DOCSLIB.ORG

Expression of the ETS Transcription Factor ELF3 in the Retinal Pigment Epithelium

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression of the ETS Transcription Factor ELF3 in the Retinal Pigment Epithelium Expression of the ETS Transcription Factor ELF3 in the Retinal Pigment Epithelium Andrew Ian Jobling,1 Zhiping Fang,1 Daniela Koleski,2 and Martin James Tymms1,2 PURPOSE. The ETS family of transcription factors regulate sev- he retinal pigment epithelium (RPE) is a monolayer of cells eral critical cellular functions. They have also been implicated Tbordered basally by the choriocapillaris and apically by the in invertebrate ocular development. This work was undertaken distal tips of the photoreceptors. It constitutes part of the to determine whether epithelium-specific ETS transcription blood–retinal barrier and as such controls the access of serum- factors are expressed in the retinal pigment epithelium and to based factors to the neural retina.1 In addition to this role, the investigate the possible role of these factors in retinal diseases monolayer is involved in the oxidation of retinol, isomerization such as age-related macular degeneration. of the retinoids and phagocytosis of shed photoreceptor outer segments.2–4 Because the pigment epithelium is critical to METHODS. The expression of the epithelial ETS transcription retinal function, factors that regulate RPE gene expression not factors ELF5, ESE3, and ELF3 was assessed by RT-PCR in the only affect tissue homeostasis, but may also have a role in human RPE cell lines D407 and hTERT-RPE1. The full-length Ј disease. coding sequence of rat Elf3 was isolated with 3 rapid ampli- Transcription factors are known to regulate gene expres- fication of cDNA ends (RACE) and degenerative primers, and sion by binding directly to promoter sites within DNA or to its expression was determined in various rat tissues, by RT-PCR other transcription factors. During tissue development, these and real-time PCR. A polyclonal ELF3 antibody produced from factors are the main determinants of final cellular identity. a C-terminal peptide was used to observe the distribution of Within the eye, several transcription factors are known to be the transcription factor within the retina. To assess the possi- critical to proper ocular development. PAX6 has been de- ble ELF3 regulation of the TIMP3 promoter, transient transfec- scribed as the master control gene in eye formation,5 whereas tion assays were performed. Promoter activity was determined CHX10 has been implicated in retinal development.6 Other with a firefly luciferase reporter gene construct. transcription factors such as those in the Fos and Jun families,7 8 9 RESULTS. The epithelium-specific ETS transcription factor ELF3 MITF and CRX are also critical to eye formation. The impor- was expressed in the D407 and hTERT-RPE1 cell lines. Neither tance of these factors is further emphasized by the fact that ESE3 nor ELF5 was detected in the RPE. The cloning of rat Elf3 mutations within transcription factor genes have been associ- 9 produced two splice variants, designated Elf3a (1786 bp) and ated with the development of ocular disease. Elf3b (1855 bp). The larger form, Elf3b, contained a 69-bp The ETS family of transcription factors, which presently insert in the coding sequence, which showed high homology number more than 30, are important regulators of hematopoi- 10 11 12 to a similar insert previously identified in murine Elf3. Both esis, angiogenesis, cell differentiation, and organogene- sis.13 Originally identified because of their homology to the splice variants were expressed in rat lung, kidney, liver, and 14 retina, but were absent in heart tissue. Real-time PCR analysis v-ets oncogene, all members of the family share a highly showed the retina to contain high levels of Elf3, which was conserved DNA-binding domain known as the ETS domain and subsequently localized to the RPE. Elf3 upregulated the TIMP3 recognize the GGA(A/T) core sequence in the promoters and promoter, with Elf3a and -3b inducing an approximate sixfold enhancers of various cellular genes. The importance of the ETS domain to protein function is illustrated by its high degree of increase in activity. conservation (49% identity) between human and Drosoph- CONCLUSIONS. The