Expression of the ETS Transcription Factor ELF3 in the Retinal Pigment Epithelium

Andrew Ian Jobling,1 Zhiping Fang,1 Daniela Koleski,2 and Martin James Tymms1,2

PURPOSE. The ETS family of transcription factors regulate sev- he retinal pigment epithelium (RPE) is a monolayer of cells eral critical cellular functions. They have also been implicated Tbordered basally by the choriocapillaris and apically by the in invertebrate ocular development. This work was undertaken distal tips of the photoreceptors. It constitutes part of the to determine whether epithelium-specific ETS transcription blood–retinal barrier and as such controls the access of serum- factors are expressed in the retinal pigment epithelium and to based factors to the neural retina.1 In addition to this role, the investigate the possible role of these factors in retinal diseases monolayer is involved in the oxidation of retinol, isomerization such as age-related macular degeneration. of the retinoids and phagocytosis of shed photoreceptor outer segments.2–4 Because the pigment epithelium is critical to METHODS. The expression of the epithelial ETS transcription retinal function, factors that regulate RPE gene expression not factors ELF5, ESE3, and ELF3 was assessed by RT-PCR in the only affect tissue homeostasis, but may also have a role in human RPE cell lines D407 and hTERT-RPE1. The full-length Ј disease. coding sequence of rat Elf3 was isolated with 3 rapid ampli- Transcription factors are known to regulate gene expres- fication of cDNA ends (RACE) and degenerative primers, and sion by binding directly to promoter sites within DNA or to its expression was determined in various rat tissues, by RT-PCR other transcription factors. During tissue development, these and real-time PCR. A polyclonal ELF3 antibody produced from factors are the main determinants of final cellular identity. a C-terminal peptide was used to observe the distribution of Within the eye, several transcription factors are known to be the transcription factor within the retina. To assess the possi- critical to proper ocular development. PAX6 has been de- ble ELF3 regulation of the TIMP3 promoter, transient transfec- scribed as the master control gene in eye formation,5 whereas tion assays were performed. Promoter activity was determined CHX10 has been implicated in retinal development.6 Other with a firefly luciferase reporter gene construct. transcription factors such as those in the Fos and Jun families,7 8 9 RESULTS. The epithelium-specific ETS transcription factor ELF3 MITF and CRX are also critical to eye formation. The impor- was expressed in the D407 and hTERT-RPE1 cell lines. Neither tance of these factors is further emphasized by the fact that ESE3 nor ELF5 was detected in the RPE. The cloning of rat Elf3 mutations within transcription factor genes have been associ- 9 produced two splice variants, designated Elf3a (1786 bp) and ated with the development of ocular disease. Elf3b (1855 bp). The larger form, Elf3b, contained a 69-bp The ETS family of transcription factors, which presently insert in the coding sequence, which showed high homology number more than 30, are important regulators of hematopoi- 10 11 12 to a similar insert previously identified in murine Elf3. Both esis, angiogenesis, cell differentiation, and organogene- sis.13 Originally identified because of their homology to the splice variants were expressed in rat lung, kidney, liver, and 14 retina, but were absent in heart tissue. Real-time PCR analysis v-ets oncogene, all members of the family share a highly showed the retina to contain high levels of Elf3, which was conserved DNA-binding domain known as the ETS domain and subsequently localized to the RPE. Elf3 upregulated the TIMP3 recognize the GGA(A/T) core sequence in the promoters and promoter, with Elf3a and -3b inducing an approximate sixfold enhancers of various cellular genes. The importance of the ETS domain to protein function is illustrated by its high degree of increase in activity. conservation (49% identity) between human and Drosoph- CONCLUSIONS. The ELF3 transcription factor is highly expressed ila.15 In addition to their role in development, ETS factors have in the RPE and can regulate important ocular genes, such as been implicated in several diseases such as Down syndrome,16 TIMP3, in vitro. The specific expression of ELF3 in the RPE may Alzheimer’s disease,17 and tumorigenesis.11 reflect an important role for this transcription factor in retinal Several of the ETS transcription factor family are specifically function. Furthermore, its regulation of TIMP3 may have im- expressed in epithelial cells. ELF3 (ERT/ESX/ESE1) was the first plications for degenerative retinal diseases, such as age-related described in human breast cancer cells, but has subsequently macular degeneration. (Invest Ophthalmol Vis Sci. 2002;43: been identified in a wide range of epithelial cells.18,19 Three 3530–3537) other epithelial ETS factors, ELF5 (ESE2),20 ESE3,21 and PDEF (Pse),22,23 have also been identified recently; however, these factors have a more restricted pattern of expression. The presence of these ETS transcription factors may be critical for the From the 1National Vision Research Institute of Australia, Carlton, 2 epithelial phenotype, with alterations in expression associated Victoria, Australia; and the Department of Optometry and Vision 19 Sciences, University of Melbourne, Melbourne, Victoria, Australia. with malignant transformation. Supported by grants from The National Health and Medical Re- There has been only limited investigation into the presence search Council of Australia and from the Lions Vision Research Fellow- and role of ETS factors within the vertebrate eye. Recently, ship Fund. Yoshida et al.24 have reported the presence of Elf3 in mouse Submitted for publication November 27, 2001; revised February corneal epithelium. Its expression parallels that of the differ- 11, 2002; accepted February 28, 2002. entiation marker, K12 keratin and appeared critical for epithe- Commercial relationships policy: N. lial differentiation within the cornea. Earlier work by O’Neal et The publication costs of this article were defrayed in part by page al.25 implicated another two ETS domain proteins, pointed and charge payment. This article must therefore be marked “advertise- yan, in Drosophila photoreceptor development. Because ETS ment” in accordance with 18 U.S.C. §1734 solely to indicate this fact. 26 Corresponding author: Andrew Ian Jobling, National Vision Re- function is highly conserved between species, these tran- search Institute of Australia, 386 Cardigan Street, Carlton, Victoria scription factors may have important roles in the ocular devel- 3053, Australia; [email protected]. opment of higher organisms.

