PHYLOGENETIC RELATIONSHIP ON GENUS LEPTOBRACHI UM(AMPHIBIA: ANURA: MEGOPHRYIDAE) IN SARAWAK
Norhasimah Binti Jakariah (31890)
Bachelor of Science with Honours QL (Animal Resource Science Management) 47 and N839 2014 2014 UNIVERSITI MALAYSIA SARAWAK
Grade:
Please tick ('I) Final Year Project Report 0 Masters ý PhD 0
DECLARATION OF ORIGINAL WORK
Student's Declaration:
I Norhasimah binti Jakariah (31890) Faculty of Resource Science and Technology (FRST) hereby declare that the work Phylogenetic Relationship of Genus Leptobrachium (Amphibia: Anura: Megophryidae) In Sarawak is my original work. I have not copied from any other students' work or from any other sources except where due reference or acknowledgement is made explicitly in the text, nor has any part been written for me by another person.
2a1q6/201ý Date submitted Name of the student (Matric No.) %wjft«nnw WTI CIA M44 (11810)
Supervisor's Declaration:
I Ramlah binti Zainudin hereby certifies that the work Phylogenetic Relationship of Genus Leptobrachium (Amphibia: Anura: Megophryidae) In Sarawak was prepared by the above named student, and was submitted to the "FACULTY" as a full fulfillment for the conferment of Bachelor of Science with Honours (Animal Resource Science and Management) and the aforementioned work, to the best of my knowledge, is the said student's work.
M Ppw Received for examination by: 149 (Name of the supervisor) Assoc. Prof Dr Raaüah Zain th, Deputy Dean Centrefor Pre-UniversityStudies UNMMM MALAYSIAS&R,4WA c are that ProjectfMesis is dassified as (Please ti
Q CONFIDENTIAL (Contains confidential information under the Official Secret Act 1972)* TRICTED (Contains restricted information as specified by the organisation where research was done)* PEN ACCESS
Validation of Project/Thesis
I duly free therefore affirm with consent and willingly declare that this said Project/Thesis shall be for placed officially in the Centre Academic Information Services with the abiding interest and rights as follows:
" This ProjectlThesis is the sole legal property of Universiti Malaysia Sarawak (UNIMAS). " The Centre for Academic Information Services has the lawful right to make copies for the purpose of academic and research only and not for other purpose. " The Centre for Academic Information Services has the lawful right to digitalise the content for the Local Content Database. The Centre for Academic Information Services " has the lawful right to make copies of the Project/Thesis for academic exchange between Higher Learning Institute. No dispute from " or any claim shall arise the student itself neither third party on this ProjectPThesis once it becomes the sole property of UNIMAS. This ProjectJThesis data " or any material, and information related to it shall not be distributed, published or disclosed to any party by the student except with UNIMAS permission.
Student signature / 01-1 Supervisor signature: (Date) (liate) 23 Jac /zit Current Addreee: 314(o eh. , ý
Notes: * If Project/Thesis is CONFIDENTIAL RESTRICTED, the or please attach together as annexure a letter from the organisation with the period and reasons of confidentiality and restriction.
(The instrument is duly prepared by The Centre for Academic Information Services] pÜNýIVF. RstTI MALAYSIASARAWAK
PHYLOGENETIC RELATIONSHIP OF GENUS LEPTOBRACHIUM (AMPHIBIA: ANURA: MEGOPHRYIDAE) IN SARAWAK
NORHASIMAH BINTI JAKARIAH (31890)
This project is submitted in partial fulfillment of the requirement for the degree of a Bachelor of Science with Honours (Animal Resource Science and Management)
I
Department of Zoology Faculty of Resource Science and Technology UNIVERSITY MALAYSIA SARAWAK 2014
I DECLARATION
I hereby declare that no portion of the work referred to this dissertation has been submitted in
support of an application for another degree or qualification to this or any other university or
institute of higher learning.
Norhasimah Binti Jakariah Animal Resource Science and Management Programme Department of Zoology Faculty of Resource Science and Technology Universiti Malaysia Sarawak
II ACKNOWLEDGEMENTS
First of all, praise to ALLAH s.w. t for giving me idea, mental and physical strength to
accomplish my final year project. A special gratitude I give to our beloved supervisor, Associate
Professor Dr. Ramlah Zainudin for her encouragement and patiently guiding me throughout this
study is under taken. This study was also done under her grant research project (Grant project
number: FRGS/1/213/STWN1O/UNIMAS/02/3)had also ease the completion of this thesis. I
would also like to acknowledge with much appreciation the crucial role of my parents, for giving
me moral support and financial support throughout my studies years. I would like to thank the
staff of department of zoology, for helping in collecting samples and providing chemical and
apparatus, post graduate student of Molecular ecology Lab, namely Elvy Quatrin anak Deka,
Muhammad Fadzil Amram, and all master student for the knowledge and support during my
research period.
Special thanks also given to Sarawak Forestry for their permission to conduct research on biological resources (Permit Number: NCCA.907.4.4 (Jld. 9)-227, Park permit number:
385/2013). I would like to extend my gratitude to my teammates Nooraina Atira binti Alaudin,
Siti Khairiah binti Khamis, Nur Kamaliyah binti Ismail, Mohd Adzmier Helmi bin Mohd Zin and
Muhammad Syamil bin Shahabudin for their assistance throughout research progress and much appreciation goes to Molecular Lab teammates for their guidance. Thanks also dedicated to all my coursemates for their supports throughout the years and will always be remembered. Last but not least, my appreciation goes to all my lecturers and staff members in Faculty of Resource
Science and Technology, University Malaysia Sarawak, who have contributed in this project either directly or indirectly.
III Punt Kridmst AIWWjvmstAlrsdem;. UMVCRSITI MALAYSUSARAWA t
TABLE OF CONTENTS
TITLE PAGE I
DECLARATION II
ACKNOWLEDGEMENT III
TABLE OF CONTENTS IV
LIST OF ABBREVIATIONS VI
LIST OF TABLES IX
LIST OF FIGURES X
ABSTRACT I
ABSTRAK 1
CHAPTER 1 INTRODUCTION 2
1.1 Background of Study 2
1.2 Problem Statement 3
1.3 Objectives 4
CHAPTER 2 LITERATURE REVIEW 5
2.1 Systematic, Habitat and Distribution 5
2.2 Mitochondrial Ribosomal 16S rRNA 8
2.3 Morphometric 9
2.3.1 Discriminant Function Analysis 9
CHAPTER 3 METHODOLOGY 10
3.1 Sample Collection 10
3.2 Molecular Work 13
IV 3.3 Data Analysis 14
3.3.1 Molecular Phylogenetic Analyses 14
3.3.2 Morphometric Analyses 15
CHAPTER 4 RESULTS 17
4.1 Molecular Analyses 17
4.1.1 DNA Extraction 17
4.1.2 Polymerase Chain Reaction 18
4.2 Sequence Analysis 20
4.2.1 Pairwise Genetic Distance 21
4.3 Phylogenetic Analyses 23
4.4 Morphological Analyses
CHAPTER 5 DISCUSSION 29
5.1 DNA Extraction 29
5.2 Polymesse Chain Reaction 30
5.3 Phylogenetic Analyses 30
5.4 Morphological Analyses 33
CHAPTER 6 CONCLUSION 35
REFERENCES 36
APPENDIXA 40
V LIST OF ABBREVIATIONS
Bp Base Pair
16s Ribosomal RNA 16S rRNA
1FL First Finger Length
3FL Third Finger Length
CIA Chloroform - Isoamyl Alcohol
CTAB Cetyltrimethylammonium Bromide
DNA Dinucleotide Acid
Acid EDTA Ethylene-Diamine-Tetra-acetic
EL Eye Length
FL Foot Length
HAL Hand Length
Length HL Head
HLL Hindlimb Length
Head Width Upper arm Length
vi ICD Intercanthal Distance (Distance Between Eyes)
IMTL Inner Metatarsal Tubercle Length
IND Length Internarial Distance (Distance Between Nostril)
IPTL Inner Palmar Tubercle Length
LAL Lower Arm and Hand Length
MEGA Molecular Evolutionary Genetic Analysis
MgCL2 Magnesium Chloride
ML Maximum Likelihood he Maximum Parsimony
Mitohcondrial Deoxyribonucleic Acid mtDNA
NaCl Sodium Chloride
N-EL Nostril To Eye Distance
NJ Neighbour Joining
OPTL Outer Palmar Tubercle Length
PCR Polymesse Chain Reaction
RNA Ribonucleic Acid
VII SL Snout Length
S-NL Snout to Nostril Length
SVL Snout-to-Vent Length
TAE Tris-Acetate- EDTA
TD Tympanum Diameter
TEL Tympanic- Eye Length
TL Tibia Length LIST OF TABLES
Table Page f Table 1 Sample of Leptobrachium used for laboratory work and DNA analysis in this 12 study including information on voucher, collection locality, and sample ID genBank accession number.
Table 2 Primer paired used in this study. Primer sequence type amplified direction is 13 indicated by heavy (H) or light (L) strand.
Table 3 Morphometric characters of genus Leptobrachium based on Matsui (1984). 16 Table 4 Nucleotide composition of the sequence and all frequencies are given in 20 percentage. Table5 Pairwise genetic distance among species of genus Leptobrachium analysed 22 based on Kimura 2-parameter modal.
Table 6 Eigenvalues of five functions in DFA 26
Table 7 The wilks' lambda test of five functions. 26
Table 8 Standardized Canonical Discriminant Function Coefficients. 27
Ix LIST OF FIGURE
Npre Page
Figure 1 Map of study site within Sarawak (Source: map source) 11
Figure 2 Gel photo of gel visualisation of DNA Extraction. 17
Figure 3 Gel photo of gel visualisation of DNA Extraction. 18
Figure 4 Gel photo of gel visualisation of DNA Extraction. 18
Figure 5 Gel photo of gel visualisation of PCR 19
Figure 6 Maximum likelihood (ML) phylogram tree of 1464 bp of 16S rRNA 25 mitochondrial gene for samples of Leptobrachium.
Figure 7 Canonical discriminant functions of function 1 and function 2 for 28 morphometric measurement of genus Leptobrachium
X Phylogenetic Relationship of Genus Leptobrachium (Amphibia: Anura: Megophridae)
in Sarawak
Norhasimah binti Jakariah
Animal Resource Science and Management Department of Zoology Faculty of Science and Technology University Malaysia Sarawak
ABSTRACT
Genus Leptobrachium is one of genera within family Megophridae found in Sarawak. It consists of cryptic species that are difficult to distinguish. Thus, phylogenetic relationship of genus Leptobrachium was studied by using mitochondrial ribosomal of 16S rRNA. Tissue sample were collected in four localities within Sarawak namely Kubah National Park, Matang Wildlife Centre, Mt. Gading National Park, and Mt. Santubong, Sarawak by using forest transects method and quadrats method. Tissues were extracted using molecular technique approach such as DNA extraction, PCR amplification, and sequencing. Phylogenetic relationships were inferred using primer pair of mitochondrial ribosomal 16S rRNA gene. A total of 1464bp of 16S rRNA from 10 samples were analyzed using Neighbor-Joining (NJ), Maximum Parsimony (MP) and Maximum Likelihood (ML) method. For this study, monophyletic group were formed consist of all species within the genus Leptobrachium with respect to outgroup. It is proven that 16S rRNA gene was useful as gentic marker to elucidate phylogenetic study within genus level. The study of phylogenetic relationship of genus Leptobrachium able to infer the divergence and lineage of species within respected genus thus contribute to provide future reference at local level.