ELF3 transcription factor is highly expressed ila.15 In addition to their role in development, ETS factors have in the RPE and can regulate important ocular genes, such as been implicated in several diseases such as Down syndrome,16 TIMP3, in vitro. The specific expression of ELF3 in the RPE may Alzheimer’s disease,17 and tumorigenesis.11 reflect an important role for this transcription factor in retinal Several of the ETS transcription factor family are specifically function. Furthermore, its regulation of TIMP3 may have im- expressed in epithelial cells. ELF3 (ERT/ESX/ESE1) was the first plications for degenerative retinal diseases, such as age-related described in human breast cancer cells, but has subsequently macular degeneration. (Invest Ophthalmol Vis Sci. 2002;43: been identified in a wide range of epithelial cells.18,19 Three 3530–3537) other epithelial ETS factors, ELF5 (ESE2),20 ESE3,21 and PDEF (Pse),22,23 have also been identified recently; however, these factors have a more restricted pattern of expression. The pres- ence of these ETS transcription factors may be critical for the From the 1National Vision Research Institute of Australia, Carlton, 2 epithelial phenotype, with alterations in expression associated Victoria, Australia; and the Department of Optometry and Vision 19 Sciences, University of Melbourne, Melbourne, Victoria, Australia. with malignant transformation. Supported by grants from The National Health and Medical Re- There has been only limited investigation into the presence search Council of Australia and from the Lions Vision Research Fellow- and role of ETS factors within the vertebrate eye. Recently, ship Fund. Yoshida et al.24 have reported the presence of Elf3 in mouse Submitted for publication November 27, 2001; revised February corneal epithelium. Its expression parallels that of the differ- 11, 2002; accepted February 28, 2002. entiation marker, K12 keratin and appeared critical for epithe- Commercial relationships policy: N. lial differentiation within the cornea. Earlier work by O’Neal et The publication costs of this article were defrayed in part by page al.25 implicated another two ETS domain proteins, pointed and charge payment. This article must therefore be marked “advertise- yan, in Drosophila photoreceptor development. Because ETS ment” in accordance with 18 U.S.C. §1734 solely to indicate this fact. 26 Corresponding author: Andrew Ian Jobling, National Vision Re- function is highly conserved between species, these tran- search Institute of Australia, 386 Cardigan Street, Carlton, Victoria scription factors may have important roles in the ocular devel- 3053, Australia; [email protected]. opment of higher organisms. Investigative Ophthalmology & Visual Science, November 2002, Vol. 43, No. 11 3530 Copyright © Association for Research in Vision and Ophthalmology Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, November 2002, Vol. 43, No. 11 ELF3 Expression in the RPE 3531 TABLE 1. Specific PCR Primers Used for the Amplification of the ETS Factors ELF3, ESE3 and ELF5 Primers Target Gene Upstream Downstream Product Size (bp) hELF3 gatggggccaccctctgcaattgtg ccctcagttccgactctggagaacctc 827 hESE3 tttcccacccagaatctttag ccaaagtattggcagcttcag 953 hELF5 gaaagcctcctctttggacc gcaatagacattcgaaaggctt 890 rElf3 gttgaccctgaacaaccaac cttcgggacctcacctcca 272,341 Primers for the human genes were designed from previously published sequences, and those for rat were determined as outlined in Materials and Methods. The sizes of the two splice variants amplified from rat Elf3 are indicated. ETS transcription factors may also regulate genes potentially spanning oligonucleotide (5Ј-atggcngcnacntgygarat-3Ј). All cDNA se- involved in retinal disease. Of particular interest is the tissue quences were confirmed by automated sequencing of both strands. inhibitor of metalloproteinase 3 (TIMP3) gene, which has The full rat Elf3 coding sequence was cloned using the degenerate shown elevated levels in retinitis pigmentosa (RP),27 Sorby’s oligonucleotide and a primer within the 3Ј untranslated region (5Ј- fundus dystrophy (SFD),27 and age-related macular degenera- ctgacccttaattctgactctctccaacc-3Ј). The 1192-bp (Elf3a) and 1123-bp tion (ARMD).28 (Elf3b) products were subcloned into a plasmid vector (pGEM-T; Pro- TIMP3, unlike the other members of the TIMP family, is an mega Corp., Madison, WI) and subsequently cloned into the NotI site insoluble component of the extracellular matrix (ECM). It is of the expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA), yielding synthesized in the RPE and deposited in Bruch’s membrane, the constructs rElf3a/pcDNA3.1 and rElf3b/pcDNA3.1. where it regulates ECM turnover and limits choroidal neovas- cularization. Mutations within the TIMP3 gene are known to RNA Isolation and RT-PCR lead to the development of autosomal dominant SFD.29 Be- cause SFD and ARMD have a similar etiology, TIMP3 may also Total RNA was isolated from individual rat tissues (10–30 mg) and the play a role in the progression of the age-related condition. D407 and hTERT-RPE1 cell lines (0.5–1 ϫ 107 cells) using an extraction However, no mutations have been found in patients with kit (RNeasy mini kit; Qiagen, Chatsworth, CA). The retinal samples ARMD, suggesting that other mechanisms are involved in ac- included tissue from the posterior eye cup. Total RNA from the human cumulation of TIMP3 and the resultant changes in the ECM that breast and prostate cancer cell lines, T47D and
Load more

Recommended publications
  • The Diverse Roles of TIMP-3: Insights Into Degenerative Diseases of the Senescent Retina and Brain
    cells Review The Diverse Roles of TIMP-3: Insights into Degenerative Diseases of the Senescent Retina and Brain Jennifer M. Dewing 1, Roxana O. Carare 1, Andrew J. Lotery 1,2 and J. Arjuna Ratnayaka 1,* 1 Clinical and Experimental Sciences, Faculty of Medicine, University of Southampton, MP806, Tremona Road, Southampton SO16 6YD, UK; [email protected] (J.M.D.); [email protected] (R.O.C.); [email protected] (A.J.L.) 2 Eye Unit, University Hospital Southampton NHS Foundation Trust, Southampton SO16 6YD, UK * Correspondence: [email protected]; Tel.: +44-238120-8183 Received: 13 November 2019; Accepted: 19 December 2019; Published: 21 December 2019 Abstract: Tissue inhibitor of metalloproteinase-3 (TIMP-3) is a component of the extracellular environment, where it mediates diverse processes including matrix regulation/turnover, inflammation and angiogenesis. Rare TIMP-3 risk alleles and mutations are directly linked with retinopathies such as age-related macular degeneration (AMD) and Sorsby fundus dystrophy, and potentially, through indirect mechanisms, with Alzheimer’s disease. Insights into TIMP-3 activities may be gleaned from studying Sorsby-linked mutations. However, recent findings do not fully support the prevailing hypothesis that a gain of function through the dimerisation of mutated TIMP-3 is responsible for retinopathy. Findings from Alzheimer’s patients suggest a hitherto poorly studied relationship between TIMP-3 and the Alzheimer’s-linked amyloid-beta (Aβ) proteins that warrant further scrutiny. This may also have implications for understanding AMD as aged/diseased retinae contain high levels of Aβ. Findings from TIMP-3 knockout and mutant knock-in mice have not led to new treatments, particularly as the latter does not satisfactorily recapitulate the Sorsby phenotype.
    [Show full text]
  • Suramin Inhibits Osteoarthritic Cartilage Degradation by Increasing Extracellular Levels
    Molecular Pharmacology Fast Forward. Published on August 10, 2017 as DOI: 10.1124/mol.117.109397 This article has not been copyedited and formatted. The final version may differ from this version. MOL #109397 Suramin inhibits osteoarthritic cartilage degradation by increasing extracellular levels of chondroprotective tissue inhibitor of metalloproteinases 3 (TIMP-3). Anastasios Chanalaris, Christine Doherty, Brian D. Marsden, Gabriel Bambridge, Stephen P. Wren, Hideaki Nagase, Linda Troeberg Arthritis Research UK Centre for Osteoarthritis Pathogenesis, Kennedy Institute of Downloaded from Rheumatology, University of Oxford, Roosevelt Drive, Headington, Oxford OX3 7FY, UK (A.C., C.D., G.B., H.N., L.T.); Alzheimer’s Research UK Oxford Drug Discovery Institute, University of Oxford, Oxford, OX3 7FZ, UK (S.P.W.); Structural Genomics Consortium, molpharm.aspetjournals.org University of Oxford, Old Road Campus Research Building, Old Road Campus, Roosevelt Drive, Headington, Oxford, OX3 7DQ (BDM). at ASPET Journals on September 29, 2021 1 Molecular Pharmacology Fast Forward. Published on August 10, 2017 as DOI: 10.1124/mol.117.109397 This article has not been copyedited and formatted. The final version may differ from this version. MOL #109397 Running title: Repurposing suramin to inhibit osteoarthritic cartilage loss. Corresponding author: Linda Troeberg Address: Kennedy Institute of Rheumatology, University of Oxford, Roosevelt Drive, Headington, Oxford OX3 7FY, UK Phone number: +44 (0)1865 612600 E-mail: [email protected] Downloaded
