Expression of the ETS Transcription Factor ELF3 in the Retinal Pigment Epithelium Andrew Ian Jobling,1 Zhiping Fang,1 Daniela Koleski,2 and Martin James Tymms1,2 PURPOSE. The ETS family of transcription factors regulate sev- he retinal pigment epithelium (RPE) is a monolayer of cells eral critical cellular functions. They have also been implicated Tbordered basally by the choriocapillaris and apically by the in invertebrate ocular development. This work was undertaken distal tips of the photoreceptors. It constitutes part of the to determine whether epithelium-specific ETS transcription blood–retinal barrier and as such controls the access of serum- factors are expressed in the retinal pigment epithelium and to based factors to the neural retina.1 In addition to this role, the investigate the possible role of these factors in retinal diseases monolayer is involved in the oxidation of retinol, isomerization such as age-related macular degeneration. of the retinoids and phagocytosis of shed photoreceptor outer segments.2–4 Because the pigment epithelium is critical to METHODS. The expression of the epithelial ETS transcription retinal function, factors that regulate RPE gene expression not factors ELF5, ESE3, and ELF3 was assessed by RT-PCR in the only affect tissue homeostasis, but may also have a role in human RPE cell lines D407 and hTERT-RPE1. The full-length Ј disease. coding sequence of rat Elf3 was isolated with 3 rapid ampli- Transcription factors are known to regulate gene expres- fication of cDNA ends (RACE) and degenerative primers, and sion by binding directly to promoter sites within DNA or to its expression was determined in various rat tissues, by RT-PCR other transcription factors. During tissue development, these and real-time PCR. A polyclonal ELF3 antibody produced from factors are the main determinants of final cellular identity. a C-terminal peptide was used to observe the distribution of Within the eye, several transcription factors are known to be the transcription factor within the retina. To assess the possi- critical to proper ocular development. PAX6 has been de- ble ELF3 regulation of the TIMP3 promoter, transient transfec- scribed as the master control gene in eye formation,5 whereas tion assays were performed. Promoter activity was determined CHX10 has been implicated in retinal development.6 Other with a firefly luciferase reporter gene construct. transcription factors such as those in the Fos and Jun families,7 8 9 RESULTS. The epithelium-specific ETS transcription factor ELF3 MITF and CRX are also critical to eye formation. The impor- was expressed in the D407 and hTERT-RPE1 cell lines. Neither tance of these factors is further emphasized by the fact that ESE3 nor ELF5 was detected in the RPE. The cloning of rat Elf3 mutations within transcription factor genes have been associ- 9 produced two splice variants, designated Elf3a (1786 bp) and ated with the development of ocular disease. Elf3b (1855 bp). The larger form, Elf3b, contained a 69-bp The ETS family of transcription factors, which presently insert in the coding sequence, which showed high homology number more than 30, are important regulators of hematopoi- 10 11 12 to a similar insert previously identified in murine Elf3. Both esis, angiogenesis, cell differentiation, and organogene- sis.13 Originally identified because of their homology to the splice variants were expressed in rat lung, kidney, liver, and 14 retina, but were absent in heart tissue. Real-time PCR analysis v-ets oncogene, all members of the family share a highly showed the retina to contain high levels of Elf3, which was conserved DNA-binding domain known as the ETS domain and subsequently localized to the RPE. Elf3 upregulated the TIMP3 recognize the GGA(A/T) core sequence in the promoters and promoter, with Elf3a and -3b inducing an approximate sixfold enhancers of various cellular genes. The importance of the ETS domain to protein function is illustrated by its high degree of increase in activity. conservation (49% identity) between human and Drosoph- CONCLUSIONS. The ELF3 transcription factor is highly expressed ila.15 In addition to their role in development, ETS factors have in the RPE and can regulate important ocular genes, such as been implicated in several diseases such as Down syndrome,16 TIMP3, in vitro. The specific expression of ELF3 in the RPE may Alzheimer’s disease,17 and tumorigenesis.11 reflect an important role for this transcription factor in retinal Several of the ETS transcription factor family are specifically function. Furthermore, its regulation of TIMP3 may have im- expressed in epithelial cells. ELF3 (ERT/ESX/ESE1) was the first plications for degenerative retinal diseases, such as age-related described in human breast cancer