Keywords: Phylogenetic, 16S rNA, Leptobrachium, Maximum-likelihood, Monophyletic
ABSTRAK Genus Lentobrachium merupakan salah satu genera di bawah keluarga Megophridae yang terdapat di Sarawak la terdiri daripada species kriptik yang sukar untuk dikenal pasti. Oleh itu hubungan filogenetik genus 14ntobrachium telah dikaji dengan menggunakan ribosom didapati mitokondria daripada 16S rRNA. Sampel tisu telah daripada empat kawasan di Sarawak iaitu Taman Negara Kubah, Pusat Hidupan Liar Matang, Taman Negara Gading, dan Gunung Santubong, Sarawak dengan menggunakan kaedah eransek hutan dan kaedah kuadrat. Tisu di extrak menggunakan pendekatan teknik molekul seperti pengekstrakan DNA, PCR, dan sekuensing. Hubungan filogenetik telah disimpulkan menggunakan pasangan primer asas daripada mitokondria ribosom 16S rRNA gen. Sebanyak 1464bp daripada 16S rRNA dari 10 sampel telah dianalisis dengan menggunakan kaedah Neighbor - Menyertai (N.1), kaedah Maksimum Parsimony (MP) dan kaedah Maximum Likelihood (Ag). Untuk kajian ini, kumpulan daripada dalam monofiletik telah dibentuk terdiri semua spesies genus Lentobrachium berkenaan dengan keluarga luar. la membuktikan bahawa 16S rRNA gen berguna sebagai penanda genetik dalam untuk menjelaskan kajian filogenetik tahap genus. Kajian hubungan filogenetik genus Lgptobrachium dapat membuat kesimpulan pencaran dan keturunan spesies dalam genus dengan depan di itu menyumbang dalam menyediakan rujukan masa pada peringkat tempatan.
Kata kunci: Filogentik; 16S rRNA, Leptobrachium, Maximum- likelihood, Monofiletik CHAPTER 1
INTRODUCTION
1.1 Background of study
Frogs are among the most diverse vertebrates in the world as they appear very abundance
throughout the world. Currently, 6350 living species of Anuran were recognized (Frost,
2014). Frogs are widely distributed and continuously to grow especially in the island of
Borneo. It is reported that in Borneo there are rich in biodiversity especially in the group of
herpetofauna (Das, 2006). In Borneo, it is reported that 154 species of frog have been
recorded whereas 89 species are classified as endemic to Borneo and expected the number
of species recognized will continuously to grow (Inger and Stuebing, 2009). The
abundance of frogs in Borneo is mainly due to the ecological suitability of certain frogs
species. There are 6 families of frog recorded in Borneo which are Bombinatoridae,
Bufonidae, Megophyridae, Microhylidae, Ranidae, Rhacophoridae (Inger and Stuebing,
2005).
Megophyridae is one of the families consist of many cryptic species and most are endemic to Borneo. It is known as Bornean litter frog consists of four genera within family with total of 22 species recorded in Borneo (Inger and Stuebing, 2005). Current status of total species was increased to total of 25 species (Frost, 2014). Among 22 species, 15 species were recorded from Sarawak and four of species are endemic to Sarawak Inger and
Stuebing (2005). With current status, number of endemic species was also increase to five species (Frost, 2014).
2 Four genera were recognized within Bomean Megophryidae including genus
Leptobrachella, genus Leptobrachium, genus Leptolalax, and genus Megophrys. Species of
genus Leptobrachium recorded in Sarawak were L. montanum Fischer, 1885, L. abbotti
Cochran, 1926, L. hendricksoni Taylor, 1962, and L. nigrops Berry and Hendrickson, 1963
(Inger and Stuebing, 2005). This includes three new species described which are L. ingeri
Hamidy, Matsui, Nishikawa, and Belabut, 2012, L. kanowitense Hamidy, Matsui,
Nishikawa, and Belabut, 2012 and L kantonishikawai Hamidy and Matsui, 2014 (Frost,
2014).
1.2 Problem Statement
The study on phylogeny of Asian spade foot of genus Leptobrachium is relatively poor and
was not well understood (Matsui, 2010). Taxonomic problem occur in Leptobrachium span
from supraspecific to the species level (Matsui, 2010). Hence, crypticity occurrence among
the species within genus Leptobrachium itself has contributed to this problem. Recent L. molecular study had found that both L. montanum and abbotti contain several cryptic discordance species where there are morphological and genetic occurs within this both
species in north western of Borneo (Hamidy et al., 2011) and later study come out with
(Hamidy description of new species of L. kantonishikawai and Matsui., 2014). It is similar
to other subgenus of Bornean Leptobrachium which is L. nigrops where study by Hamidy
et al. (2012) had detected crypticity within these taxa at population level and distinguished L. ingeri from inland Sarawak L.nigrops from coastal Sarawak as and as L. kanowitense.
There are many more cryptic species await description from Borneo (Hamidy et al., 2011;
Hamidy et al., 2012). Study on molecular alone especially within cryptic species might give less rigid evidence to clear the status on phylogeny structure of genus Leptobrachium.
3 Morphological analysis data based on multivariate analysis of discriminant function
analysis (DFA) were also included in this study.
In this project the study were focused on genus Leptobrachium Tschudi of Bornean
Megophyridae within Sarawak. The aim of this study was to construct phylogenetic
relationship of genus Leptobrachium in Sarawak by using mitochondrial ribosomal of 16S
gene sequence. Based on previous study, it is stated that mitochondrial ribosomal of 16S
gene is a good molecular marker as it fulfil the requirements for a universal DNA
barcoding marker in amphibian (Vences et al., 2005). This is also to promote a comparative study on molecular and morphometric analysis to validate the taxonomic status of genus Leptobrachium to assist molecular phylogeny studies especially within cryptic species. This study also importance as it could inferred the information on phylogenetic relationship of genus Leptobrachium such as their divergence and lineage, and also able to assist on the identification of species of genus Leptobrachium in Sarawak from based on molecular approaches with aid of data morphometric analysis. This study local would contribute to provide future reference especially at level.
13 Objectives of study
I. To construct phylogenetic tree of four species in genus Leptobrachium of family
Megophyridae in Sarawak by using mitochondrial ribosomal of partial 16S gene
sequence.
II. To determine whether mitochondrial ribosomal 16S gene is a good genetic marker
to infer phylogenetic relationship of species within genus Leptobrachium.
4 Prqt jCiýat 1MýIdýtAlcsiarii. []NIVERS111MALAYASARAWAK
CHAPTER 2
LITERATURE REVIEW
2.1 Systematics, Habitat and Distribution
Megophyridae is one of the families that found in Sarawak. The name of Megophyridae is
defined based on Greek words mean large eyebrow. The family of Megophyridae is
distributed to southeast continental Asia, from Pakistan to western China, east to the
Philippines and the Sunda Island (Frost, 2014). Family of Megophryidae or common named litter frog is classified under the order of anuran. Megophryidae were classified as sister taxon of Pelobates based on adult characters (Pugener, 2003) and subfamily of
Pelobatidae (Haas, 2003). However it is later revised by frost et al. (2006) through
history molecular study had provided taxonomic and a partial phylogenetic analysis to reject the subfamilies of Megophryidae and separate the rank as independent family.
Overall, a total of 181 species of Megophryidae from nine genera were recorded from
Pakistan and western China east to the Philippines and the Greater Sunda Islands (Frost,
2014). The species of Megophryidae often found seen along the river bank, sometimes wander over the leaf litter of forest floor and near the rocky stream of secondary forest at lowland (Inger and Stuebing, 2005). The species also recorded to inhabit highland of
1000m above the sea level.
In Borneo, there are total of 22 species were and within 22 species, 17 species can be found in Sarawak (Inger and Stuebing, 2005; Hamidy and Matsui, 2012) where five of
5 species were endemic to Sarawak. However, recent study by Hamidy and Matsui (2012)
had provided three descriptions on new species of genus Leptobrachium which make total
species found in Borneo increased to 25 species. Four genus of Megophridae distributed in
Borneo are Leptobrachella, Leptobracium, Leptolalax and Megophrys (Inger and Stuebing,
2005; Matsui, 2010; Frost, 2014). Species of Leptobrachium including new species known
in Sarawak are as follows: L. montanem Fischer, 1885, L. abbotti Cochran, 1926, L.
hendricksoni Taylor, 1962, L. nigrops Berry and Hendrickson, 1963 (Inger and Stuebing,
2005), L. ingeri Hamidy, Matsui, Nishikawa, and Belabut, 2012, L. kanowitense Hamidy,
Matsui, Nishikawa, and Belabut, 2012, and L kantonishikawai Hamidy and Matsui, 2014
(Frost, 2014).
The megophryid genus Leptobrachium Tschudi, 1838 is considered to contain two
subgenera Vibrissaphora Liu, 1945, and Leptobrachium in which the presence of with bearing spines on upper lip in adult males differentiate this two subgenera (Ohler et al.,
2004). Zheng et al. (2008) and Rao and Wilkinson (2008) had place Vibrissaphora within the genus Leptobrachium and neither group of researchers recognizes subgenera. 34 known species within the genus Leptobrachium were throughout Southern China and India to islands of the Sunda Shelf and the Philippines (Hamidy and Matsui, 2014; Frost, 2014).
In Borneo alone there are total of 25 species were recorded (Hamidy and Matsui, 2012).
Inger (1966) and Berry (1975) had applied the name of L. hasseltii to most of Southeast
Asian population. It is clarified that L. hasseltii from Borneo was not conspeeific with the L. Javanese population and thus applied the names montanum and L. abbotti to Bornean species (Inger et al., 1995). Previous study by Hamidy et al. (2011) had stated that there in are morphological and genetic discordance occurs species, L. montanum and L. abbot:! as crypticity were found within both species. They have only slightly difference in
6 morphology where it can be identified only in live specimens. At population level study by
Hamidy and Matsui (2014) had also describe new species of L. kantonishikawai from
Bario, Kelabit Highland of Sarawak as it is once confused as L. abbotti. The Bario
population was known to have characteristics distinct from all other congeners.
Similar to other congeneric species, L. nigrops was once described from Southeast Asia and
treated as L. hasseltii (Taylor, 1962). However, it is revised later by Berry and
Hendrickson (1963), describe that Singapore as the type locality of L. nigrops and the
populations of L. hasseltii from Singapore and Peninsular Malaysia were distinct species. It
is known that population of L. hasseltii is restricted to Bali and Java, and other population
of northeastern India to the Philippines was once treated as L. hasseltii was assigned to
other named (Dubois and Ohler, 1998; Matsui, Nabhitabhata, and Panha, 1999; frost,
2014). There are high levels of genetic divergences among allopatric populations of L.
nigrops (Brown et al., 2009; Matsui et al., 2010) where three clades of populations from
Malay Peninsula, Belitung, and inland area of Borneo were recognized. Taxonomic relationship of L. nigrops were later evaluated based on molecular study by Hamidy and
Matsui (2012) describe true population of L. nigrops were from Singapore and Malay
Peninsula while populations from coastal area of Sarawak as L. ingeri and the population from the inland area of Sarawak as L. kanowitense.