    [Show full text]
  • Prognostic Significance of TIMP-1 in Non-Small Cell Lung Cancer
    ANTICANCER RESEARCH 31: 4031-4038 (2011) Prognostic Significance of TIMP-1 in Non-small Cell Lung Cancer MARTIN PESTA1, VLASTIMIL KULDA2, RADEK KUCERA1, MILOS PESEK3, JINDRA VRZALOVA1, VACLAV LISKA4, LADISLAV PECEN1, VLADISLAV TRESKA4, JARMIL SAFRANEK4, MARKETA PRAZAKOVA1, ONDREJ VYCITAL4, JAN BRUHA4, LUBOS HOLUBEC5 and ONDREJ TOPOLCAN1 Departments of 1Internal Medicine II and 2Biochemistry, Faculty of Medicine in Pilsen, Charles University in Prague, Czech Republic; 3TRN Clinic, University Hospital and Medical Faculty in Pilsen, Czech Republic; Departments of 4Surgery and 5Oncology, University Teaching Hospital, Pilsen, Czech Republic Abstract. Tissue inhibitor of metalloproteinases 1 (TIMP1) the mortality 48.7/100 000 per year (1). Non-small cell lung regulates not only extracellular matrix catabolism but the cancer (NSCLC) accounts for 80% of all cases (2). major effect in tumor tissue is promotion of cell growth and Although there are tumor markers routinely used for solid anti-apoptotic activity. The aim of our study was to evaluate tumors, some of them having become gold standards (3), plasma TIMP1 levels and tissue TIMP1 mRNA expression as there is still an effort being made to search for new ones. prognostic markers in NSCLC patients. Patients and Tissue inhibitor of metalloproteinases 1 (TIMP1) has been Methods: We studied a group of 108 patients with NSCLC studied intensively over the last ten years and in colorectal who had undergone lung surgery. Estimation of TIMP1 cancer it seems to be promising as a prognostic marker in mRNA was performed by quantitative polymerase chain clinical use (4). A Danish-Australian endoscopy study group reaction (qPCR) and estimation of plasma TIMP1 protein on colorectal cancer detection is trying to use TIMP1 as a using enzyme-linked immunosorbent assay (ELISA).
    [Show full text]
  • Demethylation of TIMP2 and TIMP3 Inhibit Cell Proliferation, Migration and Invasion in Pituitary Adenoma
    Demethylation of TIMP2 and TIMP3 inhibit cell proliferation, migration and invasion in pituitary adenoma Yongdong Yang the Second Aliated Hospital of Guilin Medical University Fanjun Huang the Second aliated Hospital of Guilin Medical University Xiufu Wu the Second aliated Hospital of Guilin Medical University Chunqin Huang the Second aliated Hospital of Guilin Medical University Shenyu Li ( [email protected] ) the second aliated hospital of guilin medical university Research article Keywords: Invasive pituitary adenoma, TIMPs, DNA methylation, 5-AzaC, GH3 Posted Date: October 29th, 2019 DOI: https://doi.org/10.21203/rs.2.15805/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/15 Abstract Background: Pituitary adenoma (PA) is one of the most common intracranial neoplasms. Tissue inhibitors of metalloproteinases (TIMPs) are prognostic biological markers, but their biological roles remains largely unclear in invasive PA. Methods: The promoter methylation status of TIMP2 and TIMP3 genes in invasive PA tissues and cells was measured by methylation-specic polymerase chain reaction (MSP). The expression of TIMP1-3 was validated by quantitative real time PCR and western blot analysis. Overexpression and knockdown of TIMP2 and TIMP3 in GH3 cells were created by transfection of pcDNA3.0 and siRNA against TIMP2 and TIMP3, respectively. Functional experiments in GH3 cells were performed with CCK-8 assay, wound healing assay and transwell assay. Effects of 5- Azacytidene (5-AzaC) on the methylation of TIMP2 and TIMP3 gene, and DNA methyltransferase 1 (DNMT1), DNMT3a and DNMT3b were determined by western blot analysis. Results: We found the expression of TIMP1, TIMP2 and TIMP3 was down-regulated in invasive PA tissues and cells.
