Characterisation of Frontotemporal Lobar Degeneration with Motor Neuron Disease
Agnes Anna Luty
A thesis submitted for the degree of Doctor of Philosophy in the Faculty of Medicine, University of New South Wales and Neuroscience Research Australia
2010 ORIGINALITY STATEMENT
‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’
Signed ……………………………………………......
Date ………………………………………………......
ii COPYRIGHT STATEMENT
‘I hereby grant the University of New South Wales or its agents the right to archive and to make available my thesis or dissertation in whole or part in the University libraries in all forms of media, now or here after known, subject to the provisions of the Copyright Act 1968. I retain all proprietary rights, such as patent rights. I also retain the right to use in future works (such as articles or books) all or part of this thesis or dissertation. I also authorise University Microfilms to use the 350 word abstract of my thesis in Dissertation Abstract International. I have either used no substantial portions of copyright material in my thesis or I have obtained permission to use copyright material; where permission has not been granted I have applied/will apply for a partial restriction of the digital copy of my thesis or dissertation.'
Signed ……………………………………………......
Date ……………………………………………......
AUTHENTICITY STATEMENT
‘I certify that the Library deposit digital copy is a direct equivalent of the final officially approved version of my thesis. No emendation of content has occurred and if there are any minor variations in formatting, they are the result of the conversion to digital format.’
Signed ……………………………………………......
Date ……………………………………………......
iii December 17, 2010
Supervisor Certification
This is to certify that as primary supervisor I have confirmed that all co-authors of the following published or submitted papers agree to Agnes Luty submitting these papers as part of her doctoral thesis. Furthermore, with the exception of Dr Clement Loy, none of the co-authors has, or intends to submit, any of the work covered by these papers as part of a separate thesis. Dr Loy intends to submit the work as part of his PhD thesis. Dr Loy's work involved the recruitment and clinical assessment of the families examined in this study, whereas Agnes Luty contributions to these two papers included the practical details of experimental design, the majority of the laboratory experimental work and data analysis and the drafting of the manuscripts.
With regard to the contents of the submitted manuscript, I certify that in my professional opinion the work is complete and is of a standard and significance that it is highly likely to be accepted for publication in the journal Brain.
Luty AA, Kwok JB, Thompson EM, Blumbergs P, Brooks WS, Short CL, Field CD, Panegyres PK, Hecker J, Blair IP, Halliday GM, Schofield PR. Corticobasal pathology in a large FTD-MND family with suggestive linkage to chromosome 15q21-q23 (Undergoing revisions following submission to Brain).
Luty AA, Kwok JB, Thompson EM, Blumbergs P, Brooks WS, Loy CT, Dobson-Stone C, Panegyres PK, Hecker J, Nicholson GA, Halliday GM, Schofield PR. Pedigree with frontotemporal lobar degeneration-motor neuron disease and Tar DNA binding protein-43 positive neuropathology: genetic linkage to chromosome 9. BMC Neurol. 2008; 8: 32.
Luty AA, Kwok JB, Dobson-Stone C, Loy CT, Coupland KG, Karlström H, Sobow T, Tchorzewska J, Maruszak A, Barcikowska M, Panegyres PK, Zekanowski C, Brooks WS, Williams KL, Blair IP, Mather KA, Sachdev PS, Halliday GM, Schofield PR. Sigma nonopioid intracellular receptor 1 mutations cause frontotemporal lobar degeneration-motor neuron disease. Ann Neurol. 2010; 68: 639-49.
Yours Sincerely,
Professor Peter R Schofield
iv Declaration of contributions to publications
As first author, my contribution to the three papers included in this thesis involved the practical experimental design, undertaking the majority of experimental work and data analyses and writing of the first draft of the manuscripts.
The overall concept design for each study as well as practical supervision and advice was provided by my PhD supervisors PR Schofield and JB Kwok.
The pedigrees, disease and control cohorts were collected and assessed by EM Thompson, WS Brooks, CD Field, PK Panegyres, CT Loy, CL Short and J Hecker. GA Nicholson provided the MND cohort; J Tchorzewska, A Maruszak, T Sobow, M Barcikowska, C Zekanowski provided the Polish cohorts; and KM Mather and PS Sachdev provided the Memory and Ageing Study (MAS) cohort.
P Blumbergs and GM Halliday provided expertise in diagnosis and interpretation of the neuropathological findings.
For the manuscript submitted to Brain, I conducted the majority of the experimental work and linkage analysis, with clinical and neuropathological inputs as detailed above.
For the paper published in BMC Neurology, I conducted the majority of the experimental work and linkage analysis, with clinical and neuropathological contributions detailed above. Sequencing of MND genes was carried out by KL Williams and IP Blair.
For the paper published in Annals of Neurology, I carried out the mutation screen of candidate genes and identified the SIGMAR1 mutation. I screened the Sydney Older Person Study cohort, familial presenile dementia cohort and the Polish presenile dementia cohorts for SIGMAR1 mutations. I conducted the TDP-43 and sigma-1 receptor immunohistochemistry and double immunofluorescence. I did the quantification of sigma-1 receptor and TDP-43 transcript levels. Primer design and construct generation was carried out with advice and assistance from H Karlström. Cell culture and brain tissue analyses were conducted by C Dobson-Stone. KG Coupland conducted the
v microRNA experiment. KL Williams and IP Blair sequenced SIMGAR1 in MND and control cohorts. Clinical and neuropathological contributions are as detailed above.
vi ACKNOWLEDGEMENTS
Foremost, I would like to thank my supervisors Peter Schofield and John Kwok for the opportunity to work on this incredible project. I can’t thank them enough for their constant support, encouragement and patience especially over the last few years.
A sincere thank you to Glenda Halliday for her invaluable advice and assistance with the project. I would also like to extend a special thank you to Helena Karlström for all her guidance and support in and out of the lab during my stay in Sweden. Many thanks to Bill Brooks for his assistance with the clinical aspect of the project.
A huge thank you to all the members of the lab, especially Marianne Hallupp who has helped me out with countless experiments and has always been a great friend. Ian, Kerrie, Clement and Carol, thank you for always providing a helping hand when needed most.
Dom, Lottie, Erica, Rushie, Jen, Connie and Paris - thank you for your support, friendship, many fond memories and the laughs that we’ve shared.
Most importantly, many thanks to my family, Mum, Dad and Annette for being the inspiration that I needed to get through an otherwise arduous journey. Mr and Mrs Dengate, thank you for being my extended family and for all your support.
Finally, I would like to thank Chris who has been incredibly patient and has stood by me every step of the way. I could not have done this without him.
vii Abstract
Frontotemporal lobar degeneration (FTLD) is the second most common cause of early-onset dementia after Alzheimer’s disease (AD). It is a clinically, neuropathologically and genetically heterogeneous syndrome. With the exception of mutations in the MAPT, GRN, VCP and CHMP2B genes, the aetiology of FTLD remains largely unknown and to date no effective treatments exist. In two families with FTLD and motor neuron disease (MND), immunohistochemical analysis revealed two quite distinct neuropathologies. To identify the genes involved in the pathogenesis of FTLD-MND, linkage analysis was carried out. Family Aus-12 failed to show significant linkage to any known genetic locus but showed suggestive linkage to chromosome 15. These findings together with the unusual pathology of a combined tauopathy and TDP-43 proteinopathy suggest that this family represents a novel genetic form of FTLD-MND. A genome-wide linkage analysis of family Aus-14, which shows a concomitant TDP-43 and FUS pathology, revealed a significant association to chromosome 9p where most FTLD-MND families show linkage. A positional candidate gene analysis led to the identification of a single nucleotide change (c.672*51G>T) in the 3’ untranslated region of the sigma-1 receptor gene (SIGMAR1). Its non-polymorphic nature was verified using multiple control cohorts. A SIGMAR1 mutation screen conducted in Australian FTLD probands and two Polish presenile dementia cohorts identified two more presumptive mutations (c.672*26C>T and c.672*47G>A). Functional studies revealed that the three mutations lead to significant dysregulation of SIGMAR1 expression. Subsequent investigations revealed that consistent with the identified cytoplasmic TDP-43 and FUS inclusions in c.672*51G>T mutation carriers, overexpression of sigma- 1 receptor (sigma-1R) resulted in significant shunting of TDP-43 and FUS from the nucleus to the cytoplasm. Antisense knock down of sigma-1R expression resulted in lowered cytoplasmic TDP-43 and FUS levels suggesting a common underlying pathogenic mechanism. Furthermore, treatment of cells with sigma-1R ligands significantly altered TDP-43 subcellular localisation. These results provide a potential therapeutic strategy for the treatment of FTLD and MND, diseases with underlying TDP-43 and/or FUS pathology, through the use of known sigma-1R ligands.
viii Abbreviations
(+) PTZ (+) Pentazocine (+) SKF10047 (+)-N-Allylnormetazocine hydrochloride
[Ca2+]i Intracellular calcium concentration 3’UTR Three prime untranslated region 3MS Modified Mini-Mental State Examination AE Beta amyloid AC915 2-(1-Pyrrolidinyl)ethyl 3,4-dichlorophenylacetate oxalate ACh Acetylcholine AD Alzheimer’s disease ADAM10 A disintegrin and metallopeptidase 10 AGD Argyrophilic grain disease AGRF Australian genome research facility AICD Amyloid precursor protein intracellular domain ALS Amyotrophic lateral sclerosis AMPA Alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid AMTS Abbreviated mental test score ANG Angiogenin APH-1 Anterior-pharynx-defective-1 Apo Apoliporptein APP Amyloid precursor protein ArG Argyrophilic grain AS Antisense ASIC Acid-sensing ion channels ATF6 Activating transcription factor 6 AY9944 Trans-1,4-bis(2-Chlorobenzylaminomethyl)cyclohexane BACE1 Beta-secretase 1 BAD Bcl-2/Bcl-XL-associated death promoter BAX Bcl-2–associated X protein
ix Bcl-2 B-cell lymphoma 2 Bcl-xL B-cell lymphoma-extra large BDK Bradykinin BDNF Brain derived neurotrophic factor BI Basophilic inclusions BIBD Basophilic inclusion body disease BiP Binding immunoglobulin protein Bp Base pairs bvFTD Behavioural variant frontotemporal dementia Ca2+ Calcium CASI Cognitive Abilities Screening Instrument CBD Corticobasal degeneration CBP Carbetapentane CBS Corticobasal syndrome CFTR Cystic fibrosis transmembrane conductance regulator ChBD Cholesterol binding domain CHMP2B Chromatin-modifying protein 2B CJD Creutzfeldt–Jakob disease c-LD Cytoplasmic lipid droplets CNS Central nervous system CTF C-terminal fragments CTF Carboxyterminal fragment DCTN1 Dynactin 1 DEX Dextromethorpan DHEA-S Dehydroepiandrosterone sulphate DLB Dementia with Lewy bodies DN Dystrophic neurites DSM-IV-TR Diagnostic and Statistical Manual of Mental Disorders DTG Di(2-tolyl)guanidine EIF2D Alpha subunit of eukaryotic translation initiation factor 2 x ER Endoplasmic reticulum ERAD Endoplasmic-reticulum-associated degradation ER-LD Endoplasmic reticulum lipid droplets ESCRT-III Endosomal sorting complex required for transport III FAD Familial Alzheimer’s disease FTD Frontotemporal dementia FTLD Frontotemporal lobar degeneration FTLD-ni Frontotemporal lobar degeneration-no inclusions FTLD-U Frontotemporal lobar degeneration-Ubiquitinopathy FUS Fused in sarcoma FUS-ir Fused in sarcoma-immunoreactive GCI Glial cytoplasmic inclusions G-PDC Guam parkinsonism-dementia complex GPI Glycosylphosphatidylinositol GRN Progranulin Haloperidol 4-[4-(4-chlorophenyl)-4-hydroxy-1-piperidyl]-1-(4-fluorophenyl)-butan-1-one HD Huntington’s disease hnRNP Heterogenous ribonucleoprotein IBK Inhibited charybdotoxin-sensitive K channel IBM Inclusion body myopathy IBMPFD Inclusion body myopathy, Paget’s disease of bone and frontotemporal dementia ICD-10 International classification of disorders 10 IF Intermediate filaments IP3R Inositol 1,4,5-triphosphate receptor IRE1 Inositol requiring kinase 1 LB Lewy bodies LBPA Lysobisphosphatidic acid LN Lewy neurite LR Lipid raft LRRK2 Leucine-rich-repeat-kinase-2
xi LTP Long term potentiation MAM Mitochondrion-associated ER membrane MAPT Microtubule associated protein tau miRNA Micro- Ribonucleic acid MMSE Mini mental state examination MND Motor neuron disease mRNA Messanger ribonucleic acid MSTD Multiple system tauopathy with presenile dementia MT Micortubule MVB Multivesicular body Na+ Sodium nACh Nicotinic acetylcholine NCI Neuronal cytoplasmic inclusions NCLS6 Neuronal ceroid lipofuscinoses NES Nuclear export sequence NF Neurofilament NFT Neurofibrillary tangle NFTPD Neurofibrillary tangle-predominant dementia NG108 Neuroblastoma-glioma 108 NIFID Neuronal intermediate filament inclusion disease NII Neuronal intranuclear inclusions NMDA N-methyl D-aspartate NPI Neuropsychiatric inventory NTF Aminoterminal fragment Opipramol 4-[3-(5H-dibenz[b,f]azepin-5-yl)propyl]-1-piperazinethanol PARK Parkinson’s disease protein PBL Pick body like PD Parkinson’s disease PDB Paget’s disease of bone PDD Parkinson’s disease dementia xii PDI Protein disulphide isomerase PEN-2 Presenilin-enhancer-2 PERK Protein kinase-like endoplasmic reticulum kinase PiD Pick’s disease PINK1 Phosphatase and Tensin Homolog-induced kinase-1 PKA Protein kinase A PKC Protein kinase C PMA Phorbol 12-myristate 13-acetate PNFA Primary non-fluent aphasia PNS Peripheral nervous system PPA Primary progressive dementia PREG-S Pregnenolone sulfate PS Presenilin (protein) PSEN Presenilin (gene) PSP Progressivie supranuclear palsy PSP-S Progressive supranuclear palsy syndrome REM Rapid eye movement RNA Ribonucleic acid RRM RNA recognition motif sAPP Soluble amyloid precursor protein SBDL Steroid binding domain-like SCA Spinocerebellar ataxia SD Semantic dementia SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis SF Straight filaments Sigma-1R Sigma-1 receptor SMA Spinal muscular atrophy SMN Spinal motor neuron SNc Substantia nigra pars compacta SNCA Alpha-synuclein
xiii SOD1 Superoxide dismutase 1 SP Senile plaques SPS Progressive supranuclear palsy SSRI Serotonin reuptake inhibitor TARDBP Transactive response DNA binding protein TDP-43 TAR DNA binding protein 43 TLS Translated in liposarcoma TM Transmembrane TMD Transmembrane domain Ub Ubiquitin Ub-ir Ubiquitin immunoreactive UPR Unfolded protein response VAPB Synaptobrevin-associated protein B VCP Valosin-containing protein VGCC Voltage gated calcium channel WT Wild type
xiv Table of contents
CHAPTER 1 INTRODUCTION ______1
1.1 Dementia ……………………………………..…………………………………………………………… 2 1.2 Neurodegenerative disease …………………………..……………………………………………….. 5 1.2.1 Clinical aspects of neurodegenerative diseases ………………………...……………. 6 1.2.1.1 Behavioural syndromes ……………………………………..…………………… 7 Alzheimer’s disease ………………………………………………...…………… 7 Frontotemporal lobar degeneration ……………………………………………. 7 Behavioural variant frontotemporal dementia ………….…………… 8 Primary progressive aphasia ………………………………….……… 9 Argyrophilic grain disease …………………………………………..……….. 10 Neurofibrillary tangle-predominant dementia ……………………………..… 10 1.2.1.2 Motor syndromes………………………………………………………………… 11 Corticobasal syndrome ………………………………………………………… 11 Progressive supranuclear palsy syndrome ………..………………………… 11 Parkinsonism……………………………….…………………………....……… 12 Parkinson’s disease ……………………………………..…………… 13 Dementia with Lewy Bodies …………………………………..…….. 13 Parkinson’s disease with dementia ………………………………… 14 Motor neuron disease ….……………………………………………………… 15 1.2.1.3 Summary ………………………………………………………………..……….. 16 1.2.2 Neuropathology of neurodegenerative diseases …………………………….……… 17 1.2.2.1 Amyloidopathies ……………………………………………………………...… 18 Cerebral amyloid angiopathy.……… ……………………………………….….18 1.2.2.2 Tauopathies ……………………………………………………………………... 19 Alzheimer’s disease ……………………………………………………………. 19 Pick’s disease ……………………………………………………………...…… 21 Corticobasal degeneration …………………………………………………….. 22
xv Progressive supranuclear palsy ……………………………….……………… 24 Argyrophilic grain disease ………………...……………………………….….. 24 Multiple system tauopathy with presenile dementia …………………...…… 26 Neurofibrillary tangle-predominant dementia ……………………………….. 26 1.2.2.3 Tau biochemistry ……………………………………………………..…………. 27 1.2.2.4 Ubiquitin …………………………………………………………………….……. 31 1.2.2.5 TDP-43 Proteinopathies ……………………………………………...………… 32 Type 1 …………………………………………………………………………… 32 Type 2 ……...………………………………………………………………...…. 32 Type 3 …………………………………………………………………………… 33 Type 4 …………………………………………………………………………… 33 1.2.2.6 TDP-43 biochemistry …………………………………………………………… 35 1.2.2.7 Fused in sarcoma/translated in liposarcoma proteinopathy …...... ………... 37 Motor neuron disease…………..………………….……………….………….. 38 Neurofilament inclusion body disease ……………………..………………… 40 Basophilic inclusion body disease …………………………… ……………… 41 1.2.2.8 Fused in sarcoma biochemistry…………………………………………..……. 42 1.2.2.9 Frontotemporal lobar degeneration with no inclusions……...………….…… 42 1.2.2.10 Alpha-synucleinopathies ……………………………………………….…….. 43 1.2.2.11 Summary …………………………………………………………..…………… 45 1.2.3 Genetics underlying neurodegenerative diseases …………………………..……… 46 1.2.3.1 Alzheimer’s disease ……………………………………………….……………. 46 Amyloid precursor protein ………………………………………...…………… 46 Presenilins ………………………………………………………………………. 49 Apolipoprotein E …………………………………………………...…………… 50 1.2.3.2 Parkinson’s disease ……………...…………………………………………..…. 52 1.2.3.3 Motor neuron disease …………..………………………………….…………… 53 Superoxide dismutase 1 ………………………………………………………. 54 TAR DNA binding protein …………………………………….……………….. 55 Fused in sarcoma/translated in liposarcoma………………………………… 56