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, November 2002, Vol. 43, No. 11 ELF3 Expression in the RPE 3531

TABLE 1. Speciﬁc PCR Primers Used for the Ampliﬁcation of the ETS Factors ELF3, ESE3 and ELF5

Primers

Target Gene Upstream Downstream Product Size (bp)

hELF3 gatggggccaccctctgcaattgtg ccctcagttccgactctggagaacctc 827 hESE3 tttcccacccagaatctttag ccaaagtattggcagcttcag 953 hELF5 gaaagcctcctctttggacc gcaatagacattcgaaaggctt 890 rElf3 gttgaccctgaacaaccaac cttcgggacctcacctcca 272,341

Primers for the human genes were designed from previously published sequences, and those for rat were determined as outlined in Materials and Methods. The sizes of the two splice variants ampliﬁed from rat Elf3 are indicated.

ETS transcription factors may also regulate genes potentially spanning oligonucleotide (5Ј-atggcngcnacntgygarat-3Ј). All cDNA se- involved in retinal disease. Of particular interest is the tissue quences were confirmed by automated sequencing of both strands. inhibitor of metalloproteinase 3 (TIMP3) gene, which has The full rat Elf3 coding sequence was cloned using the degenerate shown elevated levels in retinitis pigmentosa (RP),27 Sorby’s oligonucleotide and a primer within the 3Ј untranslated region (5Ј- fundus dystrophy (SFD),27 and age-related macular degenera- ctgacccttaattctgactctctccaacc-3Ј). The 1192-bp (Elf3a) and 1123-bp tion (ARMD).28 (Elf3b) products were subcloned into a plasmid vector (pGEM-T; Pro- TIMP3, unlike the other members of the TIMP family, is an mega Corp., Madison, WI) and subsequently cloned into the NotI site insoluble component of the extracellular matrix (ECM). It is of the expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA), yielding synthesized in the RPE and deposited in Bruch’s membrane, the constructs rElf3a/pcDNA3.1 and rElf3b/pcDNA3.1. where it regulates ECM turnover and limits choroidal neovas- cularization. Mutations within the TIMP3 gene are known to RNA Isolation and RT-PCR lead to the development of autosomal dominant SFD.29 Be- cause SFD and ARMD have a similar etiology, TIMP3 may also Total RNA was isolated from individual rat tissues (10–30 mg) and the play a role in the progression of the age-related condition. D407 and hTERT-RPE1 cell lines (0.5–1 ϫ 107 cells) using an extraction However, no mutations have been found in patients with kit (RNeasy mini kit; Qiagen, Chatsworth, CA). The retinal samples ARMD, suggesting that other mechanisms are involved in ac- included tissue from the posterior eye cup. Total RNA from the human cumulation of TIMP3 and the resultant changes in the ECM that breast and prostate cancer cell lines, T47D and PC3, were used as the are observed in this disease. The upregulation of TIMP3 by positive control for ETS transcription factor expression. RT-PCR was transcription factors could provide such a mechanism. performed on 0.5 ␮g RNA (Omniscript RT; Qiagen) using an oligo dT The purpose of the present study was to identify whether primer. Subsequent amplification on a thermal cycler (PCR Express; epithelial ETS transcription factors are expressed in the RPE. Hybaid, Ashford, UK) used HotStarTaq DNA polymerase (Qiagen) and The identification of retinal transcription factors may provide intron-spanning primers for the ETS family members hELF3, hESE3, an insight, not only into RPE regulation, but also into the hELF5, and rElf3 (Table 1). The amplification protocol consisted of cellular disruption that occurs in retinal diseases such as 95°C (15 minutes), followed by 30 cycles of 94°C (10 seconds), 58°C ARMD. (30 seconds), and 72°C (1 minute). The Elf3a and -3b splice variants were amplified from rat tissues with a 35-cycle protocol. MATERIALS AND METHODS Rat Tissue Elf3 Expression All experiments conformed to the ARVO statement for the Use of Animals in Ophthalmic and Vision Research. The proportion of Elf3 was determined in various rat tissues using real-time PCR (LightCycler; Roche, Mannheim, Germany). RT-PCR was Cell Lines and Culture performed on 0.4 ␮g total RNA as described, and 1 ␮L of the resultant cDNA was added to a 19-␮L PCR reaction mix (50 mM Tris [pH 8.3], The transformed human RPE cell line D407 was grown in Dulbecco’s 3 mM MgCl2, 0.2 mM dNTP, 0.25mg/mL BSA, 0.8 U Taq, and a 1:3000 modified Eagle’s medium (DMEM; Gibco-Life Technologies, Gaithers- dilution of fluorescent green dye [SYBR Green I; Applied Biosystems, burg, MD) supplemented with 10% fetal calf serum (FCS), 100 U/mL Foster City, CA] in 10 mM Tris, 0.1 mM EDTA [pH 8.0]). Rat Elf3 ␮ penicillin, and 100 g/mL streptomycin (CSL, Melbourne, Australia). primers (0.5 ␮M; Table 1) were included in a 40-cycle protocol (95°C, The telomerase-immortalized human RPE cell line, hTERT-RPE1 (Clon- 0 seconds; 61°C, 10 seconds; 72°C, 20 seconds). Detection of the tech, Palo Alto, CA), was grown in DMEM-F12 (Gibco-Life Technolo- fluorescent signal was performed at 88°C, and amplifications were gies) containing 10% FCS, 0.348% Na2HCO3, 100 U/mL penicillin, and performed in triplicate. The full coding sequence of rat Elf3b was ␮ 100 g/mL streptomycin. Cell lines were maintained in a humidified amplified as described and quantified spectrophotometrically, and a incubator at 5% CO2 and 37°C. Confluent cell monolayers were pas- standard curve (102–106 copies) was produced. Tissue Elf3 copy num- saged using a 1% (wt/vol) trypsin-EDTA solution (CSL). bers were determined with reference to the standard curve. Isolation and Characterization of Rat Elf3 cDNA Elf3 Polyclonal Antibody Production The 3Ј coding sequence of rat Elf3 was determined using the rapid amplification of cDNA ends (RACE) system (Life Technologies). The New Zealand White rabbits were challenged with an Elf3 peptide initial RACE reaction used a specific rat Elf3 primer (5Ј-ggagatcctg- sequence (VDGRRLVYKFGKNSSGWKE) linked to a diphtheria toxin gaacgggtggatgg-3Ј) and a universal primer (UAP; Life Technologies). carrier (Chiron Technologies, Melbourne, Australia). Antibodies were The subsequent product was reamplified with a nested primer (5Ј- affinity purified using a recombinant human ELF3 linked gel (Sepha- ctcgtctacaagtttggcaaaaac-3Ј). The specific Elf3 and nested primers rose-4B; Amersham Pharmacia Biotech, Piscataway, NJ). The recombi- were derived from a rat expressed sequence tag (EST) that showed a nant protein was generated using the His-tag expression vector pQE30 high homology with the human and murine ELF3 sequences. Addi- and purified on a separation column (Ni-NTA Superflow; Qiagen), with tional 5Ј coding sequence was determined with a degenerate ATG- a denaturing protocol.19

