures with HB-EGF protected neurons against kai- 21 layers of hippocampus from birth to postnatal day (P) 7, nate toxicity. The kainate-induced elevation of [Ca ]i in whereas from P14 through adulthood, expression decreased in hippocampal neurons was not altered in cultures pretreated the pyramidal cell layer versus the dentate gyrus granule cells. with HB-EGF, suggesting an excitoprotective mechanism dif- After kainate-induced excitotoxic seizures, levels of HB-EGF ferent from that of previously characterized excitoprotective mRNA increased markedly in the hippocampus, as well as in growth factors.
    [Show full text]
  • Regulation of Mitogen-Activated Protein Kinase and Phosphoinositide 3-Kinase Signaling by Wild-Type and Oncogenic Ras
    REGULATION OF MITOGEN-ACTIVATED PROTEIN KINASE AND PHOSPHOINOSITIDE 3-KINASE SIGNALING BY WILD-TYPE AND ONCOGENIC RAS by Amy Young DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biomedical Sciences in the GRADUATE DIVISION of the UNIVERSITY OF CALIFORNIA, SAN I RANCISCO Copyright 2011 by Amy Young ii ACKNOWLEDGEMENTS It is hard to believe that my graduate career has finally come to an end. The work presented here could not have been possible without the support and generosity of the many people I have had the privilege to work with during my time at UCSF. First and foremost, I would like to thank my graduate advisor Frank McCormick for his guidance and support during my time as a student in his lab. I have learned a tremendous amount while training in the lab, and I sincerely appreciate Frank’s enthusiasm for science, his optimism for our projects, and the freedom he gives us to pursue our scientific research. I also want to thank Frank for being a very kind and generous mentor - I have been incredibly lucky to have been a member of the McCormick lab, and I value all of the opportunities and experiences I have had over the past several years. I would like to thank the members of my thesis committee, Allan Balmain and David Stokoe, for their advice and encouragement. I appreciate the time they sacrificed to provide feedback on my projects, and I am honored to have trained under some of the brightest minds in the field of Ras signaling.
    [Show full text]
  • Human Amphiregulin Quantikine ELISA
    Quantikine® ELISA Human Amphiregulin Immunoassay Catalog Number DAR00 For the quantitative determination of human Amphiregulin concentrations in cell culture supernates, cell lysates, serum, plasma, saliva, and urine. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION .....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ...................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE .................................................................................................................................2 TECHNICAL HINTS .................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ...................................................................................................3 OTHER SUPPLIES REQUIRED .............................................................................................................................................3 PRECAUTIONS .........................................................................................................................................................................4
    [Show full text]
  • Factor Receptor-Related Gene (Receptor Tyrosine Kinase/Sequence/Amphiregulin/ERBB2/ERBB3) GREGORY D
    Proc. Nati. Acad. Sci. USA Vol. 87, pp. 4905-4909, July 1990 Biochemistry Molecular cloning and expression of an additional epidermal growth factor receptor-related gene (receptor tyrosine kinase/sequence/amphiregulin/ERBB2/ERBB3) GREGORY D. PLOWMAN, GENA S. WHITNEY, MICHAEL G. NEUBAUER, JANELL M. GREEN, VICKI L. MCDONALD, GEORGE J. TODARO, AND MOHAMMED SHOYAB Oncogen, 3005 First Avenue, Seattle, WA 98121 Contributed by George J. Todaro, March 21, 1990 ABSTRACT Epidermal growth factor (EGF), transform- MATERIALS AND METHODS ing growth factor a (TGF-a), and amphiregulin are structur- Cell Culture. All cells were obtained from ATCC and ally and functionally related growth regulatory proteins. These grown in Dulbecco's modified Eagle's medium (DMEM)/ secreted polypeptides all bind to the 170-kDa cell-surface EGF 10% heat-inactivated fetal bovine serum. receptor, activating its intrinsic kinase activity. However, cDNA Cloning. Total cellular RNA was extracted from amphiregulin exhibits different activities than EGF and TGF-a A-431 (subclone A3), and MDA-MB-361 cells, and poly(A)+ in a number of biological assays. Amphiregulin only partially RNA was isolated. First-strand cDNA synthesis (11) was competes with EGF for binding EGF receptor, and amphireg- performed on A-431-A3 RNA with reverse transcriptase by ulin does not induce anchorage-independent growth of normal using a 72-fold degenerate primer mixture based on the rat kidney cells (NRK) in the presence ofTGF-.8. Amphiregulin amino acid sequence (in one-letter code) YMIMVKCWMI also appears to abrogate the stimulatory effect ofTGF-a on the (ARRD1). A cDNA library was constructed in AgtlO, and growth of several aggressive epithelial carcinomas that over- 3.0 x 105 recombinants were screened in duplicate on nitro- express EGF receptor.
