DOCSLIB.ORG

Macrophages in Alveolar Aspergillus Fumigatus to Phosphate Oxidase

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Macrophages in Alveolar Aspergillus Fumigatus to Phosphate Oxidase Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase-Independent Resistance to Aspergillus fumigatus in Alveolar Macrophages This information is current as of September 27, 2021. E. Jean Cornish, Brady J. Hurtgen, Kate McInnerney, Nancy L. Burritt, Ross M. Taylor, James N. Jarvis, Shirley Y. Wang and James B. Burritt J Immunol 2008; 180:6854-6867; ; doi: 10.4049/jimmunol.180.10.6854 Downloaded from http://www.jimmunol.org/content/180/10/6854 References This article cites 80 articles, 29 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/180/10/6854.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 27, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase-Independent Resistance to Aspergillus fumigatus in Alveolar Macrophages1 E. Jean Cornish,* Brady J. Hurtgen,* Kate McInnerney,* Nancy L. Burritt,* Ross M. Taylor,* James N. Jarvis,† Shirley Y. Wang,† and James B. Burritt2* The fungal pathogen Aspergillus fumigatus is responsible for increasing numbers of fatal infections in immune-compromised humans. Alveolar macrophages (AM) are important in the innate defense against aspergillosis, but little is known about their molecular responses to fungal conidia in vivo. We examined transcriptional changes and superoxide release by AM from C57BL/6 and gp91phox؊/؊ mice in response to conidia. Following introduction of conidia into the lung, microarray analysis of AM showed the transcripts most strongly up-regulated in vivo to encode chemokines and additional genes that play a critical role Downloaded from in neutrophil and monocyte recruitment, indicating that activation of phagocytes represents a critical early response of AM to fungal conidia. Of the 73 AM genes showing >2-fold changes, 8 were also increased in gp91phox؊/؊ mice by conidia and in C57BL/6 mice by polystyrene beads, suggesting a common innate response to particulate matter. Ingenuity analysis of the microarray data from C57BL/6 mice revealed immune cell signaling and gene expression as primary mechanisms of this response. Despite the well-established importance of phagocyte NADPH oxidase in resisting aspergillosis, we found no evidence of this mechanism in AM following introduction of conidia into the mouse lung using transcriptional, luminometry, http://www.jimmunol.org/ or NBT staining analysis. In support of these findings, we observed that AM from C57BL/6 and gp91phox؊/؊ mice inhibit conidial germination equally in vitro. Our results indicate that early transcription in mouse AM exposed to conidia in vivo targets neutrophil recruitment, and that NADPH oxidase-independent mechanisms in AM contribute to inhibition of conidial germination. The Journal of Immunology, 2008, 180: 6854–6867. spergillus fumigatus is the leading airborne fungal patho- AM are resident pulmonary phagocytes that respond early to gen in immune-compromised individuals, where it can inhaled A. fumigatus conidia. Numerous studies have examined the cause potentially fatal invasive pulmonary aspergillosis response of AM to A. fumigatus conidia, both in vivo and in vitro. A3 by guest on September 27, 2021 (IPA) (1–4). However, IPA is rare in individuals with a normal Despite the key role of AM in aspergillosis immunity, there is little inflammatory response, due primarily to innate immunity in which in vivo data that indicate how A. fumigatus conidia affect gene phagocytic leukocytes including alveolar macrophages (AM), expression in AM, limiting our understanding about the molecular polymorphonuclear neutrophils (PMN), and dendritic cells play an mechanisms by which AM respond to this fungus. In contrast to essential early role in the defense against aspergillosis (5). There- previous studies on in vitro transcriptional and functional changes fore, infections caused by A. fumigatus, which originate in the of peritoneal macrophages and AM following exposure to conidia airway of