    [Show full text]
  • A Rare Penetrant TIMP3 Mutation Confers Relatively Late Onset Choroidal Neovascularisation Which Can Mimic Age-Related Macular D
    Eye (2016) 30, 488–491 © 2016 Macmillan Publishers Limited All rights reserved 0950-222X/16 www.nature.com/eye 1,2 3 3 1,2 CASE SERIES A rare penetrant A Warwick , J Gibson , R Sood and A Lotery TIMP3 mutation confers relatively late onset choroidal neovascularisation which can mimic age-related macular degeneration Abstract world.1 Genetic predisposition is thought to play a role and to date 19 genetic loci have been Purpose To perform a genotype–phenotype correlation for three patients heterozygous for associated at a genome-wide level with an 2 a missense mutation in the tissue inhibitor of increased risk of developing AMD. ’ metalloproteinase 3 (TIMP3) gene. Sorsby s fundus dystrophy (SFD) is a rare autosomal dominant fundus dystrophy caused 1Clinical Neurosciences Methods Retrospective, observational case Research Group, Clinical series. The medical records and photographs by mutations in the tissue inhibitor of TIMP3 3 and Experimental Sciences, were reviewed for three patients diagnosed at metalloproteinase 3 ( ) gene. It shares Faculty of Medicine, the time with neovascular age-related macular similar clinical features with AMD, including University of choroidal neovascularisation (CNV), although Southampton, degeneration (AMD). All were later found to Southampton, UK carry a predicted C113G mutation in the TIMP3 the age of onset is typically younger in the fourth gene, other known mutations in which are decade of life. 2Eye Unit, University associated with Sorsby’sfundusdystrophy. We report the clinical phenotypes of three Southampton NHS Trust, Results All three patients developed drusen patients diagnosed at Southampton Eye Unit Southampton, UK and bilateral choroidal neovascularisation with with bilateral neovascular AMD before the subsequent disciform scarring and atrophy.
    [Show full text]
  • Gene Regulation Underlies Environmental Adaptation in House Mice
    Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Research Gene regulation underlies environmental adaptation in house mice Katya L. Mack,1 Mallory A. Ballinger,1 Megan Phifer-Rixey,2 and Michael W. Nachman1 1Department of Integrative Biology and Museum of Vertebrate Zoology, University of California, Berkeley, California 94720, USA; 2Department of Biology, Monmouth University, West Long Branch, New Jersey 07764, USA Changes in cis-regulatory regions are thought to play a major role in the genetic basis of adaptation. However, few studies have linked cis-regulatory variation with adaptation in natural populations. Here, using a combination of exome and RNA- seq data, we performed expression quantitative trait locus (eQTL) mapping and allele-specific expression analyses to study the genetic architecture of regulatory variation in wild house mice (Mus musculus domesticus) using individuals from five pop- ulations collected along a latitudinal cline in eastern North America. Mice in this transect showed clinal patterns of variation in several traits, including body mass. Mice were larger in more northern latitudes, in accordance with Bergmann’s rule. We identified 17 genes where cis-eQTLs were clinal outliers and for which expression level was correlated with latitude. Among these clinal outliers, we identified two genes (Adam17 and Bcat2) with cis-eQTLs that were associated with adaptive body mass variation and for which expression is correlated with body mass both within and between populations. Finally, we per- formed a weighted gene co-expression network analysis (WGCNA) to identify expression modules associated with measures of body size variation in these mice.
