DOCSLIB.ORG

Identifi Cation of Herpes Simplex Virus DNA and Lack of Human

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identifi Cation of Herpes Simplex Virus DNA and Lack of Human 214 Letters to the Editor Identi cation of Herpes Simplex Virus DNA and Lack of Human Herpesvirus-8 DNA in Mycosis Fungoides Emel Erkek1, Nilgu¨n Sentu¨rk1, Irem Dinc¸er2, Ali Ilgõ n Olut2, Tanõ l Kocago¨z2, Gu¨l Bu¨ku¨lmez1 and Sedef Sahin1 Departments of 1Dermatology and 2Clinical Microbiology; Hacettepe University Faculty of Medicine, Neyzen Tev k sokak, Ferah apt., 12/12 Maltepe, TR-06570 Ankara, Turkey. E-mail: [email protected] Accepted February 22, 2002. 2a-1) 5¢ CTG GTC AGC TTT CGG TAC GA 3¢ , and (HSV Sir, gB 2a-2) 5¢ CAG GTC GTG CAG CTG GTT GC 3¢ . These Human herpesvirus 8 (HHV-8) is the most recent putat- primers have been amplifying both types of HSV, namely ive human herpesvirus. Evidence was obtained using types I and II. As a positive control specimen, cerebrospinal molecular biology techniques (1). Speci c DNA uid of a patient with a clinical and serologically proven HSV sequences were rst identi ed in 1994 by Chang et al. encephalitis was used. (2) in Kaposi’s sarcoma tissues from patients with AIDS using the representational diVerence analysis technique. In the vast majority of cases, HHV-8 DNA sequences RESULTS AND DISCUSSION can be shown by polymerase chain reaction (PCR) in Using PCR, we were able to amplify DNA speci c for classical, endemic, iatrogenic and AIDS-associated HSV from 16 of 50 MF patients (32%). Thirteen out of Kaposi’s sarcoma (1). HHV-8 is also lymphotrophic 16 HSV-positive samples were diagnosed as MF eryth- and has the ability to immortalize cells (3, 4). The virus ematous stage and 3 were MF plaque stage. All samples has been associated with peripheral T-cell lymphomas, lacked HHV-8 DNA by PCR. Neither HSV nor HHV-8 plaque parapsoriasis, lymphomatoid papulosis and cuta- was detected in any of the control specimens. The neous T-cell lymphomas (CTCL), including mycosis representative positive PCR results are shown in Figs 1 fungoides (MF ) (5–7). Herpes simplex virus (HSV ) and 2. primarily targets epithelial and neural cells rather than HHV-8 is usually together with EBV as a dual infec- lymphocytes. However, given the immunologic relation- tion in body cavity lymphomas, AIDS-related non- ship between T lymphocytes and the epidermis, and the Hodgkin’s lymphomas and in non-malignant lymphoid fact that MF often appears to be initiated as a cutaneous lesions (10, 11). In HIV + patients, EBV and HHV-8 process, a potential role for HSV in the development or associated CTCL have been reported to take anaplastic progression of MF has been suggested (8). large cell morphology (12). However, there was no The purpose of this study was to elucidate a potential evidence for the presence of EBV (9) and HHV-8 in role for HHV-8 and HSV in the etiopathogenesis of MF. lesional samples of our patients. This nding is in accordance with that of previous studies (5–7, 13–15) revealing the absence of HHV-8 in MF and suggesting MATERIAL AND METHODS that HHV-8 can be excluded from the list of potential Fifty formalin- xed paraYn-embedded samples from lesional etiological factors in MF. skin of 50 Caucasian patients with MF were selected and The presence of both HSV-speci c antigens and HSV retrospectively collected from archival les of the Pathology DNA in lesions of CTCL has been reported previously Department. In a previous study performed in our department, these biopsy samples have been shown by PCR to be EBV (16, 17). However, no direct association between chronic negative (9). In all patients, the skin biopsies have been