xvi 1.2.3.4 Frontotemporal lobar degeneration ………………………………….….…..… 57 Chromosome 17q21 and frontotemporal lobar degeneration…….....…….. 58 FTDP-17 and microtubule associated protein tau……..………….. 58 FTDP-17 and progranulin ………………………..………………….. 59 Chromosome 3 and frontotemporal lobar degeneration ……....…………… 61 Chromatin modifying protein 2B …………………….…………….… 62 Chromosome 9 and frontotemporal lobar degeneration……………………. 63 Inclusion body myopathy with Paget’s disease of bone and frontotemporal dementia …………………………………………….. 63 Frontotemporal lobar degeneration and motor neuron disease …. 65 1.2.3.5 Summary……………………………………………………………………..…… 67 1.3 Aim ………………………………………………………………………………………………..……… 68
CHAPTER 2 Paper I Corticobasal pathology in a large FTD-MND family with suggestive linkage to chromosome 15q21-q23 ………………………………………………………………………..… 69
CHAPTER 3 Paper II Pedigree with frontotemporal lobar degeneration-motor neuron disease and Tar DNA binding protein-43 positive neuropathology: genetic linkage to chromosome 9 …………………… 103 Supplementary data ……………………………………………………………………….…….. 115
CHAPTER 4 Paper III SIGMAR1 mutations cause frontotemporal lobar degeneration – motor neuron disease ………………………………………………….………………………..119 Supplementary data ………………………………………………………………………………131
xvii CHAPTER 5 GENERAL DISCUSSION ______138
5.1 Thesis Summary ………………………………………………………………………..……………. 139 5.2 The heterogeneous nature of frontotemporal lobar degeneration ………………….……… 142 5.2.1 Clinical perspective ………………………………………………………...……………… 142 5.2.1.1 Frontotemporal lobar degeneration and motor neuron disease linked to chromosome 9 ………………………….… 143 Aus-14 and Alzheimer’s disease ………………….……………..………. 144 Aus-14 and schizophrenia ………………………………………...……... 144 Aus-14 and dystonia ………………………………………………………. 145 5.2.1.2 Summary ………………………………………………...…………………...… 145 5.2.2 Pathological perspective ……………………………………………………………..…… 146 5.2.3 Genetic perspective …………………………………………………………………..…… 149 5.2.3.1 The role of variable expression in frontotemporal lobar degeneration…… 149 5.2.3.2 Role of lipids in neurodegeneration …………………………………………. 151 5.2.3.3 Gene clustering in frontotemporal lobar degeneration ….……..………….. 153 5.2.3.4 Difficulties of gene identification in frontotemporal lobar degeneration ……………………………………….…. 153 5.3 Review of Sigma-1 Receptor ………………………………………………………………………. 158 5.3.1 Introduction ………………… ……………………………………………………………. 158 5.3.2 Location ………………………………………………………………………….…………. 161 5.3.2.1 Anatomical distribution of sigma-1R …………………..…………………….. 161 5.3.2.2 Cellular and subcellular distribution of sigma-1R ………………………...… 162 5.3.3 Genetics …………………………………………………………………………..………… 162 5.3.3.1 Schizophrenia …………………………………………………………..……… 162 5.3.3.2 Alzheimer’s disease …………………………………………………………… 163 5.3.3.3 Alcoholism ……………………………………………………………………… 164 5.3.3.4 Transgenic mice ……………………………………………………..………… 164 5.3.4 Cholesterol, lipid rafts and the sigma-1R ……….…………………….………………… 165 5.3.5 Calcium homeostasis and the sigma-1R ………....……………………………..……… 168 xviii 5.3.5.1 NMDA receptor ……………………………………………………...…………. 169 5.3.5.2 Sigma-1R and neuroprotection ………………………………………………. 171 5.3.6 Potassium modulation by sigma-1R …………………………………………………..… 174 5.3.7 Sigma-1R as a chaperone …………………...………………………..…………………. 174 5.3.8 Therapeutic potential of sigma-1R ligands …………...………………………………… 177 5.3.9 Summary …………………………………………...…………………………...…………. 179 5.4 Future studies ………………………………………………………………………………………... 179 5.4.1 Chromosome 15 – family Aus-12 ………………………………………………..……… 179 5.4.2 Sigma-1R …………………………………………………………………………………… 181 5.4.2.1 Animal models …………………………………………………………...…….. 182 5.4.2.2 Clinical trials …………………………………………………………...……….. 183 5.5 Concluding remarks ………………………………………………………………………….……… 186
REFERENCES ______187
xix Chapter 1 Introduction
1
1.1 Dementia
At the age of 92, Sophocles is said to have written “Oedipus at Colonus”, while Titian was still painting masterpieces in his late 80’s. Such outstanding contributions are just some examples of those fortunate enough to stay intellectually intact late into their lives. Unfortunately, many people are denied that privilege and as they age, develop mild decline in memory and cognitive abilities while others develop dementia.
The term dementia refers to a clinical syndrome characterized by loss of function in multiple cognitive domains due to damage or disease in the body beyond what might be expected from normal aging.
Clinical diagnosis of dementia can be made according to several established diagnostic classification systems such as the Diagnostic and Statistical Manual of Mental Disorders (DSM-IV-TR) and the International Classification of Disorders (ICD-10). DSM-IV-TR diagnostic features include: memory impairment and at least one of the following: aphasia, apraxia, agnosia or disturbances in executive functioning. In addition, the cognitive impairments must be severe enough to cause impairment in social and occupational functioning. In the ICD-10 criteria, dementia is defined as decline in memory and two other domains, as well as impairment in basic activities of daily living that lead to dependency on caregivers. Decline must be present for at least 6 months. Short cognitive tests such as the abbreviated mental test score (AMTS), the mini mental state examination (MMSE), modified mini-mental state examination (3MS), the cognitive abilities screening instrument (CASI), and the clock drawing test also have reasonable reliability and are often used as a screening tool for dementia. However, although there has been great progress in enhancing the accuracy of ante- mortem diagnosis, definitive diagnosis still requires neuropathological confirmation.
By itself, dementia is not diagnostic of any specific disease but rather it is an umbrella term for a group of symptoms that may result from age, brain injury, disease, vitamin or hormone imbalance and drugs or alcohol. Currently there are over 100 conditions described that cause dementia. Some of the major disorders are summarised in Table 1 below with AD, vascular dementia, FTLD and dementia with Lewy bodies (DLB) accounting for over 90% of cases.
2 Table 1. Causes of Dementia Neurodegenerative diseases x Alzheimer’s disease x Dementia with Lewy Bodies x Frontotemporal lobar degeneration x Corticobasal syndrome x Progressive supranuclear palsy x Motor neuron disease x Huntington’s disease x Parkinson’s disease
Vascular Dementia x Multi-infarct dementia x Subcortical vascular dementia (Binswanger’s disease) x Acute onset vascular dementia
Traumatic Dementia x Dementia pugilistica (boxer’s dementia)
Infectious Dementia x Creutzfeldt-Jakob Disease x Gerstmann-Straussler-Scheinker disease x Kuru x Acquired immunodeficiency syndrome
Alcohol Induced Dementia x Korsakoff's syndrome x Wernicke's encephalopathy
Potentially treatable conditions x Chronic sub-dural haematoma x Cerebral tumour x Normal pressure hydrocephalus x Vitamin deficiency x Endocrine disorders x Anoxic disorders x Polypharmacy x Depression
3 The international prevalence rates of dementia are illustrated in Figure 1 where there are currently 29.8 million people with dementia, and the number is expected to rise to 81.1 million by 2050. Amongst Australians aged 65+, the average rate of moderate to severe dementia is ~7%. This increases to ~11% for those aged 80 to 84 and to a staggering 25% among those aged 85+ (Alzheimer’s Australia, 2008). Australia’s population is progressively ageing and as a consequence more people are falling into the age groups where the prevalence of dementia is highest. As at present there is no prevention or cure for most forms of dementia, it is estimated that between 2000 and 2050 the number of people with dementia in Australia will increase by 327%, equating to 731,000 affected individuals (Alzheimer’s Australia, 2008). This dramatic increase in the number of people with dementia in the Australian population will have profound impact on families, communities and health care systems. Therefore, there is a need for greater understanding of the cause and pathological pathway(s) that lead to dementia, so that better diagnosis, treatment and therapies can be developed.
International Prevalence of Dementia (2009)
Figure 1. International Prevalence of Dementia (Prince and Jackson, 2009)
4 1.2 Neurodegenerative disease
The term “neurodegeneration” is derived from Greek neuro (nerval) and Latin degenerare (to decline or to worsen). Neurodegenerative disease is characterised by progressive loss of neurons that usually occurs in a selective pattern, leading to different clinical phenotypes. Associated secondary changes in white matter tracts can also be present. Many of the diseases arise without any clear inciting event in patients, but almost all of them lead to the development of protein aggregates that are resistant to normal cellular mechanisms of degradation through the ubiquitin-proteosome system (UPS). The aggregated proteins are generally cytotoxic and eventually lead to neuronal cell death.
Over the past decade there have been considerable advances in our understanding of neurodegenerative diseases. Unfortunately, with these advances a plethora of new terms from many different fields developed resulting in confusion as to whether the clinical, neuropathological or genetic entities were described. In addition to the already confusing nomenclature, another degree of complexity arises from the considerable overlap between the different diseases. Pathologically confirmed cases can manifest with alternative clinical phenotypes and conversely, classic clinical syndromes can sometimes have alternative pathologies. Therefore, the remainder of the chapter will focus on each entity, namely clinical, pathological, and genetic separately, describing neurodegenerative diseases most relevant to this thesis.
5 1.2.1 Clinical aspects of neurodegenerative diseases
According to their phenotypic effects, neurodegenerative disorders can be crudely divided into behavioural syndromes and movement disorders (Figure 2), although it is important to note that these are not always mutually exclusive.
Figure 2. Summary of the clinical spectrum of neurodegenerative disorders. AD Alzheimer’s disease, AGD Argyrophilic grain disease, FTLD Frontotemporal lobar degeneration, NFTPD Neurofibrillary tangle- predominant dementia, bvFTD Behavioural variant frontotemporal dementia, PPA Primary progressive dementia, PNFA Primary non-fluent aphasia, SD Semantic dementia, PSP-S Progressive supranuclear palsy syndrome, MND Motor neuron disease, PD Parkinson’s disease, DLB Dementia with Lewy bodies, PDD Parkinson’s disease dementia, CBS Corticobasal syndrome
6 1.2.1.1 Behavioural syndromes
Alzheimer’s disease
In 1907 Alois Alzheimer described the first case of dementia that now bears his name. A 51-year old woman, Auguste D. had developed memory deficits and progressive loss of cognitive abilities. She became suspicious of her husbands behaviour, she hid objects in her apartment and later could no longer orient herself, even in her own home. She suffered from language deficits, auditory hallucinations, delusions, paranoia and aggressive behaviour and was eventually institutionalised in a psychiatric hospital. She died less than five years after the onset of the illness (Alzheimer, 1907).
Alzheimer’s disease is the most common form of dementia, accounting for 50-60% of all cases (Ferri et al., 2005). AD usually begins to exhibit clinical signs after the age of 65, however, its onset may occur as early as 30. In these cases there is often a strong family history and disease progression is very rapid. The more common sporadic form which accounts for 90-95% of cases has a later age of onset and has slower disease progression, however, clinically it is indistinguishable from the familial forms of AD. Patients show abnormalities in memory, problem solving, language, calculation, visuospatial perception, judgement, and behaviour (McKhann et al., 2011). As with the case described by Alzheimer, some patients develop psychotic symptoms, such as hallucinations and delusions. In all these patients, mental functions and activities of daily living become progressively impaired. In the late stages these individuals become mute, incontinent and bed ridden and usually die of other medical illnesses. The course of illness is variable with the length of time between diagnosis and death ranging from 3 to 15 years (Hort et al., 2010; McKhann et al., 2011).
Frontotemporal lobar degeneration
After AD and DLB, FTLD is the third most common cause of cortical dementia accounting for 20-25% of all cases over the age of 65 despite generally being considered a presenile dementia (Rabinovici and Miller, 2010). Age at onset is usually between 45 and 65 although some cases as young as 21 and as old as 70 have been reported thus FTLD is the second most prevalent form of early onset dementia (Snowden et al., 2004). The mean duration of illness is approximately 8 years (Neary and
7 Snowden, 1996). The reported prevalence of FTLD ranges from 3.3/100,000 in the 50-59-year age group to 9.4/100,000 in the 60-69-year age group (Knopman et al., 2004; Rosso et al., 2003). Amongst the 45-64-year old group from Cambridgeshire, United Kingdom, FTLD is almost twice as common as vascular dementia (8.2/100, 000) and parkinsonian syndromes (6.9/100,000) and accounts for 15.1/100,000 cases. This is comparable in incidence to AD in the same age group and has been reported in multiple studies (Mercy et al., 2008). FTLD represents a heterogenous group of sporadic and familial neurodegenerative syndromes that reflect degeneration in the frontal and/or temporal lobes (McKhann et al., 2001). Clinically, FTLD syndromes include: behavioural variant frontotemporal dementia (bvFTD) and primary progressive aphasia (PPA) with two variant subtypes: progressive non-fluent aphasia (PNFA) and semantic dementia (SD) (Neary et al., 1998).
Behavioural variant frontotemporal dementia
Behavioural variant frontotemporal dementia (often referred to as just ‘frontotemporal dementia’) is often familial and is the most common clinical manifestation of FTLD. The overriding presenting feature in bvFTD is a profound alteration in the patient’s social conduct and personality which onsets in a gradual and insidious fashion (Gustafson, 1987). The most common symptoms include impaired insight, apathy, disinhibition, distractibility, abnormal eating behaviour, stereotypic and ritualistic behaviour, impaired empathy, and speech adynamism (Rabinovoci and Miller, 2010). Cognitive deficits occur in the domains of attention, abstraction, planning, and problem solving (dysexecutive symptoms), whereas primary tools of language, perception, and spatial functions as well as memory are well preserved (Boxer and Miller, 2005).
Although bvFTD is defined by behavioural presentation, patients with language variants of FTLD often have marked behavioural disturbance and conversely, a variable degree of language impairment frequently accompanies the behavioural syndrome. Bizarre visual hallucinations and prominent parkinsonism have also been described in a small subset of patients (Josephs, 2008). Numerous reports of bvFTD in association with motor neuron disease (MND) have also begun to emerge (Lomen-Hoerth, 2004; Lomen-Hoerth et al., 2002; Ringholz and Greene, 2006).
8 Primary progressive aphasia Progressive non-fluent aphasia
Progressive non-fluent aphasia is a disorder of expressive language characterised by speech that is produced in a halting and distorted fashion (i.e. non-fluent). Word retrieval difficulties as well as phonologic and grammatical errors are apparent (Gorno-Tempini et al., 2004). Comprehension of single word meaning is relatively intact but patients have difficulty understanding syntactically complex sentences (Mesulam, 2003; Neary et al., 1998). Oro-buccal apraxia commonly accompanies the language disorder (Josephs et al., 2006a). As mentioned earlier, behavioural changes characteristic of bvFTD may emerge late in the disease course however are relatively rare. Late development of extrapyramidal features such as parkinsonism, apraxia, gait impairment, or combinations of these are more common, sometimes resulting in a corticobasal syndrome or progressive supranuclear palsy syndrome diagnosis (Gorno-Tempini et al., 2004; Kertesz et al., 2005).
Primary progressive aphasia Semantic dementia
In contrast to PNFA, speech in SD remains fluent, effortless, and grammatical but becomes progressively devoid of content words. Patients with SD suffer from severe naming and word comprehension impairment as well as an inability to recognise the meaning of visual percepts (associative agnosia) reflecting a breakdown in semantic memory (Gorno-Tempini et al., 2004; Hodges et al., 1992). This is in contrast to day-to-day (episodic) memory and autobiographical memory, as well as immediate or working memory which all remain relatively intact. Patients also have relatively good visuo-perceptual and visually based problem solving abilities. Repetition, reading aloud and writing to dictation are also preserved (Mesulam, 2003; Neary et al., 1998).
Unfortunately with disease progression patients eventually become mute. Prominent bvFTD and visual agnosia develop in almost every case over time (Hodges et al., 1992; Kertesz et al., 2007). Behavioural changes distinct from bvFTD have also been noted in some patients (Rosen et al., 2006; Snowden et al., 2001). SD associated with MND has also been reported (Boeve, 2007).