Downloaded from iovs.arvojournals.org on 09/26/2021 3532 Jobling et al. IOVS, November 2002, Vol. 43, No. 11

Western Blot Analysis Rat tissue nuclear extracts were isolated in a two-step lysis protocol.

Respective tissues were washed with PBS (7.2 mM Na2HPO4, 2.8 mM NaH2PO4 [pH 7.2], and 0.15M NaCl) and homogenized in a cytoplasmic lysis buffer (10 mM Tris-HCl [pH 8], 5 mM KCl, 2 mM MgCl2, and 0.5% Nonidet P-40). Cell nuclei were pelleted (22,000g), washed with the cytoplasmic lysis buffer, and resuspended in SDS sample buffer. Soluble proteins were separated by SDS-PAGE,30 and Western blot analysis was performed according to the method of Towbin and Gor- dan.31 The Elf3 antibody was used at a concentration of 1 ␮g/mL, and a sheep anti-rabbit HRP conjugate (Silenus, Melbourne, Australia) was used as the secondary antibody. The membrane was developed with a luminescence detection kit (ECL Plus; Amersham, Buckinghamshire, UK).

Immunohistochemistry FIGURE 1. Expression of ETS transcription factors in human RPE cell lines. Expression of ELF3, ESE3, and ELF5 was assessed by RT-PCR in Hybrid-ready rat eye sections (Novagen, Madison, WI) were deparaf- the RPE cell lines D407 and hTERT-RPE1. The cancer cell lines T47D finized, rehydrated, immersed in 0.01 M sodium citrate buffer (pH 6.0), and PC3 were used as positive controls for the ETS transcription and heated for 10 minutes.32 Tissue sections were blocked with 20% factors. A 1-kb (250–10,000 bp) DNA ladder is included between sheep serum for 1 hour, rinsed, and incubated overnight in PBS hTERT and t47D. containing 1% BSA, 1% rat serum, 1% sheep serum, and 5 ␮g/mL Elf3 antibody. Sections were subsequently incubated with a sheep anti- rabbit AP conjugate (Silenus), followed by a rabbit anti-APAAP conju- RESULTS gate (Sigma Chemical Co., St. Louis, MO). The signal was detected using fast blue BB and sections were counterstained with periodic The ETS transcription factors ELF3, ESE3, ELF5, and PDEF are acid-Schiff stain (Sigma). For the blocking control, the Elf3 antibody specifically expressed in epithelial cells. It is not known was incubated for 1 hour with a 200-fold molar excess of immunizing whether these factors are expressed in the RPE. To address peptide. this, specific primers were designed from the published sequences and RT-PCR performed on two human RPE cell lines: Construction of Luciferase Reporter Vectors D407 and hTERT-RPE1. The expression of PDEF was not assessed in the RPE, because it is confined to the glandular A 3.5-kbp fragment, containing the human TIMP3 promoter was iso- epithelium.22 lated from the bacterial artificial chromosome (BAC) bK766E1 after As observed in Figure 1, both human RPE cell lines con- BamHI digestion. This fragment was cloned into a vector tained specific message for ELF3, whereas neither expressed (pGem3Zf(Ϫ); Promega Corp.) and a 1210-bp fragment subsequently ESE3 or ELF5. The spontaneously transformed D407 cell line isolated after digestion with EcoICRI (Promega Corp.). The TIMP3 appeared to express significantly more ELF3 than hTERT-RPE1; promoter fragment (Ϫ932 to ϩ278) was finally blunt-end cloned into however, semiquantitative PCR must be performed to estimate the HindIII site of a luciferase reporter vector (pGL3basic; Promega the difference in expression. Although ELF3 expression has Corp.) yielding TIMP3-932luc. been reported in tissues such as liver, lung, and kidney,19 this A fragment corresponding to the human E-cadherin promoter is the first evidence of expression in the retina. The human (Ϫ970 to ϩ30) was isolated by PCR. Forward (5Ј-tcacgcctgtaatccaacac- breast (T47D) and prostate (PC3) cancer cell lines are known 3Ј) and reverse (5Ј-tcacaggtgctttgcagttc-3Ј) primers were designed to express ELF5, ELF3, ESE3, and ELF3, ESE3, respectively, and with reference to the published sequence.33 The 1000-bp product was were used as positive controls.19,20 subcloned into a plasmid vector (pGEM-T; Promega Corp.) before Although the human and murine ELF3 sequences have been being cloned into an expression vector (pGL3basic; Promega Corp.), as determined,18,19 the rat sequence is unknown. Because the rat described earlier. This construct was designated Ecad-970luc. has been a suitable model for the study of retinal anatomy and The sequence of both reporter constructs were verified by auto- disease, elucidation of its Elf3 sequence would be invaluable. mated DNA sequencing. The full coding sequence of rat Elf3 was derived by using the RACE method and an ATG-spanning degenerative primer. Two Transient Transfection Assays splice variants of 1786 and 1855 bp were identified and designated Elf3a and Elf3b (Fig. 2A). The two differ because of a Human RPE cells (hTERT-RPE1) were transfected with a lipid-based 69-bp in-frame insertion, which probably arose from differen- transfection reagent (Qiagen). Equal amounts (0.2 ␮g) of the TIMP3- tial splicing. The sequences are predicted to encode 371 and 932luc plasmid and rElf3a/pcDNA3.1, rElf3b/pcDNA 3.1, or the empty 394 amino acid proteins, both of which contain the conserved expression vector pcDNA3.1 was added. For control experiments, the ETS domain (Fig. 2, shown in bold). Rat Elf3 displays a high E-cadherin promoter construct (Ecad-970luc) was used in place of homology to the human (90% identity) and murine (95% iden- TIMP3-932luc. Cells were harvested after 24 hours and lysed (25 mM tity) sequences, reflecting the low interspecies variation of the

Tris-phosphate [pH 7.8], and 10 mM MgCl2, 1 mM EDTA, 1 mM ETS transcription factor family. dithiothreitol, 15% glycerol, and 1% Triton X-100). The cell extract was The 69-bp insertion, present in rat Elf3b, was very similar to added to an assay buffer (lysis buffer without 1 mM dithiothreitol, with the insert found in the murine gene (Fig. 2B). Although the 1.25 mM adenosine triphosphate [ATP] and 75 ␮M luciferin; Promega murine insert did not have the initial three amino acids, those Corp.) and luciferase activity estimated on a luminometer (Lumat LB remaining displayed a 90% identity. Such high homology is rare 9507; EG&G Berthold, Bad Wildbad, Germany). Protein content was in a differentially spliced region and may reﬂect a functional determined with a protein assay kit (Dc; Bio-Rad, Richmond, CA). The conservation. Although human ELF3 also shows a second mean Ϯ SD was obtained from triplicate samples and the data com- splice variant, the insert is not homologous to the murine and pared with ANOVA. rat Elf3b and occurs closer to the 3Ј end of the transcript.34

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, November 2002, Vol. 43, No. 11 ELF3 Expression in the RPE 3533

FIGURE 2. cDNA coding and amino acid sequence for rat Elf3. (A) The complete nucleotide and corresponding amino acid (single-letter code) sequences are shown. Shaded area: inserted bases identiﬁed in the longer Elf3 transcript (Elf3b). The amino acids comprising the ETS domain are shown in bold, and a putative polyadenylation sequence (AATAAA) is also identiﬁed. (B) Comparison of the murine and rat Elf3b inserts. Single-letter codes are shown for the extra amino acid sequences found in murine (m) and rat (r) Elf3b. Boxed regions: amino acid identity; dashes: amino acids not present in the mouse insert.

Downloaded from iovs.arvojournals.org on 09/26/2021 3534 Jobling et al. IOVS, November 2002, Vol. 43, No. 11