HSV infection and the development of malignant obtained during initial admission to hospital, before initiation lymphoma has been con rmed to date. Brice et al. (18) of any form of therapy. Forty-three of the 50 patients were could not detect any HSV positivity among 30 patients diagnosed as MF erythematous stage (86%) and 7 were MF with CTCL, 9 patients with lymphomatoid papulosis plaque stage (14%). The patients were classi ed according to the TNM staging as follows: 19 of the 50 were stage IA (38%), and 10 patients with pityriasis lichenoides et varioli- 25 were stage IB (50%) and 6 were stage IIA (12%). Control formis acuta. In contrast, our study revealed the presence skin samples were obtained from normal skin of 20 healthy of HSV DNA in 16 of 50 (32%) lesional biopsy samples. individuals undergoing elective plastic surgery. There are previously reported cases of chronic, dissemin- The patient and control samples were studied by PCR for ated and fatal cases of HSV infections in CTCL, includ- the presence of HSV and HHV-8. All samples showed human b-globulin gene ampli cation by PCR, indicating the absence ing MF (19, 20). The presence of HSV within MF of major PCR inhibitors. The primers used in this study were lesions might re ect the immunode ciency secondary to rst described by Chang et al. (2), and were speci c for advanced disease or to immunosuppressive treatment. HHV-8. 5¢ TCCGTGTTGTCTACGTCCAG3¢ was used as the However, cutaneous biopsies in our study were obtained rst primer, and 5¢ AGCCGAAAGGATTCCACCAT3¢ as the before therapy and none of the samples belonged to second. A positive control containing HHV-8 DNA was obtained from patients with HIV-associated Kaposi’s sarcoma. patients with advanced tumoral or erythrodermic MF. For HSV, a target region of 342 base pairs between the 2348th We believe that the role of HSV as an initiator or and 2689th bases was selected on the viral genome: (HSV gB promoter in CTCL is worth investigating, and further Acta Derm Venereol 82 Letters to the Editor 215 1353 H 803 H342bp 310 M + 1 2 3 4 5 6 7 Fig. 1. PCR ampli cation of HSV-speci c 342 bp DNA fragment in patients with mycosis fungoides (MF ). M: molecular DNA weight marker; + : positive control for HSV; lane 1: negative control; lanes 2, 3, 4, 6, 7: negative patient samples; lane 5: positive HSV PCR ampli cation of a patient with MF. 5. Sander CA, Simon M, Puchta U, RaVeld M, Kind P. HHV-8 in lymphoproliferative lesions in skin. Lancet 1996; 348: 475–476. 6. Fossati S, Boneschi V, Ferruci S, Brambilla L. Human 1353 immunodeYciency virus negative Kaposi’s sarcoma and lymphoproliferative disorders. Cancer 1999; 85: 1611–1615. 7. Dupin N, Franck N, Calvez V, Gorin I, Grandadam M, 603 Huraux JM, et al. Lack of evidence of human herpesvirus 8 DNA sequences in HIV-negative patients with various lymphoproliferative disorders of the skin. Br J Dermatol 233bp 1997; 136: 827–830. 8. Diamandidou E, Cohen PR, Kurzrock R. Mycosis fung- oides and Sezary syndrome. Blood 1996; 88: 2385–2409. 9. Erkek E, S¸ahin S, Atakan N, Kocago¨z T, Olut AI, Go¨ko¨z A. Examination of mycosis fungoides for the presence of Epstein-Barr virus and human herpesvirus-6 by poly- M + - 1 2 3 4 merase chain reaction. J Eur Acad Dermatol Venereol Fig. 2. PCR ampli cation of HHV-8 in patients with mycosis fung- 2001; 15: 422–426. oides. M: molecular DNA weight marker; + : positive control for 10. Cesarman E, Chang Y, Moore PS, Said JW, Knowles HHV-8; ± : negative control; lanes 1, 2, 3, 4: negative patient samples. DM. Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 1995; 332: 1186–1891. studies in lesional and non-lesional biopsy specimens 11. Luppi M, Barozzi P, Maiorana A, Artusi T, Travato R, from patients with MF are awaited. Marasca R, et al. Human herpesvirus-8 DNA sequences in human immunodeYciency virus-negative angioimmu- noblastic lymphadenopathy and benign lymphadenopathy REFERENCES with giant germinal center hyperplasia and increased vas- cularity. Blood 1996; 87: 3903–3909. 1. Luppi M, Torelli G. The new lymphotropic herpesviruses 12. Nakamura K, Katano H, Hoshino Y, Nakamura T, (HHV-6, HHV-7, HHV-8) and hepatitis C virus (HCV ) in human lymphoproliferative diseases: an overview. Hosono O, Masunaga A, et al. Human herpesvirus type Haematologica 1996; 81: 265–281. 8 and Epstein-Barr virus-associated cutaneous lymphoma 2. Chang Y, Cesarman E, Pessin MS, Lee F, Culpepper J, taking anaplastic large cell morphology in a man with Knowles DM, et al. Identi cation of herpesvirus-like DNA HIV infection. Br J Dermatol 1999; 141: 141–145. sequences in AIDS-associated Kaposi’s sarcoma. Science 13. Pastore C, Gloghini A, Volpe G, Nomdedeu J, Leonardo 1994; 266: 1865–1869. E, Mazza U, et al. Distribution of Kaposi’s sarcoma 3. Kemeny L, Gyulai R, Kiss M, Nagy F, Dobozy A. herpesvirus sequences among lymphoid malignancies in Kaposi’s sarcoma-associated herpesvirus/human herpes- Italy and Spain. Br J Haematol 1995; 91: 918–920. virus-8: a new virus in human pathology. J Am Acad 14. Henghold WB, Purvis SF, SchaVer J, Giam C-Z, Wood Dermatol 1997; 37: 107–113. GS. No evidence of KSHV/ HHV-8 in mycosis fungoides 4. Lyons SF, Liebowitz DN. The roles of human viruses in or associated disorders. Cancer 1999; 85: 1611–1615. the pathogenesis of lymphoma. Semin Oncol 1998; 25: 15. Beylot-Barry M, Vergier B, Masquelier B, Bagot M, Joly 461–475. P, Souteyrand P, et al. The spectrum of cutaneous Acta Derm Venereol 82 216 Letters to the Editor lymphomas in HIV infection: a study of 21 cases. Am lymphoma for human herpesviruses by using the poly- J Surg Pathol 1999; 23: 1208–1216. merase chain reaction. J Cutan Pathol 1993; 20: 304–307.
Load more

Recommended publications
  • Comorbidities in Mycosis Fungoides and Racial Differences In
    medicines Article Comorbidities in Mycosis Fungoides and Racial Differences in Co-Existent Lymphomatoid Papulosis: A Cross-Sectional Study of 580 Patients in an Urban Tertiary Care Center Subuhi Kaul 1,*, Micah Belzberg 2, John-Douglas Matthew Hughes 3, Varun Mahadevan 2 , Raveena Khanna 2, Pegah R. Bakhshi 2, Michael S. Hong 2, Kyle A. Williams 2, 2 2, 2, Annie L. Grossberg , Shawn G. Kwatra y and Ronald J. Sweren y 1 Department of Medicine, John H. Stroger Hospital of Cook County, Chicago, IL 60612, USA 2 Department of Dermatology, Johns Hopkins University School of Medicine, Baltimore, MD 21287, USA; [email protected] (M.B.); [email protected] (V.M.); [email protected] (R.K.); [email protected] (P.R.B.); [email protected] (M.S.H.); [email protected] (K.A.W.); [email protected] (A.L.G.); [email protected] (S.G.K.); [email protected] (R.J.S.) 3 Section of Dermatology, University of Calgary, Alberta, AB T2N 1N4, Canada; [email protected] * Correspondence: [email protected]; Tel.: +1-312-864-7000 Considered co-senior authors. y Received: 26 October 2019; Accepted: 24 December 2019; Published: 26 December 2019 Abstract: Background: Mycosis fungoides (MF) is a cutaneous T-cell lymphoma. Previous reports have suggested MF is associated with inflammatory conditions such as psoriasis, increased cardiovascular risk factors as well as secondary neoplasms. Methods: A cross-sectional study of MF patients seen from 2013 to 2019 was performed. Comorbidities were selected based on the 2015 Medicare report highlighting the most common chronic medical illnesses in the United States.
