Dynamic Programming

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Dynamic Programming Comp 122, Fall 2004 Review: the previous lecture • Principles of dynamic programming: optimization problems, optimal substructure property, overlapping subproblems, trade space for time, implementation via bottom-up/memoization. • Example of Match Game. • Example of Fibinacci: from Divide and Conquer (exponential time complexity) to Dynamic Programming (O(n) time and space) , then to more efficient dynamic programming (constant space, O(logn) time) • Example of LCS in O(m n) time and space. Today we will show how to reduce the space complexity of LCS to O(n) and in future lectures we will show how to reduce the time complexity of LCS. Comp 122, Spring 2004 Longest Common Subsequence • Problem: Given 2 sequences, X = x1,...,xm and Y = y1,...,yn, find a common subsequence whose length is maximum. X: springtime Y: printing LCS(X,Y): printi Comp 122, Spring 2004 0 if empty or empty, c[, ] c[ prefix, prefix ]1 if end() end( ), max(c[ prefix, ],c[, prefix ]) if end() end( ). p r i n t i n g •Keep track of c[,] in a table of nm 0 0 0 0 0 0 0 0 0 entries: s 0 0 0 0 0 0 0 0 0 •top/down: increasing row order p 0 1 1 1 1 1 1 1 1 r 0 1 2 2 •within each row left-to-right: increasing column order i n g t i m Comp 122,e Spring 2004 0 if empty or empty, c[, ] c[ prefix, prefix ]1 if end() end( ), max(c[ prefix, ],c[, prefix ]) if end() end( ). Time Complexity: O(nm). p r i n t i n g Space Complexity: O(nm). 0 0 0 0 0 0 0 0 0 Can the space complexity be s 0 0 0 0 0 0 0 0 0 improved if we just compute the p 0 1 1 1 1 1 1 1 1 length of the LCS and do not need to recover an actual LCS? r 0 1 2 2 In this case we only need to compute i the alignment score. n Can the space complexity be g improved and still allow the t recovery of an actual LCS? i Yes, but for this we will have to m address LCS as a longest path problem. Comp 122,e Spring 2004 Other sequence questions • Edit distance: Given 2 sequences, X = x1,...,xm and Y = y1,...,yn, what is the minimum number of deletions, insertions, and changes that you must do to change one to another? • Protein sequence alignment: Given a score matrix on amino acid pairs, s(a,b) for a,b{}A, m and 2 amino acid sequences, X = x1,...,xmA n and Y = y1,...,ynA , find the alignment with lowest score… Comp 122, Spring 2004 Outline • DNA Sequence Comparison: Biological background • Sequence Alignment • First Biological Success Stories • More Grid Graphs: Manhattan Tourist Problem • Longest Paths in Grid Graphs • Back to Longest Common Subsequence Problem • Review: divide and conquer paradigm • Reducing the space requirement of LCS Dynamic Programming: String Editing The Central Dogma of Molecular Biology DNA RNA PROTEIN Gene Function > DNA sequence > Protein sequence AATTCATGAAAATCGTATACTGGTCTGGTACCGG MKIVYWSGTGNTEKMAELIAKGIIES CAACACTGAGAAAATGGCAGAGCTCATCGCTAAA GKDVNTINVSDVNIDELLNEDILILGC GGTATCATCGAATCTGGTAAAGACGTCAACACCA SAMGDEVLEESEFEPFIEEISTKISG TCAACGTGTCTGACGTTAACATCGATGAACTGCT KKVALFGSYGWGDGKWMRDFEER GAACGAAGATATCCTGATCCTGGGTTGCTCTGCC MNGYGCVVVETPLIVQNEPDEAEQD ATGGGCGATGAAGTTCTCGAGGAAAGCGAATTTG CIEFGKKIANI The Central Dogma of Molecular Biology Genome: The digital backbone of molecular biology Transcripts from Gene(DNA subsequence) to Proten sequence: Perform functions encoded in the genome The Sequence Alignment Problem The Scoring Matrix - a c g t A = c t a c g a g a c - -1 -1 -1 -1 a -1 1 -1 -1 -1 c -1 -1 1 -1 -1 B = a a c g a c g a t g -1 -1 -1 1 -1 t -1 -1 -1 -1 1 Compare two strings A and B and measure their similarity by finding the optimal alignment between them. The alignment is classically based on the transformation of one sequence into the other, via operations of substitutions, insertions, and deletions (indels). 