9 Argyrophilic grain disease
Argyrophilic grain disease (AGD) is a common sporadic neurodegenerative disease that accounts for about 5% of all demented cases. The mean age of onset is about 75-80 years (Braak and Braak, 1998). There is no specific test for a clinical diagnosis of AGD and there is currently only limited data available describing clinical features of AGD. Most commonly AGD shares features of AD but the burden of cognitive dysfunction is much smaller. This is seen in several domains such as memory, language, attention, and executive dysfunction (Steuerwald et al., 2007). A small number of patients present with impairment consistent with FTLD but most often this is only seen in very aged people. The duration of the disease is between 4 and 8 years (Ferrer et al., 2008; Tolnay and Clavaguera, 2004).
Neurofibrillary tangle-predominant dementia*
Neurofibrillary tangle-predominant dementia (NFTPD) is a sporadic subtype of progressive dementia in very old subjects characterised by relatively mild cognitive dysfunction with predominant memory impairment (Jellinger and Attems, 2007; Yamada, 2003). The slowly progressing memory disturbance is frequently associated with depression, delirium and other psychotic symptoms but preserved personality function. Mild disturbances in gait and rigidity have also been described (Ulrich et al., 1992). Focal cortical symptoms such as aphasia, apraxia, or agnosia have not been reported.
The prevalence of NFTPD has been reported to be 1.7-5.6% in the autopsy series of elderly patients with dementia with 20% over the age of 90. The mean age at onset is 89.4 years (range 81-95 years of age) and age at death 95.2 years (range 88-103 years of age). The duration of clinical course ranges between 1 and 15 years (Yamada, 2003).
* Neurofibrillary tangle-predominant dementia is also known as: limbic neurofibrillary tangle dementia, senile dementia of the NFT type (tangle only dementia), senile dementia with tangles, and tangle predominant senile dementia 10 1.2.1.2 Motor syndromes
Corticobasal syndrome*
Corticobasal syndrome (CBS) is a rare cognitive and motor syndrome that classically begins in the sixth, seventh or eighth decade. The mean survival of this syndrome is ~7 years (Wenning et al., 1998). The most characteristic feature of CBS is the unilaterality and strong asymmetry of motor symptoms. A ‘useless arm’ (i.e. a rigid, akinetic, dystonic, or apraxic arm) followed by a gait disorder are most common presentations (Rinne et al., 1994). Symptoms such as ideomotor or constructional apraxia, cortical sensory loss, speech apraxia, myoclonus and the alien-limb phenomenon represent signs of cortical dysfunction and are sometimes recognised (Mahapatra et al., 2004). Cognitive decline or dementia are also a common feature of this disorder. For example, aphasia was reported in 34% of all reported patients with CBS and in 44% with pathological confirmation (Graham et al., 2003). Impaired visuospatial skills and progressive behavioural change associated with frontal lobe dysfunction are also common (Dubois et al., 2000; Mahapatra et al., 2004). In addition psychological complaints such as depression, apathy, irritability, agitation, anxiety and delusions have also been reported (Cummings and Litvan, 2000). This clinical heterogeneity poses difficulties in making the correct diagnosis, therefore it is not until the neuropathological investigation is complete that CBS can be definitively diagnosed.
Progressive supranuclear palsy syndrome
Progressive supranuclear palsy syndrome (PSP-S) also known as Steele-Richardson-Olszewski syndrome is a relatively rare, neurological disorder. The onset of the disease is usually in the mid- 60s, and males are affected approximately twice as frequently as females. Classically, patients present with severe postural instability, manifested as unexplained and unexpected falls or tendency to falls. The cardinal feature of PSP is supranuclear vertical gaze palsy, however it is only present in 8% of patients at symptom onset and usually takes 3-4 years to develop before progressing to horizontal gaze palsy and eventually ophthalmoplegia (Hauw et al., 1994). Prominent speech
*Although CBS is now more generally accepted as the name to describe a clinical syndrome, for a long time corticobasal degeneration (CBD) was used to mean both the clinical presentation and pathology. In this thesis ‘CBD’ will only be used in the context of describing pathology 11 disturbances (dysarthria) and swallowing difficulties (dysphagia) may also occur early in the course of the disease as well as signs of frontal lobe dysfunction. Patients show symptoms of executive dysfunction (difficulty planning, problem solving, concept formation, and decreased verbal fluency), behavioural disturbances (apathy and disinhibition) as well as motor perseveration and anxiety. The disease is often fatal within 5-9 years of onset (Litvan, 1994; Litvan et al., 1996; Steele et al., 1964).
Parkinsonism
Parkinsonism (also known as Parkinson's syndrome, atypical Parkinson's, or secondary Parkinson's) is a neurological syndrome characterized by tremor, hypokinesia, rigidity, and postural instability. A wide range of aetiologies can lead to a similar set of symptoms (Table 2) with Parkinson's disease (PD) being the most common cause of parkinsonism.
Table 2. Causes of parkinsonism
x Parkinson’s disease x Corticobasal degeneration x Creutzfeldt-Jakob disease x Diffuse Lewy body disease x Drug-induced parkinsonism (due to drugs such as antipsychotics, metoclopramide, MPTP) x Encephalitis lethargica x Multiple system atrophy x Pantothenate kinase-associated neurodegeneration (Hallervorden-Spatz syndrome) x Progressive supranuclear palsy x Toxicity due to substances such as carbon monoxide, carbon disulfide, manganese, paraquat, mercury, hexane, rotenone, and toluene x Vascular parkinsonism x Wilson's disease x Paraneoplastic syndrome
12 Parkinson’s disease
Parkinson’s disease (PD) is named after an English physician James Parkinson, who made a detailed description of the disease in his essay: "An Essay on the Shaking Palsy" (1817) (Parkinson, 2002). PD is uncommon in people younger than 40, and the incidence of the disease increases with age with an estimated 1% of PD cases over the age of 65 (de Lau and Breteler, 2006). PD is characterised by rigidity, tremor, bradykinesia and impaired postural reflexes, and beneficial response to levodopa-carbidopa and therefore has traditionally been considered as a motor system disorder. However, it is now increasingly recognised that non-motor manifestations such as dementia, psychiatric disorders, autonomic disturbances and sleep disorders frequently complicate the course of the disease. Psychiatric disturbances including cognitive impairment, hallucinations, depression and psychosis impact these patients considerably (Chaudhuri et al., 2006).
In some patients, the non-motor features of PD may present before or concomitantly with the motor ones in which case those patients are classified as having DLB, while non-motor symptoms that occur in the setting of well established parkinsonism (which by definition is at least of 1 year duration) should be diagnosed as Parkinson’s disease with dementia (PDD) (McKeith et al., 2005). On average, the prevalence of dementia in PD is approximately 40% (Cummings, 1988).
Dementia with Lewy bodies
Dementia with Lewy bodies is the second commonest cause of neurodegenerative dementia in older people accounting for 15-25% of cases at autopsy (Heidebrink, 2002; Perry et al., 1990b). The presenting feature in most cases is cognitive impairment with substantial attentional deficits and prominent frontosubcortical and visuospatial dysfunction. The relative preservation of confrontation naming and short and medium term recall as well as recognition and greater impairment on verbal fluency, visual perception and performance tasks can help to differentiate DLB from AD (McKeith et al., 2005). In 50-75% of patients, fluctuations in attention and alertness that may vary over minutes, hours or days are reported and form the core clinical feature of DLB (Walker et al., 2000). Early in the course of the disease, visual hallucinations, delusions, apathy and anxiety characteristic of psychiatric illness are common. Extrapyramidal signs are reported in 25-50% of patients with DLB at
13 diagnosis and are generally similar to that of age-matched patients with PD or PDD. However, in comparison to non-demented patients with PD, the pattern of extrapyramidal signs shows an axial bias with greater postural instability, facial impassivity, gait difficulty, and tendency towards left tremor, consistent with greater non-dopaminergic motor involvement (McKeith et al., 2004). Other features include autonomic abnormalities such as orthostatic hypotension, neurocardiovascular instability, urinary incontinence, rapid eye movement (REM) sleep behavioural disorder, sensitivity to neuroleptic medications, repeated falls, unexplained episodes of loss of consciousness and depression (McKeith et al., 2004).
Parkinson’s disease with dementia
Whether Parkinson’s disease with dementia (PDD) and DLB are distinct entities or represent a spectrum of the same disease is still debated in the literature as generally, the cognitive and psychiatric symptoms of PDD and DLB are essentially the same (Table 3), although some authors do report more executive dysfunction and psychiatric symptoms in DLB patients compared to patients with PDD (Aarsland et al., 2004). Pronounced gait abnormality, postural instability and decreased levodopa responsiveness are also more likely in DLB, while patients with PDD may have more prominent parkinsonism (Aarsland et al., 2004; McKeith et al., 2005). The most striking difference however is the age of onset where PDD tends to affect younger patients but more slowly than DLB where the progression of motor symptoms is much faster (Lopez et al., 2000).
Table 3. PDD and DLB clinical profiles x Neuropsychological performance almost identical x Psychiatric symptoms the same x Both have REM behaviour disorder x Parkinsonism more symmetrical and tremor less in DLB x Neuroleptic sensitivity less in PDD x Levodopa response not as robust in DLB x Similar response to cholinergic treatment (Goldmann Gross et al., 2008)
14 Motor neuron disease
Motor neuron disease, also known as Lou Gehrig's disease or amyotrophic lateral sclerosis (ALS) is a progressive, usually fatal, neurodegenerative disease caused by the degeneration of both upper and lower motor neurons. The majority of MND cases develop the disease sporadically, with only ~10% having a positive family history (Strong et al., 1991). Population-based studies in Europe have established an incidence of 2.16/100,000 person-years with an overall population-based lifetime risk of 1:400 for women and 1:350 for men (Logroscino et al., 2009). Approximately 1300 Australians are affected by MND at any one time, and one person a day dies of MND in Australia (Masters et al., 2011). The mean age of onset is 56 years in individuals with no known family history and 46 years in individuals with more than one affected family member. Average disease duration is about 2-5 years, but it can vary significantly (Vucic et al., 2007). Affected individuals typically present with asymmetric focal weakness of the extremities (stumbling or poor handgrip) accompanied by hyperreflexia (increase in tendon reflexes) and spasticity associated with fibrillations (invisible twitches) and fasciculations (visible twitches). Sometimes the first symptoms may be restricted to muscles innervated by cranial nerves resulting in dysarthria and dysphagia. When cranial nerve symptoms occur alone, the syndrome is called ‘progressive bulbar palsy’. If only the lower motor neurons are involved, the syndrome is called ‘progressive spinal muscular atrophy’. Ultimately, MND results in profound global paralysis and death, usually due to respiratory failure (Frosch et al., 2005; Ringel et al., 1993).
Cognitive dysfunction is present in up to 50% of patients with MND, with as many as 20% showing abnormalities that meet consensus criteria for clinical bvFTD (Abrahams et al., 2004; Lomen-Hoerth, 2004; Mackenzie and Feldman, 2005). Finally, although relatively rare, MND has also been described in cases with SD, PNFA, PSP-S, CBS and AD (Caselli et al., 1993; Godbolt et al., 2005; Josephs et al., 2006b).
15 1.2.1.3 Summary
Occasionally, the above-described distinct clinical presentations occur in isolation. However, they mostly present as complex syndromes with overlapping clinical entities. Combinations of overlapping behavioural and motor syndromes have been described. In addition, in many instances throughout the course of the disease, the presenting clinical syndrome will progress to a second syndrome and sometimes even a third. Therefore, clinically it is very difficult to underpin the real cause of the disease and neuropathology remains the gold standard for classification of neurodegenerative diseases.
16 1.2.2 Neuropathology of neurodegenerative diseases
Broadly speaking, neurodegenerative disease can be divided into four major categories including tauopathies, ubiquitinopathies (FTLD-U), amyloidopathies and synucleinopathies. While they all share the common feature of filamentous deposit formation composed of abnormal brain proteins, they are distinguished from one another by the type of protein deposition and their distribution. These features and features of other, less common pathologies that are also part of the degenerative spectrum are summarised in Figure 3 and detailed below.
Figure 3. Neuropathological spectrum of dementia. FTLD-U Frontotemporal lobar degeneration-ubiquitin, FTLD-ni Frontotemporal lobar degeneration-no inclusions, AD Alzheimer’s disease, CAA Cerebral amyloid angiopathy, FUS Fused in sarcoma, FTLD-UPS Frontotemporal lobar degeneration-ubiquitin proteosome system, TDP TAR DNA Binding protein, PD Parkinson’s disease, DLB Dementia with Lewy bodies, PDD Parkinson’s disease dementia, PiD Pick’s disease, NFTPD Neurofibrillary tangle-predominant dementia, NIFID Neuronal intermediate filament inclusion disease, BIBD Basophilic inclusion body disease, MND Motor neuron disease, CBD Corticobasal degeneration, PSP Progressive supranuclear palsy, AGD Argyrophilic grain disease, MSTD Multiple system tauopathy dementia, T Type, R Repeat
17 1.2.2.1 Amyloidopathies
Amyloid is an extracellular proteinaceous deposit arranged as a E-pleated sheet. Abnormal deposition of amyloid in organs leads to amyloidosis while abnormal deposition in the brain may lead to neurodegeneration. PD, AD and cerebral amyloid angiopathy (CAA) are all examples of neurodegenerative diseases where abnormal amyloid deposition occurs and are discussed in this section further.
Cerebral amyloid angiopathy
Cerebral amyloid angiopathy also known as congophilic angiopathy, is predominantly a sporadic disease that mainly affects the elderly population, is present in 5-20% of all cases with lobar intracerebral haemorrhage and often coexists with AD (Attems et al., 2011). CAA results from abnormal aggregations of the beta amyloid (AE or Abeta) peptide in the walls of leptomeningeal and intracortical cerebral blood vessels as well as capillaries (Attems et al., 2011). Amyloid deposition in blood vessels leads to microbleeds and increases the risk of haemorrhagic stroke. In addition, reduced vascular autoregulation and brain hypoperfusion due to CAA leads to infarcts and white matter lesions.
Histochemical (Congo-red, thioflavin S) or immunohistochemical (anti-AE antibody) staining reveals AE deposits in the tunica media surrounding smooth muscle cells as well as adventitia layer of the blood vessel wall in the early stages of disease. The AE deposits are predominantly composed of AE40 and to a lesser extent contain AE42, N-terminal truncated forms of AE and other proteins including ApoE (Attems et al., 2011). With increasing severity, more layers of the blood vessels are involved eventually leading to complete destruction of vascular architecture. Inflammatory infiltrates consisting of lymphocytes, macrophages and multinucleated giant cells may also be present (Attems et al., 2011).
CAA can have global distribution but is more commonly confined to a particular lobe with the occipital lobe most frequently and severely affected. Frontal, temporal, and parietal lobes are also affected
18 and as the disease progresses, allocortical areas and the cerebellum become involved. Late in the disease, basal ganglia, thalamus and white matter become affected (Attems et al., 2011).
1.2.2.2 Tauopathies
Tauopathy is a collective name for a set of neurodegenerative diseases resulting from the pathological aggregation of the microtubule associated protein tau in neurons or glial cells (Lee et al., 2001). Tau protein is abundant in both the central (CNS) and peripheral (PNS) nervous systems where it is predominantly expressed in axons. Normally it is involved in microtubule (MT) assembly and stabilisation however, in human diseases it becomes hyperphosphorylated and assembles into filaments (Hirokawa, 1994; Lee et al., 2001). A variety of tau phenotypes have been described and depending on their location (both at the cellular level and brain region) the tauopathy can be classified into one of several neurodegenerative diseases. AD is most commonly described, however due to the presence of additional protein deposition in the form of amyloid plaques, it is sub-classified as a secondary tauopathy. Primary tauopathies are predominantly sporadic and include a heterogenous group of disorders, which include progressive supranuclear palsy (PSP), Pick’s disease (PiD), AGD and corticobasal degeneration (CBD) amongst others (Lee et al., 2001). PSP and CBD are most common, followed by PiD and the much rarer tauopathies that include neurofibrillary tangle-predominant dementia (NFTPD), multiple system tauopathy with presenile dementia (MSTD) and AGD (Josephs, 2008).
Alzheimer’s disease
Gross observation of an AD brain shows variable degree of cortical atrophy with widening of the cerebral sulci (Figure 4 A) most prominent in the frontal, temporal and parietal lobes. Abnormalities in the entorhinal area, hippocampus, amygdala, nucleus basalis, anterior thalamus, and several brain stem monoaminergic nuclei (locus ceruleus and raphe complex) are characteristic of AD. Ventricular enlargement is also seen, secondary to loss of parenchyma (Frosch et al., 2005).
Neuropathologically AD is defined by the accumulation of neurofibrillary tangles (NFTs) and senile plaques in the brains of affected individuals (Figure 4 B and C). NFTs are lesions found in cell bodies and proximal dendrites of neurons, composed of hyperphosphorylated protein tau. The abnormally
19 phosphorylated tau either forms straight filaments (SF) or forms bundles of filaments twisted about each other in pairs (paired helical filaments) that comprise 95% of NFTs. In pyramidal neurons, they often have an elongated “flame” shape, while in rounder cells the fibres surround the nucleus taking on a rounded contour (“globose” tangles). Other types of lesions include dystrophic neurites (DN) (axons and terminals) and neuropil threads (distal dendrites) that also contain paired filaments (Frosch et al., 2005).