    [Show full text]
  • Rush University Medical Center, May 2005
    TABLE OF CONTENTS Case # Title Page 1. Malignant Spitz’s Nevus 1 2. Giant Congenital Nevus 4 3. Methotrexate Nodulosis 7 4. Apthae with Trisomy 8–positive Myelodysplastic Syndrome 10 5. Kwashiorkor 13 6. “Unknown” 16 7. Gangrenous Cellulitis 17 8. Parry-Romberg Syndrome 21 9. Wegener’s Granulomatosis 24 10. Pediatric CTCL 27 11. Hypopigmented Mycosis Fungoides 30 12. Fabry’s Disease 33 13. Cicatricial Alopecia, Unclassified 37 14. Mastocytoma 40 15. Cutaneous Piloleiomyomas 42 16. Granular Cell Tumor 44 17. Disseminated Blastomycoses 46 18. Neonatal Lupus 49 19. Multiple Lipomas 52 20. Acroangiodermatitis of Mali 54 21. Pigmented Basal Cell Carcinoma (BCC) 57 Page 1 Case #1 CHICAGO DERMATOLOGICAL SOCIETY RUSH UNIVERSITY MEDICAL CENTER CHICAGO, ILLINOIS MAY 18, 2005 CASE PRESENTED BY: Michael D. Tharp, M.D. Lady Dy, M.D., and Darrell W. Gonzales, M.D. History: This 2 year-old white female presented with a one year history of an expanding lesion on her left cheek. There was no history of preceding trauma. The review of systems was normal. Initially the lesion was thought to be a pyogenic granuloma and treated with two courses of pulse dye laser. After no response to treatment, a shave biopsy was performed. Because the histopathology was interpreted as an atypical melanocytic proliferation with Spitzoid features, a conservative, but complete excision with margins was performed. The pathology of this excision was interpreted as malignant melanoma measuring 4.0 mm in thickness. A sentinel lymph node biopsy was subsequently performed and demonstrated focal spindle cells within the subcapsular sinus of a left preauricular lymph node.
    [Show full text]
  • Utility of CD123 Immunohistochemistry in Differentiating Lupus Erythematosus from Cutaneous T-Cell Lymphoma
    DR PAUL WILLIAM HARMS (Orcid ID : 0000-0002-0802-2883) DR MAY P. CHAN (Orcid ID : 0000-0002-0650-1266) Article type : Original Article Utility of CD123 immunohistochemistry in differentiating lupus erythematosus from cutaneous T-cell lymphoma (Running title: CD123 in lupus and cutaneous T-cell lymphoma) Stephanie J. T. Chen1,2, Julie Y. Tse3, Paul W. Harms1,4, Alexandra C. Hristov1,4, May P. Chan1,4 1Department of Pathology, University of Michigan, Ann Arbor, MI 2Department of Pathology, University of Iowa, Iowa City, IA 3Department of Pathology, Tufts Medical Center, Boston, MA 4Department of Dermatology, University of Michigan, Ann Arbor, MI Corresponding author: May P. Chan, MD University of Michigan Author Manuscript NCRC Building 35 This is the author manuscript accepted for publication and has undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/HIS.13817 This article is protected by copyright. All rights reserved 2800 Plymouth Road Ann Arbor, MI 48109 Phone: (734)764-4460 Fax: (734)764-4690 Email: [email protected] The authors report no conflict of interest. Abstract: 250 words Manuscript: 2496 words Figures: 3 Tables: 2 Abstract Aims: Histopathologic overlap between lupus erythematosus and certain types of cutaneous T- cell lymphoma (CTCL) is well documented. CD123+ plasmacytoid dendritic cells (PDCs) are typically increased in lupus erythematosus, but have not been well studied in CTCL. We aimed to compare CD123 immunostaining and histopathologic features in these conditions.