immune-compromised humans, arise because of a defect (6–9), the present study was designed to include transcriptional in one or more of the innate mechanisms of resistance that nor- responses of AM to conidia in mouse lungs, thus providing better mally protect from IPA. insight into the overall mechanism by which AM help resist in- fections by A. fumigatus in vivo. The generation of reactive oxygen species represents a well- *Department of Microbiology, Montana State University, Bozeman, MT 59717; and characterized antimicrobial mechanism used by phagocytic leu- † Oklahoma University Health Sciences Center, Oklahoma City, OK 73104 kocytes, and extensive clinical evidence implicates the super- Received for publication December 21, 2007. Accepted for publication March oxide-producing phagocyte NADPH oxidase in the resistance to 13, 2008. aspergillosis (10). Human patients with defects in this system The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance suffer from chronic granulomatous disease characterized by re- with 18 U.S.C. Section 1734 solely to indicate this fact. current infections, extensive granuloma formation, and fre- 1 This work was supported by National Institutes of Health (NIH) Award 1 R03 quently, IPA (11). Although it is generally accepted that AI057931-01 (to J.B.B.), American Heart Association Scientist Development Grant NADPH oxidase is necessary for killing A. fumigatus conidia 0630253N (to R.M.T.), and was also made possible by NIH Grant 1 P20 RR- 020185-01 from the National Center for Research Resources. by PMN (12, 13), there is conflicting information on the role of 2 Address correspondence and reprint requests to Dr. James B. Burritt, Department of this mechanism in AM-mediated resistance to IPA (12, 14–17). Microbiology, Montana State University, 109 Lewis Hall, Bozeman, MT 59717. E- Therefore, in addition to transcriptional studies on AM exposed mail address: [email protected] to A. fumigatus conidia, we have examined functional aspects of 3 Abbreviations used in this paper: IPA, invasive pulmonary aspergillosis; AM, al- AM for evidence of NADPH oxidase involvement following veolar macrophage; PMN, polymorphonuclear neutrophil; qRT-PCR, quantitative RT-PCR; BALF, bronchoalveolar lavage fluid; MCLA, 2-methyl-6-(4-methoxyphe- contact with conidia. nyl)imidazo[1,2-a] pyrazin-3(7H)-one; SOD, superoxide dismutase; HO, heme DNA microarray analysis is a powerful method for monitoring oxygenase. the effect of microbes on the global transcription of cellular gene Copyright © 2008 by The American Association of Immunologists, Inc. 0022-1767/08/$2.00 products. Relevant to the present study, microarray analysis has www.jimmunol.org The Journal of Immunology 6855 previously been used to characterize changes in gene expression Materials and Methods associated with oxidative defense in phagocytes responding to Preparation of A. fumigatus conidia stimuli in vitro. For example, increased transcription of some A clinical isolate (no. 13073; American Type Culture Collection) of A. genes encoding oxidant scavengers was observed in human mono- fumigatus was grown on Sabouraud dextrose agar slants in 75-cm2 culture cytes in response to A. fumigatus conidia (6), as was increased flasks at 37°C for 5 days and conidia were collected in 0.1% Tween 20 in transcription of the gene encoding the gp91phox subunit of the HBSS (no. 10-547F; Cambrex Bio Science) by gentle rocking as described 6 NADPH oxidase in mouse macrophages when exposed to LPS (13). Conidia were then diluted in HBSS without Tween 20 to obtain either 10 or 107 conidia in 40 ␮l for intrapharyngeal administration. All in vivo inocu- (18). Additionally, the analysis of in vitro changes in transcription lations were performed using conidia harvested immediately before use. of human monocytes has provided valuable clues about innate re- sponses to A. fumigatus (6, 8). In those studies, the exposure of Animal handling and sample collection monocytes to conidia was found to induce genes involved in a All protocols involving mice were approved by