Tangle pathology is usually observed throughout the AD brain in a distinct pattern with respect to cell type, cell layers and brain regions. NFTs are commonly found in cortical neurons, especially in the entorhinal cortex, as well as in other sites such as pyramidal cells of the hippocampus, the amygdala, and basal forebrain, and the raphe nuclei. Based on the severity and pattern of NFTs distribution in the brain, Braak and Braak (1991) defined six neuropathological stages (Braak I-VI). Only when stages V and VI of the Braak classification are recognised, does the pathology meet criteria for the diagnosis of AD. Individuals at stage V and VI have large numbers of NFTs and neuropil threads in virtually all subdivisions of the cerebral cortex and neocortical association areas are particularly severely destroyed (Hyman et al., 2011).
Neuritic or senile plaques (SP) are spherical extracellular deposits of amyloid surrounded by dystrophic axons as well as the processes of astrocytes and microglia. The principal constituent of amyloid in AD is AE (Glenner and Wong, 1984; Masters et al., 1985). AE is cleaved from a larger precursor protein, the amyloid precursor protein (APP) that is discussed in detail later.
Unlike NFTs, the distribution of SPs is variable. The initial deposition of SP is in the cortical areas of the frontal, temporal and occipital lobes. The greatest density of SP in the later stages of the disease occurs in the amygdala, hippocampus and neocortex. Senile plaques can also occur in the walls of cerebral blood vessels (Duyckaerts et al., 2009).
20 A B C
Figure 4. Alzheimer’s disease pathology. A. Brain showing cortical atrophy in advanced AD B. Bielschowsky stain showing a neuritic plaque with an amyloid core surrounded by dystrophic neurites C. Bielschowsky silver stain showing a neurofibrillary tangle (A adapted from Agamanolis, 2008; B & C adapted from
In some patients, deposits of amyloid peptide are present which lack the surrounding neuritic reaction. These lesions are termed diffuse plaques and are thought to represent an early stage of plaque development. They are mainly found in the superficial portions of cerebral cortex as well in basal ganglia and cerebellar cortex.
Plaques and tangles are not specific to AD, and have been identified in other diseases as well. In addition, brains of non-demented patients can also contain a degree of NFT and plaque deposition.
Pick’s disease*
Pick’s disease is one of the causes of the clinical syndrome of FTLD. Most often it is associated with bvFTD and PNFA rather than the SD subtype. Macroscopically, cerebral atrophy with “knife-edge” gyri is primarily seen in the frontal and anterior temporal regions (Figure 5 A) (Dickson, 2001). Asymmetric atrophy is present in ~60% of cases, more commonly affecting the left hemisphere than the right (Case records, 2000). On section, significant thinning of cerebral cortex is evident. In some cases, degeneration of the basal ganglia, substantia nigra or both may be present and the ventricles are often enlarged.
* The term ‘Pick’s disease’ is often used to represent the behavioural/dysexecutive syndrome, however used correctly Pick’s disease should only be used in reference to the neuropathologically defined disorder and bvFTD as the syndromic term 21 Microscopically, there is widespread spongiosis and astrocytosis where areas of the cortex are almost completely devoid of pyramidal neurons and normal cytoarchitecture is abolished (Dickson, 2001).
The defining histopathological lesions of PiD are Pick bodies and Pick cells (Figure 5 B and C) (Kertesz, 2004). Pick bodies are round, well-circumscribed intensely argyrophilic cytoplasmic inclusions found within neurons of the neocortex (specifically layers II, III, and IV), septal nuclei, neostriatum, basal ganglia, subiculum, entorhinal cortex, amygdala, and the hypothalamus (Case records, 2000; Tolnay and Probst, 2001). Pyramidal neurons of the hippocampus and the granule layer of the dentate gyrus, appear particularly vulnerable to Pick body deposition (Dickson, 2001; Kertesz and Munoz, 2002). Immunohistochemically, they are tau positive and contain some ubiquitin (Ub) but are D-synuclein negative (Love et al., 1988). Pick cells are described as large, swollen ballooned, diffusely argyrophilic neurons with vacuolated cytoplasm lacking neuronal achromasia (Clark et al., 1986). Pick bodies are present in 10-30% of sporadic FTLD cases (van Swieten and Spillantini, 2007).
A B C
Figure 5. Pick’s disease pathology. A. Brain showing frontal and temporal atrophy. B. Tau immunostain showing Pick inclusion bodies C. Pick cell (Figure adapted from Agamanolis, 2008)
Corticobasal degeneration
The core features of CBD include focal cortical neuronal loss, most often in frontal, parietal and/or temporal regions. Atrophy is often more generalised in cases presenting with additional clinical symptoms such as dementia or progressive aphasia (Dickson et al., 2002). Other features include pigment and neuronal loss in the substantia nigra which is almost always present and the often
22 dilated frontal horn of the lateral ventricle. Microscopically, atrophic regions show moderately severe neuronal loss with some disruption of cortical laminae, spongiosis and gliosis (Davies and Xuereb, 2007).
Neuropathological diagnosis of CBD is primarily dependent on the presence of tau positive neuronal and glial lesions, especially astrocytic plaques and thread-like processes located both in the grey and white matter (Figure 6 A). Astrocytic plaques are distinctive anular clusters of thick, short tau-positive deposits within distal processes of astrocytes while the thread-like processes can be of both glial and neuronal origin (Feany and Dickson, 1995). There may also be bundles of tau-positive fibres coiled around the nucleus and extending into the proximal cell processes of oligodendroglia known as coiled bodies (Figure 6 B) (Davies and Xuereb, 2007). Granular or diffuse cytoplasmic tau immunopositivity is most common in neurons, however densely packed small inclusions can also be present. Swollen “achromatic” or “ballooned” neurones characterised by perikaryal swelling most readily found in the cingulate cortex are also of diagnostic importance for CBD (Figure 6 C) (Davies and Xuereb, 2007).
CBD pathology may result in presentations with dementia, including bvFTD, speech apraxia, PNFA, PSP-like syndrome, and posterior cortical atrophy syndrome.
A B C
Figure 6. Corticobasal degeneration pathology illustrated by several anti-tau antibodies A. Tau 46.1 immunostained astrocytic plaque surrounded by several neuronal inclusions and neuritic threads B. Tau-2 immunostain showing coiled bodies. C. AT8 stain showing a ballooned neuron (A and B adapted from Binder, 2010a)
23 Progressive supranuclear palsy
The most striking pathological feature of PSP is midbrain atrophy. There is widespread neuronal loss in the superior colliculi, the tectum, and nucleus raphe interpositus. In addition to the midbrain, shrinkage of the subthalamic nucleus is often seen as well as moderate atrophy of the globus pallidus. The basis pontis and select thalamic nuclei are also involved. Pallor of substantia nigra is always present and the dentate nucleus of the cerebellum is typically degenerate and discoloured (Davies and Xuereb, 2007).
Microscopically, pathology is most pronounced in the deep grey matter (Feany et al., 1996). Globose NFTs are the most abundant lesion (Figure 7 A) found in PSP although glial inclusions and threads are also consistently present. Coiled bodies (Figure 7 C) may also be found in white matter underlying the pre-central motor cortex while tufted astrocytes (Figure 7 B) account for much of the cortical tau pathology in PSP. NFTs may also be particularly prominent in the pontine nuclei and are a well defined feature in the substantia nigra (Davies and Xuereb, 2007).
A B C
Figure 7. Progressive supranuclear palsy pathology illustrated by several anti-tau antibodies A. Tau-1 immunostained globose tangles in the midbrain B. Tufted astrocytes in the frontal cortex C. Tau 64.1 immunostained threads along with two coiled bodies in the medulla (Figure adapted from Binder, 2010b)
Argyrophilic grain disease
On external examination, brains of AGD patients usually show only mild diffuse or frontotemporal cortical atrophy with no obvious atrophy of the hippocampus and/or the amygdala. The ventricles also remain unchanged (Tolnay and Clavaguera, 2004). Histologically, the signature feature of AGD is the
24 tau positive argyrophilic grain (ArG), which is an oval, spindle- or comma-shaped structure located in neuronal processes (Figure 8). ArGs can be found in both cortical and subcortical structures. The highest density of ArG is usually found in areas of the entorhinal and transentorhinal cortices as well as the hippocampus and amygdala. Other lesions associated with AGD include coiled bodies in the white matter, occasional ballooned achromatic neurones, especially in the cingulate cortex and amygdala, pre-tangle neurons with the same distribution as ArGs as well as tau-containing astrocytes found in the amygdala and white matter of the temporal lobe (Davies and Xuereb, 2007; Ferrer et al., 2008). AD type pathology with NFTs (Braak stages I-III) and senile plaques (mainly diffuse) has been reported in two thirds of AGD cases (Braak and Braak, 1987) and AGD type pathology is also frequently associated with other degenerative diseases including PiD, PSP, CBD, tangle only dementia, hippocampal sclerosis, Creutzfeldt-Jakob disease (CJD) and D-synucleinopathies such as PD and DLB (Ferrer et al., 2008). Interestingly, an estimated 4-9% of cognitively normal people also have ArGs (Davis et al., 1997). Based on these observations, the reality of AGD as a distinct entity has been questioned. Nevertheless, recent clinicopathological dementia studies have recognized AGD as a well-defined neuropathological entity among tauopathies.
B
A C
Figure 8. Argyrophilic grain disease. A. Tau immunoreactive argyrophilic grains in CA1 region of the hippocampus next to some pretangle neurons. B & C. Gallyas silver staining showing oligodendroglial coiled bodies in the white matter of the temporal lobe (A adapted from Tolnay and Clavaguera, 2004; B & C adapted from Ferrer et al., 2008)
25 Multiple system tauopathy with presenile dementia
Multiple system tauopathy with presenile dementia is an autosomal dominant familial disorder characterised by dementia and generalised motor disturbance. Patients initially present with disequilibrium and deficits in short term memory which later progress to severe cognitive decline, gait instability, bradykinesia, generalised axial and limb rigidity, superior gaze palsy and dysphagia. The mean age at onset is 49 years and a range of r 10 years. The mean duration of illness is 11 years (Spillantini et al., 1997).
Neuroimaging reveals global cerebral atrophy with frontotemporal predominance in some individuals. Accordingly, neuronal cell loss involves many areas of the CNS including the cerebellum where there is marked loss of Purkinje cells and the spinal cord where the propriospinal tract, ventral and lateral spinothalamic tracts and lateral vestibulospinal tracts also reveal extensive loss of nerve fibres. Fibrillary lesions and axonal swellings are observed in anterior horn and dorsal gray of the spinal cord. Extensive tau deposition is present in the cerebral cortex, hippocampal formation, substantia nigra, hypothalamus, periaqueductal gray, third and fourth cranial nerve nuclei, reticular nuclei, raphe nuclei, raphe neurons, and dorsal nucleus of the vagus nerve. Tau-positive fibrillary lesions consist of slender twisted ribbons (distinct from paired helical filaments seen in AD) and are present in neurons and glia (predominantly oligodendrocytes) (Spillantini et al., 1997).
While there is some overlap between MSTD, CBD and PSP, MSTD is distinguished neuropathologically based on the absence of tufted astrocytes, astrocytic plaques, and based on the ultrastructure of tau deposits which are made of twisted filaments that differ from those found in other neurodegenerative diseases (Spillantini et al., 1997).
Neurofibrillary tangle-predominant dementia
Macroscopic evaluation of NFTPD reveals mild to moderate diffuse cortical and hippocampal atrophy with an enlarged inferior horn of the lateral ventricles. Hippocampal atrophy, neuronal and synaptic loss, astrocytic and microglial proliferation is usually mild compared with classical AD (Yamada et al., 2001). Neuropathologically, NFTPD is characterised by numerous NFT in the hippocampal region and absence or scarcity of senile plaques throughout the brain. Very low prevalence of apolipoprotein
26 E4 (ApoE4) allele and higher frequency of ApoE3 and/or E2 has been suggested as a possible mechanism for the low levels of amyloidogenesis in these patients relative to AD cases (Jellinger and Bancher, 1998). Abundant extracellular “ghost” tangles and neuropil threads are found predominantly in the allocortex (entorhinal region, subiculum, CA1 sector of the hippocampus, and amygdala), with only rare and mild involvement in the neocortex, basal ganglia and brainstem (except nucleus basalis and locus ceruleus) (Jellinger and Bancher, 1998). Argyrophilic grains and tau-positive glial inclusions (coiled bodies) are also reported in 20-66% and 50% of cases respectively (Jellinger and Bancher, 1998; Ulrich et al., 1992). Tufted astrocytes and astrocytic plaques are rare while ballooned neurons, neuritic plaques or Lewy bodies (LB) are not reported. The immunohistochemical and ultrastructural properties of the NFTs are identical to those in AD (Itoh et al., 1996; Yamada et al., 2001).
Figure 9. Neurofibrillary tangle-predominant dementia pathology showing CA1 region of the hippocampus with a large number of NFTs including many extracellular NFTs (Yamada et al., 2003)
1.2.2.3 Tau biochemistry
The tauopathies also have a biochemical signature where tau aggregates differ in both phosphorylation and content of tau isoforms. In adult human brain there are six tau isoforms that are produced from a single gene (the microtubule associated protein tau – MAPT) by alternative mRNA splicing of exons 2, 3 and 10 (Figure 10) (Goedert et al., 1989). They differ by the presence of three or four repeats, which constitute the MT-binding domains of tau and depend on whether exon 10 is
27 included (4R-tau) or not (3R-tau) (Kar et al., 2003; Lee et al., 1989). Three isoforms contain three repeats each, encoded by exons 9, 11 and 12, whereas alternatively spliced exon 10 encodes the additional repeat in the remaining three isoforms (Goedert et al., 1989b). The triplets are further distinguished from one another based on the presence or absence of exons 2 and 3 (Figure 10). In adult human brain, the ratio between 3R and 4R tau isoforms is close to 1 (Goedert and Jakes, 1990).
Figure 10. Schematic of the human tau gene and the six isoforms generated by alternative splicing. A. The MAPT gene contains 15 exons of which exons 4a, 6 and 8 are not transcribed in the CNS. Exons 9-12 code for the microtubule binding repeats. Exons 2, 3 and 10 produce the alternate isoforms. B. Schematic representation of the six human brain tau isoforms (ranging from 352 to 441 amino acids). The region common to all isoforms is shown in blue. The amino-terminal inserts are shown in green (exon 2) and yellow (exon 3). The alternative splicing of exon 10 (shown in red) produces tau isoforms with three or four tandem repeats (3R or 4R). The black bars represent the repeat sequences that correspond to the microtubule binding domains (Figure adapted from Giasson et al., 2010)
28 In AD, all six isoforms are abnormally phosphorylated. They aggregate into paired helical filaments and are detected as three major bands (60, 64 and 68kDa) and one minor band of 72 kDa by immunoblotting (Figure 11) (Greenberg and Davies, 1990; Lee et al., 1991). In CBD, only four-repeat tau aggregates into twisted filaments while in PSP and AGD, straight filaments are formed (Buee and Delacourte, 1999; Roy et al., 1974; Togo et al., 2002). Both appear as a major tau doublet (64 and 68kDa) (Figure 11). MSTD shows a similar pattern to PSP and CBD with two major bands of 64kDa and 68kDa and a minor band of 72kDa. These pathological bands consist mainly of two tau isoforms, each with four microtubule-binding repeats (Spillantini et al., 1997). A tau doublet (60 and 64kDa) also appears in PiD but results from randomly oriented straight and coiled filaments aggregating from three-repeat (3R) tau isoforms (Figure 11) (Buee and Delacourte, 1999). While in some tauopathies one isoform predominates over the other, in NFTPD, inclusions contain a mixture of both 3R and 4R tau (Iseki et al., 2006; Jellinger and Bancher, 1998). An even more heterogenous picture is present in those with MAPT mutations where depending on the type of mutation either 3R, 4R or both 3R and 4R tauopathy will result (Cairns et al., 2004a).
29 PSP CBD Ageing MSTD AD PiD AGD
Figure 11. Schematic representation of Western blot banding pattern of normal and insoluble tau bands from filamentous assemblies of different tauopathies. From left to right, Lane 1 shows six bands representing each of the six native tau protein isoforms prior to post-translational modification found in human brain indicated by the number besides it as defined in Figure 10. Lane 2 shows four bands (60, 64, 68 and 72 kDa) that consist of all six tau isoforms characteristic of Alzheimer’s disease (AD) and normal ageing. Lane 3 is characteristic of Pick’s disease (PiD) with two major tau bands of 60 and 64 kDa and a minor band of 68 kDa. Progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), multiple system tauopathy with presenile dementia (MSTD) and argyrophilic grain disease (AGD) are characterised by two major tau bands of 64 and 68 kDa and a minor bands of 72 kDa (Lane 4) (Adapted from Spillantini and Goedert, 1998)
Overall, tauopathies represent a heterogenous group of diseases, with affected patients presenting with diverse clinico-pathological phenotypes ranging from prototypical aphasia to dementia syndromes.
30 1.2.2.4 Ubiquitin
Ubiquitin is a small 76 amino acid protein that covalently binds to many cytosolic, nuclear and ER proteins and is crucial in their degradation. Ubiquitination of proteins is a complex ATP-dependent process that plays a major role in the breakdown of abnormal proteins that result from oxidative stress, neurotoxicity and mutations. Structural changes in the protein substrates or malfunction or overload of the Ub/ATP-dependent pathway may halt the degradation process and result in ubiquitinated aggregates. Aggregation in turn disrupts cellular homeostasis, causing degeneration (Alves-Rodrigues, 1998).