13 Two Sequence Alignment Problems Global Alignment. A = c t a c g a g a c B = a a c g a c g a t Local Alignment. A = c t a c g a g a c B = a a c g a c g a t 14 Two Sequence Alignment Problems Global Alignment. The Scoring Matrix A = c t a c g a g a c - a c g t - -1 -1 -1 -1 a -1 1 -1 -1 -1 B = a a c g a c g a t c -1 -1 1 -1 -1 g -1 -1 -1 1 -1 t -1 -1 -1 -1 1 Local Alignment. A = c t a c g a g a c B = a a c g a c g a t 15 Two Sequence Alignment Problems Global Alignment. The Scoring Matrix A = c t a c g a g a c - a c g t - -1 -1 -1 -1 a -1 1 -1 -1 -1 B = a a c g a c g a t c -1 -1 1 -1 -1 g -1 -1 -1 1 -1 Value: 2 t -1 -1 -1 -1 1 Local Alignment. A = c t a c g a g a c B = a a c g a c g a t 16 Two Sequence Alignment Problems Global Alignment. The Scoring Matrix A = c t a c g a g a c - a c g t - -1 -1 -1 -1 a -1 1 -1 -1 -1 B = a a c g a c g a t c -1 -1 1 -1 -1 g -1 -1 -1 1 -1 Value: 2 t --1 -1 -1 -1 1 Local Alignment. A = c t a c g a g a c B = a a c g a c g a t Value: 5 17 The O(n 2 ) time, Classical Dynamic Programming Algorithm The Alignment Graph |B|= n The Scoring Matrix a a c g a c g a t - a c g t 0 1 2 3 4 5 6 7 8 9 - -1 -1 -1 -1 c a -1 1 -1 -1 -1 1 c -1 -1 1 -1 -1 t g -1 -1 -1 1 -1 2 a t -1 -1 -1 -1 1 3 |A|= n c 4 g 5 a 6 g 7 a c8 9 0 1 2 3 4 5 6 7 8 9 18 Computing the Optimal Global Alignment Value |B|= n a c a a 0 1 a 2 3 g 4 5 c 6 g 7 8 t 9 Score of = 1 c Score of = -1 1 t 2 a 3 |A|= n c 4 g 5 a 6 g 7 a c8 9 0 1 2 3 4 5 6 7 8 9 Classical Dynamic Programming: O(n 2 ) 19 Computing an Optimal Local Alignment Value |B|= n a a c a a t 0 2 g4 5 c 6 g 8 1 3 7 9 Score of = 1 c Score of = -1 1 t 2 a 3 |A|= n c 4 g 5 a 6 g 7 a 8 c 9 0 1 2 3 4 5 6 7 8 9 Classical Dynamic Programming: O(n 2 ) 20 DNA Sequence Comparison: First Success Story • Finding sequence similarities with genes of known function is a common approach to infer a newly sequenced gene’s function • In 1984 Russell Doolittle and colleagues found similarities between cancer-causing gene and normal growth factor (PDGF) gene Cystic Fibrosis • Cystic fibrosis (CF) is a chronic and frequently fatal genetic disease of the body's mucus glands (abnormally high level of mucus in glands). CF primarily affects the respiratory systems in children. • Mucus is a slimy material that coats many epithelial surfaces and is secreted into fluids such as saliva Cystic Fibrosis: Inheritance • In early 1980s biologists hypothesized that CF is an autosomal recessive disorder caused by mutations in a gene that remained unknown till 1989 • Heterozygous carriers are asymptomatic • Must be homozygously recessive in this gene in order to be diagnosed with CF Cystic Fibrosis: Finding the Gene Cystic Fibrosis and the CFTR Protein •CFTR (Cystic Fibrosis Transmembrane conductance Regulator) protein is acting in the cell membrane of epithelial cells that secrete mucus •These cells line the airways of the nose, lungs, the stomach wall, etc. Mechanism of Cystic Fibrosis • The CFTR protein (1480 amino acids) regulates a chloride ion channel • Adjusts the “wateriness” of fluids secreted by the cell • Those with cystic fibrosis are missing one single amino acid in their CFTR • Mucus ends up being too thick, affecting many organs Cystic Fibrosis and the CFTR Protein •CFTR (Cystic Fibrosis Transmembrane conductance Regulator) protein is acting in the cell membrane of epithelial cells that secrete mucus •These cells line the airways of the nose, lungs, the stomach wall, etc. Finding Similarities between the Cystic Fibrosis Gene and ATP binding proteins • ATP binding proteins are present on cell membrane and act as transport channel • In 1989 biologists found similarity between the cystic fibrosis gene and ATP binding proteins • A plausible function for cystic fibrosis gene, given the fact that CF involves sweet secretion with abnormally high sodium level Cystic Fibrosis: Mutation Analysis If a high % of cystic fibrosis (CF) patients have a certain mutation in the gene and the normal patients don’t, then that could be an indicator of a mutation that is related to CF A certain mutation was found in 70% of CF patients, convincing evidence that it is a predominant genetic diagnostics marker for CF Outline • DNA Sequence Comparison: Biological background • The Sequence Alignment problem • First Biological Success Stories • Grid Graphs: Manhattan Tourist Problem • Longest Paths in Grid Graphs • Back to Longest Common Subsequence Problem • Review: divide and conquer paradigm • Reducing the space requirement of LCS Manhattan Tourist Problem (MTP) Imagine seeking a path (from source to Source sink) to travel (only * * eastward and * * * southward) with the * most number of * * attractions (*) in the * * * * Manhattan grid Sink Manhattan Tourist Problem (MTP) Imagine seeking a path (from source to Source sink) to travel (only * * eastward and * * * southward) with the * most number of * * attractions (*) in the * * * * Manhattan grid Sink Manhattan Tourist Problem: Formulation Goal: Find the longest (highest scoring) path in a weighted grid.
Recommended publications
  • Networkx: Network Analysis with Python