was shown to be restricted to the RPE, studies were undertaken to determine whether it regulates genes involved in retinal disease. Work focused on the TIMP3 gene, because it has been implicated in RP, SFD, and ARMD.27,28 Computer analysis of the human and murine TIMP3 promoters revealed several consensus binding sites for ETS transcription factors. One of these, an inverted ETS binding site (Fig. 6A), was found at positions Ϫ177 of the human and Ϫ174 of murine TIMP3 promoters. Because inverted ETS sites are known to play a role in gene regulation,36 transient transfection assays were used to assess the regulation of the TIMP3 promoter by ELF3. As observed in Figure 6B, the human TIMP3 promoter (TIMP3-932luc) showed low basal level activity when the empty expression vector (pcDNA3.1) was added. However, when constructs containing either Elf3a (rElf3a/pcDNA3.1) or -3b (rElf3b/pcDNA3.1) were included, a sixfold upregulation was observed (P ϭ 0.005, P ϭ 0.0016, respectively). The regulatory properties of the two splice variants were similar, ϭ FIGURE 3. Elf3 expression in rat tissues. (A) Real-time PCR analysis of with the difference not statistically significant (P 0.3). The Elf3 expression in rat tissues. Rat heart (lane 1), liver (lane 2), lung E-cadherin promoter construct (Ecad-970luc) was included as a (lane 3), kidney (lane 4), and retina (lane 5) were assessed for Elf3 negative control. Transfection with either Elf3a or -3b did not expression. Copy numbers were estimated after comparison to an affect luciferase activity (P ϭ 0.47, P ϭ 0.1, respectively). external standard (cloned rElf3b). (B) RT-PCR of Elf3a and -3b in various rat tissues. The expression of the two Elf3 splice variants was assessed in heart (lane 1), liver (lane 2), lung (lane 3), kidney (lane 4), DISCUSSION and retina (lane 5). Also included are the rElf3b/pcDNA3.1 and rElf3a/ pcDNA3.1 expression constructs (lanes 6 and 7, respectively). The role of transcription factors in ocular development and disease is of great interest. Although factors such as PAX6 and CHX10 have been implicated in ocular development of the Elf3 expression in various rat tissues was quantified by eyes, the ocular expression and role of the ETS transcription real-time PCR, which provides an accurate measure of gene factor family has not been explored in vertebrate organisms. expression.35 Elf3 was detected in lung, kidney, liver, and This study is the first to show that the RPE expresses the retina, yet was absent in heart (Fig. 3A). Previous reports have epithelial specific ETS transcription factor ELF3. Furthermore, found that heart tissue does not express ELF3.19 Although rat transient transfection studies show this factor to up regulate retina contains significant quantities of this transcription fac- the important TIMP3 gene significantly. tor, its levels are approximately 50% lower than those found in ELF3 was expressed in rat retinal tissue and in the human lung and kidney. These tissues have previously been reported RPE cell lines, D407 and hTERT-RPE1. The other epithelial ETS to contain high levels of ELF3.19 factors, ELF5 and ESE3 were not found in the RPE, reflecting The proportions of the Elf3 splice variants in rat tissues their restricted expression patterns.20–22 Histochemical stain- were determined with RT-PCR (Fig. 3B). Elf3b was the major ing of the retina localized the expression predominantly to the (Ͼ95%) splice variant in rat lung, kidney, liver, and retina, with RPE, with only weak staining observed in the inner nuclear the 3a-to-3b ratios remaining constant. Neither splice variant layer, specifically the horizontal cell bodies. While this staining was detected in heart tissue. Expression of Elf3a and -3b did appeared to be specific, ELF3 expression has not been re- not appear to have a developmental role in the rat retina, ported in neuronal cells. In fact, Northern and RNase protec- because proportions did not vary as a function of age (data not tion analysis performed by Tymms et al.19 showed that neither shown). The rElf3a and 3b expression constructs are included fetal nor adult brain expresses ELF3. Neuronal cells, however, in Figure 3B and show sizes (269 and 338 bp, respectively) identical with the amplified product from the tissue samples. Because commercial Elf3 antibodies were unsuitable for use in rat tissues, a polyclonal antibody was produced after chal- lenge from a C-terminal peptide to Elf3. The 19-amino-acid peptide (368Val–386Glu) is totally conserved among human, murine, and rat Elf3. The Western blot in Figure 4 shows the antibody to be specific for Elf3, with an approximate 43-kDa band detected for the human recombinant protein and the rat tissue samples. Because the RT- and real-time PCRs showed ELF3 in the retina, the polyclonal Elf3 antibody was used to determine whether expression was ubiquitous or confined to a particular cell type. Figure 5A shows the label mostly confined to the RPE, with only diffuse staining observed in the inner nuclear layer. Preincubation of the tissue section with a 200-fold excess of neutralizing peptide abolished Elf3 immunoreactivity (Fig. 5B). Whereas the ETS factors ESE3, ELF5, and PDEF show some homology with the immunizing peptide, PDEF is confined to 22 FIGURE 4. Western blot analysis of rat Elf3. Recombinant human Elf3 the glandular epithelium and ESE3 and ELF5 are not present (pQE30; lane 1), rat retina (lane 2), and kidney (lane 3) extracts were in the RPE (Fig. 1). separated by 10% SDS-PAGE and probed with the polyclonal antibody Alterations in the RPE have been associated with several derived from the C-terminal peptide. Molecular weight markers are diseases such as RP, SFD, and ARMD. Because ELF3 expression indicated at left.