cells, but has subsequently macular degeneration. (Invest Ophthalmol Vis Sci. 2002;43: been identified in a wide range of epithelial cells.18,19 Three 3530–3537) other epithelial ETS factors, ELF5 (ESE2),20 ESE3,21 and PDEF (Pse),22,23 have also been identified recently; however, these factors have a more restricted pattern of expression. The pres- ence of these ETS transcription factors may be critical for the From the 1National Vision Research Institute of Australia, Carlton, 2 epithelial phenotype, with alterations in expression associated Victoria, Australia; and the Department of Optometry and Vision 19 Sciences, University of Melbourne, Melbourne, Victoria, Australia. with malignant transformation. Supported by grants from The National Health and Medical Re- There has been only limited investigation into the presence search Council of Australia and from the Lions Vision Research Fellow- and role of ETS factors within the vertebrate eye. Recently, ship Fund. Yoshida et al.24 have reported the presence of Elf3 in mouse Submitted for publication November 27, 2001; revised February corneal epithelium. Its expression parallels that of the differ- 11, 2002; accepted February 28, 2002. entiation marker, K12 keratin and appeared critical for epithe- Commercial relationships policy: N. lial differentiation within the cornea. Earlier work by O’Neal et The publication costs of this article were defrayed in part by page al.25 implicated another two ETS domain proteins, pointed and charge payment. This article must therefore be marked “advertise- yan, in Drosophila photoreceptor development. Because ETS ment” in accordance with 18 U.S.C. §1734 solely to indicate this fact. 26 Corresponding author: Andrew Ian Jobling, National Vision Re- function is highly conserved between species, these tran- search Institute of Australia, 386 Cardigan Street, Carlton, Victoria scription factors may have important roles in the ocular devel- 3053, Australia; [email protected]. opment of higher organisms. Investigative Ophthalmology & Visual Science, November 2002, Vol. 43, No. 11 3530 Copyright © Association for Research in Vision and Ophthalmology Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, November 2002, Vol. 43, No. 11 ELF3 Expression in the RPE 3531 TABLE 1. Specific PCR Primers Used for the Amplification of the ETS Factors ELF3, ESE3 and ELF5 Primers Target Gene Upstream Downstream Product Size (bp) hELF3 gatggggccaccctctgcaattgtg ccctcagttccgactctggagaacctc 827 hESE3 tttcccacccagaatctttag ccaaagtattggcagcttcag 953 hELF5 gaaagcctcctctttggacc gcaatagacattcgaaaggctt 890 rElf3 gttgaccctgaacaaccaac cttcgggacctcacctcca 272,341 Primers for the human genes were designed from previously published sequences, and those for rat were determined as outlined in Materials and Methods. The sizes of the two splice variants amplified from rat Elf3 are indicated. ETS transcription factors may also regulate genes potentially spanning oligonucleotide (5Ј-atggcngcnacntgygarat-3Ј). All cDNA se- involved in retinal disease. Of particular interest is the tissue quences were confirmed by automated sequencing of both strands. inhibitor of metalloproteinase 3 (TIMP3) gene, which has The full rat Elf3 coding sequence was cloned using the degenerate shown elevated levels in retinitis pigmentosa (RP),27 Sorby’s oligonucleotide and a primer within the 3Ј untranslated region (5Ј- fundus dystrophy (SFD),27 and age-related macular degenera- ctgacccttaattctgactctctccaacc-3Ј). The 1192-bp (Elf3a) and 1123-bp tion (ARMD).28 (Elf3b) products were subcloned into a plasmid vector (pGEM-T; Pro- TIMP3, unlike the other members of the TIMP family, is an mega Corp., Madison, WI) and subsequently cloned into the NotI site insoluble component of the extracellular matrix (ECM). It is of the expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA), yielding synthesized in the RPE and deposited in Bruch’s membrane, the constructs rElf3a/pcDNA3.1 and rElf3b/pcDNA3.1. where it regulates ECM turnover and limits choroidal neovas- cularization. Mutations within the TIMP3 gene are known to RNA Isolation and RT-PCR lead to the development of autosomal dominant SFD.29 Be- cause SFD and ARMD have a similar etiology, TIMP3 may also Total RNA was isolated from individual rat tissues (10–30 mg) and the play a role in the progression of the age-related condition. D407 and hTERT-RPE1 cell lines (0.5–1 ϫ 107 cells) using an extraction However, no mutations have been found in patients with kit (RNeasy mini kit; Qiagen, Chatsworth, CA). The retinal samples ARMD, suggesting that other mechanisms are involved in ac- included tissue from the posterior eye cup. Total RNA from the human cumulation of TIMP3 and the resultant changes in the ECM that breast and prostate cancer cell lines, T47D and