    [Show full text]
  • Evaluation of Melanocyte Loss in Mycosis Fungoides Using SOX10 Immunohistochemistry
    Article Evaluation of Melanocyte Loss in Mycosis Fungoides Using SOX10 Immunohistochemistry Cynthia Reyes Barron and Bruce R. Smoller * Department of Pathology and Laboratory Medicine, University of Rochester Medical Center, Rochester, NY 14642, USA; [email protected] * Correspondence: [email protected] Abstract: Mycosis fungoides (MF) is a subtype of primary cutaneous T-cell lymphoma (CTCL) with an indolent course that rarely progresses. Histologically, the lesions display a superficial lymphocytic infiltrate with epidermotropism of neoplastic T-cells. Hypopigmented MF is a rare variant that presents with hypopigmented lesions and is more likely to affect young patients. The etiology of the hypopigmentation is unclear. The aim of this study was to assess melanocyte loss in MF through immunohistochemistry (IHC) with SOX10. Twenty cases were evaluated, including seven of the hypopigmented subtype. The neoplastic epidermotropic infiltrate consisted predominantly of CD4+ T-cells in 65% of cases; CD8+ T-cells were present in moderate to abundant numbers in most cases. SOX10 IHC showed a decrease or focal complete loss of melanocytes in 50% of the cases. The predominant neoplastic cell type (CD4+/CD8+), age, race, gender, histologic features, and reported clinical pigmentation of the lesions were not predictive of melanocyte loss. A significant loss of melanocytes was observed in 43% of hypopigmented cases and 54% of conventional cases. Additional studies will increase our understanding of the relationship between observed pigmentation and the loss of melanocytes in MF. Citation: Barron, C.R.; Smoller, B.R. Evaluation of Melanocyte Loss in Keywords: mycosis fungoides; hypopigmented mycosis fungoides; SOX10; cutaneous T-cell lymphoma Mycosis Fungoides Using SOX10 Immunohistochemistry.
    [Show full text]
  • Granulomatous Mycosis Fungoides, a Rare Subtype of Cutaneous T-Cell Lymphoma
    CASE REPORT Granulomatous mycosis fungoides, a rare subtype of cutaneous T-cell lymphoma Marta Kogut, MD,a Eva Hadaschik, MD,a Stephan Grabbe, MD,b Mindaugas Andrulis, MD,c Alexander Enk, MD,a and Wolfgang Hartschuh, MDa Heidelberg and Mainz, Germany Key words: Granulomatous dermatitis; granulomatous mycosis fungoides; T-cell receptor gamma gene. ranulomatous mycosis fungoides (GMF) is an unusual histologic subtype of cutaneous Abbreviations used: T-cell lymphoma.1 The diagnosis of GMF is GMF: granulomatous mycosis fungoides G INF-a: interferon alfa usually established after observation of a granulo- MF: mycosis fungoides matous inflammatory reaction associated with a TCR: T-cell receptor malignant lymphoid infiltrate. Epidermotropism, a clue to diagnosis in classical mycosis fungoides (MF) 2 may be absent in about 47% of cases of GMF. In ear, Mycobacterium gordonae grew in a culture; some instances, the granulomatous component may however, polymerase chain reaction results were be intense and obscures the lymphomatous compo- negative. The etiologic relevance was considered nent of the infiltrate.1 There are no distinctive clinical 1,3 questionable, and the appropriate systemic antibi- patterns associated with GMF. otic therapy did not show any effects. The histopathologic evaluation of biopsy speci- CASE REPORT mens from the ear and forearm found a lympho- In 1998 a 28 year-old male patient presented with histiocytic, lichenoid inflammatory infiltrate with desquamating erythema on his left auricle (Fig 1, A). epitheloid giant cell granulomas (Fig 3, A and B). On exam he also had erythematous scaly plaques on On the basis of the clinical findings of a chronic his forearms and trunk associated with surrounding ulceration and histologic evidence of granulomas, we alopecia (Fig 2, A).