    [Show full text]
  • Genetically Engineered Fusion Proteins for Treatment of Cancer
    CANCER GENOMICS & PROTEOMICS 9: 357-372 (2012) Review Genetically Engineered Fusion Proteins for Treatment of Cancer ULRICH H. WEIDLE, BRITTA SCHNEIDER, GUY GEORGES and ULRICH BRINKMANN Roche Pharma Research and Early Development (pRED), Roche Diagnostics GmbH, Penzberg, Germany Abstract. In this review, we summarize approaches to treat generated by combining entities derived from the ECDs of cancer with genetically engineered fusion proteins. Such two, or theoretically more, plasma membrane-associated proteins can act as decoy receptors for several ligands or as receptors. The fusion proteins, as outlined, can bind several recruiters of immune effector cells to tumor. Examples of ligands dedicated to one or several receptors inhibiting, interference with growth factor-mediated tumor growth and processes such as tumor-associated angiogenesis or human tumor-related angiogenesis with fusion proteins consisting of epidermal growth factor receptor (HER)-based signaling. the extracellular domains, and in some cases also of entities Another approach is the recruitment of immune effector cells of one or several receptors and the Fc part of human IgG1, to the tumor with genetically engineered fusion proteins. We are discussed. In addition, we present strategies for discuss fusion proteins of tumor-related antibodies and recruitment of immune effector cells to tumor with fusion cytokines or MHC-class I peptide complexes, T-cell receptor proteins. This can be achieved with fusion proteins consisting (TCR) cytokine fusion proteins, and fusions proteins of a of a tumor-related antibody and a cytokine or major T-cell-recruiting antibody and a tumor-cell receptor ligand or histocompatibilty complex class-I-peptide complexes, by a defined TCR.
    [Show full text]
  • Cripto-1: a Multifunctional Modulator During Embryogenesis and Oncogenesis
    Oncogene (2005) 24, 5731–5741 & 2005 Nature Publishing Group All rights reserved 0950-9232/05 $30.00 www.nature.com/onc Cripto-1: a multifunctional modulator during embryogenesis and oncogenesis Luigi Strizzi1, Caterina Bianco1, Nicola Normanno2 and David Salomon*,1 1Tumor Growth Factor Section, Mammary Biology & Tumorigenesis Laboratory, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA; 2Division of Haematological Oncology and Department of Experimental Oncology, ITN-Fondazione Pascale, 80131 Naples, Italy It is increasingly evident that genes known to perform tions within stem cells or alterations in signaling critical roles during early embryogenesis, particularly pathways within the stem cell niche are almost certainly during stem cell renewal, pluripotentiality and survival, central to the early appearance of premalignant cells. are also expressed during the development of cancer. In Stem cells, therefore, represent desirable targets for the this regard, oncogenesis may be considered as the development of future cancer therapies (Reya et al., recapitulation of embryogenesis in an inappropriate 2001; Beachy et al., 2004). Growth factors that are temporal and spatial manner. The epidermal growth important in development, oncogenesis and stem cell factor-Cripto-1/FRL1/cryptic family of proteins consists self-renewal include members of the Hedgehog (Hh), of extracellular and cell-associated proteins that have Wnt, Notch, transforming growth factor beta (TGFb/ been identified in several vertebrate species. During early Activin/Nodag/BMP) and epidermal growth factor- embryogenesis, epidermal growth factor-Cripto-1/FRL1/ Cripto-1/FRL1/cryptic (EGF-CFC) superfamilies cryptic proteins perform an obligatory role as coreceptors (Salomon et al., 2000; Shen and Schier, 2000; Kodja- for the transforming growth factor-beta subfamily of bachian, 2001; Kleber and Sommer, 2004; Nelson and proteins, which includes Nodal.