The accumulation of Ub-protein conjugates in neuropathological lesions was first detected in NFTs and then in inclusions in a whole host of neurodegenerative diseases. Ub-positive, tau-negative intraneuronal inclusions were initially described in the dentate gyrus and cortex of several MND patients and subsequently in cases with FTLD-MND and later in patients with FTLD in the absence of motor abnormalities. FTLD and/or MND characterised by Ub-immunoreactive (Ub-ir) inclusions in the absence of abnormal tau, D-synuclein or AE is collectively known as FTLD-U and represents the most common neuropathological subtype accounting for more than 50% of FTLD cases (Josephs et al., 2004).
In the vast majority of cases, the core component of Ub-ir inclusions is the Transactive response DNA binding protein 43 (TARDBP or TDP-43). This subtype of FTLD-U is referred to as FTLD-TDP and provides a molecular link between FTLD and MND. Distinct from this subset are a number of cases immunopositive for the newly identified fused in sarcoma/translated in liposarcoma (FUS/TLS or more commonly FUS) protein designated FTLD-FUS. FTLD-FUS accounts for ~10% of FTLD-U cases. In a very small proportion of FTLD-U cases, the ubiquitinated protein remains unidentified. These cases are termed FTLD-UPS because the inclusions are only detectable with immunohistochemistry against proteins of the UPS (Mackenzie et al., 2009).
31 1.2.2.5 TDP-43 proteinopathies (FTLD-TDP)
FTLD-TDP is a relatively recent subclassification for FTLD and/or MND associated with TDP-43 and Ub positive but tau and D-synuclein negative pathology. TDP-43 is a 414-amino-acid protein that is ubiquitously expressed in many tissues including the heart, lung, liver, spleen, kidney, muscle and brain. Normally, TDP-43 is mostly a nuclear protein acting as a transcription repressor, activator of exon skipping and scaffold for nuclear bodies. However, in the disease state it becomes hyperphosphorylated, ubiquitinated and cleaved to generate C-terminal fragments forming several characteristic inclusions found in neurons and glial cells. Four types of TDP-43 positive lesions have been described: (1) neuronal cytoplasmic inclusions (NCI), (2) DN, (3) glial cytoplasmic inclusions (GCI), and (4) neuronal intranuclear inclusions (NII). Based on their density, distribution and morphology they can be classified into one of four pathologic subtypes (Cairns et al., 2007a). Currently two schemes with the same descriptors, originally based on Ub immunostaining can be employed to describe TDP-43 pathology. For the purpose of this thesis the scheme proposed by Sampathu et al. (2006) will be used.
Type 1
Abundant long neuritic profiles found predominantly in the superficial cortical laminae with few or no NCIs and NIIs is characteristic of type 1 pathology (Figure 12) (Sampathu et al., 2006). However, variable often rounded and solid but sometimes granular inclusions have also been reported in hippocampal dentate granule cells of some patients (Mackenzie et al., 2006a). Subtype 1 is most often associated with SD and although there are a few cases with MND and/or family history that have type 1 pathology, it is most common in sporadic cases without MND (Mackenzie et al., 2006a).
Type 2
Type 2 pathology is mainly found in the upper cortical laminae, but also throughout the entire cortical thickness. The predominant and sometimes exclusive inclusions in subtype 2 cases are well- circumscribed NCIs. In some patients NCI are most numerous within neurons of layer II of frontal and temporal cortex, while in others dentate granule cells of the hippocampus are predominantly affected
32 (Figure 12). Relatively few neurites and rare or no NII can be present (Mackenzie et al., 2006a; Sampathu et al., 2006). Another feature is the presence of diffuse/granular cytoplasmic TDP-43 staining (“pre-inclusions”) nearly always devoid of Ub that may represent incipient TDP-43 inclusion formation (Brandmeir et al., 2008). Previously unrecognised Ub-negative but TDP-43 positive GCIs and rare thread like inclusions are also associated with subtype 2. Glial (most likely oligodendrocyte) inclusions can be found throughout the frontal and temporal lobes as well as brainstem and spinal cord regions in FTLD-U cases with motor neuron involvement (Neumann, 2009). In some cases, motor neurons in the hypoglossal nuclei and ventral horn of the spinal cord also contain TDP-43- positive inclusions similar to those found in pure MND cases. Invariably, this subtype is reported in familial FTLD with confirmed linkage to chromosome 9 and is also found in sporadic FTLD with MND where similar type 2 histology is also present (Cairns et al., 2007b; Mackenzie et al., 2006).
Type 3
Subtype 3 cases are characterised by an abundance of small neuritic profiles and NCI, often ring shaped, predominantly in the superficial cortical layers (Figure 12). NCI of variable numbers can be found within granule cells of the dentate gyrus of the hippocampus. Moderate numbers of “cat’s eye” or “lentiform” NIIs can also be found in layer II of the cerebral cortex, especially in cases with a positive family history. In addition, similarly to subtype 2, glial pathology is often present in affected cortical regions (Neumann et al., 2007a; Sampathu et al., 2006). This type of pathology is characteristic of FTLD cases with progranulin (GRN) mutations and is most often associated with the bvFTD and PNFA phenotypes (Snowden et al., 2006). However, this subtype is not exclusive to patients with GRN mutations and has also been identified in other cases (Davidson et al., 2007; Mackenzie et al., 2006b).
Type 4
This type of pathology is unique to inclusion body myopathy (IBM) with Paget’s disease of bone and frontotemporal dementia (IBMPFD) with valosin-containing protein (VCP) mutations. It is characterised by abundant NII and DN in the upper cortical layers with no detectable inclusions in the
33 hippocampal dentate granule cells (Figure 12). Relatively few NCI are present in the affected cortical areas (Cairns et al., 2007b; Neumann et al., 2007).
Type 1 Type 2
Type 3 Type 4
Figure 12. TPD-43 immunohistochemistry demonstrating the different pathological subtypes (1- 4). Type 1 is characterised by predominance of long and tortuous dystrophic neurites (DNs) with rare or absent intranuclear inclusions (NII) and relatively few neuronal cytoplasmic inclusions (NCIs). Type 2 has numerous NCIs, relatively few DNs and rare to absent NIIs. Type 3 has numerous small neurites and NCIs and occasional NIIs. Type 4 is associated with VCP mutations and is characterised by numerous NIIs and small neurites but relatively few NCIs (Cairns et al., 2007a)
Overall, TDP-43 is widely distributed throughout the different brain regions. It has been described in the basal ganglia (including caudate, putamen, and pallidum), substantia nigra, cervical, thoracic, and lumbar spinal cords, medulla (including the superior and inferior olivary nuclei, trigeminal nucleus, facial nucleus, hypoglossal nucleus and dorsal motor plate), pons, non-nigral midbrain, hippocampal formation, entorhinal cortex, temporal cortex, parietal cortex, cingulate cortex, frontal cortex, amygdala, subthalamus, and thalamus. The only regions that remain relatively spared are the visual cortex, cerebellum, and the anterior and posterior spinal roots (Brandmeir et al., 2008).
34 1.2.2.6 TDP-43 biochemistry
TDP-43 consists of two RNA recognition motifs (RRM1 and RRM2) and a glycine-rich C terminal domain (Wang et al., 2004). The C-terminal region (274-413aa) appears to be involved in protein- protein interactions including interactions with several members of the heterogenous ribonucleoprotein (hnRNP) family involved in the biogenesis of mRNA and regulates alternative splicing of several genes including the cystic fibrosis transmembrane conductance regulator (CFTR) and the apolipoprotein IIa (Apo IIA) gene (Buratti et al., 2005; Buratti et al., 2001). In addition, the C terminal domain also functions as a transcriptional repressor and was shown to regulate tissue specific expression of the mouse testis specific SP-10 gene.
Biochemical analysis of abnormal TDP-43 reveals a distinct pattern on a Western blot (Figure 13). Full-length TDP-43 is present in all soluble and insoluble fractions regardless of the patients’ affection status. On the other hand, pathological TDP-43 is only present in detergent insoluble urea extracts of affected grey and white matter regions revealing immunoreactive bands at ~25kDa, ~45kDa as well as a high molecular weight smear or diffuse staining. The 45kDa fragment represents the hyperphosphorylated and ubiquitinated form of TDP-43 which collapses into the (full length) 43kDa form upon alkaline phosphatase treatment. N-terminal truncation is thought to result in the 25kDa band composed of C-terminal fragments (CTF) which when dephosphorylated, separate into at least four distinct TDP-43 immunobands (Neumann et al., 2006). The accumulation of CTF-rich aggregates may lead to abnormal interactions with proteins and disrupt many of the cellular processes described above. The smear is also of interest because it could also represent abnormal TDP-43 modification reminiscent of the smeared tau seen in AD cases resulting from phosphorylation, ubiquitination, deamination, isomerization, and proteolytic cleavage (Arai et al., 2006).
This biochemical signature of pathologically altered TDP-43 remains relatively preserved amongst the FTLD-U cases despite different genetic causes (GRN and VCP mutations) and pattern of deposition (TDP-43 types 1-4) as well as non-FTLD cases (Hippocampal sclerosis, DLB and AGD). Occasionally however, additional bands are reported. For instance, in Guam parkinsonism–dementia complex (G-PDC) cases, multiple bands are seen within the 30-35kDa and 22-28kDa range
35 (Hasegawa et al., 2007) and although not discussed, an additional band was also visible in the 30- 37kDa range in AD and CBD cases reported by Uryu et al. (2008). Davison et al. (2007) identified two C-terminal fragments ~24kDa and ~26kDa in a cohort of 37 patients with frontotemporal dementia while Rutherford et al. (2008) investigated TARDBP MND mutation cases and also identified two fragments with a molecular weight of approximately 35 and 25 kDa in lymphoblastoid cell lines. Further analysis is needed to clarify some of these inconsistencies.
Controls FTLD-TDP CBD G-PDC PiD FTLD (Types1-3) PSP GRN AD CBD mutation MND
Figure 13. Schematic representation of Western blot banding patterns of TDP-43 in normal and pathological cases. From left to right, Lanes 1-3 and 5 represent cleavage products found in the urea fractions extracted from brain tissue. Lanes 4 is a sarkosyl-insoluble fraction from brain tissue and Lane 6 is TDP-43 extracted from lymphoid cells. Lane 1 shows the full length TDP-43 present in normal controls and pathology cases. Lane 2 represents a banding pattern associated with FTLD-TDP (Types1-3) and AD. It shows a 45 kDa resulting from hyperphosphorylation and ubiquitination of the full length TDP-43, as well as a 25 kDa band representing a truncated product. A high molecular weight smear (*) and two additional bands at 30 and 37 kDa are also often present. Lane 3 represents CBD cases with TDP-43 pathology while Lane 4 is consistent with G-PDC where a variable number of low molecular weight bands are present within the 22-37 kDa range. The 30 and 37 kDa are often most prominent. Lane 5 shows an ~40 kDa band found in PiD, PSP and CBD cases without TDP-43 immunohistochemistry. Lane 6 shows a predominant 30 kDa cleavage product and two additional bands (~25 and ~28 kDa) found in lymphoid cells from FTLD-U, GRN mutation cases and MND cases.
36 The quantity of modified TDP-43 species roughly corresponds with TDP-43 density detected by immunohistochemistry as well as the region that it was obtained from. Igaz et al. (2008) recently demonstrated an increased representation of C-terminal TDP-43 fragments (CTF) in cortical and hippocampal regions compared to spinal cord motor neurons where the inclusions comprise mostly of full length TDP-43. This suggests that TDP-43 is differentially processed in brain versus spinal cord and that TDP-43 CTFs might seed inclusion formation and aggregation in cortical neurons (Igaz et al., 2008).
Tau- and TDP-43 proteinopathies represent more than 90% of cases of FTLD and related disorders (Josephs, 2008). The remaining proportion of cases encompasses FUS proteinopathies, D- synucleinopathies, and FTLD with no inclusions (FTLD-ni).
1.2.2.7 Fused in sarcoma/translated in liposarcoma proteinopathy (FTLD-FUS)
Fused in sarcoma/translated in liposarcoma is the latest sub-classification for FTLD-U. FUS is a ubiquitously expressed protein that binds to RNA and DNA and is involved in a number of cellular processes including cell proliferation, transcription regulation, RNA splicing and transport of RNA between intracellular compartments (Neumann et al., 2009a). FUS is found exclusively in glial nuclei and predominantly in the nuclei of neurons, however under pathological conditions, FUS redistributes from the nucleus to the cytoplasm where it forms Ub-ir NCI, vermiform NII and DNs. Additional inclusions are also seen in glial cells.
FUS pathology was first described in familial MND cases following the discovery of mutations in the FUS gene (Kwiatkowski et al., 2009; Vance et al., 2009). Since then FUS pathology has also been identified in a number of FTLD-UPS cases characterised by the presence of unusual NII of vermiform shape (Munoz et al., 2009) and subsequently in two rare subtypes of FTLD; neuronal intermediate filament inclusion disease (NIFID) and basophilic inclusion body disease (BIBD). Extensive FUS pathology has also been found in Huntington’s disease (HD) (Doi et al., 2008), spinocerebellar ataxia 1 (SCA1) and SCA3 where it forms characteristic NIIs (Woulfe et al., 2010).
37 Motor neuron disease
A definitive diagnosis of MND is made based on brain stem and spinal cord pathology which is characterised by motor system degeneration and loss of motor neurons in anterior horns and brainstem motor nuclei of cranial nerves VII, X, XII and most commonly hypoglossal nucleus (Pamphlett et al., 1995). At the level of the internal capsule and cerebral peduncles in the midbrain, degeneration of the corticobulbar and corticospinal tract is often detected while the lateral and anterior corticospinal tracts show axonal loss and decreased myelin staining. Finally, although sensory loss is usually not apparent during life, some individuals show mild degeneration of the mid- zone of the posterior sensory tracts (Donkervoort and Siddique, 1993).
Although an essential pathological feature of MND is motor neuron loss, affected motor neurons often contain characteristic inclusions in the perikarya, dendrites and axons which include hyaline masses, LB-like inclusions, granular eosinophilic Bunina bodies and Ub inclusions (Ub-i) (Figure 14). The Ub-i often appear as either filamentous skeins or as compact round bodies and can be either superoxide dismutase 1 (SOD1) immunoreactive in SOD1 mutation mediated MND (Shibata et al., 1996) or TDP- 43 and/or FUS-positive. TDP-43 and FUS inclusions have similar morphology and distribution pattern and are found in both, TARDBP or FUS mutation carriers as well as sporadic cases (Deng et al. 2010).
38 A
B C D
Figure 14. Motor neuron disease pathology. A. C7 cervical cord section showing symmetrical Wallerian degeneration of lateral and anterior corticospinal tracts. B. TDP- 43 immunopositive skein-like and C. punctate cytoplasmic inclusions within anterior horn cells of the spinal cord. D. Anterior horn cell showing Bunina bodies
In MND patients with dementia, numerous short, curved neurites and compact round, oval or crescenteric NCI are concentrated in superficial layers (II and III) of the neocortex and NCI are present in the dentate granule cells of the hippocampus. Similar pathology is also present in a subgroup of FTLD patients with no motor features and alternatively in patients with MND and no cognitive impairment (Pamphlett et al., 1995).
39 Neuronal intermediate filament inclusion disease *
Neuronal intermediate filament inclusion disease is a sporadic neurodegenerative disease with a variable clinical phenotype that includes FTLD, CBS and/or MND. Several cases have also had clinical and pathologic features that overlap with multiple-system atrophy. Studies indicate an early age at onset (mean age 40.8 years) and rapid disease progression where patients become mute and non-ambulatory and most die within 3 years of onset of symptoms (Josephs et al., 2003).
Both structural and functional imaging reveals frontal and to a lesser degree temporal lobe, parietal lobe and basal ganglia involvement (Cairns et al., 2004a). The affected areas show neuronal loss and astrocytosis. Until recently, the pathological hallmark of NIFID was the presence of filamentous intraneuronal inclusions immunopositive for neurofilament (NF) and/or D-internexin. Neurofilaments and D-internexin are type IV intermediate filaments (IF) that are abundant in the neuronal cytoskeleton (Ching and Liem, 1991). The inclusions are pleimorphic (Figure 15) with Pick-body like (PBL) inclusions being most abundant and are present in the cytoplasm and axons of affected neurons in the neocortex and underlying white matter of all lobes but most predominantly in the frontal and temporal lobes. The inclusions are negative for tau and D-synuclein, variably positive for Ub and most recently have been shown to be FUS immunoreactive (FUS-ir) (Cairns et al., 2004b; Neumann et al., 2009b). Relative to IF, FUS pathology is more abundant showing many more FUS-ir PBL, crescentic, annular and tangle-like NCI. In addition, previously unrecognised vermiform NIIs, aggregates of coarse cytoplasmic granules and GCIs are also consistently FUS-positive but IF- negative. NIIs are most numerous in the dentate granule cells while GCIs are common in the cerebral white matter and include small round bodies adjacent to the nucleus and small tangle-like inclusions. These findings have resulted in classification of NIFID into the FTLD-FUS molecular class of FTLD (Mackenzie et al., 2010).