    Networkx: Network Analysis with Python

    NetworkX: Network Analysis with Python Salvatore Scellato Full tutorial presented at the XXX SunBelt Conference “NetworkX introduction: Hacking social networks using the Python programming language” by Aric Hagberg & Drew Conway Outline 1. Introduction to NetworkX 2. Getting started with Python and NetworkX 3. Basic network analysis 4. Writing your own code 5. You are ready for your project! 1. Introduction to NetworkX. Introduction to NetworkX - network analysis Vast amounts of network data are being generated and collected • Sociology: web pages, mobile phones, social networks • Technology: Internet routers, vehicular flows, power grids How can we analyze this networks? Introduction to NetworkX - Python awesomeness Introduction to NetworkX “Python package for the creation, manipulation and study of the structure, dynamics and functions of complex networks.” • Data structures for representing many types of networks, or graphs • Nodes can be any (hashable) Python object, edges can contain arbitrary data • Flexibility ideal for representing networks found in many different fields • Easy to install on multiple platforms • Online up-to-date documentation • First public release in April 2005 Introduction to NetworkX - design requirements • Tool to study the structure and dynamics of social, biological, and infrastructure networks • Ease-of-use and rapid development in a collaborative, multidisciplinary environment • Easy to learn, easy to teach • Open-source tool base that can easily grow in a multidisciplinary environment with non-expert users
  • 1 Hamiltonian Path

    1 Hamiltonian Path

    6.S078 Fine-Grained Algorithms and Complexity MIT Lecture 17: Algorithms for Finding Long Paths (Part 1) November 2, 2020 In this lecture and the next, we will introduce a number of algorithmic techniques used in exponential-time and FPT algorithms, through the lens of one parametric problem: Definition 0.1 (k-Path) Given a directed graph G = (V; E) and parameter k, is there a simple path1 in G of length ≥ k? Already for this simple-to-state problem, there are quite a few radically different approaches to solving it faster; we will show you some of them. We’ll see algorithms for the case of k = n (Hamiltonian Path) and then we’ll turn to “parameterizing” these algorithms so they work for all k. A number of papers in bioinformatics have used quick algorithms for k-Path and related problems to analyze various networks that arise in biology (some references are [SIKS05, ADH+08, YLRS+09]). In the following, we always denote the number of vertices jV j in our given graph G = (V; E) by n, and the number of edges jEj by m. We often associate the set of vertices V with the set [n] := f1; : : : ; ng. 1 Hamiltonian Path Before discussing k-Path, it will be useful to first discuss algorithms for the famous NP-complete Hamiltonian path problem, which is the special case where k = n. Essentially all algorithms we discuss here can be adapted to obtain algorithms for k-Path! The naive algorithm for Hamiltonian Path takes time about n! = 2Θ(n log n) to try all possible permutations of the nodes (which can also be adapted to get an O?(k!)-time algorithm for k-Path, as we’ll see).
  • K-Path Centrality: a New Centrality Measure in Social Networks