    [Show full text]
  • 1 a Novel Kinase Inhibitor INCB28060 Blocks C-MET-Dependent Signaling
    Author Manuscript Published OnlineFirst on September 14, 2011; DOI: 10.1158/1078-0432.CCR-11-1157 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. A novel kinase inhibitor INCB28060 blocks c-MET-dependent signaling, neoplastic activities, and crosstalk with EGFR and HER-3 Xiangdong Liu*, Qian Wang, Gengjie Yang, Cindy Marando, Holly K. Koblish, Leslie M Hall, Jordan S. Fridman, Elham Behshad, Richard Wynn, Yu Li, Jason Boer, Sharon Diamond, Chunhong He, Meizhong Xu, Jincong Zhuo, Wenqing Yao, Robert C. Newton, Peggy A. Scherle. Incyte Corporation, Wilmington, DE 19880 Running Title: INCB28060, a c-MET kinase selective inhibitor Keywords: Hepatocyte growth factor (HGF), c-MET receptor tryrosine kinase, kinase inhibitor, epithelial growth factor receptor (EGFR), and cancer *Corresponding Author: Incyte Corporation, Route 141 and Henry Clay Road, Building E400/3229C, Wilmington, DE 19880. Phone: 302-498-6815; Fax: 302-425-2760; E-mail: [email protected]. Competing Interests: All authors are employees of and/or own stock in Incyte Corporation. Word count: 5257 Total number of figures and tables: (6 figures and 2 tables) 1 Downloaded from clincancerres.aacrjournals.org on September 27, 2021. © 2011 American Association for Cancer Research. Author Manuscript Published OnlineFirst on September 14, 2011; DOI: 10.1158/1078-0432.CCR-11-1157 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. TRANSLATIONAL RELEVANCE The c-MET pathway plays important roles in human cancer and presents an attractive therapeutic target. This study describes preclinical characterization of INCB28060, a selective and potent c-MET kinase inhibitor currently being studied in patients.
    [Show full text]
  • Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network
    The Journal of Immunology Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network Kai H. Ha¨nel,*,†,1,2 Carolina M. Pfaff,*,†,1 Christian Cornelissen,*,†,3 Philipp M. Amann,*,4 Yvonne Marquardt,* Katharina Czaja,* Arianna Kim,‡ Bernhard Luscher,€ †,5 and Jens M. Baron*,5 Atopic dermatitis, a chronic inflammatory skin disease with increasing prevalence, is closely associated with skin barrier defects. A cy- tokine related to disease severity and inhibition of keratinocyte differentiation is IL-31. To identify its molecular targets, IL-31–dependent gene expression was determined in three-dimensional organotypic skin models. IL-31–regulated genes are involved in the formation of an intact physical skin barrier. Many of these genes were poorly induced during differentiation as a consequence of IL-31 treatment, resulting in increased penetrability to allergens and irritants. Furthermore, studies employing cell-sorted skin equivalents in SCID/NOD mice demonstrated enhanced transepidermal water loss following s.c. administration of IL-31. We identified the IL-1 cytokine network as a downstream effector of IL-31 signaling. Anakinra, an IL-1R antagonist, blocked the IL-31 effects on skin differentiation. In addition to the effects on the physical barrier, IL-31 stimulated the expression of antimicrobial peptides, thereby inhibiting bacterial growth on the three-dimensional organotypic skin models. This was evident already at low doses of IL-31, insufficient to interfere with the physical barrier. Together, these findings demonstrate that IL-31 affects keratinocyte differentiation in multiple ways and that the IL-1 cytokine network is a major downstream effector of IL-31 signaling in deregulating the physical skin barrier.
    [Show full text]
  • Targeting of Both the C-Met and EGFR Pathways Results in Additive Inhibition of Lung Tumorigenesis in Transgenic Mice
    Cancers 2010, 2, 2153-2170; doi:10.3390/cancers2042153 OPEN ACCESS cancers ISSN 2072-6694 www.mdpi.com/journal/cancers Article Targeting of Both the c-Met and EGFR Pathways Results in Additive Inhibition of Lung Tumorigenesis in Transgenic Mice Laura P. Stabile 1,6, Mary E. Rothstein 1 , Phouthone Keohavong 2,6, Diana Lenzner 3, Stephanie R. Land 3,6, Autumn L. Gaither-Davis 1,6, K. Jin Kim 4, Naftali Kaminski 5,6 and Jill M. Siegfried 1,6,* 1 Department of Pharmacology and Chemical Biology, University of Pittsburgh, Pittsburgh, PA 15213, USA; E-Mails: [email protected] (L.P.S.); [email protected] (M.E.R); [email protected] (A.L.G.D) 2 Department of Environmental and Occupational Health, University of Pittsburgh, Pittsburgh, PA 15213, USA; E-Mail: [email protected] 3 Department of Biostatistics, University of Pittsburgh, Pittsburgh, PA 15213, USA; E-Mails: [email protected] (D.L.); [email protected] (S.R.L) 4 Galaxy Biotech, LLC, Sunnyvale, CA 94089, USA; E-Mail: [email protected] 5 Department of Medicine, University of Pittsburgh, Pittsburgh, PA 15213, USA; E-Mail: [email protected] 6 Lung and Thoracic Malignancy Program, University of Pittsburgh, Pittsburgh, PA 15213, USA * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-412-623-7769; Fax: +1-412-623-7768. Received: 20 October 2010; in revised form: 25 November 2010 / Accepted: 21 December 2010 / Published: 22 December 2010 Abstract: EGFR and c-Met are both overexpressed in lung cancer and initiate similar downstream signaling, which may be redundant.