the Institutional Review diverse array of cellular functions including leukocyte adhesion, Board of the Institutional Animal Care and Use Committee at Montana cell recruitment, endocytosis, phagocytosis, and oxidant stress re- State University. C57BL/6 male mice were obtained at 9–11 wk of age from Charles River Laboratories, kept in the Animal Resource Center at sponses. However, transcriptional differences between AM and Montana State University in microisolator cages, and given food and water monocytes (19, 20), and the influences on AM by other resident ad libitum. Breeder mice with a null allele corresponding
Load more

Recommended publications
  • FKBP2 Antibody Cat
    FKBP2 Antibody Cat. No.: 23-414 FKBP2 Antibody Western blot analysis of extracts of various cell lines, using FKBP2 antibody (23-414) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST. Detection: ECL Basic Kit. Exposure time: 90s. Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human, Mouse, Rat Recombinant fusion protein containing a sequence corresponding to amino acids 22-142 IMMUNOGEN: of human FKBP2 (NP_004461.2). TESTED APPLICATIONS: IF, IHC, WB October 2, 2021 1 https://www.prosci-inc.com/fkbp2-antibody-23-414.html WB: ,1:500 - 1:2000 APPLICATIONS: IHC: ,1:100 - 1:200 IF: ,1:50 - 1:200 POSITIVE CONTROL: 1) MCF7 2) SKOV3 3) Jurkat 4) HeLa 5) Mouse thymus 6) Mouse liver PREDICTED MOLECULAR Observed: 14kDa WEIGHT: Properties PURIFICATION: Affinity purification CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. STORAGE CONDITIONS: Store at -20˚C. Avoid freeze / thaw cycles. Additional Info OFFICIAL SYMBOL: FKBP2 FKBP-13, FKBP13, PPIase, peptidyl-prolyl cis-trans isomerase FKBP2, 13 kDa FK506-binding protein, 13 kDa FKBP, FK506 binding protein 2, 13kDa, FK506-binding protein 2, PPIase ALTERNATE NAMES: FKBP2, epididymis secretory sperm binding protein, immunophilin FKBP13, proline isomerase, rapamycin-binding protein, rotamase GENE ID: 2286 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References October 2, 2021 2 https://www.prosci-inc.com/fkbp2-antibody-23-414.html The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking.
    [Show full text]
  • Compression of Large Sets of Sequence Data Reveals Fine Diversification of Functional Profiles in Multigene Families of Proteins
    Technical note Compression of Large Sets of Sequence Data Reveals Fine Diversification of Functional Profiles in Multigene Families of Proteins: A Study for Peptidyl-Prolyl cis/trans Isomerases (PPIase) Andrzej Galat Retired from: Service d’Ingénierie Moléculaire des Protéines (SIMOPRO), CEA-Université Paris-Saclay, France; [email protected]; Tel.: +33-0164465072 Received: 21 December 2018; Accepted: 21 January 2019; Published: 11 February 2019 Abstract: In this technical note, we describe analyses of more than 15,000 sequences of FK506- binding proteins (FKBP) and cyclophilins, also known as peptidyl-prolyl cis/trans isomerases (PPIases). We have developed a novel way of displaying relative changes of amino acid (AA)- residues at a given sequence position by using heat-maps. This type of representation allows simultaneous estimation of conservation level in a given sequence position in the entire group of functionally-related paralogues (multigene family of proteins). We have also proposed that at least two FKBPs, namely FKBP36, encoded by the Fkbp6 gene and FKBP51, encoded by the Fkbp5 gene, can form dimers bound via a disulfide bridge in the nucleus. This type of dimer may have some crucial function in the regulation of some nuclear complexes at different stages of the cell cycle. Keywords: FKBP; cyclophilin; PPIase; heat-map; immunophilin 1 Introduction About 30 years ago, an exciting adventure began in finding some correlations between pharmacological activities of macrocyclic hydrophobic drugs, namely the cyclic peptide cyclosporine A (CsA), and two macrolides, namely FK506 and rapamycin, which have profound and clinically useful immunosuppressive effects, especially in organ transplantations and in combating some immune disorders.