    K-Path Centrality: a New Centrality Measure in Social Networks

    Centrality Metrics in Social Network Analysis K-path: A New Centrality Metric Experiments Summary K-Path Centrality: A New Centrality Measure in Social Networks Adriana Iamnitchi University of South Florida joint work with Tharaka Alahakoon, Rahul Tripathi, Nicolas Kourtellis and Ramanuja Simha Adriana Iamnitchi K-Path Centrality: A New Centrality Measure in Social Networks 1 of 23 Centrality Metrics in Social Network Analysis Centrality Metrics Overview K-path: A New Centrality Metric Betweenness Centrality Experiments Applications Summary Computing Betweenness Centrality Centrality Metrics in Social Network Analysis Betweenness Centrality - how much a node controls the flow between any other two nodes Closeness Centrality - the extent a node is near all other nodes Degree Centrality - the number of ties to other nodes Eigenvector Centrality - the relative importance of a node Adriana Iamnitchi K-Path Centrality: A New Centrality Measure in Social Networks 2 of 23 Centrality Metrics in Social Network Analysis Centrality Metrics Overview K-path: A New Centrality Metric Betweenness Centrality Experiments Applications Summary Computing Betweenness Centrality Betweenness Centrality measures the extent to which a node lies on the shortest path between two other nodes betweennes CB (v) of a vertex v is the summation over all pairs of nodes of the fractional shortest paths going through v. Definition (Betweenness Centrality) For every vertex v 2 V of a weighted graph G(V ; E), the betweenness centrality CB (v) of v is defined by X X σst (v) CB
  • The On-Line Shortest Path Problem Under Partial Monitoring

    The On-Line Shortest Path Problem Under Partial Monitoring

    Journal of Machine Learning Research 8 (2007) 2369-2403 Submitted 4/07; Revised 8/07; Published 10/07 The On-Line Shortest Path Problem Under Partial Monitoring Andras´ Gyor¨ gy [email protected] Machine Learning Research Group Computer and Automation Research Institute Hungarian Academy of Sciences Kende u. 13-17, Budapest, Hungary, H-1111 Tamas´ Linder [email protected] Department of Mathematics and Statistics Queen’s University, Kingston, Ontario Canada K7L 3N6 Gabor´ Lugosi [email protected] ICREA and Department of Economics Universitat Pompeu Fabra Ramon Trias Fargas 25-27 08005 Barcelona, Spain Gyor¨ gy Ottucsak´ [email protected] Department of Computer Science and Information Theory Budapest University of Technology and Economics Magyar Tudosok´ Kor¨ utja´ 2. Budapest, Hungary, H-1117 Editor: Leslie Pack Kaelbling Abstract The on-line shortest path problem is considered under various models of partial monitoring. Given a weighted directed acyclic graph whose edge weights can change in an arbitrary (adversarial) way, a decision maker has to choose in each round of a game a path between two distinguished vertices such that the loss of the chosen path (defined as the sum of the weights of its composing edges) be as small as possible. In a setting generalizing the multi-armed bandit problem, after choosing a path, the decision maker learns only the weights of those edges that belong to the chosen path. For this problem, an algorithm is given whose average cumulative loss in n rounds exceeds that of the best path, matched off-line to the entire sequence of the edge weights, by a quantity that is proportional to 1=pn and depends only polynomially on the number of edges of the graph.
  • An Efficient Reachability Indexing Scheme for Large Directed Graphs