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, November 2002, Vol. 43, No. 11 ELF3 Expression in the RPE 3535

FIGURE 5. Elf3 distribution in the rat retina. The polyclonal Elf3 antibody raised against the C-terminal peptide sequence was used to stain rat retinal sections. (A) Speciﬁc labeling of the RPE layer with the Elf3 antibody. (B) The control incubation with the immunizing peptide. INL, inner nuclear layer; IPL, inner plexiform layer; ONL, outer nuclear layer; OPL, outer plexiform layer.

express other ETS family members, such as Pet-1 and Er81.37,38 variant (Elf3b) described in this study has an extra 69 bp Although cross reactivity with these related transcription fac- adjacent to the conserved N-terminal domain (pointed-like). tors may have resulted in the apparent horizontal cell localiza- The apparent preference for this transcript, coupled with the tion, it was not observed in the Western blot analysis. high insert homology to murine Elf3b, could reflect a func- Alternatively spliced products have been reported for many tional significance. A protein motif search showed the insert to ETS genes, including Ets1, Elk1, and Tel.39–41 The larger splice contain a potential casein kinase II (CK2) or protein kinase C (PKC) phosphorylation site (SQRD). Phosphorylation of ETS transcription factors is known to regulate many of their functions, such as DNA binding, transcriptional activation, transcriptional repression, and subunit association.42 Furthermore, the proximity of the insert to the pointed-like domain, may potentiate this domain’s role in dimerization and transactiva- tion.43,44 The presence of a different human ELF3 splice variant may reflect a species-specific regulatory mechanism for this transcription factor.34 As in previous studies, ELF3 was detected in the liver, lung, and kidney, but was absent from the heart.19 Quantification of the relative copy numbers showed lung and kidney to express the highest levels of ELF3, followed by retina and liver. How- ever, because ELF3 is expressed only in epithelial cells, the proportion of epithelia in the various tissues has a large impact on the apparent levels. Whereas the lung and kidney contain high proportions of specialized epithelial cells, the retina has only a single, noninvaginated layer of epithelial cells. It is therefore likely that retinal expression of ELF3 is underesti- mated. The existence of high expression levels in the RPE could reflect an important role for this factor in retinal gene regulation. Although the part played by ELF3 in tissue development is yet to be determined, its expression has been associated with FIGURE 6. Regulation of the TIMP3 promoter by Elf3. (A) Identifica- mammary gland development and the occurrence of the epi- tion of a putative Elf3 consensus binding sequence within the human thelial phenotype.45,46 ELF3 is known to regulate numerous and murine TIMP3 promoters. The region corresponds to Ϫ177 to genes such, as keratin 4, c-met and Erb-B2.12,18,47 Recently, it Ϫ147 (human promoter) and Ϫ174 to Ϫ144 (murine promoter). (B) was also shown to induce expression of the TGF-␤ receptor Regulation of the human TIMP3 promoter by rat Elf3a and Elf3b. type II.48 The TGF-␤ family, including their receptors, are Human RPE cells (hTERT-RPE1) were cotransfected with TIMP3-932luc known to play important roles in the development and func- and rElf3a/pcDNA 3.1 (p), rElf3b/pcDNA 3.1 (s), or pcDNA3.1 (Ⅺ). For control experiments TIMP3-932luc was replaced with Ecad970-luc. tioning of the retina. Triplicate samples were used, and luciferase activity was corrected for The in vitro transfections showed ELF3 to upregulate the protein content. Multiples of upregulation are relative to the empty TIMP3 gene, presumably through one of the identified ETS expression vector (pcDNA3.1). binding sites. Although previous reports have identified an ETS

Downloaded from iovs.arvojournals.org on 09/26/2021 3536 Jobling et al. IOVS, November 2002, Vol. 43, No. 11