    [Show full text]
  • Human FKBP2 Natural ORF Mammalian Expression Plasmid
    Human FKBP2 natural ORF mammalian expression plasmid Catalog Number: HG12433-UT General Information Plasmid Resuspension protocol Gene : FK506 binding protein 2, 13kDa 1.Centrifuge at 5,000×g for 5 min. Official Symbol : FKBP2 2.Carefully open the tube and add 100 l of sterile water to Synonym : PPIase, FKBP-13 dissolve the DNA. Source : Human 3.Close the tube and incubate for 10 minutes at room temperature. cDNA Size: 429bp 4.Briefly vortex the tube and then do a quick spin to concentrate RefSeq : BC003384 the liquid at the bottom. Speed is less than 5000×g. Plasmid pCMV3-FKBP2 5.Store the plasmid at -20 ℃. Description Lot : Please refer to the label on the tube The plasmid is ready for: Sequence Description : • Restriction enzyme digestion Identical with the Gene Bank Ref. ID sequence. • PCR amplification Restriction site: HindIII + XbaI (6.1kb + 0.43kb) • E. coli transformation Vector : pCMV3-untagged • DNA sequencing Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. E.coli strains for transformation (recommended but not limited) Storage : Most commercially available competent cells are appropriate for The lyophilized plasmid can be stored at ambient temperature for three months. the plasmid, e.g. TOP10, DH5α and TOP10F´. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list : pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Tumor Growth and Cancer Treatment
    Molecular Cochaperones: Tumor Growth and Cancer Treatment The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Calderwood, Stuart K. 2013. “Molecular Cochaperones: Tumor Growth and Cancer Treatment.” Scientifica 2013 (1): 217513. doi:10.1155/2013/217513. http://dx.doi.org/10.1155/2013/217513. Published Version doi:10.1155/2013/217513 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:11879066 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Hindawi Publishing Corporation Scientifica Volume 2013, Article ID 217513, 13 pages http://dx.doi.org/10.1155/2013/217513 Review Article Molecular Cochaperones: Tumor Growth and Cancer Treatment Stuart K. Calderwood Division of Molecular and Cellular Biology, Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Harvard Medical School, 99 Brookline Avenue, Boston, MA 02215, USA Correspondence should be addressed to Stuart K. Calderwood; [email protected] Received 11 February 2013; Accepted 1 April 2013 Academic Editors: M. H. Manjili and Y. Oji Copyright © 2013 Stuart K. Calderwood. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Molecular chaperones play important roles in all cellular organisms by maintaining the proteome in an optimally folded state. They appear to be at a premium in cancer cells whose evolution along the malignant pathways requires the fostering of cohorts of mutant proteins that are employed to overcome tumor suppressive regulation.
    [Show full text]
  • DNA Methylation of FKBP5 in South African Women: Associations with Obesity and Insulin Resistance Tarryn Willmer1,2* , Julia H
    Willmer et al. Clinical Epigenetics (2020) 12:141 https://doi.org/10.1186/s13148-020-00932-3 RESEARCH Open Access DNA methylation of FKBP5 in South African women: associations with obesity and insulin resistance Tarryn Willmer1,2* , Julia H. Goedecke3,4, Stephanie Dias1, Johan Louw1,5 and Carmen Pheiffer1,2 Abstract Background: Disruption of the hypothalamic–pituitary–adrenal (HPA) axis, a neuroendocrine system associated with the stress response, has been hypothesized to contribute to obesity development. This may be mediated through epigenetic modulation of HPA axis-regulatory genes in response to metabolic stressors. The aim of this study was to investigate adipose tissue depot-specific DNA methylation differences in the glucocorticoid receptor (GR) and its co-chaperone, FK506-binding protein 51 kDa (FKBP5), both key modulators of the HPA axis. Methods: Abdominal subcutaneous adipose tissue (ASAT) and gluteal subcutaneous adipose tissue (GSAT) biopsies were obtained from a sample of 27 obese and 27 normal weight urban-dwelling South African women. DNA methylation and gene expression were measured by pyrosequencing and quantitative real-time PCR, respectively. Spearman’s correlation coefficients, orthogonal partial least-squares discriminant analysis and multivariable linear regression were performed to evaluate the associations between DNA methylation, messenger RNA (mRNA) expression and key indices of obesity and metabolic dysfunction. Results: Two CpG dinucleotides within intron 7 of FKBP5 were hypermethylated in both ASAT and GSAT in obese compared to normal weight women, while no differences in GR methylation were observed. Higher percentage methylation of the two FKBP5 CpG sites correlated with adiposity (body mass index and waist circumference), insulin resistance (homeostasis model for insulin resistance, fasting insulin and plasma adipokines) and systemic inflammation (c-reactive protein) in both adipose depots.