* Neuronal intermediate filament inclusion disease is also known as neurofilament Inclusion body disease or neurofilament inclusion disease
40 A BCD
EF GH
Figure 15. Alpha-internexin immunopositive neuronal inclusions found in neurofilament inclusion body disease. A. A swollen achromatic neuron in the frontal lobe. B. A Pick-body like inclusion in the frontal lobe. C. A globose neurofibrillary tangle-like inclusion in layer V of the frontal lobe. D. A neuronal inclusion in the medial dorsal thalamus. E. A neurofibrillary tangle-like inclusion in a pyramidal neuron of layer III of the frontal lobe. F. A crescentic inclusion in the temporal lobe. G. Axonal spheroid in the spinal cord. H. An inclusion in a neuron in the cervical spinal cord (Figure adapted from Cairns et al., 2004b)
Basophilic inclusion body disease
Basophilic inclusion body disease is a rare disease whose clinical phenotype includes dementia and/or MND. BIBD was first associated with juvenile MND (Matsumoto et al., 1992; Nelson and Prensky, 1972; Oda et al., 1978), but has since been reported in adult-onset MND patients as well (Fujita et al., 2008; Kusaka et al., 1990; Kusaka et al., 1993; Sasaki et al., 2001). Macroscopically, BIBD is associated with degeneration in the frontotemporal cortex, caudate nucleus, substantia nigra and the spinal cord. Severe neuronal loss in the hippocampal pyramidal neurons has also been reported (Yokota et al., 2008). Immunohistochemistry reveals characteristic PBL, round cytoplasmic inclusions that stain as a basophilic mass with Nissl staining found in non-motor neurons as well as in motor neurons. Basophilic inclusions (BI) are FUS immunopositive and occasionally immunostain for Ub, but are immunonegative for tau, D-internexin and neurofilament (Cairns et al., 2007a; Munoz et al., 2009). Ultrastructurally, BI consist of a meshwork of thick filamentous structures (12-25 nm or 13- 17 nm in diameter) associated with granules (16-30 nm or 20-30 nm in diameter), occasionally containing other cytoplasmic organelles such as NF, mitochondria and vesicles (Munoz, 1998; Sasaki
41 et al., 2001). BIs are found predominantly in the basal ganglia and brainstem nuclei. Few inclusions are scattered in the cerebral cortex, hippocampus, subiculum, parahippocampal gyrus, amygdala and cerebellar dentate nucleus. In the spinal cord, they appear not only in degenerated anterior horn cells, such as central chromatolytic neurons, but also in normal-appearing large anterior horn neurons (Yokota et al., 2008). BIs are also occasionally found in the somata of the neurons of Clarke's column.
Independent of BIs, FUS immunohistochemistry also shows additional NCIs with numerous profiles including arciform, perinulcelar rings and flame-shaped NCI reminiscent of NFTs. Coiled body like and ovoid FUS immunopositive GCIs are also present, most commonly in the striatum, globus pallidus, cerebellar dentate nucleus and anterior horn. In the cerebral cortex, sparse, short thick contorted FUS-ir DN have also been reported. FUS positive NIIs have also been described but are relatively rare. Based on these findings, similarly to NIFID, BIBD is now considered as part of the FTLD-FUS classification (Mackenzie et al., 2010).
1.2.2.8 FUS biochemistry
The FUS protein is 526 amino acids long and is encoded by 15 exons (Lagier-Tourenne and Cleveland, 2009). The N-terminal domain is enriched in glutamine, glycine, serine and tyrosine residues (QGSY region). A glycine rich region, an RRM and multiple arginine/glycine/glycine (RGG) repeats have also been identified. The C-terminal contains a zinc finger motif and a nuclear localisation signal. Biochemical analysis of abnormal FUS consistently shows a major ~73 kDa band on Western blotting. Increased levels of full-length FUS protein in cytoplasmic and insoluble fractions roughly correlate with the severity of FUS pathology. Abnormal hyperphosphorylation, ubiquitination or additional protein bands thus far have not been identified (Neumann et al., 2009a).
1.2.2.9 FTLD with no inclusions
Clinical presentation of FTLD-ni (previously known as dementia lacking distinctive pathology) is consistent with frontal symptomatology that includes marked personality changes with loss of social and personal awareness, disinhibition, impulsiveness, hyperorality and stereotyped behaviour. Speech disorders are observed in 80% of cases that begin as verbal aspontaneity and repetitions of
42 limited phrases, and evolve to palilalia, echolalia and mutism. Temporospatial disorientation and memory impairment are less frequent and praxis and gnosis are strikingly preserved in most of the cases. As the disease progresses, there is a general cognitive deterioration characterized by a massive decline of higher cortical functions (Giannakopoulos et al., 1995).
FTLD-ni is extremely rare and is reserved only for cases in which there is evidence of frontal and temporal lobar atrophy with associated neuronal loss and gliosis and complete absence of lesions on hematoxylin and eosin, silver, and all other immunohistochemistry. Prion disease must also be excluded either by immunohistochemistry or molecular genetics. This diagnosis remains controversial as recent re-evaluation of previously diagnosed FTLD-ni cases with more sensitive Ub and TDP-43 immunohistochemical methods led to re-classification of majority of these cases into FTLD-U (Cairns et al., 2007a).
1.2.2.10 Alpha-synucleinopathies
Alpha-synucleinopathies comprise a diverse group of neurodegenerative diseases that include PD, DLB and PDD. Neuropathologically, D-synucleinopathies are characterized by the degeneration of populations of nerve cells that develop filamentous inclusions in the form of LB and Lewy neurites (LN).
LBs were first described by Forster and Lewy in 1912 but it wasn’t until 1961 that Okazaki speculated on their association with dementia (Forster and Lewy, 1912; Okazaki et al., 1961). A classical (brain stem) LB is an eosinophilic cytoplasmic inclusion that consists of a dense core surrounded by a halo of 10-nm wide radiating fibrils (Figure 16 C) while a cortical LB is less well-defined and lacks the halo. The primary structural component of LBs is D-synuclein, a synaptic protein which under normal physiological conditions has been implicated in the production of presynaptic vesicles (Kruger and Schulz, 2002; Spillantini et al., 1997). In LBD, PDD and PD however it becomes misfolded and forms aggregates.
The pathological hallmarks of PD are marked loss of dopaminergic neurons in the substantia nigra pars compacta (SNc), which causes dopamine depletion in the striatum (Figure 16 B), and the presence of LBs (Dickson et al., 2009). The majority of intracellular LB are found in pigmented
43 brainstem nuclei, the substantia nigra and are coupled with neural loss and gliosis (Hughes et al., 1993). In LBD, in addition to the loss of dopamine-producing neurons, loss of acetylcholine-producing neurons (in the basal nucleus of Meynert and elsewhere) associated with cerebral atrophy is also seen. The distribution of LBs is more dense and widespread and includes the brainstem as well as the neocortex, limbic cortex and subcortical nuclei (Perry et al., 1990). In many cases (occurring in up to 70% of cases), LB are associated with concurrent AD pathology. However, while AE and SP formation are common in DLB, tau pathology and NFTs are sparse (Hansen et al., 1993). In PDD, pathological changes are hardly distinguishable from DLB (Hurtig et al., 2000). Incidental LBs which increase with age, are also found on post-mortem in patients without clinical signs of parkinsonism.
Figure 16. Parkinson’s disease pathology. A. Normal substantia nigra. B. Depigmented substantia nigra in PD. C. A Lewy body (Frosch et al., 2005).
44 1.2.2.11 Summary
Overall, there is considerable heterogeneity between clinical syndromes and their associated underlying neuropathology. Some clinicopathological correlations are summarised in Figure 17, highlighting the difficulties in identifying the underling cause. Until acceptable ways of identifying the underlying pathology are discovered, appropriate targeted therapies will remain a challenge.
Figure 17. Associations between the various clinical syndromes and their underlying pathologies. Thick lines “ “ represent common associations; thin lines “ “ represent less common associations and dashed lines “- - -“ represent rare associations. bvFTD Behavioural variant frontotemporal dementia, CBS Corticobasal syndrome, NFTPD Neurofibrillary tangle-predominant dementia, SD Semantic dementia, PNFA Primary non- fluent aphasia, PSP-S Progressive supranuclear palsy syndrome, MND Motor neuron disease, AGD Argyrophilic grain disease, AD Alzheimer’s disease, PiD Pick’s disease, BIBD Basophilic inclusion body disease, TDP-43 TAR DNA Binding protein 43, NFTPD Neurofibrillary tangle-predominant dementia, NIFID Neuronal intermediate filament inclusion disease, MSTD Multiple system tauopathy dementia, PSP Progressive supranuclear palsy, CBD Corticobasal degeneration (Figure adapted from Boeve, 2007)
45 1.2.3 Genetics underlying neurodegenerative diseases
Identification of disease genes has been most successful in families with simple modes of genetic inheritance where linkage analysis can be employed. Indeed, over the years linkage analysis of familial forms of dementia has led to the identification of multiple chromosomal loci and subsequent candidate gene analysis has identified numerous causative and susceptibility genes. Identification of these genes has been crucial to our current understanding of the biological processes underlying neurodegeneration and has also provided important insights into the primary aetiologies underlying neuronal death in the more commonly encountered sporadic cases.
1.2.3.1 Alzheimer’s disease
Familial AD (FAD) is an autosomal dominant disease and accounts for 5-10% of all AD cases (Selkoe, 2001). A family history of an affected first degree relative increases the risk of developing AD 3.5 fold compared to those with no family history and children with 2 affected parents have an estimated risk of 54% of being affected with AD by the age of 80.
Amyloid precursor protein
Amyloid Precursor Protein (APP) is a ubiquitously expressed single transmembrane protein found in the dendrites, cell bodies and axons of neurons. It is encoded by a gene in the mid portion of the long arm of human chromosome 21 and is a member of a family that includes the amyloid-like proteins APLP1 and APLP2. APP exists in three principal isoforms of 695 (most abundant brain isoform), 751, and 770 amino acids, each of which contains the AE peptide sequence (Price, 2000). The AE peptides are derived through APP processing (Figure 18). A soluble form of APP (sAPPD) can be released from the cell surface by the proteolytic cleavage with the D-secretase enzyme. The remaining membrane-retained C-terminal fragment of 83 amino acids (C83) is sequentially cleaved by the J-secretase enzyme generating a P3 peptide and APP intracellular domain (AICD) (Esch et al., 1990). Molecules of APP that have undergone this cleavage cannot give rise to the AE fragment. AE is created when E-secretase (BACE-1) activity cleaves APP to generate sAPPE. Cleavage of the resultant 99-residue C-terminus (C99) by J-secretase at amino acid residues 711 or 713 leads to the release of AE40 (40 amino acids in length) and AE42 (42 amino acids in length) into the extracellular
46 space leaving AICD behind (Haass and Selkoe, 1993). AE40 is the most common form of the peptide (90%) and is less amyloidogenic compared to the AE42 which is less soluble, more neurotoxic and tends to aggregate rapidly to form amyloid deposits. The insoluble core of the senile plaques observed in AD cases contains both AE40 and AE42 while diffuse plaques are predominantly made up of AE42.
Figure 18. Amyloidogenic and non-amyloidogenic processing of the amyloid precursor protein. A. APP is a transmembrane protein with three potential cleavage sites for the enzymes: D-, E- and J-secretase. B. APP cleavage by D-secretase generates a soluble fragment (sAPPD) and a C-terminal fragment (C83). Subsequent cleavage of C83 by J-secretase results in P3 and APP intracellular domain (AICD). This does not give rise AE. C. Cleavage of APP by E-secretase results in soluble fragment (sAPPE) and C-terminal fragment (C99) which when subsequently cleaved by J-secretase generates AICD and the AE peptide. AE can aggregate and form fibrils. (Figure adapted from Frosch et al., 2005).
47 In 1990, Van Broeckhoven and colleagues mapped two unrelated early onset AD families to chromosome 21 close to the APP gene (Van Broeckhoven et al., 1990). The first pathogenic mutation (E693Q) was identified in Dutch patients with hereditary cerebral haemorrhage with amyloidosis (Levy et al., 1990). Soon after another mutation (I717V) was identified in an early onset AD pedigree (Goate et al., 1991). The 717 residue in APP is close to the J-secretase site, so it was hypothesized that mutations at this residue may have an effect on APP metabolism. Mutations adjacent to the D- secretase cleavage site and the E-secretase cleavage site were soon identified, confirming the idea that APP mutations altered protein processing (Hendriks et al., 1992; Mullan et al., 1992).
At present 30 mutations have been reported in APP (Alzheimer Disease & Frontotemporal Dementia Mutation Database; www.molgen.ua.ac.be/admutations). All the mutations are clustered in exons 16 and 17, located in close proximity to the major APP processing sites, either adjacent to the AE domain (the E- and J-secretase cleavage sites) or within the AE domain itself (D-secretase cleavage site). Mutations close to the E- and J-secretase cleavage sites alter the proteolytic processing of APP and result in either increased AE40/42 levels or an increased AE42/40 ratio (Brouwers et al., 2008). Some mutations can affect J-secretase cleavage by altering the structure of transmembrane architecture of APP (Zekanowski et al., 2004). Generally, typical early onset familial AD with classic AD pathology is associated with these mutations. Amyloid deposition in cerebral blood vessels in addition to the AD pathology is generally associated with intra-AE mutations. The resulting clinical manifestations are variable and include hereditary amyloid angiopathy with cerebral haemorrhage, AD with repeated stroke, dementia with severe amyloid angiopathy, or AD without stroke (Wakutani et al., 2004).
The premature occurrence of classical AD pathology in Down’s syndrome owing to elevated APP gene dosage (Trisomy 21) has been recognized for many years, however it wasn’t until recently that APP duplications in families with a variant of AD have been discovered demonstrating that APP overexpression can also cause AD (Rovelet-Lecrux et al., 2006).
48
Presenilins
Presenilins are transcribed in both the CNS and non-neuronal organs and are involved in a range of biological processes which include WNT and G-protein mediated signaling, Fas-induced apoptosis, cell adhesion, protein trafficking, tau phosphorylation, calcium regulation and proteolysis of Notch (Fortini, 2002). Presenilin 1 (PSEN1) and presenilin 2 (PSEN2) form the active sites of the J- secretase complex involved in APP processing.
Presenilin 1 gene (PSEN1) is located on chromosome 14q24.2 and consists of 13 exons (10 coding) with three alternatively spliced variants coding for a 463 residue protein. The presenilin 1 (PS1) protein contains 9 transmembrane (TM) domains, with a hydrophilic loop between the sixth and seventh domain. The conserved aspartate residues Asp257 in TM6 and Asp385 in TM7, appear to contain the active site of PS1 that contributes to J-secretase activity and the region between the two residues is critical for PS1 endoproteolysis (Wakabayashi and De Strooper, 2008).
Presenilin 2 gene (PSEN2), is located on chromosome 1q42.13, consists of 12 exons (10 coding) and codes for a 447 amino acid protein which shares 67% homology with PS1 (Levy-Lahad et al., 1995).
Under physiological conditions presenilins are cleaved into an aminoterminal fragment (NTF) and the carboxyterminal fragment (CTF) which dimerise to form the active functional presenilin heterodimer (Podlisny et al., 1997; Thinakaran et al., 1996). The heterodimers are then incorporated into high molecular weight oligomer containing three other proteins: nicastrin, anterior pharynx-defective-1 (APH-1) and presenilin enhancer-2 (PEN-2) (collectively known as the J-secretase complex) (Kimberly et al., 2003). The mature complex predominantly exists at the cell surface regulating the cleavage of a number of single transmembrane domain proteins but is also found to reside in the membranes of the ER and Golgi apparatus (Newman et al., 2007).
PSEN1 mutations are the major cause of FAD, accounting for 18-55% of families. Compared to the 389 families with 175 PSEN1 mutations, mutations in PSEN2 are much rarer with just 14 having been
49 described in only 23 families (Alzheimer Disease & Frontotemporal Dementia Mutation Database). The majority of missense mutations identified in FAD are distributed across highly conserved regions of the entire gene with some clustering around putative transmembrane domains (Fraser et al., 2000). A large population of mutations are found in exon 5 which resides in TM2 of PS1 and PS2 accounting for ~21% of PSEN1 mutations and ~40% of PSEN2 mutations. Mutations are also spread between TM domains 1-6 and also in the N- and C-terminus in PSEN1 while PSEN2 mutations are most common within regions coding for TM domains 2 and 5 (Kowalska, 2004). A mutation in the N- terminus of PSEN2 of a sporadic AD case has also been identified.
PSEN mutations disturb presenilin oligomerisation and interactions with other proteins in the J- secretase complex through conformation changes that affect APP processing and alter the AE42/40 ratio either through an increase in AE42 or decrease in AE40 (Newman et al., 2007).
Apolipoprotein E
Apolipoprotein E is a constituent of many types of lipoproteins and plays a major role in the distribution and metabolism of cholesterol and triglycerides within different organs and cell types by binding to specific receptors and regulating uptake of these lipoproteins. In addition to maintaining lipid homeostasis, ApoE also plays a role in repairing injured neurons, maintaining synaptodendritic connections, and scavenging toxins (Beffert et al., 1998). ApoE is highly expressed in the liver but is also found in other tissues such as the brain, kidneys, and spleen. In the brain ApoE is predominantly synthesized and secreted by astrocytes and microglia, while neurons preferentially express the receptors for ApoE.
The APOE gene is mapped to chromosome 19q13.32, consists of four exons and codes for a 34kDa, 229 amino acid protein. APOE is polymorphic with three major isoforms, ApoE2, ApoE3, ApoE4, which differ from each other only by single amino acid substitutions at positions 112 and 158, where apoE3 contains a cysteine and an arginine respectively, ApoE2 contains cysteine and ApoE4 arginine at both positions. These substitutions affect the three dimensional structure and the lipid- binding properties between the isoforms so that ApoE4 binds preferentially to very low density lipoproteins while ApoE2 and E3 bind preferentially to high-density lipoproteins (Mahley et al., 2006).