7 L. hendricksoni is distinct in having black spots on its venter and an orange-colored upper
(and sometimes whole) iris (Inger, 1966). Matsui et al. (2010) stated that L. hendricksoni
in Peninsular Malaysia was paraphyletic with respect to Sumatran populations and
populations from the northern part of Peninsular Malaysia are the sister group to the
Sumatran populations and together form the sister group to the southern peninsular
populations. Genetic diversity of L. hendricksoni was much smaller compare to L. nigrops,
thus suggesting a unique evolutionary history (Matsui et al., 2010). Taxonomic status on
population of L. hendricksoni was not much to be known as they are rarely to be found.
2.2 Mitochondrial ribosomal 16S rRNA gene
In this study, the evolutionary relationship of genus Leptobrachium of Megophyridae in
Sarawak was constructed by using mitochondrial ribosomal of 16S rRNA gene sequence.
It fulfill the requirements for a universal DNA barcoding marker in amphibian by having this few characteristic such as sufficiently variable to unambiguously identify most species,
for highly conserved mitochondrial marker the marker to be less variable within species, able to convey sufficient information on phylogenetic study and the sequence alignment will be possible among distantly related taxa (Vences et al., 2005).
8 2.3 Morphometric
Morphometric is one of fundamental area of research involve quantitative description and
analysis on variation of shapes of structures based on morphology of organisms. It is one
of techniques that used in systematic study (Rohlf, 1990). Term of morphometric is taken
from greek words with direct definition as `morph' (form) and `metrikos' (measure).
Several method of morphometrics analysis was known to be widely used among biological
investigators. This included multivariate morphometrics, coordinate morphometrics,
boundary morphometrics and structural morphometrics (Lestrel, 2000). Morphometrics
plays an important post-cladistic role in the analysis of trends and responses to evolutionary causes and constraints (Smith, 1990). A traditional morphometrics used in phylogenetics were commonly using data in term of size and shape variable (Smith, 1990).
Commonly, a primary method used for traditional morphometric is multivariate statistics which applied for both animal and botanical.
2.3.1 Discriminant Function Analysis
is Discriminant function analysis a multivariate statistical analysis used to predict a categorical dependent variable by one or more continuous or binary independent variable.
DFA aid to determine which continuous variables discriminate between two or more
French, 2004). naturally occurring groups (Poulsen and Study by Multivariate analyses of interpret variance using discriminant function able to morphological differences between factors influence the two cryptic species in relation to that the morphology characters
(Klimov, 2004).
9 CHAPTER 3
MATERIALS AND METHODS
3.1 Sample collections
Field sampling of Leptobrachium species was conducted from study sites located within
Sarawak namely Kubah National Park (NO1°36' 19.3" E110°11'30.3"), UNIMAS east
campus (01° 27'N; 110° 27'E), Mt. Gading National Park (NO1°41' 49.5" E109°50'92.7")
and Mt. Santubong, Sarawak (NO1°44'0" E110°20'0"). Samples were collected based on
standard method of two types of line transect which are forest transect and stream transect,
and forest floor quadrat method. The sampling started during night from hour 1930 until
2130 for transects and during the day from hour 0800 until 1200 for forest floor quadrat.
All ecological data including snout-vent length and weight of specimen was recorded.
Details of tissue used are shown in table 1. Tissue sample was taken from thigh muscle and for put into cryovial containing 99% absolute ethanol preservation and stored in 20°C freezer for long term storage. The voucher tissue samples of previous collection from other localities were also included in this study. The specimen collected was tagged and the cryovial tube was marked following the specimen tags. The specimens were preserved in
10% formalin and brought back to UNIMAS for further processing.
10 ar rr IIII
ýilXltll ý: INnq `iee
foduk Kim. uuo.
Tduk D r,,.fd E3 GL'IlliII?GädID_° r u näi', GLnt:n?S=ýM? NationalPal I /
I)AL, l. rý - :. uujk., w: uý i ` 1 ('1 KubahNational Park K0 and 3orneo 'mmar wxtn Matav2Udhfe Centre I tnlokpolwiei Tnbok Sul( . ! #r.. I. wM to" A. Mtg
ýý . on".. loltok Aitý ý{Iý Teluk +1ý'R! ...... _.... __. _... ý... _. _. .... II
Figure 1: Map of study site within Sarawak (Source: map source)
11 Table 1: Sample of Leptobrachium used for laboratory work and DNA analysis in this study including ID information on voucher, collection locality, and sample genBank accession number.
No. Species voucher Locality Sample GenBank
(coordinates) ID
Leptobrachium nigrop Sarawak, STB38 Santubong (fresh sample ) (NO1 °44'0" E 110°20'0")
2 Leptobrachium nigrops UNIMAS, East UE167 campus (NO1° 27" E 110° 27")
3 Leptobrachium montanum Sabah, Kinabalu RZ 18 NP (N6.074544,
E 116.562721)
4 Leptobrachium abbotti Sarawak, Kubah KNP1095 (fresh sample) NP (NO1°36'19.3" El 10°11'30.3")
5 Leptobrachium KUHE42590 Malaysia, Sarawak, AB530431 kanowitense Kanowit (N02° 06'0" E 112° 09'0")
6 Leptobrachium ingeri KUHE53834 Sarawak, AB719244 Santubong
(N01°44'0" E 110°20'0") 7 Leptobrachium KUHE15756 Selangor, Gombak AB719247 hendricksoni (N3.237462, E101.68342) 8 Leptobrachium KUHE52150 Johor, Endau AB530418 hendricksoni Rompin (N2°12.905' E 103°32.429')
9 Leptolalax hamidy Sarawak, Kubah KNP1036 (outgroup) NP (NOI°36' 19.3" E110°11'30.3")
10 Megophrys nasuta Sarawak, Kubah KNP 1015 (outgroup) NP (NO1°36' 19.3" E 110° 11'30.3")
12 3.2 Molecular Work
Total genomic DNA was extracted using modified CTAB protocol (Cetyl Trimethyl
Ammonium Bromide) (Grewe et al., 1993) with presence of proteinase K, CTAB buffer,
99% 70% for Chloroform-isoamyl alcohol , of absolute ethanol, ethanol DNA washing and NaCl. The targeted sequences were amplified through use of standard polymerase chain reaction (PCR) using primer pair of 16S-rRNA mitochondrial gene with approximately 600bp (table 2) and was carried out in a 25-µL reaction volume. The PCR cycle included an initial denaturation step of 5 min at 94 °C; 33 cycles of denaturing for
30s at 94 °C, primer annealing for 30 s at 48-50°C, and extension for I min 30 s at 72 °C and final extension for 7 minutes at 72°C (Matsui et at., 2010). The polymerase chain reaction (PCR) products were purified and taken to First Base Laboratories Sdn Bhd.,
Kuala Lumpur for direct sequencing using ABI 377 automatic sequencer.
Table 2: Primer paired used in this study. Primer sequence type amplified direction is indicated by heavy (H) or light (L) strand.
Type Primer sequences References Primer 16Sar-L 3'-CGCCTCCCGCTTAAAAACAT-5' Palumbi, S.R (1996).
Primer 16 Sb-H 5'-ATGTTTTTAAGCAAGAGGCG-3' Palumbi, S.R (1996).
13 3.3 Data Analysis
3.3.1 Molecular Phylogenetic Analyses
The chromatogram of DNA of each sample was observed using CHROMAS (version 2.24)
program. CLUSTAL X program was used to edit the DNA sequences, and completely
align the DNA Sequence. The initial alignments of each of samples were checked by eye
and adjusted slightly. The sequences were translated into amino acids sequences using
CLUSTAL X program.
Phylogenetic relationships were estimated by using maximum parsimony (MP), maximum
likelihood (ML) and neighbour joining (NJ) applied in MEGA 5 (Tamura et al., 2011).
Pair wise genetic distance was calculated by using kimura 2-parameter model (Kimura,
1980). MP trees obtained using MEGA 5 (Tamura et al., 2011), involved a search method
of Sub tree-Pruning-Regrafting (SPR), with complete deletion of missing data, and 10
by random addition replicates. ML analysis was performed MEGA 5 following the best fit
modal for 16S rRNA partition in ML which was GTR (Tavare, 1986) with a gamma shape parameter (G) of uniform rates and involved heuristic search method of Nearest-Neighbor-
Interchange (NNI). NJ analysis were involved kimura 2-parameter model include a substitutions of equal weighted of transitions and transversions at uniform rates, and gaps were treated as complete deletion. Strength of nodal support in MP analysis, ML analysis 1000 and NJ analysis used bootstrapping with replications. A bootstraps values of 70% or greater for MP, ML and NJ indicates a sufficient support to the phylogenetic confidence between (Huelsenbeck and Hillis, 1993) and those 50% and 70% was regarded as tendencies while 95% or greater were considered significant (Leache and Reeder, 2002;
Hamidy et al., 2011).
14 3.3.2 Morphometric analyses
The data analysis was extended by incorporating a multivariate morphometric analysis
using IMB SPSS statistic ver. 21 in Discriminant Factor Analysis (DFA) to distinguish the
species based on the morphological characters of Leptobrachium species. In this study,
total of 11 specimens of Leptobrachium species were measured using digital calliper to the
nearest 0.1 mm following Matsui (1984) for 21 morphometric characters (table 3).
Morphological measurements of species Leptobrachium were recorded and morphometric
analyses were done following Discriminant Function Analysis (DFA) with the stepwise
procedure using the software Statistical Package for Social Science (SPSS) version 21.0.
Measurement data of L. ingeri and L. kanowitense from Hamidy et al. (2012) was included
in this analysis. The DFA was carried out to analyse which best characters discriminate data between species and thus support the molecular analysis of genus Leptobrachium.
15 Table3. Morphometric characters of genus Leptobrachium based on Matsui (1984).
No Code Character
1 SVL Snout-to-vent length
2 HL Head length
3 SL Snout length
4 S-NL Snout to nostril length
5 N-EL Nostril to eye distance
6 EL Eye length
7 TEL Tympanic- eye length
8 TD Tympanum diameter
9 HW Head width Upper arm length
10 IND length Internarial distance (distance between nostril)
11 ICD Intercanthal distance (distance between eyes)
12 LAL Lower arm and hand length
13 3FL Third finger length
14 I FL First finger length
15 OPTL Outer palmar tubercle length
16 IPTL inner palmar tubercle length
17 HAL Hand length
18 TL Tibia length
19 FL Foot length
20 HLL Hindlimb length
21 IMTL Inner metatarsal tubercle length
16 CHAPTER 4
RESULTS
4.1 Molecular Analyses
4.1.1 DNA Extraction
A total of four samples consist of three Leptobrachium species were successfully extracted
following modified CTAB protocol (Cetyl Trimethyl Ammonium Bromide) (Grewe et al.,
1993). DNA extraction of five samples produce good band which sufficient to be used for
DNA amplification in Polymerase Chain Reaction. Gel visualisation of DNA bands are shown in Figure 2- 4. 4
2a) Gel DNA Extraction. (Lane I lkb DNA ladder, Figure 2: Left - photo of gel visualisation of - Lane 3 - Leptolalax hamidy (outgroup)). UE 167 L. nigrops, lane 4 - KNP 1036
17 DNA Extraction. (Lane I lkb DNA ladder, lane Figure 3: Gel photo of gel visualisation of - 2 - KNP1015 Alegophrys nasuta (outgroup), lane 3- KNP 1095 L. abbotti)
DNA Extraction. (Lane l lkb DNA ladder, Figure 4: Gel photo of gel visualisation of - lane 2 - RZ18 L. montanum, lane 3 - STB38 L. nigrops)
18 4.1.2 Polymerase Chain Reaction
All samples of DNA extraction were successful amplified and obtained result with
presence of DNA band in gel electrophoresis visualisation. Total of five successful DNA
extractions were amplified by using primer pair l6S-rRNA mitochondrial gene and
produce approximately 600bp in size. The successful PCR samples were taken to First
Base Laboratories Sdn Bhd., Kuala Lumpur for purification and direct sequencing. The
annealing temperature for genus Leptobrachium was found to be 50°C following Matsui et
al. (2010). Clear band formed were shown in Figure 5.