    [Show full text]
  • Influence of LPS, TNF, TGF-ß1 and IL-4 on the Expression of Mmps, Timps and Selected Cytokines in Rat Synovial Membranes Incubated in Vitro
    127-137.qxd 18/11/2010 09:29 Ì ™ÂÏ›‰·127 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 27: 127-137, 2011 127 Influence of LPS, TNF, TGF-ß1 and IL-4 on the expression of MMPs, TIMPs and selected cytokines in rat synovial membranes incubated in vitro ANNA HYC, ANNA OSIECKA-IWAN, JUSTYNA NIDERLA-BIELINSKA and STANISLAW MOSKALEWSKI Department of Histology and Embryology, Medical University of Warsaw, Chalubinskiego 5 St., PL02-004 Warsaw, Poland Received July 30, 2010; Accepted September 28, 2010 DOI: 10.3892/ijmm.2010.550 Abstract. Synovial membranes are formed by four main Introduction types of cells, i.e. fibroblasts, macrophages, epitheliocytes and adipocytes. To study the combined effect of various The synovial membrane defined in anatomy textbooks as the factors on these cell populations, synovial membranes vascular connective tissue which produces the synovial fluid dissected from rat knee joints were incubated in control (1) is composed of the synovial lining and the subsynovium medium or medium with lipopolysaccharide (LPS), TNF, (2). The synovial lining, also called the synovial intima (3), TGF-ß1 or IL-4 for 12 h. LPS stimulated TNF secretion and consists of macrophage-like type A cells and fibroblast-like both agents stimulated secretion of IL-6. TGF-ß1 slightly B cells (4-6). It is supported by the highly vascularized increased IL-6 secretion. LPS increased the mRNA levels of subsynovium, consisting of loose alveolar tissue, dense fibrous IL-6, IL-1ß, TGF-ß1, MMP1a, MMP1b, MMP3, MMP9, tissue and fat pad (2). MMP13, MMP14, TIMP1 and TIMP3 while the mRNA Most of the studies on the cells present in the synovial levels of MMP2, TIMP2 and TIMP4 were significantly membrane deal with the cells forming the synovial lining decreased.
    [Show full text]
  • Changes in Gene and Protein Expression of Metalloproteinase-2 and -9 and Their Inhibitors TIMP2 and TIMP3 in Different Parts of Fluoride-Exposed Rat Brain
    International Journal of Molecular Sciences Article Changes in Gene and Protein Expression of Metalloproteinase-2 and -9 and Their Inhibitors TIMP2 and TIMP3 in Different Parts of Fluoride-Exposed Rat Brain Agnieszka Łukomska 1 , Irena Baranowska-Bosiacka 2, Karolina Dec 3, Anna Pilutin 4, Maciej Tarnowski 5 , Karolina Jakubczyk 3 , Wojciech Zwierełło˙ 1 , Marta Skórka-Majewicz 1 , Dariusz Chlubek 2 and Izabela Gutowska 1,* 1 Department of Medical Chemistry, Pomeranian Medical University, Powsta´nców Wlkp. 72 Av., 70-111 Szczecin, Poland; [email protected] (A.Ł.); [email protected] (W.Z.);˙ [email protected] (M.S.-M.) 2 Department of Biochemistry, Pomeranian Medical University, Powsta´nców Wlkp. 72 Av., 70-111 Szczecin, Poland; [email protected] (I.B.-B.); [email protected] (D.C.) 3 Department of Human Nutrition and Metabolomic, Pomeranian Medical University, Broniewskiego 24 Str., 71-460 Szczecin, Poland; [email protected] (K.D.); [email protected] (K.J.) 4 Department of Histology and Embryology, Pomeranian Medical University, Powsta´nców Wlkp. 72 Av., 70-111 Szczecin, Poland; [email protected] 5 Department of Physiology, Pomeranian Medical University, Powsta´nców Wlkp. 72 Av., 70-111 Szczecin, Poland; [email protected] * Correspondence: [email protected] Abstract: Fluoride (F) exposure decreases brain receptor activity and neurotransmitter production. Citation: Łukomska, A.; A recent study has shown that chronic fluoride exposure during childhood can affect cognitive func- Baranowska-Bosiacka, I.; Dec, K.; tion and decrease intelligence quotient, but the mechanism of this phenomenon is still incomplete. Pilutin, A.; Tarnowski, M.; Jakubczyk, Extracellular matrix (ECM) and its enzymes are one of the key players of neuroplasticity which is es- K.; Zwierełło,˙ W.; Skórka-Majewicz, sential for cognitive function development.