50 The E4 variant is the best known genetic risk factor for late-onset AD in a variety of ethnic groups. While ApoE4 is not a determinant of the disease, 40-65% of AD patients have at least one copy of the E4 allele and patients homozygous for the E4 allele have up to 15 times greater risk of developing AD (Corder et al., 1993). The E2 isoform, on the other hand has been shown to be protective, although not every study could replicate these findings. In addition to the three major protein isoforms, four promoter variants influencing ApoE expression levels have also been shown to affect AD risk (Brouwers et al., 2008).
The exact mechanism of how E4 leads to AD remains to be fully determined, however some evidence suggests an interaction with amyloid where ApoE4 has been shown to bind AE peptides with higher avidity compared to E3. In addition, there is a high correlation between E4 and AE burden in the brains of AD patients (Rebeck et al., 1993; Schmechel et al., 1993) suggesting that ApoE enhances plaque deposition. Other experimental evidence suggests that there is an ApoE-dependent degradation of AE (Bales et al., 2002). Some isoforms of ApoE and in particular ApoE4 are not as efficient as others at catalyzing these reactions and therefore impair AE clearance resulting in increased vulnerability to AD in individuals with that gene variation.
ApoE is also thought to be involved in signal transduction mechanisms such as mediating changes in neuronal calcium (Ca2+) flux. Ca2+ promotes both APP processing and alters tau phosphorylation. ApoE3 but not ApoE4 interacts with tau suggesting that ApoE3 prevents tau’s hyperphosphorylation, thus allowing it to function normally in stabilisation of microtubular structure and function. In the presence of ApoE4, tau could become hyperphosphorylated and promote the formation of NFTs (Cedazo-Minguez and Cowburn, 2001).
ApoE4 is also associated with impaired CNS glucose utilisation compared to the ApoE3 protein (Reiman et al., 2001; Reiman et al., 2004) and patients with probable AD or bvFTD that are also ApoE4 carriers appear to have more severe brain atrophy in disease specific regions compared with non-carriers (Agosta et al., 2009).
Finally, there is growing evidence that cholesterol plays a role in AD pathogenesis. For instance, cholesterol mediates APP cleavage and AE production. Compared to ApoE2, ApoE4 was shown to
51 be least efficient at inducing cholesterol secretion in a number of cell models indicating that it may lead to cytotoxic levels of cholesterol (Michikawa et al., 2000).
1.2.3.2 Parkinson’s disease
In general, PD is considered to be a sporadic disease with only an estimated 5-10% of PD cases having a clear familial aetiology, exhibiting a classical recessive or dominant Mendelian mode of inheritance. Over the last decade, 15 PD genetic loci and 11 genes have been described and are summarised in Table 4 (Hatano et al., 2009).
Table 4. Summary of Parkinson’s disease-associated genes Locus Inheritance Gene Onset PARK1/4 4q21.3-q22 Dominant SNCA Around 40 PARK2 6q25.2-q27 Recessive Parkin <40 PARK3 2p13 Dominant Unknown 35–89 PARK5 4p13 Dominant UCHL1 ~50 PARK6 1p36.12 Recessive PINK1 32 ± 7 PARK7 1p36 Recessive DJ-1 27–40 PARK8 12q12 Dominant LRRK2 ~65 PARK9 1p36 Recessive ATP13A2 11–16 PARK10 1p Dominant? Unknown 65.8 PARK11? 2p37.1 Dominant? GIGYF2 Late PARK12 Xq21-q25 X-linked Unknown Late PARK13? 2p13.1 Dominant HTRA2/OMI Late PARK14 22q13.1 Recessive PLA2G6 20–25 PARK15 22q11.2-qter Recessive FBXO7 10–19
Alpha-synuclein is a major component of LBs in PD and was the first gene identified to carry mutations associated with this disorder (Polymeropoulos et al., 1997). Later studies reported duplications and triplications of the D-synuclein gene (SNCA) in familial PD suggesting that both a toxic gain function of mutant protein as well as SNCA overexpression could lead to PD pathology (Ahn et al., 2008; Chartier-Harlin et al., 2004; Ibanez et al., 2004; Nishioka et al., 2006; Singleton et al., 2003). Mutations in the leucine-rich repeat kinase-2 (LRRK2) gene are the most common cause of autosomal-dominantly inherited familial PD (Hatano et al., 2009). To date approximately 20 putative pathogenic mutations have been identified (Lu and Tan, 2008) with the G2019S mutation
52 occurring at the highest frequency accounting for ~40% of familial and sporadic PD in the Arab population of North Africa (Lesage et al., 2006), and ~20% of familial and sporadic PD in Ashkenazi Jewish populations (Ozelius et al., 2006). Autosomal-recessive, early onset PD (before the age of 40) is most commonly associated with mutations in the Parkin gene (PARK2) (Hatano et al., 2009). The parkin protein is a component of a multiprotein E3 Ub ligase complex which in turn is part of the UPS that mediates the targeting of substrate proteins for proteasomal degradation. Most patients with PARK2 mutations do not have LBs despite Parkin (ligase) having been shown to interact with D-synuclein (Hatano et al., 2009).
Overall analysis of the different gene products revealed that PD-associated genes play important roles in cellular functions such as mitochondrial functions, protein degradation pathways such as the UPS and chaperone mediated autophagy-lysosomal pathway and membrane trafficking and axon guidance. In addition, recent evidence suggests that some PARK2 gene products are active in the same pathways within the cell. For instance, one study showed that both PTEN-induced kinase 1 (PINK1) and Parkin both affect mitochondrial function, while Parkin and DJ1, LRRK2 and D-synuclein interact with one another (Hatano et al., 2009).
1.2.3.3 Motor neuron disease
Although, the majority of MND cases are sporadic, ~10% of patients have a family history, typically with an autosomal dominant pattern of inheritance (Strong et al., 1991). On clinical and pathological grounds, most cases of familial and sporadic MND are indistinguishable from one another. Therefore, the principles underlying neurodegeneration discovered through gene analysis in familial cases can be applied to understanding the mechanisms underlying sporadic neuronal death.
Familial MND is extremely genetically heterogenous. To date, mutations have been reported in superoxide dismutase-1 (SOD1) (Rosen et al., 1993), synaptobrevin-associated protein B (VAPB) (Nishimura et al., 2004), a DNA/RNA helicase that causes juvenile MND (Chen et al., 2004), alsin (ALS2) (Hadano et al., 2001; Yang et al., 2001), dynactin (DCTN1) (Munch et al., 2004; Puls et al., 2003), angiogenin (ANG) (Greenway et al., 2006), TARDBP (Sreedharan et al., 2008) and FUS
53 (Kwiatkowski et al., 2009; Vance et al., 2009). SOD1 which accounts for a large proportion of familial MND cases and the most recently identified genes TARDBP and FUS are detailed below.
Superoxide dismutase 1
Linkage to chromosome 21q22 led to the identification of mutations in the Cu/Zn superoxide dismutase gene which account for approximately 12-25% of familial cases and only 2% of all MND cases (Cudkowicz et al., 1997; Rosen et al., 1993; Siddique et al., 1991). SOD1 is an enzyme that metabolises superoxide radicals to molecular oxygen and hydrogen peroxide and therefore is important in antioxidant defence in nearly all cells exposed to oxygen.
The SOD1 gene has 5 exons and codes for a 153 amino acid, 32kDa protein. SOD1 is predominantly located in the cytoplasm but also in the mitochondrial intermembrane space, nucleus, and peroxisomes where it forms a homodimer with a reactive centre consisting of copper and zinc.
Mutations in SOD1 were first identified by Rosen et al. in 1993. They identified 11 different heterozygous mutations in 13 different families with amyotrophic lateral sclerosis. The authors presented 2 possible mechanisms by which mutations in SOD1 could cause the disorder: decreased SOD1 activity leading to the accumulation of toxic superoxide radicals, or increased SOD1 activity leading to excessive levels of hydrogen peroxide and a highly toxic hydroxyl radical. It is now apparent that SOD1 mutations lead to toxic-gain of function pathology as SOD1 knockout mice fail to yield a phenotype while transgenic mice that overexpress mutant SOD1 develop a motor neuron phenotype (Gurney et al., 1994; Howland et al., 2002; Valdmanis and Rouleau, 2008).
Currently more than 140, predominantly missense, mutations are described that are spread across all five exons of the gene. Most of the mutations are single base substitutions leading to an amino acid substitution of every possible nature (i.e. charge reversal, charge increase or decrease, from hydrophobic to hydrophilic, different residue size, etc.). The most common mutation is the substitution of alanine for valine at codon 4 (A4V) in exon 1 occurring in 50% of families followed by a substitution of isoleucine for threonine at codon 113 (I113T) occurring in ~12% of families (Cudkowicz et al., 1997). Some of these mutations lead to conformational changes by altering conserved interactions
54 critical to the beta-barrel fold and dimer contact of the protein resulting in reduced ability of SOD1 to dimerise, and chelate copper ions (Deng et al., 1993). Others change the catalytic activity of SOD1 enzyme leading to production of toxic oxygen species resulting in peroxidation of cytoplasmic membranes. Other pathogenic mechanisms suggested include disordered Ub-associated protein degradation and increases in sensitivity for pro-apoptotic stimuli (Beck et al., 2007).
Occasionally, specific mutations are associated with a particular phenotype. For instance, the A4V, H43R, L84V, G85R, N86S, N86K and G93A mutations have been associated with rapid disease progression and survival times shorter than 3 years (Beck et al., 2007). On the other hand mutations G37R, G41D, H46R, and E100K confer a significantly longer mean duration of at least 17 years (Cudkowicz et al., 1997; Donkervoort and Siddique, 1993; Juneja et al., 1997). Clinical presentation can occasionally be correlated with SOD1 mutations. For example, symptomatic persons with A4V and V148 mutations often have few upper motor neuron findings, while persons with the D90A mutation can present with ataxia (Cudkowicz et al., 1998).
TAR DNA binding protein
The recently discovered 43kDa protein, TDP-43 is encoded by the 6 exon gene TARDBP located on chromosome 1p36.22. The first pathogenic mutations were discovered in an autosomal dominant MND family (ALS85) and in two sporadic MND patients from two independent cohorts (Sreedharan et al., 2008). The mutations led to increased fragmentation of TDP-43 and apoptosis in embryos expressing mutant TDP-43 suggesting a toxic gain of function or a dominant negative effect of abnormal TDP-43. Since then 17 different mutations have been identified (Daoud et al., 2009; Gitcho et al., 2008; Kabashi et al., 2008; Kuhnlein et al., 2008; Rutherford et al., 2008; Van Deerlin et al., 2008). The vast majority (15) are located in exon 6 which codes for the highly conserved region of the C-terminus (Figure 19). With the exception of one mutation (Y374X) which is a frameshift mutation creating a premature stop codon, all the rest are missense mutations. Many of the mutations have been predicted to increase TDP-43 phosphorylation via the numerous potential phosphorylation sites in the C-terminal. This in turn may interfere with protein-protein interactions, transport through the nuclear pore, or exon skipping and splicing inhibitory activity. The stop codon mutation removes the last 41 amino acids of TDP-43 which may alter or abrogate the interaction of the C-terminal with
55 members of the heterogenous nuclear ribonuclear A and B protein families with well known splicing inhibitory properties (Kuhnlein et al., 2008). The other 2 mutations include D169G which is located in the first RNA recognition motif and therefore may abrogate RNA binding (Kabashi et al., 2008), and the (c.1462T>C) variant which was found in 3’UTR region however its pathogenicity is yet to be confirmed. Two silent changes (Ala66 and Ala315) have also been reported however it is unlikely that they play a significant role (Kabashi et al., 2008).
Figure 19. Schematic diagram of the TAR DNA Binding Protein-43 gene and its corresponding protein. A. Gene structure of TARDBP indicating untranslated exons in purple and coding exons in blue. B. The corresponding protein structure indicating the RNA-recognition motifs 1 and 2 (RRM1 and RRM2) in green and regions responsible for RNA binding, the nuclear export sequence (NES) in yellow and the heterogeneous nuclear ribonucleoprotein (hnRNP) domain in red.
Fused in sarcoma/translated in liposarcoma gene
Mutations in the FUS gene were first identified in MND families that mapped to chromosome 16 and are now thought to be the second most common cause of familial MND after SOD1 (Kwiatkowski et al., 2009; Vance et al., 2009; Yan et al., 2010). Thus far, 29 FUS mutations have been described in 62 families and account for ~4% of all familial MND cases (Yan et al., 2010). Mutations in sporadic MND and FTLD with PD and/or MND have also been identified but are very rare.
To date, the vast majority of mutations described are missense mutations with the R521C mutation being most commonly reported (Kwiatkowski et al., 2009; Vance et al., 2009). The mutations tend to cluster in two regions of the FUS gene: one in exons 4 to 6 and the other in exons 14 to 15 implying the functional importance of these regions in triggering neurodegeneration (Yan et al., 2010). The extreme C-terminus of the protein, which harbours many of the mutations, encodes for a nonclassic
56 nuclear localisation sequence which when truncated or mutated results in FUS redistribution and inclusion formation characteristic of that seen in affected neurons of MND cases (Waibel et al., 2010). While functional studies are needed to clarify the exact mechanisms that lead to neuronal death, it is plausible that FUS redistribution and accumulation could lead to its loss of function and therefore affect transcription, mRNA splicing and mRNA transport. In addition, mutated or truncated forms of FUS may acquire novel toxic functions (Waibel et al., 2010)
1.2.3.4 Frontotemporal lobar degeneration
A family history of dementia is present in up to 40% of FTLD patients, implicating a strong genetic influence (Pickering-Brown et al., 2008). Familial FTLD presents as a complex array of clinical manifestations often accompanied by motor syndromes such as parkinsonism, CBS, PSP-S and MND and occasionally by Paget’s disease with Inclusion Body Myopathy. As a result, such families remained as difficult-to-classify progressive neurodegenerative disorders for many years. In 1994, Wilhelmsen et al. published a family with features of disinhibition, dementia, parkinsonism and amyotrophy with linkage to chromosome 17. This stimulated genetic analysis of other complex families and ultimately led to the discovery of the first FTLD gene - MAPT. Since then 6 additional chromosomal loci have been identified including chromosome 3, 9p (2 loci), 9q, 17q21 (2 loci), and 17q24 (Pickering-Brown, 2007). Genes identified to date have led to major progress in our understanding of mechanisms underlying neurodegeneration.
Chromosome 17q21 and frontotemporal lobar degeneration
Linkage of multiple families to chromosome 17q21-22 prompted their classification into what is now known as FTD and parkinsonism linked to chromosome 17 (FTDP-17) (Foster et al., 1997). However, despite their collective name these families differ both in the type of underlying pathology and presence of mutations in either the MAPT or GRN gene both of which are located in this region. Patients belonging to this group of families can present with an extraordinary variety of clinical features including bvFTD, PNFA, SD, AD, CBS, PSP and parkinsonism (Foster et al., 1997; van Swieten and Heutink, 2008). Because of such diversity in symptoms, distinguishing between the
57 families based on clinical presentation alone is immensely difficult. However there are subtle differences that may be more indicative of mutations in one gene over the other.
FTDP-17 and microtubule mssociated protein tau
The average age of onset for MAPT mutations carriers is 55 years (range: 40 to 60) but occasionally patients <40 and >70 years old are also reported (van Swieten and Spillantini, 2007). Penetrance appears to be almost 100% and the duration of symptoms is typically 8-10 years (Seelaar et al., 2008; van Herpen et al., 2003). The principal clinical features include symptoms consistent with bvFTD (most commonly disinhibition and complex compulsive behaviour), cognitive impairment, and motor disturbances. Language impairment is most commonly associated with semantic features and memory impairment is rare. Motor disturbances are principally parkinsonian-like extrapyramidal disorders including PSP and CBS.
The tau gene is located on chromosome 17q21, spans ~100 kilobases and contains 15 exons. The major tau protein in the human brain is encoded by 11 exons. At present 43 different confirmed pathogenic mutations in MAPT have been identified in over 127 families and account for around 30% of familial FTLD cases (Alzheimer Disease & Frontotemporal Dementia Mutation Database). The majority of mutations occur in the coding region of tau and includes deletions, missense and silent mutations. Most of these are located in the MT-binding domain (exons 9-12) and close to it (exon 13) (van Swieten and Spillantini, 2007). Mutations in exons 1, 9, 12 and 13 affect all six tau isoforms and reduce the ability of tau to promote MT assembly by reducing the affinity of tau for MTs (Hong et al., 1998). The increased proportion of unbound tau aggregates and forms filaments. The same mechanism applies to certain mutations in exon 10, however these affect only 4R tau isoforms or their expression (van Swieten and Spillantini, 2007). A reduction in MT binding has also been reported for two additional mutations in exon 1 of tau (Hayashi et al., 2002; Kodama et al., 2000).
Intronic mutations are also common, and are located close to the splice-donor site of the intron following exon 10 and effect mRNA splicing and lead to altered ratios of tau isoforms. Most intronic mutations and some exonic mutations lead to splicing-in of exon 10 by either disrupting the secondary structure of the mRNA splice site or by disrupting the splicing regulatory sequences. This
58 in turn leads increased expression of four-repeat tau which assemble into filaments (Lee et al., 2001). On the other hand, 3R tau predominates in patients with mutations that increase the splicing-out of exon 10 by altering a splicing silencer sequence (Stanford et al., 2003). Several mutations affecting tau-MT interactions also have pro-fibrillogenic effects leading to the aggregation of specific tau isoforms (Goedert et al., 1999).