    An Efficient Reachability Indexing Scheme for Large Directed Graphs

    1 Path-Tree: An Efficient Reachability Indexing Scheme for Large Directed Graphs RUOMING JIN, Kent State University NING RUAN, Kent State University YANG XIANG, The Ohio State University HAIXUN WANG, Microsoft Research Asia Reachability query is one of the fundamental queries in graph database. The main idea behind answering reachability queries is to assign vertices with certain labels such that the reachability between any two vertices can be determined by the labeling information. Though several approaches have been proposed for building these reachability labels, it remains open issues on how to handle increasingly large number of vertices in real world graphs, and how to find the best tradeoff among the labeling size, the query answering time, and the construction time. In this paper, we introduce a novel graph structure, referred to as path- tree, to help labeling very large graphs. The path-tree cover is a spanning subgraph of G in a tree shape. We show path-tree can be generalized to chain-tree which theoretically can has smaller labeling cost. On top of path-tree and chain-tree index, we also introduce a new compression scheme which groups vertices with similar labels together to further reduce the labeling size. In addition, we also propose an efficient incremental update algorithm for dynamic index maintenance. Finally, we demonstrate both analytically and empirically the effectiveness and efficiency of our new approaches. Categories and Subject Descriptors: H.2.8 [Database management]: Database Applications—graph index- ing and querying General Terms: Performance Additional Key Words and Phrases: Graph indexing, reachability queries, transitive closure, path-tree cover, maximal directed spanning tree ACM Reference Format: Jin, R., Ruan, N., Xiang, Y., and Wang, H.
  • An Optimal Path Cover Algorithm for Cographs R

    An Optimal Path Cover Algorithm for Cographs R

    Old Dominion University ODU Digital Commons Computer Science Faculty Publications Computer Science 1995 An Optimal Path Cover Algorithm for Cographs R. Lin S. Olariu Old Dominion University Follow this and additional works at: https://digitalcommons.odu.edu/computerscience_fac_pubs Part of the Applied Mathematics Commons, and the Computer Sciences Commons Repository Citation Lin, R. and Olariu, S., "An Optimal Path Cover Algorithm for Cographs" (1995). Computer Science Faculty Publications. 118. https://digitalcommons.odu.edu/computerscience_fac_pubs/118 Original Publication Citation Lin, R., Olariu, S., & Pruesse, G. (1995). An optimal path cover algorithm for cographs. Computers & Mathematics with Applications, 30(8), 75-83. doi:10.1016/0898-1221(95)00139-p This Article is brought to you for free and open access by the Computer Science at ODU Digital Commons. It has been accepted for inclusion in Computer Science Faculty Publications by an authorized administrator of ODU Digital Commons. For more information, please contact [email protected]. Computers Math. Applic. Vol. 30, No. 8, pp. 75-83, 1995 Pergamon Copyright©1995 Elsevier Science Ltd Printed in Great Britain. All rights reserved 0898-1221/95 $9.50 + 0.00 0898-1221(95)00139-$ An Optimal Path Cover Algorithm for Cographs* R. LIN Department of Computer Science SUNY at Geneseo, Geneseo, NY 14454, U.S.A. S. OLARIU Department of Computer Science Old Dominion University, Norfolk, VA 23529-0162, U.S.A. G. PRUESSE Department of Computer Science and Electrical Engineering University of Vermont, Burlington, VT 05405-0156, U.S.A. (Received November 1993; accepted March 1995) Abstract--The class of cographs, or complement-reducible graphs, arises naturally in many dif- ferent areas of applied mathematics and computer science.
  • PDF Reference

    PDF Reference

    NetworkX Reference Release 1.0 Aric Hagberg, Dan Schult, Pieter Swart January 08, 2010 CONTENTS 1 Introduction 1 1.1 Who uses NetworkX?..........................................1 1.2 The Python programming language...................................1 1.3 Free software...............................................1 1.4 Goals...................................................1 1.5 History..................................................2 2 Overview 3 2.1 NetworkX Basics.............................................3 2.2 Nodes and Edges.............................................4 3 Graph types 9 3.1 Which graph class should I use?.....................................9 3.2 Basic graph types.............................................9 4 Operators 129 4.1 Graph Manipulation........................................... 129 4.2 Node Relabeling............................................. 134 4.3 Freezing................................................. 135 5 Algorithms 137 5.1 Boundary................................................. 137 5.2 Centrality................................................. 138 5.3 Clique.................................................. 142 5.4 Clustering................................................ 145 5.5 Cores................................................... 147 5.6 Matching................................................. 148 5.7 Isomorphism............................................... 148 5.8 PageRank................................................. 161 5.9 HITS..................................................
  • Single-Source Bottleneck Path Algorithm Faster Than Sorting For