    [Show full text]
  • Impact of Fkbp5 × Early Life Adversity × Sex in Humanized Mice on Multidimen- Sional Stress Responses and Circadian Rhythmicity
    bioRxiv preprint doi: https://doi.org/10.1101/2021.07.06.450863; this version posted July 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Title Page Title Impact of Fkbp5 × Early Life Adversity × Sex in Humanized Mice on Multidimen- sional Stress Responses and Circadian Rhythmicity Corresponding Author M.Sc. Verena Nold Boehringer Ingelheim Pharma GmbH & Co KG, CNSDR (and Ulm University, Clinical & Biological Psychology) Birkendorferstraße 65 88397 Biberach an der Riß Germany [email protected] https://orcid.org/0000-0003-0302-0966 Phone +49 (7351) 54-187968 Co-Authors Michelle Portenhauser, Boehringer Ingelheim Pharma GmbH & Co KG Dr. Dolores Del Prete, BioMedX Institute, Heidelberg Andrea Blasius, Boehringer Ingelheim Pharma GmbH & Co KG Isabella Harris, University of Manchester, England Dr. Eliza Koros, Boehringer Ingelheim Pharma GmbH & Co KG Dr. Tatiana Peleh, Boehringer Ingelheim Pharma GmbH & Co KG Prof. Dr. Bastian Hengerer, Boehringer Ingelheim Pharma GmbH & Co KG Prof. Dr. Iris-Tatjana Kolassa, Ulm University, Clinical & Biological Psychology Dr. Michal Slezak,Lukasiewicz Research Network - Polish Center for Technology Development Dr. Kelly Ann Allers, Boehringer Ingelheim Pharma GmbH & Co KG Running Title Early Life Adversity × Fkbp5 Polymorphisms Modulate Adult Stress Physiology Keywords Fkbp5, early life adversity, stress resilience, psychiatric disorder, animal model, cir- cadian rhythmicity 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.07.06.450863; this version posted July 8, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Interaction of Polymorphisms in the Fkbp5 Gene & Childhood Adversity on the Cortisol Response to a Psychosocial Stress Task in Adolescents and Young Adults
    INTERACTION OF POLYMORPHISMS IN THE FKBP5 GENE & CHILDHOOD ADVERSITY ON THE CORTISOL RESPONSE TO A PSYCHOSOCIAL STRESS TASK IN ADOLESCENTS AND YOUNG ADULTS by Raegan Mazurka A thesis submitted to the Department of Psychology In conformity with the requirements for the degree of Master of Science Queen’s University Kingston, Ontario, Canada (September, 2013) Copyright © Raegan Mazurka, 2013 Abstract Childhood adversity is often associated with devastating physical, cognitive, and psychosocial outcomes, and is a major public health problem in terms of its prevalence and economic cost. Childhood adversity is associated with increased risk for psychopathology, as well as with dysregulation of the neurobiological stress response. An additional factor known to alter neuroendocrine functioning and increase psychopathology risk is polymorphisms within the FKBP5 gene. The goal of the current study was to examine the gene-environment interaction of childhood adversity and variation in the FKBP5 gene on the cortisol response to a psychosocial stress task (i.e., the Trier Social Stress Test). The final sample consisted of 90 depressed and non- depressed adolescents and young adults (11 - 21 years). Childhood adversity was assessed using the Childhood Experience and Abuse Scale (CECA; Bifulco et al., 1994), and was defined as the presence versus absence prior to 18 years of age of severe physical, sexual, or emotional abuse or neglect, witness to domestic discord/violence, or peer-perpetrated bullying. Participants were genotyped at the rs1360780 site of the FKBP5 gene and grouped according to whether they had at least one risk T allele (i.e., TT or TC genotype versus the CC genotype).