    [Show full text]
  • Theranostics TIMP3 Expression Associates with Prognosis In
    Theranostics 2019, Vol. 9, Issue 22 6676 Ivyspring International Publisher Theranostics 2019; 9(22): 6676-6689. doi: 10.7150/thno.34020 Research Paper TIMP3 expression associates with prognosis in colorectal cancer and its novel arylsulfonamide inducer, MPT0B390, inhibits tumor growth, metastasis and angiogenesis Han-Li Huang1,2, Yi-Min Liu1, Ting-Yi Sung2, Tsui-Chin Huang3, Ya-Wen Cheng3, Jing-Ping Liou1,4,, Shiow-Lin Pan1,2,3, 1. TMU Biomedical Commercialization Center, Taipei Medical University, Taipei 11031, Taiwan 2. Ph.D Program in Biotechnology Research and Development, College of Pharmacy, Taipei Medical University, Taipei 11031, Taiwan. 3. Graduate Institute of Cancer Molecular Biology and Drug Discovery, College of Medical Science and Technology, Taipei Medical University, Taipei 11031, Taiwan. 4. School of Pharmacy, College of Pharmacy, Taipei Medical University, Taipei 11031, Taiwan. Corresponding authors: Shiow-Lin Pan, Ph.D. Graduate Institute of Cancer Molecular Biology and Drug Discovery, College of Medical Science and Technology, Taipei Medical University, No. 250 Wuxing Street, Taipei 11031, Taiwan. E-mail: [email protected]. Phone: 886-2-27361661 ext 7671. Jing-Ping Liou, Ph.D. School of Pharmacy, College of Pharmacy, Taipei Medical University, Taipei, Taiwan. No. 250, Wuxing St., Taipei 11031, Taiwan. E-mail address: [email protected]. Phone: 886-2-27361661 ext 6130 © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2019.02.12; Accepted: 2019.07.31; Published: 2019.09.18 Abstract Tissue inhibitors of metalloproteinase 3 (TIMP3) are a major endogenous inhibitor of matrix metalloproteinase (MMPs) that inhibit tumor growth, invasion, metastasis and angiogenesis.
    [Show full text]
  • Increased TIMP-3 Expression Alters the Cellular Secretome Through Dual
    www.nature.com/scientificreports OPEN Increased TIMP-3 expression alters the cellular secretome through dual inhibition of the metalloprotease Received: 21 September 2017 Accepted: 6 August 2018 ADAM10 and ligand-binding of the Published: xx xx xxxx LRP-1 receptor Simone D. Scilabra1,2, Martina Pigoni1, Veronica Pravatá 1, Tobias Schätzl1, Stephan A. Müller1, Linda Troeberg 3 & Stefan F. Lichtenthaler1,2,4,5 The tissue inhibitor of metalloproteinases-3 (TIMP-3) is a major regulator of extracellular matrix turnover and protein shedding by inhibiting diferent classes of metalloproteinases, including disintegrin metalloproteinases (ADAMs). Tissue bioavailability of TIMP-3 is regulated by the endocytic receptor low-density-lipoprotein receptor-related protein-1 (LRP-1). TIMP-3 plays protective roles in disease. Thus, diferent approaches have been developed aiming to increase TIMP-3 bioavailability, yet overall efects of increased TIMP-3 in vivo have not been investigated. Herein, by using unbiased mass-spectrometry we demonstrate that TIMP-3-overexpression in HEK293 cells has a dual efect on shedding of transmembrane proteins and turnover of soluble proteins. Several membrane proteins showing reduced shedding are known as ADAM10 substrates, suggesting that exogenous TIMP-3 preferentially inhibits ADAM10 in HEK293 cells. Additionally identifed shed membrane proteins may be novel ADAM10 substrate candidates. TIMP-3-overexpression also increased extracellular levels of several soluble proteins, including TIMP-1, MIF and SPARC. Levels of these proteins similarly increased upon LRP-1 inactivation, suggesting that TIMP-3 increases soluble protein levels by competing for their binding to LRP-1 and their subsequent internalization. In conclusion, our study reveals that increased levels of TIMP-3 induce substantial modifcations in the cellular secretome and that TIMP-3-based therapies may potentially provoke undesired, dysregulated functions of ADAM10 and LRP-1.