1 2 3 4 5 6 7 8 9 10 11
1- 100bp DNA ladder, Figure 5: Gel photo of gel visualisation of PCR. (Lane lane 2- UE167 L. nigrops, lane L. lane 5- RZ18 L. lane 3- STB38 L. nigrops, lane 4- KNP1095 abbotti, , montanum, 6- KNP1036 Leptolalax hamidy (outgroup), lane 7- KNP 1015 Megophrys nasuta (outgroup)).
19 4.2 Sequence Analysis
Sequence analyses of total of 10 individuals including two out-groups and four GenBank
data were successfully obtained. The aligned statistics for 16S rRNA gene fragment of
concatenate data of 16S rRNA mitochondrial gene with GenBank data yielded 1464 bp. Of
1464 nucleotide sites, 410 were variables, 1043 were conserved and 191 were
phylogenetically informative. Parsimony informative sites indicate that mitochondrial 16S
rRNA gene were good genetic marker to infer phylogeny of species within genus
Leptobrachium. From the sequence data, it is known that the highest nucleotide
frequencies in 16S rRNA of genus Leptobrachium were (A) adenine with average value of
33.7% followed by (T) thymine with 27.1 %, (C) cytosine with 21.5% and (G) guanine with
17.7%. High level of Adenine and Thymine indicate the properties of mtDNA that the
occurrence of mutational forces had generate the frequent shifted of adenine towards
thymine and vice versa (Jermiin et al., 1994). Percentage average nucleotide composition
for Leptobrachium was shown in table 4. Nucleotide frequencies of this finding were
consistence to previous study by Matsui et al. (2010) where the highest average value were
adenine (34.7%) followed by thymine (27%), cytosine (21%) and guanine (17.3%).
Table4. Nucleotide composition of the sequence and all frequencies are given in percentage.
T C A G KNP1095 Leptobrachium abbotti 29.1 20.4 29.8 20.7 RZ 18 Leptobrachium montanum 29.0 20.6 30.3 20.2 KUHE52150 Leptobrachium hendricksoni 27.6 20.5 35.6 16.3 KUHE15756 Leptobrachium hendricksoni 27.6 20.8 35.3 16.3 KUHE42590 Leptobrachium kanowitense 27.0 21.5 35.7 15.9 STB38 Leptobrachium nigrops 26.5 22.1 30.7 20.8 KUHE53834 Leptobrachium ingeri 26.8 21.2 35.9 16.1 UE 167 Leptobrachium nigrops 26.4 22.9 30.5 20.1 KNP1015 Megophrys nasuta 26.1 23.6 30.2 20.1 KNP 1036 Leptolalax hamidy 24.6 23.7 31.2 20.5 Avg. 27.1 21.5 33.7 17.7 *note: T= Thymine, C= Cytosine, A= Adenine, G= Guanine
20 4.2.1 Pairwise Genetic Distance
Analysis of pairwise genetic distance conducted using Kimura 2-parameter model produce
larger distance among species of Leptobrachium ranged from 0.000% to 13.3% within
species. Genetic distance in 16s rRNA within population is small (KUHE52150 L.
hendricksoni and KUHE15756 L. hendricksoni; 0.20%), however, higher genetic distance
between STB38 L. nigrops and UE167 L. nigrops with 10.1%.
Genetic distance produce between species were ranged between 6.7% and 13.3%
(KNP1095 L. abbotti vs RZ18 L. montanum; 0.067%, KNP1095 L. abbotti vs KUHE42590
L. kanowitense; 11.5%, KNP1095 L. abbotti vs KUHE52150 L. hendricksoni; 11.8%,
KNP1095 L. abbotti vs KUHE15756 L. hendricksoni; 12.0%, KNP1095 L. abbotti vs
UE167 L. nigrops; 11.8%, KNP1095 L. abbotti vs KUHE53834 L. ingeri; 13.3%, RZ18 L.
montanum vs KUHE42590 L. kanowitense; 12.8%, RZ18 L. montanum vs KUHE52150 L. hendricksoni; 0.107%, RZ 18 L. montanum vs KUHE15756 L. hendricksoni; 0.110%, RZ18
L. montanum vs UE167 L. nigrops; 12.5%, RZ18 L. montanum vs STB38 L. nigrops;
12.8%, RZ 18 L. montanum vs KUHE53834 L. ingeri; 12.8%, KUHE42590 L. kanowitense vs KUHE52150 L. Hendricksoni; 12.2%, KUHE42590 L. kanowitense vs KUHE15756 L. hendricksoni; 12.5%, KUHE42590 L. kanowitense vs UE167 L. nigrops; 0.4%,
KUHE42590 L. kanowitense vs STB38 L. nigrops; 10.6%, KUHE42590 L. kanowitense vs
KUHE53834 L. ingeri; 10.6%, KUHE52150 L. hendricksoni vs UE167 L. nigrops, STB38
L. nigrops and KUHE53834 L. ingeri; 12.2% respectively, KUHE15756 L. hendricksoni vs
STB38 L. nigrops and KUHE53834 L. ingeri; 12.5%, UE167 L. nigrops vs KUHE53834
L. ingeri; 10.1%).
21 However, smaller genetic distance was produced between STB38 L. nigrops and
KUHE53834 L. ingeri with genetic distance of 0.00%. Pairwise genetic distance of STB38
L. nigrops and UE167 L. nigrops were differs by large genetic distance (corrected p-
distance in 16S rRNA of 10.1%). Such genetic distance was far exceeding than those
usually observed among different species of frogs (Vences et a!. 2005; Fouquet et al.
2007).
Table 5. Pairwise genetic distance among species of genus Leplobrachium analysed based on Kimura 2- parameter modal. 1 2 3 4 5 6 7 8 9
I KNP1095 L. abbotti 2 RZ 18 L. montanum 0.067 3 KUHE52150 L. hendricksoni 0.118 0.107
4 KUHE 15756 L. hendricksoni 0.120 0.110 0.002
5 UE 167 L. nigrops 0.118 0.125 0.122 0.125 6 STB38 L. nigrops 0.133 0.128 0.122 0.125 0.101 7 KUHE42590 L. kanowitense 0.115 0.128 0.122 0.125 0.004 0.106 8 KUHE53834 L. ingeri 0.133 0.128 0.122 0.125 0.101 0.000 0.106
9 KNP1015 Megophrys nasuta 0.233 0.242 0.236 0.233 0.239 0.228 0.233 0.228 10 KNP1036 Leptolalax hamidy 0.250 0.268 0.282 0.278 0.262 0.259 0.256 0.259 0.237
22 4.3 Phylogenetic Analyses
All analyses data using own data and GenBank data resulted in similar topologies of all
tree analysis differ only in associations at poorly supported nodes. Overall tree analysis
produce sufficient bootstrap support of 70% or greater and bootstrap support between 50%
and 70% were produced recognized as tendencies. MP analysis yielded two most
parsimonious trees of 269 steps with consistency index of 0.743719 and a retention index of 0.741117. The ML analysis produces topologies with logL -1819.0182 and NJ analysis produced sum-branch length of 0.57509552.
Sets of relationship were inferred and presented in ML tree (Figure 6). Based on the tree constructed, Monophyly of genus Leptobrachium with respect to KNP1015 Megophrys nasuta and KNP 1036 Leptolalax hamidy was supported in all phylogenetic trees (NJ =
100%, MP = 100%, ML = 100%) were formed. The monophyletic group was divided into two main clades. Clade A consisted of species KNP1095 L. abbotti (Sarawak), RZ18 L. montanum (Sabah), KUHE52150 L. hendricksoni and KUHE15756 L. hendricksoni with bootstrap value in all phylogenetic tree (NJ = 72%, MP= 77%, ML =74%) and Glade B
kanowitense, consists of species of L. nigrops, L. and L. ingeri (NJ = 67%, MP = 58%, ML
= 72%).
23 Next, Clade A formed two monophyletic sister subclade with relationship of each other
formed were fully resolved. Subclade I consist of species L. abbotti and L. montanum bootstrap 97%=NJ, 90%=MP monophyletic group to each other with support of and L. hendricksoni 98%=ML and were sister Glade to monophyletic group of KUHE52150 from Malaysia (NJ 100%, MP 100%, ML and KUHE 15756 L. hendricksoni peninsular = = L. L.kanowitense, L. ingeri formed = 100%). In Glade B consist of species of nigrops, and L. L. kanowitense (NJ 100%, MP two monophyletic groups which are nigrops with = =
100%, ML = 100%) and L. nigrops with L.ingeri ((NJ = 100%, MP = 100%, ML = 100%).
24 KNP 1095 L. 97/90/98 I abbotti
RZ 18 L. montanum 72/77/74 Clade A
KUHE52150 L. hendricksoni
100/100/100 KUHE15756 L. hendricksoni 100/100/100
UE 167 L. nigrops
L KUHE42590 L. kanowitense 100/100/100 Clade B
67/58/72 STB38 L. nigrops
100/100/100 KUHE53834 L. ingeri
KNP 1015 Megophrys nasuta
KNP 1036 Leptolalax hamidy
ýrc
ý,ý
Figure6. Maximum likelihood (ML) phylogram tree of 1464 bp of 16S rRNA mitochondrial gene for samples in bold indicates data in Numbers branches of Leptobrachium. Data already genBank. above represent ML (NJ/MP/ML). bootstrap support for NJ, MP and
25 4.4 Morphological Analyses
Result of molecular analysis produced was contained ambiguities within the species such
as specimen of STB38 L. nigrops and UE167 L. nigrops split into two clades and formed
monophyletic group to L. ingeri and L. kanowitense. Therefore, morphological analysis
was conducted based on this grouping. Based on table 6, eigenvalue of functions I is
4601.560 with percentage of variance is 93.1% indicate that function I is the highest
variability of characters. Function 2 and function 3 has eigenvalue of 222.007 and 93.995
with 4.5 and 1.9 percent of variance respectively. Function 4 and function 5 show very low
eigenvalue indicate that it has low variability in characters.
Table 6. Eigenvalues of five functions in DFA
Function Eigenvalue % of Variance Cumulative % Canonical Correlation 1 4601.560 93.1 93.1 1.000 2 222.007' 4.5 97.6 .998 93.995 * 1.9 99.5 3 .995 21.388' 4 100.0 4 . .977 1.022' 0 100.0 5 . .711 *First five canonical discriminant functions were used-in the analysis.
Table 7 showed the significant test of DFA analysis based on wilks' lambda and p-value. function function The wilks' lambda for the test of I through 5 showed significant value of 0.000 with wilks' lambda value of 0.000.