    [Show full text]
  • Roadmap for Resilience: the California Surgeon General's
    DECEMBER 09, 2020 Roadmap for Resilience The California Surgeon General’s Report on Adverse Childhood Experiences, Toxic Stress, and Health Roadmap for Resilience: The California Surgeon General’s Report on Adverse Childhood Experiences, Toxic Stress, and Health Suggested citation for the report: Bhushan D, Kotz K, McCall J, Wirtz S, Gilgoff R, Dube SR, Powers C, Olson-Morgan J, Galeste M, Patterson K, Harris L, Mills A, Bethell C, Burke Harris N, Office of the California Surgeon General. Roadmap for Resilience: The California Surgeon General’s Report on Adverse Childhood Experiences, Toxic Stress, and Health. Office of the California Surgeon General, 2020. DOI: 10.48019/PEAM8812. OFFICE OF THE GOVERNOR December 2, 2020 In one of my first acts as Governor, I established the role of California Surgeon General. Among all the myriad challenges facing our administration on the first day, addressing persistent challenges to the health and welfare of the people of our state—especially that of the youngest Californians—was an essential priority. We led with the overwhelming scientific consensus that upstream factors, including toxic stress and the social determinants of health, are the root causes of many of the most harmful and persistent health challenges, from heart disease to homelessness. An issue so critical to the health of 40 million Californians deserved nothing less than a world-renowned expert and advocate. Appointed in 2019 to be the first- ever California Surgeon General, Dr. Nadine Burke Harris brought groundbreaking research and expertise in childhood trauma and adversity to the State’s efforts. In this new role, Dr. Burke Harris set three key priorities – early childhood, health equity and Adverse Childhood Experiences (ACEs) and toxic stress – and is working across my administration to give voice to the science and evidence-based practices that are foundational to the success of our work as a state.
    [Show full text]
  • FKBP2 Is Differentially Expressed in the Lymph Nodes of Patients With
    FKBP2 is differentially expressed in lymph node metastasis in human breast cancer. Shahan Mamoor, MS1 [email protected] East Islip, NY USA Metastasis to the brain is a clinical problem in patients with breast cancer1-3. Between the breast and the brain reside the secondary lymphoid organ, the lymph nodes. We mined published microarray data4,5 to compare primary and metastatic tumor transcriptomes for the discovery of genes associated with metastasis to the lymph nodes in humans with metastatic breast cancer. We found that FK506 binding protein 2, FKBP2, was among the genes whose expression was most different in the lymph node metastases of patients with metastatic breast cancer as compared to primary tumors of the breast. Analysis of a separate microarray dataset revealed that FKBP2 was also differentially expressed in brain metastatic tissues. FKBP2 mRNA was present at decreased quantities in lymph node metastases as compared to primary tumors of the breast. Importantly, expression of FKBP2 in primary tumors of the breast was correlated with patient overall survival, in lymph node negative patients but not in lymph node positive patients. Modulation of FKBP2 expression may be relevant to the biology by which tumor cells metastasize from the breast to the lymph nodes and the brain in humans with metastatic breast cancer. Keywords: breast cancer, metastasis, brain metastasis, central nervous system metastasis, lymph node metastasis, FK506 binding protein 2, FKBP2, systems biology of breast cancer, targeted therapeutics in breast cancer. 1 One report described a 34% incidence of central nervous system metastases in patients treated with trastuzumab for breast cancer2.