    Single-Source Bottleneck Path Algorithm Faster Than Sorting For

    Single-Source Bottleneck Path Algorithm Faster than Sorting for Sparse Graphs 1 1 1 1 Ran Duan ∗ , Kaifeng Lyu † , Hongxun Wu ‡ , and Yuanhang Xie § 1Institute for Interdisciplinary Information Sciences, Tsinghua University Abstract In a directed graph G = (V, E) with a capacity on every edge, a bottleneck path (or widest path) between two vertices is a path maximizing the minimum capacity of edges in the path. For the single-source all-destination version of this problem in directed graphs, the previous best algorithm runs in O(m+n log n) (m = E and n = V ) time, by Dijkstra search with Fibonacci heap [Fredman and Tarjan 1987]. We| improve| this| time| bound to O(m√log n), thus it is the first algorithm which breaks the time bound of classic Fibonacci heap when m = o(n√log n). It is a Las-Vegas randomized approach. By contrast, the s-t bottleneck path has an algorithm with k running time O(mβ(m,n)) [Chechik et al. 2016], where β(m,n) = min k 1 : log( ) n m . { ≥ ≤ n } 1 Introduction The bottleneck path problem is a graph optimization problem finding a path between two ver- tices with the maximum flow, in which the flow of a path is defined as the minimum capacity of edges on that path. The bottleneck problem can be seen as a mathematical formulation of many network routing problems, e.g. finding the route with the maximum transmission speed between two nodes in a network, and it has many other applications such as digital compositing [FGA98]. It is also the important building block of other algorithms, such as the improved Ford-Fulkerson algorithm [EK72, FF56], and k-splittable flow algorithm [BKS02].
  • Longest Path in a Directed Acyclic Graph (DAG)

    Longest Path in a Directed Acyclic Graph (DAG)

    Longest path in a directed acyclic graph (DAG) Mumit Khan CSE 221 April 10, 2011 The longest path problem is the problem of finding a simple path of maximal length in a graph; in other words, among all possible simple paths in the graph, the problem is to find the longest one. For an unweighted graph, it suffices to find the longest path in terms of the number of edges; for a weighted graph, one must use the edge weights instead. To explain the process of developing this algorithm, we’ll first develop an algorithm for computing the single-source longest path for an unweighted directed acyclic graph (DAG), and then generalize that to compute the longest path in a DAG, both unweighted or weighted. We’ve already seen how to compute the single-source shortest path in a graph, cylic or acyclic — we used BFS to compute the single-source shortest paths for an unweighted graph, and used Dijkstra (non-negative edge weights only) or Bellman-Ford (negative edge weights allowed) for a weighted graph without negative cycles. If we needed the shortest path between all pairs, we could always run the single-source shortest path algorithm using each vertex as the source; but of course there is Floyd-Warshall ready to do just that. The use of dynamic programming or a greedy algorithm is made possible by the fact the shortest path problem has optimal substructure — the subpaths in the shortest path between two vertices must themselves be the shortest ones! When it comes to finding the longest path however, we find that the problem does not have optimal substructure, and we lose the ability to use dynamic programming (and of course greedy strategy as well!).
  • Depth-First Search, Topological Sort