    [Show full text]
  • Absence of Tissue Inhibitor of Metalloproteinase-4 (TIMP4
    www.nature.com/scientificreports OPEN Absence of Tissue Inhibitor of Metalloproteinase-4 (TIMP4) ameliorates high fat diet-induced Received: 13 September 2016 Accepted: 7 June 2017 obesity in mice due to defective Published online: 24 July 2017 lipid absorption Siva S. V. P. Sakamuri1, Russell Watts3, Abhijit Takawale1, Xiuhua Wang1, Samuel Hernandez- Anzaldo2, Wesam Bahitham3, Carlos Fernandez-Patron2, Richard Lehner3 & Zamaneh Kassiri1 Tissue inhibitor of metalloproteases (TIMPs) are inhibitors of matrix metalloproteinases (MMPs) that regulate tissue extracellular matrix (ECM) turnover. TIMP4 is highly expressed in adipose tissue, its levels are further elevated following high-fat diet, but its role in obesity is unknown. Eight-week old wild-type (WT) and Timp4-knockout (Timp4−/−) mice received chow or high fat diet (HFD) for twelve weeks. Timp4−/− mice exhibited a higher food intake but lower body fat gain. Adipose tissue of Timp4−/–-HFD mice showed reduced hypertrophy and fbrosis compared to WT-HFD mice. Timp4−/–- HFD mice were also protected from HFD-induced liver and skeletal muscle triglyceride accumulation and dyslipidemia. Timp4−/−-HFD mice exhibited reduced basic metabolic rate and energy expenditure, but increased respiratory exchange ratio. Increased free fatty acid excretion was detected in Timp4−/−- HFD compared to WT-HFD mice. CD36 protein, the major fatty acid transporter in the small intestine, increased with HFD in WT but not in Timp4−/− mice, despite a similar rise in Cd36 mRNA in both genotypes. Consistently, HFD increased enterocyte lipid content only in WT but not in Timp4−/− mice. Our study reveals that absence of TIMP4 can impair lipid absorption and the high fat diet-induced obesity in mice possibly by regulating the proteolytic processing of CD36 protein in the intestinal enterocytes.
    [Show full text]
  • The Role of Timps in Regulation of Extracellular Matrix Proteolysis
    Review The role of TIMPs in regulation of extracellular matrix proteolysis Valerie Arpino a,d, Michael Brock a,d and Sean E. Gill a,b,c,d a - Centre for Critical Illness Research, Lawson Health Research Institute, London Health Sciences Center, London, Ontario, Canada b - Division of Respirology, Schulich School of Medicine and Dentistry, Western University, London, Ontario, Canada c - Department of Medicine, Schulich School of Medicine and Dentistry, Western University, London, Ontario, Canada d - Department of Physiology and Pharmacology, Schulich School of Medicine and Dentistry, Western University, London, Ontario, Canada Correspondence to Sean E. Gill: 800 Commissioners Road East, Centre for Critical Illness Research, Victoria Research Labs, A6-134, London, ON, N6A 5W9, Canada. [email protected] http://dx.doi.org/10.1016/j.matbio.2015.03.005 Edited by W.C. Parks and S. Apte Abstract Tissue inhibitors of metalloproteinases (TIMPs), which inhibit matrix metalloproteinases (MMPs) as well as the closely related, a disintegrin and metalloproteinases (ADAMs) and ADAMs with thrombospondin motifs (ADAMTSs), were traditionally thought to control extracellular matrix (ECM) proteolysis through direct inhibition of MMP-dependent ECM proteolysis. This classical role for TIMPs suggests that increased TIMP levels results in ECM accumulation (or fibrosis), whereas loss of TIMPs leads to enhanced matrix proteolysis. Mice lacking TIMP family members have provided support for such a role; however, studies with these TIMP deficient mice have also demonstrated that loss of TIMPs can often be associated with an accumulation of ECM. Collectively, these studies suggest that the divergent roles of TIMPs in matrix accumulation and proteolysis, which together can be referred to as ECM turnover, are dependent on the TIMP, specific tissue, and local tissue environment (i.e.
    [Show full text]