binding site in the response element for TIMP1,49 this is the 9. Freund CL, Gregory-Evans CY, Furukawa T, et al. Cone-rod dystro- first evidence of ELF3 regulation of the TIMP3 gene. TIMP3 is phy due to mutations in a novel photoreceptor-specific homeobox localized to the extracellular matrix and is able to inhibit all the gene (CRX) essential for maintenance of the photoreceptor. Cell. major classes of matrix metalloproteinases (MMPs),50 making it 1997;91:543–553. a very powerful modulator of extracellular matrix (ECM) turn- 10. Scott EW, Simon MC, Anastasi J, Singh H. Requirement of tran- over. The ELF3 regulation of TIMP3 would have implications scription factor PU.1 in the development of multiple hematopoi- for development, morphogenesis, and tissue remodelling in etic lineages. Science. 1994;265:1573–1577. epithelial cells. Furthermore, because alterations in ECM have 11. Wernert N, Raes MB, Lassalle P, et al. c-ets1 proto-oncogene is a been observed in several diseases such as cancer, arthritis, and transcription factor expressed in endothelial cells during tumor cardiovascular disease,51 this regulatory mechanism could be vascularization and other forms of angiogenesis in humans. Am J Pathol. 1992;140:119–127. of great interest. 12. Brembeck FH, Opitz OG, Libermann TA, Rustgi AK. Dual function In the retina, the accumulation of TIMP3 is thought to play of the epithelial specific ets transcription factor, ELF3, in modu- a significant role in the progression of the phenotypically 27,28 lating differentiation. Oncogene. 2000;19:1941–1949. similar SFD and ARMD. Although the development of SFD 13. Kola I, Brookes S, Green AR, et al. The Ets1 transcription factor is has been attributed to several point mutations within the widely expressed during murine embryo development and is as- TIMP3 gene, the mechanisms underlying ARMD have yet to be sociated with mesodermal cells involved in morphogenetic pro- elucidated. ELF3 regulation of TIMP3 may provide such a cesses such as organ formation. Proc Natl Acad Sci USA. 1993;90: mechanism. If the regulation observed in vitro is representative 7588–7592. of in vivo regulatory properties, then increases in ELF3 expres- 14. Nunn MF, Seeburg PH, Moscovici C, Duesberg PH. Tripartite sion within the retina would result in an accumulation of structure of the avian erythroblastosis virus E26 transforming gene. TIMP3. Such an accumulation may play a role in the thickening Nature. 1983;306:391–395. of Bruch’s membrane and the progression of ARMD. A similar 15. Hsu T, Schulz RA. Sequence and functional properties of Ets genes ELF3-related pathway could also explain the increased TIMP3 in the model organism Drosophila. Oncogene. 2000;19:6409– levels observed in patients with RP.27 Although this study 6416. shows TIMP3 to be under the control of ELF3 in vitro, further 16. Sumarsono SH, Wilson TJ, Tymms MJ, et al. Down’s syndrome-like work is needed to determine whether such regulation occurs skeletal abnormalities in Ets2 transgenic mice. Nature. 1996;379: in vivo. Furthermore, the existence of ELF3 within the retina 534–537. raises the possibility that other genes involved in retinal disease 17. Pastorcic M, Das HK. An upstream element containing an ETS may be under its control. binding site is crucial for transcription of the human presenilin-1 This study has shown the RPE to express significant quan- gene. J Biol Chem. 1999;274:24297–24307. tities of the ETS transcription factor ELF3. Although the role of 18. Chang CH, Scott GK, Kuo WL, et al. ESX: a structurally unique Ets this factor in retinal development is unclear, there are a num- overexpressed early during human breast tumorigenesis. Onco- ber of critical genes that it may regulate. The upregulation of gene. 1997;14:1617–1622. TIMP3 by ELF3 may have implications for the ECM changes 19. Tymms MJ, Ng AY, Thomas RS, et al. A novel epithelial-expressed observed in diseases such as RP and ARMD. ETS gene, ELF3: human and murine cDNA sequences, murine genomic organization, human mapping to 1q32.2 and expression Acknowledgments in tissues and cancer. Oncogene. 