Table 7. The wilks' lambda test of five functions. Test of Function(s) Wilks' Lambda Chi-square df Sig. I through 5 244.290 90 .000 .000 2 through 5 151.512 68 .000 .000 3 5 92.033 48 through .000 .000 5 41.941 30 4 through .022 .072 5 7.747 14 .494 .902
26 The result was supported by value in Standardized Canonical Discriminant Function
Coefficients. For function 1, the highest value is heavily loaded by characters of NEL (Nostril
to Eye Length) (15.817), SVL (Snout Vent Length) (14.041) and HW (Head Width) (15.214)
(table 8). It is suggested that the variables contribute in determine score in function 1.
Table 8. Standardized Canonical Discriminant Function Coefficients.
Function Characters 2 3 4 5 14.041 3.343 2.074 SVL -3.732 .035 3.039 2.520 5.335 HL -5.756 -1.931 1.711 SL -4.464 -1.823 -3.259 .042 1.774 SNL -10.730 -2.154 -2.062 .351 15.817 2.967 1.587 NEL .533 -.748 2.713 1.087 1.147 EL .189 -. 169 6.310 1.335 829 426 TEL -. -. -. 008
TD -9.646 -3.309 -1.521 .097 .401 15.214 020 976 HW -. -2.532 -. -. 125 1.189 300 IND .768 -. .727 .608 1.517 lCD -8.659 .542 -. 159 -. 185 7.616 1.211 2.613 LAL -1.827 .208 10.425 1.689 705 @3FL .984 -. .421 828 @IFL -9.682 -. -2.796 -2.734 1.216 2.303 1.887 OPTL -3.268 -3.505 .054 2.497 2.334 6.210 IPTL -4.246 .373 739 1.971 2.269 HAL -. -2.299 1.262 3.583 450 FL -26.353 .498 -. -. 406
27 Canonical Discriminant Functions ID 0 1 UE 167 L. nigrops (7)2 STB38 L. nigrops 1oo-1 3 RZ 18 L. montanum 04 KNP 1095 L. abbottt 5 KUHE53834 L. Ingeri C)6 KUHE42590 L. kanowitense N Group Cerkroid 50-1
4 N ý 3 C ý 0 z ý u o-1 5 c 3 6 LL. .
-50
-1oo-1
T -100 -50 0 50 100 Function 1
Figure 7. Canonical discriminant functions of function 1 and function 2 for morphometric measurement of genus Leptobrachium. ID 1= UE167 L. nigrops, ID 2= STB38 L. nigrops, ID 3= RZ18 L. montanum, ID 4= kanowitense. KNP1095 L. abbotti, ID 5= KUHE53834 L. ingeri, ID 6= KUHE42590 L.
28 CHAPTER 5
DISCUSSION
5.1 DNA extraction
In this study, five species of genus Leptobrachium were extracted following modified
CTAB protocol. DNA band were poorly formed with very intense band and some are fainted for most of sample. The almost smear band shows that the DNA product extracted contains total genome while for fainted band DNA product might be due to DNA degradation which cause only little DNA product yielded.
low A few reasons of contributes to DNA product contain total DNA and yields of DNA product. Volume of tissue minced taken for extracted were more than what suggested and dDH2O also the size of DNA pallet produce does not diluted with proper volume of causes the DNA product were in higher concentration. Besides, low yield of DNA product were lyses if it is left for long also contributed by over-lyses during incubation step. DNA might done frequently during DNA time duration. Thus, monitor during intubation should be extraction process. In addition, human error might also causes this problem whereas improper sterilisation causes contamination, poor preservation technique when preserving voucher tissue, improper handle of sample during DNA extraction process and transferring of chemical aliquot into tube cause other.
29 5.2 Polymerase Chain Reaction
In PCR process, specific annealing temperature for PCR is varies from different taxa. To
produce an accurate synthesis product, optimum parameter and concentration of
component is very crucial. Annealing temperature is the most critical phase because
synthesis product will result in the primers bind correctly to the target region in the
template (Palumbi, 1996). In this study, optimization was done in order to find a specific
annealing temperature. The optimum temperature for genus Leptobrachium was found to
be between ranges of 48-50°C following Matsui et al. (2010) Study by Ramlah (2009) had for shown annealing temperature of 50°C is optimum temperature amplification of using
mitochondrial genes of 16S rRNA. Both parameter were used and produce clear band of
DNA.
5.3 Phylogenetic Analyses
All phylogenetic trees constructed using NJ, MP, and ML analysis were successfully formed Glade of genus Leptobrachium (L. nigrops, L.hendricksoni, L.montanum and
L.abbotti) with respect to the outgroup Megophrys nasuta and Leptolalax hamidy with distance fully supported bootstraps value of 100%, and genetic of more than 22.8%.
Phylogeny tree constructed produced a clear separation between genus Leptobrachium
by Frost (2006), with respect to Leptolalax and Megophrys as reported et. al. genus
Leptobrachium was closed distant to genus Leptolalax and Megophrys within family as both genera formed monophyletic group to each other.
2001). L. L. abbotti and L. montanum are endemic to Borneo (Sengupta et al., montanum were once confused with L. gunungense as both are very similar in morphology, both 2002) differ without black and white pattern ventrally (Malkmus et al., and only 30 substantially in call characteristics (Malkmus 1996; Malkmus et al., 2002). In Glade A,
KNP 1095 L. abbotti (Sarawak, Kubah) formed monophyletic group to RZ 18 L. montanum
(sabah, Kinabalu Park) with bootstrap value of 72%= NJ, 77% = MP and 74% = ML, and
genetic distance of 6.7%. Topology produce were supported by previous study by Hamidy
et al., (2011), provided that tree in which both species (L.abbotti and L. montanum) show
topologies of genetically close to each other even though there are clear variance in
morphology of ventral colour pattern. Hamidy et al. (2012) had stated that their genetic
distance was higher compare to other species within genus Leptobrachium.
L. hendricksoni was known to be genetically distant from Bornean endemics (Matsui et al.,
2010b). In this study, KUHE52510 L. hendricksoni formed monophyletic group to
KUHE 15756 L. hendricksoni (locality of Malay Peninsular) with full bootstrap value of
100% for all phylogenetic tree and 0.4% genetic distance. Study by Matsui et al (2010) had
lower in verify the relationship of L. hendricksoni within population at peninsular was Sumatra. However, in genetic distance and related to population at this case, monophyletic Malay Peninsular) formed group of L. hendricksoni (locality of sister Glade to Borneo (L. L. in monophyletic group of endemic species of abbotti and montanum) Glade
A. Such taxonomy relationship is not expected. Study by Wogan. (2012) L. hendricksoni is
Sundaland L. Occurrence phylogenetically more closely related to species such as nigrops. from Thailand, of L. hendricksoni was explained northernmost through peninsular
Malaysia, Sumatra to Borneo (Berry, 1975). The separation of L. hendricksoni population
Borneo in northern Malay Peninsula, Sumatra and were expected to occur starting early
Pliocene in which Inger and Voris (2001) had shown disjunction of the Malay Peninsular from Borneo by the South China Sea occurred once about 5 MYBP. The age corresponded
be to date of intraspecific divergence (Matsui et al., 2010). This might reason to such
31 finding. However, it should be revised again by associate more data on species L.
hendricksoni from Borneo locality especially Sarawak to clarify their taxonomic
relationship.
Application of various molecular studies has detected presence of cryptic species within
taxon that difficult to differentiate (Hamidy et al., 2012). Study by Inger (1966), had notice
the presence of morphological variation of L. nigrops group nearly half a century ago and been also presence of high genetic divergence among populations never recognized until 2010b; Hamidy 2011). Recent recently (Brown et al. 2009; Matsui et al. et al. molecular Leptobrachium, known studies had detected presence of cryptic species within genus as L. (201 Ob) high nigrops (hamidy et al., 2012) only after Matsui et al. clarified the presence of from genetic divergence comparable to species level in L. nigrops Malay Peninsula,
Belitung and Borneo. Based on the tree constructed, Both species of UE167 L. nigrops and
STB38 L. nigrops was nested in different Glade whereas UE167 L. nigrops formed
(NJ: 100%, MP: 100%, ML: 100%, distance monophyletic group to L. kanowitense genetic formed L. ingeri (NJ: 100%, MP: = 0.04%) while STB38 L.nigrops monophyletic group to
100%, ML: 100%, genetic distance 0.00%).
distinct Based on molecular study, both species was suggested as species and recognized as (2012) had L. ingeri and L. kanowitense. Study by Hamidy et al. restricted species of L. Singapore, describe nigrops population from Malay Peninsular and and two new species from (L. ingeri and L. kanowitense). Both new species population were restricted Belitung
inland Sarawak In both and coastal area of Sarawak, and area of respectively. this study, from different locality Kota Samarahan, species of L. nigrops were taken which was
UNIMAS and Sarawak, Santubong. Both localities were located at inland and coastal area long-term between Borneo of Sarawak respectively. The continental connection and the
Malay Peninsula was once interrupted in the mid Miocene, 15 MYBP (Inger, 2005) might
32 have isolated Bornean L.nigrops from Malay Peninsula and Belitung population.
Preliminary suggestion on taxonomic status of STB38 L. nigrops, as L. ingeri should be
considered as same species as it is consistence with previous data by Hamidy et al. (2012).
Besides, sequence sample of L. ingeri used were taken from GenBank were previously
used in study by Hamidy et al. (2012) on detection of cryptic taxa in L. nigrops. Similar
locality of sequence sample chosen was used in this study. Additional data on
morphological and bioacoustics investigation are needed to clarify the taxonomic status of
these populations.
5.4 Morphological Analyses
Genus Leptobrachium is known as their higher genetic divergence and presence of
crypticity (Matsui et al. 2010; Hamidy et al. 2012). Morphologically, Inger and stuebing,
(1997) recognized L. abbotti from Lmontanum based on presence of heavily marked with
bold black and white mottling, while absent of white and black pattern ventrally in L.
Montanum (Malkmus et al., 2002). So as L. hendricksoni, presence of distinct black spots
iris discriminate on its venter and an orange coloured upper (sometimes whole) this species
from other (Taylor, 1962; Inger, 1966; Matsui et al., 1999; Mal onus et al., 2002; Matsui et al., 2010). Based on morphometric analysis, most samples of species L. montanum and L. abbotti shows similar charateristisc as describe by previous study. However, a few samples do not match to the description stated as the samples were preserved specimen and also the measurement of body size was changed. This is might be due to preservation process of
10% formalin and 70% alcohol. Jawad (2003) state that body proportion of preserved sample showed variable degrees of changes after standard period of preservation in various preservatives.
33 Berry and Hendrickson (1963) distinguished L. nigrops based on smaller adult body size and different shape of larval oral disk. However, Inger (1966) note differences in shape of finger tips. Hamidy et al. (2012) recognized L. ingeri from L. nigrops based on small body size with larger eyes, sharper finger tips and more distinct marking on dorsum and ventrum, while L. kanowitense were differ based on longer head with larger eyes, less developed toe webs, and narrowly pointed finger tips. In this study, the observed morphology data was match with description but not supported based on morphometric analysis using discriminant function analysis. Although it was successfully discriminate species within genus Leptobrachium into different group (Figure 7) and determine the best variable that discriminate those species and it is expected that STB38 L. nigrops formed group with L. ingeri and UE167 L. nigrops with L. kanowitnese. But none of it verified.