    [Show full text]
  • Histologic Findings in Cutaneous Lupus Erythematosus 299
    CHAPTER 21 Histologic Findings in Cutaneous Lupus 21 Erythematosus Christian A. Sander, Amir S. Yazdi, Michael J. Flaig, Peter Kind Lupus erythematosus (LE) is a chronic inflammatory disease that can be clinically divided into three major categories: chronic cutaneous LE (CCLE), subacute cuta- neous LE (SCLE), and systemic LE (SLE). In general, LE represents a spectrum of dis- ease with some overlap of these categories. Classification is based on clinical, histo- logic, serologic, and immunofluorescent (see Chap. 22) features. Consequently, histologic findings alone may not be sufficient for correct classification. In addition, these categories can be subdivided into numerous variants affecting different levels of the skin and subcutaneous tissue. Chronic Cutaneous Lupus Erythematosus Discoid Lupus Erythematosus Discoid LE (DLE) is the most common form of LE. Clinically, the head and neck region is affected in most cases. On the face, there may be a butterfly distribution. However, in some cases, the trunk and upper extremities can be also involved. Lesions consist of erythematous scaly patches and plaques. Histologically, in DLE the epidermis and dermis are affected, and the subcuta- neous tissue is usually spared. However, patchy infiltrates may be present. Character- istic microscopic features are hyperkeratosis with follicular plugging, thinning, and flattening of the epithelium and hydropic degeneration of the basal layer (liquefac- tion degeneration) (Fig. 21.1). In addition, there are scattered apoptotic keratinocytes (Civatte bodies) in the basal layer or in the epithelium. Particularly in older lesions, thickening of the basement membrane becomes obvious in the periodic acid-Schiff stain. In the dermis, there is a lichenoid or patchy lymphocytic infiltrate with accen- tuation of the pilosebaceous follicles.
    [Show full text]
  • Cutaneous T-Cell Lymphoma: Mycosis Fungoides/Se´Zary Syndrome: Part 1
    FEATURE ARTICLE Cutaneous T-Cell Lymphoma: Mycosis Fungoides/Se´zary Syndrome: Part 1 Susan Booher, MS, RN, Sue Ann McCann, MSN, RN, DNC, Marianne C. Tawa, RN, MSN, ANP INTRODUCTION (Lutzner et al., 1975). The term CTCL should not be used Cutaneous T-cell lymphoma (CTCL) represents a category interchangeably with MF and SS; rather, it should be used of complex and diverse disease states that involve the skin only to describe the complete spectrum of cutaneous lym- as the primary site of malignant T-lymphocyte proliferation phomas of T-cell origin. and is a type of non-Hodgkin lymphoma. These malignant The World Health Organization and the European CD4+ T cells (lymphocytes) also can invade the lymphatic Organisation for Research and Treatment of Cancer met nodes, blood, and visceral organs. Mycosis fungoides (MF) in 2003 and 2004 to organize and define the cutaneous and its leukemic variant, Se´zary syndrome (SS), are the lymphomas and to separate them from systemic lymphomas most common types of CTCL. These chronic diseases are with similar histology (Willemze et al., 2005). Lymphomas rare and have considerable variation in cutaneous presen- are now classified as either T-cell or B-cell lymphoma with tation, histologic appearance, degree of blood involvement, indolent, intermediate, or aggressive clinical behavior, al- immunophenotypic profile, and prognosis. lowing for more consistent diagnosis and treatment regi- Historically, the French were pioneers in the discovery of mens (see Figure 4-1). CTCL. Approximately 200 years ago, Jean Louise Alibert published an article describing the appearance of tumors on EPIDEMIOLOGY the skin similar to that of a mushroom and coined the term MF and SS are rare diseases despite evidence that their mycosis fungoides (Alibert, 1806).
    [Show full text]
  • Erythema Annulare Centrifugum Associated with Mantle B-Cell Non-Hodgkin’S Lymphoma
    Letters to the Editor 319 Erythema Annulare Centrifugum Associated with Mantle B-cell Non-Hodgkin’s Lymphoma Marta Carlesimo1, Laura Fidanza1, Elena Mari1*, Guglielmo Pranteda1, Claudio Cacchi2, Barbara Veggia3, Maria Cristina Cox1 and Germana Camplone1 1UOC Dermatology, 2UOC Histopathology and 3UOC Haematolohy, II Unit University of Rome Sapienza Via di Grottarossa, 1039, IT-00189 Rome, Italy. *E-mail: [email protected] Accepted September 25, 2008. Sir, superficial type (Fig. 2). Previous investigations were Figurate erythemas are classified as erythema annulare normal, but as the lesions persisted further investi- centrifugum (EAC), erythema gyratum repens, erythema gations were carried out. Hepatic, pancreatic, renal migrans and necrolytic migratory erythema. Differential function and blood pictures were normal. The lymph diagnoses are mycosis fungoides, urticaria, granuloma nodes on the left side of his neck were approximately annulare and pseudolymphoma. 4.5 cm in diameter. EAC consists of recurrent and persistent erythematous A lymph node biopsy revealed a small B-cell non- eruptions or urticarial papules forming annular or serpen- Hodgkin’s lymphoma. The neoplastic cells were tiginous patterns with an advancing macular or raised positive for CD20/79a and cyclin d1. A bone marrow border and scaling on the inner aspect of the border. investigation showed scattered CD20/79a­positive EAC was first described by Darier in 1916, and classi­ lymphocytes. GeneScan analysis and heteroduplex on fied in 1978 by Ackerman into a superficial and a deep polyacrylamide gel analysis showed a monoclonal B type (1, 2). EAC can be associated with a wide variety lymphocyte population. of triggers including infections, food and drug ingestion, endocrinological conditions and as a paraneoplastic sign.