1997;15:2449–2462. 20. Zhou J, Ng AY, Tymms MJ, et al. A novel transcription factor, ELF5, The authors thank David Nikolic-Paterson, Department of Nephrology, belongs to the ELF subfamily of ETS genes and maps to human Monash Medical Centre, Clayton, Australia, for assistance with the chromosome 11p13-15, a region subject to LOH and rearrange- histochemical staining of the rat retinal sections and Paul Hertzog, ment in human carcinoma cell lines. Oncogene. 1998;17:2719– Center for Functional Genomics and Human Disease, Monash Institute 2732. of Reproduction and Development, Clayton, Australia, for donation of 21. Kas K, Finger E, Grall F, et al. ESE-3, a novel member of an the T47D and PC3 total RNA samples. epithelium-specific ets transcription factor subfamily, demon- strates different target gene specificity from ESE-1. J Biol Chem. References 2000;275:2986–2998. 22. Oettgen P, Finger E, Sun Z, et al. PDEF, a novel prostate epithe- 1. Cuhna-Vaz J. The blood-ocular barriers. Surv Ophthalmol. 1979; lium-specific ets transcription factor, interacts with the androgen 23:279–296. receptor and activates prostate-specific antigen gene expression. 2. Flannery JG, O’Day W, Pfeffer BA, Horwitz J, Bok D. Uptake, J Biol Chem. 2000;275:1216–1225. processing and release of retinoids by cultured human retinal 23. Yamada N, Tamai Y, Miyamoto H, Nozaki M. Cloning and expres- pigment epithelium. Exp Eye Res. 1990;51:717–728. sion of the mouse Pse gene encoding a novel Ets family member. 3. Bernstein PS, Rando RR. In vivo isomerization of all-trans- to 11- Gene. 2000;241:267–274. cis-retinoids in the eye occurs at the alcohol oxidation state. 24. Yoshida N, Yoshida S, Araie M, Handa H, Nabeshima Y. Ets family Biochemistry. 1986;25:6473–6478. transcription factor ESE-1 is expressed in corneal epithelial cells 4. Flood MT, Bridges CD, Alvarez RA, Blaner WS, Gouras P. Vitamin and is involved in their differentiation. Mech Dev. 2000;97:27–34. A utilization in human retinal pigment epithelial cells in vitro. Invest Ophthalmol Vis Sci. 1983;24:1227–1235. 25. O’Neal EM, Rebay I, Tjian R, Rubin GM. The activities of two 5. Gehring WJ. The master control gene for morphogenesis and Ets-related transcription factors required for Drosophila eye devel- evolution of the eye. Genes Cells. 1996;1:11–15. opment are modulated by the Ras/MAPK pathway. Cell. 1994;78: 137–147. 6. Liu IS, Chen JD, Ploder L, et al. Developmental expression of a novel murine homeobox gene (Chx10): evidence for roles in 26. Albagli O, Klaes A, Ferreira E, Leprince D, Klambt C. Function of determination of the neuroretina and inner nuclear layer. Neuron. ets genes is conserved between vertebrates and Drosophila. Mech 1994;13:377–393. Dev. 1996;59:29–40. 7. He L, Campbell ML, Srivastava D, et al. Spatial and temporal 27. Fariss RN, Apte SS, Luthert PJ, Bird AC, Milam AH. Accumulation of expression of AP-1 responsive rod photoreceptor genes and bZIP tissue inhibitor of metalloproteinases-3 in human eyes with Sors- transcription factors during development of the rat retina. Mol Vis. by’s fundus dystrophy or retinitis pigmentosa. Br J Ophthalmol. 1998;4:32. 1998;82:1329–1334. 8. Mochii M, Mazaki Y, Mizuno N, Hayashi H, Eguchi G. Role of Mitf 28. Kamei M, Hollyfield JG. TIMP-3 in Bruch’s membrane: changes in differentiation and transdifferentiation of chicken pigmented during aging and in age-related macular degeneration. Invest Oph- epithelial cell. Dev Biol. 1998;193:47–62. thalmol Vis Sci. 1999;40:2367–2375.