DFA result does not support the phylogenetic relationship between STB38 L. nigrops and
L. ingeri, and between UE167 L. nigrops and L. kanowitense. This is might be due to insufficient sample size and human error during measurement.
34 CHAPTER 6
CONCLUSION AND RECOMMENDATION
As conclusion, all species within the genus Leptobrachium of Sarawak formed sufficiently
resolved monophyletic group with respect to the outgroup Megophrys nasuta and
Leptolalax hamidy supported by values of more than 70% for all phylogenetic tree. In this
study has shown that mitochondrial ribosomal 16S gene is a good genetic marker to infer
phylogenetic relationship of species within genus Leptobrachium. However, inadequate
sample for species in Sarawak might be one of the hindrances during analysis of this study
being done. Thus, further study should be done extensively on this particular species by
associate variable types of molecular study such as include more than one genetic marker to infers phylogenetic trees in genus level study, also include bioacoustics study and morphometric analysis in order to provide a precise justification on taxonomic status of genus Leptobrachium. Besides, voucher tissue of species L. hendricksoni from Sarawak locality was none in Unimas Zoological Museum and also from Sarawak since the last found in year 1966 by Robert F. Inger. Thus, extensive sampling for this species is highly Leptobrachium recommended. This study is important to clarify taxonomic status of genus lineage in identification as such determination of their divergence and will aid proper of Leptobrachium Sarawak. species especially those species within genus that are endemic to
Such study will contribute in providing future references especially at local level.
35 REFERENCES
Berry P. Y (1975). The Amphibian Fauna of Peninsular Malaysia. Tropical Press, Kuala Lumpur.
Berry P. Y and Hendrickson, J. R. (1963). Leptobrachiwn nigrops, a New Pelobatid Frog from Malaya Peninsula, With Remarks on the Genus Leptobrachium in Southeastern Asia. Copeia, 643-648.
Brown, R. M., Siler, C. D., Diesmos, A. C. and Alcala, A. C. (2009). Philippine Frogs of the Genus Leptobrachium (Ahura; Megophryidae): Phylogeny-Based Species Delimitation, Taxonomic Review, and Descriptions of Three New Species. Herpetological Monograph, 23: 1-44.
Das, I. (2006). Crocker Range National Park, Sabah, As a Refuge for Borneo's Montane Herpetofauna. Amphibian and Reptile Conservation 4(1): 3-11. Doi: 10.1142/9789812813060_0002
Dubois, A. and Ohler, A. (1998). a New Species of Leptobrachiwn (Vibrissaphora) from Northern Vietnam, With a Review of the Taxonomy of the Genus Leptobrachium (Pelobatidae, Megophyinae) Dumerilia. Paris, 4: 1-32.
Frost, D. R. et al., (2006). The Amphibian Tree Of Life. Bulletin of the American Museum of Natural History 297: 1-370
Frost, Darrel R. (2014). Amphibian Species of the World: An Online Reference. Version 6.0 (Date of Access). Electronic Database Accessible At Http: //Research. Amnh. Org/Herpetology/Amphibia/index. Html. American Museum Of Natural History, New York, US
Grewe, P. M. et al., (1993). MitochondrialDNA VariationAmong Lake Trout (Salvelinus Namaycush) Strains Stocked Into Lake Ontario. Canadian Journal of Fisheries and Aquatic Sciences50 (11): 2397-2403
Haas, A. (2003). Phylogeny of Frogs as Inferred From Primarily Larval Characters (Amphibia: Anura). Cladistics 19: 23-90.
Hamidy A. et al., (2011). Morphological and Genetic Discordance in Two Species of Bornean Leptobrachium (Amphibia, Acura, Megophryidae). Molecular Phylogenetic and Evolution 61: 904-913
Hamidy, A., and M. Matsui. (2010). A New Species of Blue-Eyed Leptobracium (Anura: Megophryidae) From Sumatra, Indonesia. Zootara 2395: 34-44 Hamidy, A., and M. Matsui. (2014). A New Species of Leptobrachium from the Kelabut Highland, Northwestern Borneo (Anura, Megophryidae). Current Herpetology. Kyoto 33: 57-67.
36 Hamidy, A., Matsui, M., Nishikawa, K., and Belabut, D. M. (2012). Detection of Cryptic Taxa in Leptobrachium nigrops (Amphibia, Anura, Megophryidae) With Description of Two New Species. Zootaxa 3398: 22-39.
Huelsenbeck, J. P and Hillis, D. M. (1993). Success of Phylogenetic Method in Four taxon Case. Systematics Biology 42: 245-755.
Inger RF and Stuebing, R. B. (2009). New Species and New Records of Bornean Frogs (Amphibia: Anura), the Raffles Bulletin of Zoology 57(2): 527-535.
Inger, R. F and Voris, H. (2001). The Biogeographical Relations of the Frogs and Snakes of Sundaland. Journal of Biogeography, 28: 863-891.
Inger, R. F. and Stuebing, RB. (2005). A Field Guide to Frogs of Borneo. Natural History Publication (Borneo), 2: 1-29, 45: 65.
Inger, R. F. (1966). The Systematics and Zoogeography of the Amphibia of Borneo. Fieldiana Zoology, 52: 1- 402. Reprinted 1990, Lun Hung Trading Company, Kota Kinabalu.
Inger, R. F., Stuebing, RB and Tan, F-L. (1995). New Species and New Records of Anuran from Borneo. The Raffles Bulletin of Zoology 43: 115-131.
Kimura, M. (1980). A Simple Method for Estimating Evolutionary Rates of Base Substitutions through Comparative Studies of Nucleotide Sequences. Journal of Molecular Evolution. 16: 111-120.
Leache, A. D., and Reeder, T.W. (2002). Molecular Systematics Of Eastern Fence Lizard (Scleroporus Undulatus): A Comparison Parsimony, Likelihood And Bayesian Approaches. Systematics Biology. 51: 44-68.
Malkmus R. (1996). Leptobrachium Gunungense Sp. N (Anum: Pelobatidae) Vom Mount Kinabalu, Nord Borneo. Mitteilungen aus dem Zoologischen Museum in Berlin, 72: 297-301.
Malanus, R., Manthey, Y., Voge, G., Hoffman, P. and Kosuchh, J. (2002). Amphibians and Reptiles of Mount Kinabalu (North Borneo). ARG Gantner Verlag Kommanditgesellschaft, Ruggell.
Manly, B. F. J. (1994). Multivariate statistics: A Prime (Second Edition). London. Chapman and Hall.
Matsui, M. (1984). Morphometric variation analyses and revision of the Japanese toads (Genus Bufo, Bufonidae). Contributions from the Biological Laboratory, Kyoto University, 26:209-428. Matsui, M., Hamidy, A., Murphy, RM., Khonsue, W., Yambun, P., Shimada, T., Norhayati, A., Daicus, M. B. and Jiang, J. -P. (2010). Phylogenetic Relationships of Megophryid Frogs of the Genus Leptobrachium (Amphibia, Anura) As Revealed By Mtdna Gene Sequences. Molecular Phylogenetic and Evolution, 56, 259-272.
37 Matsui, M.J., Nabhitabhata, and Panha, S. (1999). On Leptobrachium from Thailand with a Description of a New Species (Anura: Pelobatidae). Japanese Journal of Herpetology / Hachü Ryöseiruigaku Zasshi 18: 19-29.
Ohler, A., Teynie, L.A., and David, P. (2004). A Green-Eyed Leptobrachium (Anura: Megophryidae) From Southern Laos. Raffles Bulletion of Zoology, 52: 695- 700.
Palumbi, S. R. (1996). Nucleic Acids II: The Polymerase Chain Reaction. In Molecular Systematics (Hillis, D. M., Moritz, C., Marble, B. K., Eds) Second Edition. Sinauer Associates, Massachusetts.
Poulsen, J. and French, A. (2004). Discriminant function analysis (DA). Retrieved May 23, 2014, from http://download. analysis3. com/DISCRIMINANT-FUNCTION- ANALYSIS-(DA)- download-w10. pdf.
Pugener L.A., Maglia A. M. and Trueb L. (2003). Revisiting the Contribution of Larval Characters to an Analysis of Phylogenetic Relationships of Basal Anurans. Zoological Journal of the Linnaean Society. 139: 129-155.
Ramlah, Z. (2009). Ecology and Molecular Phylogenetic Of Frogs from the Genus Rana Linnaeus 1758 in Sarawak. Faculty of Science and Technology, University Kebangsaan Malaysia Bangi. (Unpublished PhD Thesis).
Rao, D. Q. and Wilkinson, J. A. (2008). Phylogenetic Relationships Of The Mustache Toads Inferred From Mtdna Sequences. Molecular Phylogenetic of Evolution; 46: 61- 73.
Rohlf, F.J. (1990). Morphometrics. Annual Reviews of Ecology and Systematics 21:299- 316.
Sengupta, S., Choudhury, N. K., and Das I. (2001). Leptobrachium Smithi Matsui, Nabhitabhata and Panha, 1999 (Anum: Megophryidae), A New Record for India. Journal of Bombay National History Society, 98: 289-291.
Smith, G. R. (1990). Homology in morphometrics and phylogenetics. Pp. 326-338 in: F. J. Rohlf and F. L. Bookstein (eds. ), Proceedings of the Michigan Morphometrics Workshop. Spec. Publ. 2, The University of Michigan Museum of Zoology, Ann Arbor.
Tamura K. et al., (2011). MEGA5: Molecular Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology Evolution 29(10): 2731-2739. 2011 Doi: 10.1093/Molbev/Msr121, Advance Access Publication May 4, 2011.
Taylor, E.H. (1962). 11k Amphibian Fauna of Thailand. The University Of Kansas Science Bulletin, 43: 265-599.
38 Vences, M., Thomas, M., Meijden, A. V. D., Chiari, Y., and Vieites, D. R. (2005). Comparative Performance of the 16S rRNA Gene in DNA Barcoding of Amphibians. Frontiers in Zoology, 2: 5.
Wogan G. O. U. (2012). a New Species of Leptobrachium (Anura, Megophryidae) From Southern Laos. Zootaxa, 3415: 23-36.
J. (2008). A Phylogenetic Analysis Frog Genera Zheng, Y. -C., Li, S. -Q., and Fu, -Z. of the Vibrissaphora and Leptobrachium, and the Correlated Evolution of Nuptial Spine and Reversed Sexual Size Dimorphism. Molecular Phylogenetic. Evolution, 46: 695-707.