    [Show full text]
  • Mycosis Fungoides and Sézary Syndrome: an Integrative Review of the Pathophysiology, Molecular Drivers, and Targeted Therapy
    cancers Review Mycosis Fungoides and Sézary Syndrome: An Integrative Review of the Pathophysiology, Molecular Drivers, and Targeted Therapy Nuria García-Díaz 1 , Miguel Ángel Piris 2,† , Pablo Luis Ortiz-Romero 3,† and José Pedro Vaqué 1,*,† 1 Molecular Biology Department, Universidad de Cantabria—Instituto de Investigación Marqués de Valdecilla, IDIVAL, 39011 Santander, Spain; [email protected] 2 Department of Pathology, Fundación Jiménez Díaz, CIBERONC, 28040 Madrid, Spain; [email protected] 3 Department of Dermatology, Hospital 12 de Octubre, Institute i+12, CIBERONC, Medical School, University Complutense, 28041 Madrid, Spain; [email protected] * Correspondence: [email protected] † Same contribution. Simple Summary: In the last few years, the field of cutaneous T-cell lymphomas has experienced major advances. In the context of an active translational and clinical research field, next-generation sequencing data have boosted our understanding of the main molecular mechanisms that govern the biology of these entities, thus enabling the development of novel tools for diagnosis and specific therapy. Here, we focus on mycosis fungoides and Sézary syndrome; we review essential aspects of their pathophysiology, provide a rational mechanistic interpretation of the genomic data, and discuss the current and upcoming therapies, including the potential crosstalk between genomic alterations Citation: García-Díaz, N.; Piris, M.Á.; and the microenvironment, offering opportunities for targeted therapies. Ortiz-Romero, P.L.; Vaqué, J.P. Mycosis Fungoides and Sézary Abstract: Primary cutaneous T-cell lymphomas (CTCLs) constitute a heterogeneous group of diseases Syndrome: An Integrative Review of that affect the skin. Mycosis fungoides (MF) and Sézary syndrome (SS) account for the majority the Pathophysiology, Molecular of these lesions and have recently been the focus of extensive translational research.
    [Show full text]
  • A Patient's Guide to Understanding Cutaneous Lymphoma
    WELCOME! If you or someone close to you has been given a diagnosis of cutaneous lymphoma, you probably have many questions and concerns. Living with cutaneous lymphoma and the many changes that this diagnosis brings to your life can leave you feeling overwhelmed, confused and lonely. You may not even be sure about what kinds of questions to ask. This guide was created so you can find valuable information to help you understand the disease, learn about available treatments and how to find specialists, access support, and ways to live the best life you can with cutaneous lymphoma. The Cutaneous Lymphoma Foundation is dedicated to providing patients, caregivers and loved ones with programs and services designed to help, support and provide hope to people who are given a diagnosis of cutaneous lymphoma. We are here for you. You are not alone. You are part of a knowledgeable, caring, resourceful, and compassionate community, and we’re here to help you. Get in touch anytime. We hope to hear from you or meet you in person at one of our patient events. We wish you all the best in your journey. The Staff and Board of Directors of the Cutaneous Lymphoma Foundation A Patient’s Guide to Understanding Cutaneous Lymphoma ACKNOWLEDGMENTS This guide is an educational resource published by the Cutaneous Lymphoma The Cutaneous Lymphoma Foundation acknowledges and thanks the Foundation providing general information on cutaneous lymphoma. Publication individuals listed below who have given generously of their time and expertise. of this information is not intended to take the place of medical care or the advice We thank them for their contributions, editorial wisdom and advice, which have of your physician(s).