    [Show full text]
  • PERK-Mediated Expression of Peptidylglycine Α-Amidating
    Soni et al. Oncogenesis (2020) 9:18 https://doi.org/10.1038/s41389-020-0201-8 Oncogenesis ARTICLE Open Access PERK-mediated expression of peptidylglycine α-amidating monooxygenase supports angiogenesis in glioblastoma Himanshu Soni1,2, Julia Bode2,ChiD.L.Nguyen3, Laura Puccio1, Michelle Neßling4, Rosario M. Piro5,6,7, Jonas Bub1, Emma Phillips1, Robert Ahrends3,8, Betty A. Eipper9,BjörnTews2 and Violaine Goidts1 Abstract PKR-like kinase (PERK) plays a significant role in inducing angiogenesis in various cancer types including glioblastoma. By proteomics analysis of the conditioned medium from a glioblastoma cell line treated with a PERK inhibitor, we showed that peptidylglycine α-amidating monooxygenase (PAM) expression is regulated by PERK under hypoxic conditions. Moreover, PERK activation via CCT020312 (a PERK selective activator) increased the cleavage and thus the generation of PAM cleaved cytosolic domain (PAM sfCD) that acts as a signaling molecule from the cytoplasm to the nuclei. PERK was also found to interact with PAM, suggesting a possible involvement in the generation of PAM sfCD. Knockdown of PERK or PAM reduced the formation of tubes by HUVECs in vitro. Furthermore, in vivo data highlighted the importance of PAM in the growth of glioblastoma with reduction of PAM expression in engrafted tumor significantly increasing the survival in mice. In summary, our data revealed PAM as a potential target for antiangiogenic therapy in glioblastoma. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction activated by auto-phosphorylation at threonine 980 on its Glioblastoma is a highly aggressive primary brain tumor cytosolic domain. This type-I membrane protein kinase with less than 15 months of median patient survival1.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 7,083,918 B2 Althoff Et Al
    US007083918B2 (12) United States Patent (10) Patent No.: US 7,083,918 B2 Althoff et al. (45) Date of Patent: Aug. 1, 2006 (54) BACTERIAL SMALL-MOLECULE Abstracts, American Chemical Society, 219" ACS National THREE-HYBRD SYSTEM Meeting, San Francisco, CA, p. CHED 401 (Mar. 26-30. 2000). (75) Inventors: Eric A. Althoff, New York, NY (US); Griffith, E.C. et al. “Yeast Three-Hybrid System for Detect Virginia W. Cornish, New York, NY ing Ligand-Receptor Interactions.” Methods in Enzymology, (US) vol. 328, pp. 89-103 (2000). Dove et al., (1997) 'Activation of Prokaryotic Transcription (73) Assignee: The Trustees of Columbia University Through Arbitrary Protein-Protein Contacts' Nature in the City of New York, New York, 386:627-630 ; and. NY (US) Filman et al., (1982) “Crystal Structures of Escherichia coli and Lactobacillus casei Dihydrofolate Reductase Refined at (*) Notice: Subject to any disclaimer, the term of this 1.7. A Resolution”, The Journal of biological Chemistry patent is extended or adjusted under 35 257(22): 13663-13672. U.S.C. 154(b) by 330 days. Amara, J.F. et al. A Versatile Synthetic Dimerizer for the Regulation of Protein-Protein Interactions, Proc. Natl. Acad. (21) Appl. No.: 10/132,039 Sci. USA, 1997, 94, 10618-10623 (Exhibit 1). Austin DJ, et al. Proximity versus allostery: the role of (22) Filed: Apr. 24, 2002 regulated protein dimerization in biology. 1994. Chem Biol. 1(3): 131-6 (Exhibit 13). (65) Prior Publication Data Belshaw PJ, et al. Controlling protein association and US 2003/02O3471 A1 Oct. 30, 2003 Subcellular localization with a synthetic ligand that induces heterodimerization of proteins.
    [Show full text]