39 Appendix 1. List of all the alignment sequences
KNP1095 Leptobrachium abbotti ------[ 78] RZ18_Leptobrachium_montanum ------[ 781 KUHE52150_Leptobrachium hendri ATGTTTTCTGTCTAGCCTGATCACCC-ACCTACCTTCTATAGACCAACACATCCTC--TAAAACCAATAAAACATTCT [ 78] KUHE15756_Leptobrachium hendri ATGTTTTCTGTCTAGCCTGATCACCC-ACCCACCTTCTATAGACCAACACCTCCTC--TAAAACCAATAAAACATTCT ( 78] KUHE42590_Leptobrachium kanowi ATGTTTTCTATCTAGCCTAATAGCCC-AATAGCCCAACA-ATTCTATTTCTTCCTACATATAACCAATAAAACATTCA ( 78] STB38_Leptobrachium_nigrops ------[ 78) KUHE53834_Leptobrachium_ingeri ATGTTTTCTATCTAGCCTAACAACCCCAACCGCCTACCAAACACT----CACCTTC-----AACCAATAAAACATTTA ( 78] UE167_Leptobrachium_nigrops ------( 78] KNP1015_Megophrys_nasuta ------[ 78] KNP1036 Leptolalax hamidy ------( 78]
KNP1095_Leptobrachium_abbotti ------[ 156] RZ18_Leptobrachium_montanum ------[ 156] KUHE52150_Leptobrachium_hendri TAATATTAAGTATATGCGTTAAAAAAATATTC--AGAGCAATAGCAAAAGTACCGTAAGGGAAAGATGAAATAGAAAT ( 156] KUHE15756_Leptobrachium_hendri TAATATTAAGTATATGCGTTAAAAAAATACTC--AGAGCAATAGCAAAAGTACCGTAAGGGAAAGATGAAATAGAAAT 1 156] KUHE42590_Leptobrachium_kanowi CCATACCTAGTATATGAGATAAAAATGTACCCTAAGAGCTATAATTTA-GTACCGTAAGGGAAAGATGAAATA--AAT [ 156] STB38_Leptobrachium_nigrops ------( 156] KUHE53834_Leptobrachium_ingeri TTTTACTAAGTATATGAGATAAAAAAGTATAAT-AGAGCTTTAAAATA-GTACCGTAAGGGAAAGATGAAATA--AAT [ 156] UE167_Leptobrachium_nigrops ------( 156] KNP1015_Megophrys_nasuta ------[ 156] KNP1036 Lepto1a1ax_hamidy ------[ 156]
KNP1095_Leptobrachium_abbotti ------( 2341 RZ18_Leptobrachium_montanum ------[ 234] KUHE52150_Leptobrachium_hendri GAAACAGCTTAAAACACTAAAAAACAGAGATAAAACCTTGTACCTTTTGCATCATGGCCTAACAAGTCTAATCAGGCA ( 234] KUHE15756_Leptobrachium_hendri GAAACAGCTTAAAACACTAAAAAACAGAGATAAAACCTTGTACCTTTTGCATCATGGCCTAACAAGTCTAATCAGGCA ( 234] KUHE42590_Leptobrachium_kanowi GAAACATTTTAAAACACATAAAAGCAGAGATTTCTCCTTATACCTTTTGCATCATGGCCTAACAAGTCTAATCAGGCA [ 234] STB38_Leptobrachium_nigrops ------[ 234] KUHE53834_Leptobrachium_ingeri GAAACATTTAAAAACATTAAATAGCAGAGACCTTAACTCGTACCTTTTGCATCATGGCCTAACAAGTCCAATCAGGCA ( 234] UE167_Leptobrachium_nigrops ------( 234] KNP1015_Megophrys_nasuta ------( 234) KNP1036 Leptolalax hamidy ------( 234]
KNP1095_Leptobrachium_abbotti ------( 312] RZ18_Leptobrachium_montanum ------[ 312] KUHE52150_Leptobrachium hendri AAACGAATTTTAGTCTGACCTCCCGAAACTAAGTGAGCTACTCCGGGGCTGCTTCATGTTTAACCCGTCTCTGTAGCA [ 312] KUHE15756_Leptobrachium hendri AAACGAATTTTAGTCTGACCTCCCGAAACTAAGTGAGCTACTCCGGGGCTGCTTCATGTTTAACCCGTCTCTGTAGCA [ 312] KUHE42590_Leptobrachium kanowi AAACGAATTTTAGTCTGACTTCCCGAAACTAAGTGAGCTACTCCAGGGCTACTTTGTA---AACCCGTCTCTGTTGCA [ 312] STB38_Leptobrachium_nigrops ------( 312] KUHE53834_Leptobrachium inqeri AAACGAATTTAAGTCTGACCCCCCGAAACTAAGTGAGCTACTCCGGGGCTACTAAATGTA-AGCCCGTCTCTGTCGCA [ 312]
40 UE167_Leptobrachium_nigrops ------( 312) KNP1015_Megophrys_na3uta ------[ 312] KNP1036 Leptolalax_hamidy ------[ 312]
KNP1095 Leptobrachium abbotti ------( 390] RZ18_Leptobrachium montanum ------( 390] KUHE52150_Leptobrachium hendri AAAGAGTGGGAAGACCCCCGAGTAGAGGCAAAAAACCTATCGAACTTAGTAATAGCTGGTTGCTTAGGAAAAGGATTT [ 390) KUHE15756_Leptobrachium hendri AAAGAGTGGGAAGACCCCCGAGTA CCTATCGAACTTAGTAATAGCTGGTTGCTTAGGAAAAGGATTT [ 390] KUHE42590_Leptobrachiumkanowi AAAGAGTGGGCAGACCCTCGAGTAGAGGCGAAAAACCTACCGAACTTAGTAATAGCTGGTTGTTTAGGAAAAGGATTT ( 3901 STB38_Leptobrachium_nigrops ------[ 390] KUHE53834_Leptobrachium_ingeri AAAGAGTGGACAGACCCCTGAGTAGAGGCGAAAAACCTATCGAACTTAGTAATAGCTGGTTGCTTAGGAAAAGGATTT [ 390] UE167_Leptobrachium_nigrops ------[ 390] KNP1015_Megophrys_nasuta ------( 390] KNP1036 Leptolalax_hamidy ------( 390]
KNP1095_Leptobrachium_abbotti ------( 4681 RZ18_Leptobrachium_montanum ------[ 468] KUHE52150_Leptobrachium hendri AAGTTCTTTCTTAAAAATTCTCAAGCAAA---GCCAAGCAAACCTAATTTTTAAGAATTATTCAATAAAGGTACAGCT [ 468) KUHE15756_Leptobrachium_hendri AAGTTCTTTCTTAAAAATTCTCAAGCAAA---GCCAAGCAAACCTAATTTTTAAGAATTATTCAATAAAGGTACAGCT ( 4681 KUHE42590_Leptobrachium_kanowi AAGTTCTTTCTTAAAATACCCTTAGCAATTT-ACCAAGCAAACCTAATTTTTAAGAACTATTCAATAAGGGTACAGCT ( 468] STB38_Leptobrachium nigrops ------( 468] KUHE53834_Leptobrachium_ingeri TAGTTCTTTCTTAAAAATACCTTATCACCTCATCCAAGAGAGCCTTATTTTTAAGAATTATTCAATAAAGGTACAGCT ( 4681 UE167_Leptobrachium_nigrops ------[ 468] KNP1015_Megophrys_nasuta ------[ 468] KNP1036 Leptolalax hamidy ------( 468]
KNP1095_Leptobrachium_abbotti ------( 546] RZ18_Leptobrachium_montanum ------( 5461 KUHE52150_Leptobrachium hendri TTATTGAAGAAGGAAACAGCCTAAACCTTGGGATAATGAATATTTTTGAACAGGTAA-AAGGTTAAGTTGGCCTAAAA [ 546) KUHE15756_Leptobrachium hendri TTATTGAAGAAGGAAACAGCCTAAACCTTAGGATAATGAATATTTTTGAACAGGTAA-AAGGCTAAGTTGGCCTAAAA ( 546) KUHE42590_Leptobrachium_kanowi TTATTGAAAAAGGAGACAGCCTAAACCTTAGGATAATGATTAAACGACTCCAGAAAGTAAGGCTTAGTCGGCCTAAAA ( 546) STB38_Leptobrachium_nigrops ------( 546) KUHE53834_Leptobrachium ingeri TTATTGAAGAAGGAAACAGCCTAAACCTTTGGATAATGATTATAACACCCAAGGAAATTAAGACTAGTCGGCCTAAAA ( 546] UE167_Leptobrachium_nigrops ------[ 546] KNP1015_Megophrys_nasuta ------( 546] KNP1036 Leptolalax_hamidy ------[ 546]
KNP1095 Leptobrachium abbotti ------[ 624] RZ18_Leptobrachium_montanum ------[ 624] KUHE52150_Leptobrachium hendri GCAGCCACCTTTAAGATAGCGTCAAAGCTTCACCTCA-TATACACCTTAAATCTCATTACTTTCTCATAATCCGACAA ( 6241 KUHE15756_Leptobrachium hendri GCAGCCACCTTTAAGATAGCGTCAAAGCTTCACCTCA-TATTCACCTTAAATCTCATTACTTTCTCATAATCCGACAA [ 624) KUHE42590_Leptobrachium kanowi GCAGCCATCTCTAAA--AGCGTCAAAGCTTCACCTCA-CCCATTCCCTAA-TCCCATAATTCTATCAAAATCCATATT ( 624) STB38 Leptobrachium nigrops ------( 624] 41 KUHE53834_Leptobrachium_ingeri GCAGCCACCTTCAAT--AGCGGCAAAGCTTCACCTCAATCTCCTCCCTTAATCCCACTAAAATATCAAAATCCAATAC [ 624] UE167_Leptobrachium_nigrops ------[ 624] KNP1015_Megophrya_nasuta ------( 624] KNP1036 Leptolalax_hamidy ------[ 624]
KNP1095_Leptobrachium_abbotti ------[ 7021 RZ18_Leptobrachium_montanum ------( 702] KUHE52150_Leptobrachium hendri TTCTACTAAGCTATTCTATACTTTTATAGAAAAATTTATGTTAGGACTAGTAACACAGAATTATTTCTCTTACATGTA [ 7021 KUHE15756_Leptobrachium_hendri TTCTACTAAGCTATTCTATACTTTTATAGAAAAATTTATGTTAGGACTAGTAACACAGAATTATTTCTCTTACATGTA [ 702] KUHE42590_Leptobrachium_kanowi TACTACTAAACTATTCTATATTATTATAGAAGAATTTATGTTAGGACPAGTAACAAAGAACAACTTCTCTTATATATA [ 702] STB38_Leptobrachium_nigrops ------[ 702] KUHE53834_Leptobrachium_ingeri TACTACTAAGCCATTCTATAATTTTATAGAAGAATTTATGTTAGGATTAGTAACAAAGAATAATTTCTCTTATATATA [ 7021 UE167_Leptobrachium_nigrops ------[ 702] KNP1015 Megophrys_nasuta ------[ 7021 KNP1036 Leptolalax_hamidy ------[ 702]
KNP1095_Leptobrachium_abbotti ------[ 780] RZ18_Leptobrachium_montanum ------[ 780] KUHE52150_Leptobrachium_hendri AGTTTAAATCAACCCGAATACCTCCTTGATAATTATTCAAATTTGAACCTTAAGTAGTACCTCTACCCC-TTACAAAA [ 780] KUHE15756_Leptobrachiumhendri AGTTTAAATCAACCCGAATACCTCCTTGATAATTATTCAAATTTGAACCTTAAGTAGTACCTCTACCCCCTTACAAAA [ 7801 KUHE42590 Leptobrachium__kanowi AGTTTAAATCAGCTTGAATACCTCCCTGATAATTATTCAACCTTGAACCCGAAGTAACACCAC----CTATTTCAAAA ( 7801 ST838_Leptobrachium_nigrops ------[ 780] KUHE53834_Leptobrachium_ingeri AGTTTAAATCAGCTCGAATACCTCCCTGATAGTTAATCAACCCTGAATTCATAGTAATAACTTCTCCCC-CTCCAAAA [ 780] UE167_Leptobrachium_nigrops ------( 7801 KNP1015_Megophrys_nasuta ------( 7801 KNP1036 Leptolalax hamidy ------[ 780]