    [Show full text]
  • FROM ACNE to RETINOIDS and LYMPHOMAS Composed by Anders Vahlquist, Editor-In-Chief
    ISSN 0001-5555 Volume 92 2012 No. 3 Theme Section A Non-profit International Journal for Skin Research, Clinical Dermatology and Sexually Transmitted Diseases Official Journal of - The International Forum for the Study of Itch - European Society for Dermatology and Psychiatry THEME ISSUE: FROM ACNE TO RETINOIDS AND LYMPHOMAS COMPOSED BY ANDERS VAHLQUIST, Editor-IN-CHIEF Acta Dermato-Venereologica www.medicaljournals.se/adv Acta Derm Venereol 2012; 92: 227–289 THEME ISSUE: FROM ACNE TO RETINOIDS AND LYMPHOMAS Composed by Anders Vahlquist, Editor-in-Chief This theme issue of Acta Dermato-Venereologica bridges two bexarotene exert positive and negative effects far beyond seemingly unrelated diseases, acne and lymphoma, by inclu- those of pure RAR agonists. For the former drug, this is il- ding papers on retinoid therapy for both conditions. Beginning lustrated in a large trial on chronic hand eczema (p. 251) and with acne vulgaris, accumulating evidence suggests that diet in a pilot study of its use for congenital ichthyosis (p. 256). after all plays a role, which is ventilated in a commentary (p. For bexarotene, a new Finnish study shows 10 years expe- 228) of a prospective study using low- and high-calorie diets rience of this therapy in severe cutaneous lymphoma (p. 258). in adolescents with acne (p. 241). Acne treatment regimes Depending on the stage of the disease, lymphomas can also usually differ from one country to another; a Korean survey be treated for instance with photodynamic therapy (p. 264) (p. 236) combined with a review on how to treat post-acne and methotrexate (p. 276).
    [Show full text]
  • R&D Pipeline
    R&D Pipeline antibody protein small molecule ◎ New Molecular Entity Updated since Dec. 31, 2020 Updated since Dec. 31, 2020 Nephrology As of Mar. 31, 2021 Code Name Stage [In-House or Licensed] Generic Name Mechanism of Action Indication Area Remarks Formulation PhⅠ PhⅡ PhⅢ Filed Approved KHK7580 CN [Mitsubishi Tanabe Pharma] Evocalcet Calcimimetic Secondary Hyperparathyroidism Asia product name in Japan: Orkedia Oral Diabetic Kidney Disease JP ◎RTA 402 Antioxidant Inflammation Bardoxolone Methyl [Reata] Modulator Oral Autosomal Dominant Polycystic JP Kidney Disease KW-3357 Recombinant Human [In-House] Antithrombin Gamma Preeclampsia JP Antithrombin product name in Japan:Acoalan Injection KHK7791 Hyperphosphatemia Under Tenapanor NHE3 Inhibitor JP [Ardelyx] Maintenance Dialysis Oral Oncology Code Name Stage [In-House or Licensed] Generic Name Mechanism of Action Indication Area Remarks Formulation PhⅠ PhⅡ PhⅢ Filed Approved AU CH [In-House] KW-0761 Anti-CCR4 Humanized Mycosis Fungoides and SA POTELLIGENT® Mogamulizumab Antibody Sézary Syndrome KR product name in Japan, U.S. and Injection Europe: Poteligeo CA KW ◎KHK2375 Entinostat HDAC Inhibitor Breast Cancer JP [Syndax] Oral Mobilization of Hematopoietic Stem Cells into Peripheral Blood JP for Allogeneic Blood Stem Cell KRN125 Long-Acting Transplantation [Kirin-Amgen] Pegfilgrastim Granulocyte Colony- product name in Japan:G-Lasta Injection Stimulating Factor Automated Injection Device for Decreasing the Incidence of JP Febrile Neutropenia in Patients Receiving Cancer Chemotherapy [In-House]
    [Show full text]