Downloaded from iovs.arvojournals.org on 09/26/2021 IOVS, November 2002, Vol. 43, No. 11 ELF3 Expression in the RPE 3537

29. Weber BH, Vogt G, Pruett RC, Stohr H, Felbor U. Mutations in the 41. Baens M, Peeters P, Guo C, Aerssens J, Marynen P. Genomic tissue inhibitor of metalloproteinases-3 (TIMP3) in patients with organization of TEL: the human ETS-variant gene 6. Genome Res. Sorsby’s fundus dystrophy. Nat Genet. 1994;8:352–356. 1996;6:404–413. 30. Laemmli UK. Cleavage of structural proteins during the assembly 42. Mimeault M. Structure-function studies of ETS transcription fac- of the head of bacteriophage T4. Nature. 1970;277:680–685. tors. Crit Rev Oncog. 2000;11:227–53. 31. Towbin H, Gordan J. Immunoblotting and dot immunoblotting. 43. Golub TR, Barker GF, Lovett M, Gilliland DG. Fusion of PDGF J Immunol Methods. 1984;72:313–340. receptor beta to a novel ets-like gene, tel, in chronic myelomono- 32. Fan JM, Ng YY, Hill PA, et al. Transforming growth factor-beta cytic leukemia with t(5;12) chromosomal translocation. Cell. 1994; regulates tubular epithelial-myofibroblast transdifferentiation in 77:307–316. vitro. Kidney Int. 1999;56:1455–67. 44. Siddique HR, Rao VN, Lee L, Reddy ES. Characterization of the 33. Bussemakers MJ, Giroldi LA, van Bokhoven A, Schalken JA. Tran- DNA binding and transcriptional activation domains of the erg scriptional regulation of the human E-cadherin gene in human protein. Oncogene. 1993;8:1751–1755. prostate cancer cell lines: characterization of the human E-cad- 45. Neve R, Chang CH, Scott GK, Wong A, Friis RR, Hynes NE, Benz herin gene promoter. Biochem Biophys Res Commun. 1994;203: CC. The epithelium-specific ets transcription factor ESX is associ- 1284–1290. ated with mammary gland development and involution. FASEB J. 34. Oettgen P, Alani RM, Barcinski MA, et al. Isolation and character- 1998;12:1541–1550. ization of a novel epithelium-specific transcription factor, ESE-1, a 46. Davies JA, Garrod DR. Molecular aspects of the epithelial pheno- member of the ets family. Mol Cell Biol. 1997;17:4419–4433. type. Bioessays. 1997;19:699–704. 35. Simpson D, Feeney S, Boyle C, Stitt A. Retinal VEGF mRNA mea- sured by SYBR Green I fluorescence: a versatile approach to 47. Oettgen P, Kas K, Dube A, et al. Characterization of ESE-2, a novel quantitative PCR. Mol Vis. 2000;6:178–183. ESE-1-related Ets transcription factor that is restricted to glandular epithelium and differentiated keratinocytes. J Biol Chem. 1999; 36. Venanzoni MC, Robinson LR, Hodge DR, Kola I, Seth A. ETS1 and ETS2 in p53 regulation: spatial separation of ETS binding sites 274:29439–29452. (EBS) modulate protein-DNA interaction. Oncogene. 1996;12: 48. Choi SG, Yi Y, Kim YS, et al. A novel ets-related transcription 1199–1204. factor, ERT/ESX/ESE-1, regulates expression of the transforming 37. Fyodorov D, Nelson T, Deneris E. Cloning and expression of Pet-1, growth factor-beta type II receptor. J Biol Chem. 1998;273:110– a novel ets domain factor that can activate neuronal nAchR gene 117. transcription. J Neurobiol. 1998;32:151–163. 49. Logan SK, Garabedian MJ, Campbell CE, Werb Z. Synergistic tran- 38. Arber S, Ladle DR, Lin JH, Frank E, Jessell TM. ETS gene Er81 scriptional activation of the tissue inhibitor of metalloproteinases-1 controls the formation of functional connections between group promoter via functional interaction of AP-1 and Ets-1 transcription Ia sensory afferents and motor neurons. Cell. 2000;101:485–498. factors. J Biol Chem. 1996;271:774–782. 39. Koizumi S, Fisher RJ, Fujiwara S, et al. Isoforms of the human ets-1 50. Apte SS, Olsen BR, Murphy G. The gene structure of tissue inhib- protein: generation by alternative splicing and differential phos- itor of metalloproteinases (TIMP)-3 and its inhibitory activities phorylation. Oncogene. 1990;5:675–681. define the distinct TIMP gene family. J Biol Chem. 1995;270: 40. Rao VN, Reddy ES. Delta elk-1, a variant of elk-1, fails to interact 14313–14318. with the serum response factor and binds to DNA with modulated 51. Nagase H. In: Hooper NM, ed. Zinc Metalloproteinases in Health specificity. Cancer Res. 1993;53:215–220. and Disease. London: Taylor and Francis; 1996:153–204.

Downloaded from iovs.arvojournals.org on 09/26/2021