KNP1095 Leptobrachium abbotti ------[ 858] RZ18_Leptobrachium_montanum ------1 858] KUHE52150_Leptobrachium hendri ACCCTACTTAACTTATTGTTAATCAAACATATGGGCATGAAAGAAAGATTAAAAAATTAAGAAGGAACTCGGCAAACA [ 8581 KUHE15756_Leptobrachium_hendri ACCCTACTTAACTTATTGTTAATCAAACATATGGGCATGAAAGAAAGATTAAAAAATTAAGAAGGAACTCGGCAAACA [ 858] KUHE42590_Leptobrachium_kanowi ACCCTACTAGAATCATTGTTAATCAGACAAATGAGTATAAAAGAAAGATAAAAAGATCAAGAAGGAATTCGGCAAACA [ 8581 STB38_Leptobrachium_nigrops ------[ 858) KUHE53834_Leptobrachium_ingeri ACCCTACTTTAATAATTGTTAATCAAACACATGAATATAAAAGAAAGATGAAAAAATTAAGAAGGAACTCGGCAAACA [ 858] UE167_Leptobrachium_nigrops ------( 858] KNP1015 Megophrys_nasuta ------( 858] KNP1036 Leptolalax_hamidy ------[ 858]
KNP1095 Leptobrachium abbotti ------GCCCTTGATTATAAACGGTACGCCTGCC-AGTGACG-TATGTTAA [ 936] RZ18_Leptobrachium_montanum ------...... -...... A-...... C. [ 936] KUHE52150 Leptobrachium hendri CAAGTCCCGCCTGTTTACCAAAAACATCGCCTTTTGAA. A.. ATA... G. TA...... C. C.... AA...... [ 936] KUHE15756_Leptobrachium_hendri CAAGTCCCGCCTGTTTACCAAAAACATCGCCTTTTGAA. A.. ATA... G. TA...... C. C.... AA...... [ 936] KUHE42590 Leptobrachium kanowi CAAATCCCGCCTGTTTACCAAAAACATCGCCTTTTGAAAT.. ATA... G. TA...... C. A.... A-C...... [ 936] 42 STB38_Leptobrachium_nigrops ------G...... TC...... C. ( 936] KUHE53834_Leptobrachium_ingeri CAAATCTCGCCTGTTTACCAAAAACATCGCCTTTTGAAAA.. ATA... G. TA...... C...... TC...... C. [ 936) UE167 Leptobrachium nigrops ------...... A.... A-C...... [ 936] KNP1015_Megophrys_nasuta ------C. T... TAG...... T...... CA. G.... C. [ 936] KNP1036 Leptolalax_hamidy ------G.. C. TGA. T. G. CT...... A...... AA..... T. [ 936]
KNP1095_Leptobrachium abbotti ACGGCCGCGGTATTCTGACCGTGCAAAGGTAGCGTAATCACTTGTCTTTTAAATGAAGACTAGTATGAATGGCATCAC [1014] RZ18_Leptobrachium_montanum ...... G...... T...... A...... T...... [1014] KUHE52150_Leptobrachiumhendri T ...... G...... C...... A...... (1014] KUHE15756_Leptobrachium__hendri T ...... G...... C...... A...... (1014) KUHE42590_Leptobrachium_kanowi ...... C.. A...... G...... A...... [1014] STB38_Leptobrachium_nigrops ...... C...... C.. G...... T...... G.... CT...... A..... T.. (1014] KUHE53834_Leptobrachium_ingeri ...... C...... C.. G...... T...... G.... CT...... A..... T.. [1014] UE167_Leptobrachium_nigrops ...... C.. A...... G...... T...... A...... [1014] KNP1015_Megophrys_nasuta A..... T. A.... C.. G ...... T.. C..... A...... C... CA... (1014] FO!iP1036 Leptolalax_hamidy T...... T...... A ...... C..... A...... C.... AA.. (1014]
KNP1095_Leptobrachium_abbotti GAGGACTTAACTGTCTCCCTAATTTAATCAGTGAAACTGATCTTCCCGTGAAAAAGCGGGAGTAATCTCATAAGACGA [1092) RZ18_Leptobrachium montanum ...... T...... A... A. TT...... [1092] KUHE52150_Leptobrachium hendri ... A..... G...... T ...... CC.. T.. A...... A... A. G. C. A...... (1092] KUHE15756_Leptobrachium_hendri A..... G...... T...... C ...... CC.. T.. A...... A... A. G. C. A...... [1092] KUHE42590_Leptobrachium_kanowi ...... T..... C...... C...... C...... A.. TAA...... (1092] STB38_Leptobrachium_nigrops T...... T ...... T..... CC...... A... AGC...... [1092] KUHE53834_Leptobrachium_ingeri T ...... T ...... T..... CC...... A... AGC...... [1092] UE167_Leptobrachium_nigrops ...... T..... C...... C...... C...... A.. TAA...... [1092] KNP1015_Megophrys_nasuta ...... T. T.. C...... CC...... C. G...... GA... CAC...... (1092] KNP1036 Leptolalax hamidy ...... A...... G.. C...... T. A...... C. G...... GA... CA...... (1092]
KNP1095_Leptobrachium_abbotti GAAGACCCTATGGAGCTTTAAACTAAAAGCTAATTGTATTATCTGCCAAATTAAATGTCACTAATTTT--ACAAGTTT [1170] RZ18_Leptobrachium_montanum ...... A...... A.... C..... A...... A...... CA. ---... G.... (1170] KUHE52150_Leptobrachium_hendri ...... AT...... C.. C... AC... A. T.. --. TT.. AGT.... TAA...... ACC. (1170] KUHE15756_Leptobrachium_hendri ...... AT...... C.. C... AC... A. T.. --. CT.. AGT.... TAA...... ACC. [1170] KUHE42590_Leptobrachium_kanowi A...... G ...... CC-.. A... C... A. CA. --CA.. T. --. T. T. A. TCG..... G...... CC. (1170] STB38_Leptobrachium_nigrops ...... A.... CTC.. A... C...... A. C..... T. --. T.. CAAGCACT. AAG...... ACC. [1170] KUHE53834_Leptobrachium_ingeri ...... A.... CTC.. A... C...... A. C..... T. --. T.. CAAGCACT. AAG---.... ACC. [1170) UE167_Leptobrachium_nigrops A...... G ...... CT-.. A... C... A. CA. --CA.. T. --. T. TCA. TCG..... G...... CC. (1170] KNP1015_Megophrys_nasuta CC... CTA. C...... A000.. C. TAAA. CTC. A.. GA. C.. AC. CA... AGGT. GTA.. [1170] KNP1036 Leptolalax hamidy ...... G...... C... A. C.. TATC..... C.. CC. TCA.. CCC------CACGCA------CA. G [1170]
KNP1095_Leptobrachium_abbotti GGCCTAAGTTTTTTGTTGGGGCGACTGTGGAGAAAAACTAATCCTCCATGAA-A-T---ATACCTTGAGTTACCACTC [1248] RZ18_Leptobrachium_montanum A ...... A...... C. CT...... A...... T...... G... [1248] KUHE52150_Leptobrachium hendri A...... C...... G ...... T...... G. AA---. A.. T.... TC.... G... [1248] KUHE15756_Leptobrachium hendri A...... C...... G ...... T...... G. AA---. A.. T.... TC.... G... [1248] 43 KUHE42590_Leptobrachium_kanowi A...... CC ...... C...... G. A. ---. A.. T...... (1248] STB38_Leptobrachium_nigrops A. TT C ...... T ...... G. A. ---. A.. T. A... C...... C. [1248] KUHE53834_Leptobrachium_ingeri A. TT ...... C ...... T ...... G. A. ---. A.. T. A... C...... C. [1248] UE167_Leptobrachium_nigrops A...... CC ...... C...... G. A. ---. A.. T...... [1248] KNP1015_Megophrys_nasuta AA. T. TG..... GG...... CA.. A...... T. A... T. C... TG. T. TAT. A.. TAA...... A.... [1248] KNP1036_Leptolalax_hamidy AT. T. G. T.... CA. C..... T. G.. A...... AC...... G. AC-AC. ACTAAGATAAC.. TC... (1248]
KNP1095_Leptobrachium_abbotti TTAGTATTAGCAGGCCTAATTTTAATTGATCCAATCTTTGATCAACGGACCAAGTTACCCTAGGGATAACAGCGCAAT [1326] RZ18_Leptobrachium_montanum ...... A...... A ...... (1326] KUHE52150_Leptobrachium_hendri A...... C.. A...... T ...... (1326] KUHE15756 Leptobrachium hendri A...... C.. A...... T ...... [1326] KUHE42590_Leptobrachium_kanowi AGC...... T. AA...... C ...... C.. [1326] STB38_Leptobrachium_nigrops A...... AA...... T. C ...... T.. [1326] KUHE53834_Leptobrachium ingeri A...... T. AA..... C ...... T. [1326] UE167_Leptobrachium_nigrops AGC...... )LA...... T. C ...... C.. [1326] KNP1015_Megophrys_nasuta A...... AG. CT. T... CC.. C..... C... C. T. G... C...... A ...... [1326] KNP1036 Leptolalax hamidy AG.. T... AT. AA. T... C.. A...... C.... C. . A ...... C ...... [1326)
KNP1095_Leptobrachium_abbotti CCATTTCAAGAGTTCATATCGACAAATGGGTTTACGACCTCGATGTTGGATTAGGATATCCTAGTGGTGCAGCCGCTA (1404] RZ18_Leptobrachium_montanum C. C ...... T ...... [1404] KUHE52150_Leptobrachium_hendri C. C C...... T...... [1404] KUHE15756_Leptobrachium_hendri ...... C. C C T [1404] KUHE42590 Leptobrachium ...... kanowi ...... C. C C T [1404] STB38_Leptobrachium_nigrops ...... C. C...... C...... A...... [1404] KUHE53834_Leptobrachium_ingeri ...... C. C...... C...... A...... [1404] UE167_Leptobrachium_nigrops ...... C. C...... C...... T...... (1404] KNP1015_Megophrys_nasuta ...... C. T...... C... GC. C.. A...... A...... (1404) KNP1036_Leptolalax_hamidy C... T..... C...... G...... C ...... GC. C.. A...... A.. AT.. (1404)
KNP1095_Leptobrachium_abbotti CTAACGGTTCGTTTGTTCAACGATTAAAATCCTACGTGATCTGAGTCCAGACCGGA---- [1464] RZ18_Leptobrachium_montanum .... T ...... G...... T...... ---- (1464] KUHE52150_Leptobrachium hendri .... T------(1464] KUHE15756_Leptobrachium_hendri T ...... G------[1464] KUHE42590_Leptobrachium_kanowi ..... ------[1464] STB38_Leptobrachium_nigrops T ...... G...... T...... CCGGA-- [1464] KUHE53834 Leptobrachium_ingeri .... T ...... G. ------(1464) UE167_Leptobrachium_nigrops ...... G T CCGGA (1464] KNP1015_Megophrys_nasuta ...... A ...... GC...... (1464] KNP1036_Leptolalax_hamidy .... A ...... GC...... [1464]
44