    [Show full text]
  • Basic–Liver, Pancreas, and Biliary Tract
    GASTROENTEROLOGY 2005;128:424–432 BASIC–LIVER, PANCREAS, AND BILIARY TRACT Amphiregulin: An Early Trigger of Liver Regeneration in Mice CARMEN BERASAIN,* ELENA R. GARCÍA–TREVIJANO,* JOSEFA CASTILLO,* ELENA ERROBA,* DAVID C. LEE,‡ JESÚS PRIETO,* and MATÍAS A. AVILA* *Division of Hepatology and Gene Therapy, Centro de Investigación Médica Aplicada, Facultad de Medicina, Universidad de Navarra, Pamplona, Spain; and ‡Department of Biochemistry and Biophysics, University of North Carolina School of Medicine, Chapel Hill, North Carolina This complex response aimed at the restoration of liver- See editorial on page 504. dependent homeostasis is mediated by a network of cytokines, comitogens, and growth factors in a coordi- Background & Aims: Liver regeneration is a unique nated multistep process.2,3 Many of the mediators be- response directed to restore liver mass after resection lieved to be critical in the regenerative response to injury or injury. The survival and proliferative signals trig- or resection in animals are also expressed in humans gered during this process are conveyed by a complex during liver regeneration, thus suggesting the preserva- network of cytokines and growth factors acting in an 4 orderly manner. Activation of the epidermal growth tion of fundamental mechanisms across species. factor receptor is thought to play an important role in Despite the intensive research performed in the past liver regeneration. Amphiregulin is a member of the few decades, the molecules and mechanisms involved in epidermal growth factor family whose expression is the physiological adaptive response to liver injury are not not detectable in healthy liver. We have investigated completely known. We have recently observed that the the expression of amphiregulin in liver injury and its expression of the Wilms’ tumor suppressor 1 (WT1) gene role during liver regeneration after partial hepatec- is induced in the livers of patients with hepatocellular tomy.
    [Show full text]
  • A Pleiotropic Role for FGF Signaling in Mammary Gland Stromal Fibroblasts
    bioRxiv preprint doi: https://doi.org/10.1101/565267; this version posted March 1, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A pleiotropic role for FGF signaling in mammary gland stromal fibroblasts Zuzana Koledova1*, Jakub Sumbal1 1Department of Histology and Embryology, Faculty of Medicine, Masaryk University, Kamenice 3, Brno, 625 00, Czech Republic *To whom correspondence should be addressed: Zuzana Koledova, Faculty of Medicine, Masaryk University, Department of Histology and Embryology, Kamenice 3, 625 00 Brno, Czech Republic; [email protected] Key words: branching morphogenesis, collagen, extracellular matrix, fibroblast, fibroblast growth factor, mammary gland, stroma Running title: Role for FGF2 in mammary fibroblasts Summary statement FGF signaling in mammary fibroblasts regulates fibroblast proliferation, migration, extracellular matrix production and remodeling, and fibroblast-mediated mammary epithelial branching morphogenesis. Abstract Fibroblast growth factor (FGF) signaling is crucial for mammary gland development. While multiple roles for FGF signaling in the epithelium were described, the function of FGF signaling in mammary stroma has not been elucidated. In this study, we investigated FGF signaling in mammary fibroblasts. We found that mammary fibroblasts express FGF receptors 1 and 2 and respond to FGF ligands. In particular, FGF2 and FGF9 induce sustained ERK1/2 signaling and promote fibroblast proliferation and migration in 2D. Intriguingly, only FGF2 induces fibroblast migration in 3D extracellular matrix (ECM) through regulation of actomyosin cytoskeleton and promotes force-mediated collagen remodeling by mammary fibroblasts. Moreover, FGF2 regulates production of ECM proteins by mammary fibroblasts, including collagens, fibronectin, osteopontin, and matrix metalloproteinases.
    [Show full text]