    Depth-First Search, Topological Sort

    And, for the hous is crinkled to and fro, And hath so queinte weyes for to go— For hit is shapen as the mase is wroght— Therto have I a remedie in my thoght, That, by a clewe of twyne, as he hath goon, The same wey he may returne anoon, Folwing alwey the threed, as he hath come. — Geoffrey Chaucer, The Legend of Good Women (c. 1385) Una lámpara ilustraba el andén, pero las caras de los niños quedaban en la zona de la sombra. Uno me interrogó: ¿Usted va a casa del doctor Stephen Albert?. Sin aguardar contestación, otro dijo: La casa queda lejos de aquí, pero usted no se perderá si toma ese camino a la izquierda y en cada encrucijada del camino dobla a la izquierda. — Jorge Luis Borges, “El jardín de senderos que se bifurcan” (1941) “Com’è bello il mondo e come sono brutti i labirinti!” dissi sollevato. “Come sarebbe bello il mondo se ci fosse una regola per girare nei labirinti,” rispose il mio maestro. — Umberto Eco, Il nome della rosa (1980) Chapter 6 Depth-First Search Status: Beta. Could add more, but don’t. In the previous chapter, we considered a generic algorithm—whatever-first search— for traversing arbitrary graphs, both undirected and directed. In this chapter, we focus on a particular instantiation of this algorithm called depth-first search, and primarily on the behavior of this algorithm in directed graphs. Rather than using an explicit stack, depth-first search is normally implemented recursively as follows: DFS(v): if v is unmarked mark v for each edge v w DFS(w) We can make this algorithm slightly faster (in practice) by checking whether a node is marked before we recursively explore it.
  • Generalized Pseudoforest Deletion: Algorithms and Uniform Kernel⋆

    Generalized Pseudoforest Deletion: Algorithms and Uniform Kernel⋆

    Generalized Pseudoforest Deletion: Algorithms and Uniform Kernel? Geevarghese Philip1, Ashutosh Rai2, Saket Saurabh2;3?? 1 Chennai Mathematical Institute, Chennai, India. [email protected] 2 The Institute of Mathematical Sciences, HBNI, Chennai, India. fashutosh|[email protected] 3 University of Bergen, Bergen, Norway. Abstract. Feedback Vertex Set (FVS) is one of the most well stud- ied problems in the realm of parameterized complexity. In this problem we are given a graph G and a positive integer k and the objective is to test whether there exists S ⊆ V (G) of size at most k such that G − S is a forest. Thus, FVS is about deleting as few vertices as possible to get a forest. The main goal of this paper is to study the following interesting problem: How can we generalize the family of forests such that the nice structural properties of forests and the interesting algorithmic proper- ties of FVS can be extended to problems on this class? Towards this we define a graph class, Fl, that contains all graphs where each connected component can transformed into forest by deleting at most l edges. The class F1 is known as pseudoforest in the literature and we call Fl as l-pseudoforest. We study the problem of deleting k vertices to get into Fl, l-pseudoforest Deletion, in the realm of parameterized complex- ity. We show that l-pseudoforest Deletion admits an algorithm with k O(1) 2 running time cl n and admits a kernel of size f(l)k . Thus, for every fixed l we have a kernel of size O(k2).
  • Measures of Centrality

    Measures of Centrality

    Measures of centrality Measures of centrality Background Centrality Complex Networks measures Degree centrality CSYS/MATH 303, Spring, 2011 Closeness centrality Betweenness Eigenvalue centrality Hubs and Authorities Prof. Peter Dodds References Department of Mathematics & Statistics Center for Complex Systems Vermont Advanced Computing Center University of Vermont Licensed under the Creative Commons Attribution-NonCommercial-ShareAlike 3.0 License. 1 of 28 Measures of Outline centrality Background Centrality measures Degree centrality Closeness centrality Background Betweenness Eigenvalue centrality Hubs and Authorities References Centrality measures Degree centrality Closeness centrality Betweenness Eigenvalue centrality Hubs and Authorities References 2 of 28 Measures of How big is my node? centrality Background Centrality measures I Basic question: how ‘important’ are specific nodes Degree centrality Closeness centrality and edges in a network? Betweenness Eigenvalue centrality I An important node or edge might: Hubs and Authorities 1. handle a relatively large amount of the network’s References traffic (e.g., cars, information); 2. bridge two or more distinct groups (e.g., liason, interpreter); 3. be a source of important ideas, knowledge, or judgments (e.g., supreme court decisions, an employee who ‘knows where everything is’). I So how do we quantify such a slippery concept as importance? I We generate ad hoc, reasonable measures, and examine their utility... 3 of 28 Measures of Centrality centrality Background Centrality measures Degree centrality I One possible reflection of importance is centrality. Closeness centrality Betweenness I Presumption is that nodes or edges that are (in some Eigenvalue centrality Hubs and Authorities sense) in the middle of a network are important for References the network’s function.