The type of mutation and their location can also be correlated to some degree with certain morphology and distribution of tau filaments and tau deposits. For example, missense mutations located outside of exon 10 often result in predominantly neuronal tau pathology compared to mutations in exon 10 which lead to both neuronal and glial tau inclusions (Rademakers and Hutton, 2007). The exceptions being two exon 10 mutations and two others that result in abundant glial deposition, which prevail over neuronal involvement. Neuronal pathology characterised by NFTs and paired helical and straight filaments indistinguishable from those seen in AD has also been described and results from mutations in exons 12 and 13. However, the majority of coding region mutations (three in exons 9 and 12, one in exon 10 and two in exons 11 and 13) are characterised by the presence of numerous Pick body-like inclusions (Pickering-Brown, 2007). These mutations as well as mutations in exon 1 are most often associated with the dementia-dominant phenotype without motor symptoms while the parkinson-plus predominant phenotype most often results from intronic and exonic mutations affecting exon 10 (Ingram and Spillantini, 2002).
FTDP-17 and progranulin
Compared to MAPT mutations the age at onset within families with GRN mutations is older and more variable. It ranges from 35 to 89 years with the mean age of about 60 years (van Swieten and Heutink, 2008). Disease duration can extend from 3 to 22 years with and average of 6-7 years (Pickering-Brown et al., 2008). In addition, unlike MAPT mutations where incomplete penetrance is rare, GRN mutation carriers develop symptoms only 90% of the time by the age of 70 (Gass et al., 2006). In addition, phenocopies, without GRN mutations, occasionally appear in families affected by FTLD (Mukherjee et al., 2006).
59 The most common phenotype in GRN mutation carriers is bvFTD, compared to MAPT mutation carriers where apathy and social withdrawal are more prominent. Clinical diagnoses such as probable AD, PPA, and CBS are much more frequent amongst GRN mutation carriers than MAPT. They are also much more variable among affected individuals regardless of whether they inherit the same or different mutation. Early memory impairment is quite common and so dominant that initially it may suggest AD as a diagnosis (van Swieten and Heutink, 2008). Language dysfunction (often PNFA), delusions and visual hallucinations can also be prominent features early in the disease and have been reported to occur in up to 25% of GRN mutations carriers (Josephs et al., 2007; Le Ber et al., 2008). Extrapyramidal features are common and most often consistent with CBS although rare presentations of PD and PSP-S have also been reported (van Swieten and Heutink, 2008). GRN mutations are typically characterised by type 3 TDP-43 proteinopathy.
Progranulin (GRN) is a 593 amino acid glycoprotein encoded by the GRN gene located on chromosome 17q21.31. GRN contains 13 exons, 12 of which are coding. Full-length as well as several shorter transcripts are produced through alternative splicing. The resulting biologically active precursor protein which consists of 7.5 repeats of highly conserved 12 cysteinyl motifs undergoes proteolytic cleavage producing a variety of active granulin peptides (Bhandari et al., 1992; Zhu et al., 2002). GRN is a widely expressed pluripotent growth factor found in lymphoid tissue, gastrointestinal mucosa, spleen, and skin epithelium of adult rodents (Bhandari et al., 1992; Daniel et al., 2000). By activating signalling cascades that control cell cycle progression and cell motility, it plays a role in processes such as development, wound repair and inflammation (He et al., 2003). It has also been implicated in tumourogenesis (He and Bateman, 2003). GRN is also highly expressed in neurons of the cerebral cortex, the hippocampus and in the cerebellum where it could potentially play an important role in promoting neuronal survival and stimulating neuritic outgrowth (Daniel et al., 2000).
Interest in GRN and its function in the CNS has grown tremendously since two groups of researchers reported mutations in the GRN gene associated with FTLD. Since 2006, more that 50 different mutations have been identified scattered across the entire gene and include a variety of genetic alterations (Alzheimer Disease & Frontotemporal Dementia Mutation Database). Most commonly the mutations are either small insertions or deletions generating a frameshift. Nonsense and missense mutations have also been reported along with several intronic mutations affecting splice donor sites
60 resulting in splicing out of distinct exons (Rademakers and Hutton, 2007). These mutations result in mutant mRNAs with premature translation termination codons leading to degradation by nonsense- mediated decay. This prevents expression of truncated proteins and results in haploinsufficiency (Baker et al., 2006; Gass et al., 2006). Other mutations that lead to haploinsufficiency include mutations in exon 0 that lead to nuclear degradation and mutations that affect the Kozak sequence preventing GRN translation (Baker et al., 2006; Cruts et al., 2006; Gass et al., 2006). Finally, one unusual missense mutation (A9D) in the signal peptide affects its hydrophobic core disrupting the normal insertion of the protein into the ER membrane. The mutant protein remains trapped within the Golgi apparatus resulting in 50% less secreted protein (Mukherjee et al., 2008). The most common mutation in FTLD is R493X nonsense mutation in exon 11, which to date has been identified in 37 patients and 30 genealogically unrelated families in the UK, Canada, Australia and US. Interestingly, an intronic polymorphism (rs9897526) has been shown to affect the age at onset in R493X mutation carriers and later in another cohort. It is thought to potentially play a role in controlling alternative splicing or expression levels (Rademakers et al., 2007). Two GRN sequence variants have also been described in FTLD-MND patients however until their pathogenicity is established, FTLD-MND is very unlikely to be part of the GRN mutation disease spectrum.
Thus far all pathogenic GRN mutations reduce the levels of functional GRN and granulins and therefore it is not surprising that abnormal pathology involving GRN is absent in GRN mutation carriers. Invariably, pathology is consistent with type I TDP-43 pathology described above. While the function of GRN in the CNS is not yet fully understood, in a recent study suppression of GRN expression was shown to favour caspase-dependent cleavage of TDP-43 leading to it’s accumulation (Zhang et al., 2007). Overall, GRN mutations account for ~5-10% of patients with sporadic FTLD and ~20% with familial FTLD (Liscic, 2009).
Chromosome 3 and frontotemporal lobar degeneration
In 1995, Brown at al. reported linkage of a large kindred from the Jutland region in Denmark to the pericentromeric region of chromosome 3 (FTD-3) (Brown et al., 1995). To date only this family from Denmark has been linked to this region. The average age at onset is 57 years typically characterised by subtle personality and behavioural changes. As the disease progresses patients become
61 disinhibited, apathetic, develop stereotyped behavioural routines and gradually lose spontaneous speech until they become mute. Their emotional responses are often inappropriate and occasionally aggressive behaviour also becomes apparent. Memory loss and dyscalculia present early in the course of the disease. Hyperorality and urinary incontinence are also common. Later in the course of the disease most patients develop a motor syndrome consistent with parkinsonism, dystonia, hyperreflexia, pyramidal signs, and myoclonus. Three reported cases have features reminiscent of CBS (Ashworth et al., 1999; Brown, 1998; Gydesen et al., 2002; Gydesen et al., 1987).
On imaging, a global pattern of atrophy is observed. Several patients also show a reduction in global blood flow early in the course of the disease suggesting widespread deficits at an early stage. Pathologic examination consistently reveals global cortical and central atrophy most prominent in the frontal lobes with milder changes in the parietal and basal temporal cortex (Gydesen et al., 2002). Microscopically, neuronal loss, microvacuolation and astrocytic gliosis is present. Diffuse loss of myelin in the white matter with atrocytosis. Immunohistochemistry reveals a highly consistent pattern of pathology with Ub/p62 positive but TDP-43 negative inclusions. The most characteristic feature is the presence of mostly well-defined, round and solid NCIs in the dentate granule cells of the hippocampus. Rare, granular NCI in layer II of the frontal and temporal cortex are also present in some but not all of the cases. NFTs were also present in the hippocampus, entorhinal cortex and transentorhinal cortex corresponding to Braak stage IV characteristic of tangle only dementia (Holm et al., 2007).
Chromatin modifying protein 2B gene
Chromatin modifying protein 2B (CHMP2B) gene is located on chromosome 3 (3p11.2) and encodes for a 213 amino acid protein which is a component of the heteromeric ESCRT-III complex (Endosomal Sorting Complex Required for Transport III) (Martin-Serrano et al., 2003). ESCRT-III functions in the recycling or degradation of cell surface receptors. CHMP2B is expressed in multiple human tissues and in neurons of all major regions of the brain including the frontal and temporal lobes. The first CHMP2B mutation was described in the FTD-3 family in 2005 (Skibinski et al., 2005). The mutation (G to C) is located in a highly conserved splice site consensus sequence in exon 6 which leads to aberrant mRNA splicing and the production of two abundant splice variants. One
62 variant results from a 36 amino acid deletion creating a C- altered tail of one Val-residue and the other results from a 10bp deletion producing a C-truncated protein with 29 residues of nonsense sequence. Overexpression of these mutants causes CHMP2B accumulation on the outer membrane of enlarged, dysmorphic endosomes. Other evidence from cell culture experiments shows that CHMP2B overexpression impairs autophagic clearance which leads to the formation of large p62- postive but TDP-43 negative Ub-i (Holm et al., 2007). Since its discovery many laboratories have undertaken CHMP2B mutation screening in their FTLD cohorts but only a modest number of mutations have been reported including missense mutations in one sporadic case of SD, one case of MND with sings of FTLD, another case with progressive muscular atrophy and one patient with CBS (Parkinson et al., 2006; Skibinski et al., 2005; van der Zee et al., 2007). More recently a new branch of the FTD-3 family was discovered where an identical mutation to FTD-3 was found in 2 affected FTLD patients (Lindquist et al., 2008). In addition, a novel nonsense mutation in a Belgian familial FTLD patient was also found (van der Zee et al., 2008). Similarly to the FTD-3 mutation, this mutation also leads to a C-terminal truncation of CHMP2B. However, the identification of another protein- truncating mutation in 2 unaffected members of an Afrikaner family with FTLD, but not in their affected relatives puts into question the pathogenicity of such mutations (Momeni et al., 2006). In addition, several studies have failed to show any increased risk for FTLD associated with CHMP2B mutations. Overall, with only a few mutations identified worldwide and some uncertainty about their pathogenicity, more evidence is required to further establish CHMP2B as the real causative gene of FTLD.
Chromosome 9 and frontotemporal lobar degeneration
Inclusion body myopathy with Paget’s disease of bone and frontotemporal dementia
A rare but significant association to the p arm of chromosome 9 has also been established in families with FTLD in combination with inclusion body myopathy and Paget’s disease. Inclusion body myopathy (IBM) with Paget’s disease of bone and frontotemporal dementia (IBMPFD) is a clinical triad of variable penetrance that is inherited in an autosomal dominant fashion and was first mapped to chromosome 9p21-p12 in 2001 (Kovach et al., 2001). Subsequent investigations led to the identification of mutations in the VCP gene (Watts et al., 2004).
63 The most common clinical feature is myopathy present in ~88% of affected individuals. Proximal and distal muscle weakness clinically resembling limb girdle muscular dystrophy is characteristic of IBM and usually onsets at ~43 years (Kimonis et al., 2008). Less commonly observed in ~46% of patients is Paget’s disease of bone. With age at onset ~42 years it is characterised by elevated alkaline phosphatase and distribution of pathology in the spine, pelvis, and skull (Kimonis et al., 2008). Typical clinical presentation of FTLD (language and/or behavioural dysfunction) is only present in ~38% of affected individuals and onsets significantly later than both IBM and Paget’s (55 years) (Kimonis et al., 2008). Interestingly, as with GRN mutation cases, visual and auditory hallucinations have also been reported in some individuals. Myocardial failure was also noted in more than one unrelated family therefore it may be of significance (Gidaro et al., 2008; Hubbers et al., 2007).
On postmortem examination, patients have variable cerebral atrophy, ranging from mild, focal atrophy involving the frontal or medial temporal lobes, to severe, diffuse atrophy. Microscopically, variable superficial spongiosis, neuronal loss, and gliosis can be seen in the neocortex and limbic structures. Atrophy of the hippocampus and amygdala has also been reported. Subcortical nuclei, cerebellum, and brainstem remain preserved and subtantia nigra shows no loss of pigmentation. Neuropathologically, VCP mutation carriers are characterised by a distinct pattern of Ub/TDP-43 deposition. Typically, NIIs (with a distinct lentiform or rod shape) and DNs are most abundant in the neocortex (upper cortical layer) with the superior/middle temporal gyri most consistently affected. Frontal, parietal and occipital lobes are also affected to varying degrees. The labelling intensity of nuclear TDP-43 has also been noted to be significantly reduced in those areas. The pathology is less prominent in the limbic and subcortical nuclei with only rare NIIs noted in pyramidal neurons of the hippocampus and in small granular cells of the dentate gyrus. Unusually, the dentate granule cells are spared from NCI deposition. Ub/TDP-43 pathology is rare in the brainstem and cerebellum. Scattered glial intranuclear inclusions may be present in the white matter. VCP-like immunoreactivity is observed only rarely in the Ub-i in these patients (Forman et al., 2006; Schroder et al., 2005)
Valosin-containing protein or p97, a member of the AAA-ATPase superfamily is characterised by a structure with an N-termianl domain, involved in Ub binding, two central domains that bind and hydrolyse ATP and a C-terminal domain. Linkers, L1 and L2 connect the N- and C-terminal regions to the central domains (DeLaBarre and Brunger, 2003; Zhang et al., 2000). VCP is an essential
64 component of the Ub-proteosome dependent degradation of cytosolic proteins and in the retro- translocation of misfolded proteins from the ER into the cytoplasm through the Endoplasmic Reticulum-Associated Degradation (ERAD) pathway (Guyant-Marechal et al., 2006). VCP has been shown to play a role in untethering ubiquitinated proteins from their binding partners by binding polyubiquitin chains and therefore facilitating their transport to the UPS (Kakizuka, 2008). The loss of VCP function leads to accumulation of polyubiquitinated proteins or vacuole and inclusion body formation (Neumann et al., 2007)
Mutations in the VCP gene are thought to result in impairment of the Ub-dependent pathways and have been directly attributed to the cause of IBMPFD in families from North America (Watts et al., 2004), Germany (Schroder et al., 2005), Austria (Haubenberger et al., 2005), Italy (Gidaro et al., 2008) and France (Guyant-Marechal et al., 2006). To date, 10 missense mutations have been identified, most of which cluster around the N-domain which mediates the majority of VCP cofactor binding function, as well as interactions with the ubiquitinated target proteins. Two others affect the first linker domain, and two are found in the first AAA-ATPase domain. The most commonly affected amino acid is Arginine 155 identified in 10 families to date (Watts et al., 2004).
Frontotemporal lobar degeneration and motor neuron disease
Compared to FTLD families described above where motor syndromes such as parkinsonism, CBS and PSP-S tend to predominate, families linked to chromosome 9 without VCP mutations are more commonly associated with MND. It is now recognized that ~10% of familial FTLD coexists with MND. Within the context of a single family, FTLD and MND can occur in separate individuals as pure clinical syndromes or can occur in the same individual where FTLD is preceded, accompanied or followed by signs of MND (Seelaar, 2007).
Hosler et al. (2000) was the first to describe linkage of 5 families with FTLD and/or MND to chromosome 9q21-22. Subsequent analyses of FTLD and/or MND families led to six additional publications describing FTLD-MND families with linkage to chromosome 9 (Boxer et al., 2010; Le Ber et al., 2009; Momeni et al., 2006; Morita et al., 2006; Valdmanis et al., 2007; Vance et al., 2006). However, unlike the families reported by Hosler et al. (2000), peak LOD scores localised to the short
65 arm of chromosome 9. With over 60% of families with FTLD-MND now linked to this region, 9p has become a major FTLD-MND locus.
Collectively, the average age at onset in those families is ~53.4 years (age range, 35-84 years) with a mean disease duration of ~4.5 years (age range, 1-10 years). Within the fourteen families described, two had individuals that presented with either FTLD or MND but not both (Morita et al., 2006; Valdmanis et al., 2007). Subtle cognitive dysfunction was present in some MND individuals. The remaining five families comprised of individuals with either FTLD or MND or a combination of both where in most cases FTLD preceded the onset of MND, although within one family MND predominated the clinical picture and was often followed rather than preceded by FTLD (Vance et al., 2006). Individuals with MND had both upper and lower motor neuron signs with either bulbar or spinal onset. The clinical features of FTLD were dominated by behavioural symptoms such as lack of insight, dysregulation of social and interpersonal conduct, social isolation, poor judgement and apathy. One individual developed visual and auditory hallucinations (Vance et al., 2006). Parkinsonism consistent with CBS (Boxer et al., 2010) as well as oral apraxia and reduced verbal fluency ending in mutism were also noted (Valdmanis et al., 2007).
Given the nature of this rapidly progressive disease, the degree of atrophy is relatively minor although in some cases frontal atrophy is present. Neuropathological changes are indistinguishable from the classical MND and include neuronal loss in the anterior horn of the spine and bulbar nuclei (Bak, 2007). Ubiqutin/TDP-43-positive intraneuronal inclusions in cortical layer II and the hippocampal dentate granule cells are characteristic of FTLD-MND. Skein-like inclusions in the motor neurons of the spinal cord are not only found in patients with clinical FTLD-MND but also in FTLD patients without clinical signs of MND (Seelaar, 2007). Neuron loss of substantia nigra and striatum also present in some cases.
Overall, 22 FTLD-MND families have been linked to chromosome 9p strongly suggesting that this locus contains the pathogenic mutation. However, despite best efforts no mutations have been reported to date.
66 1.2.3.5 Summary
Overall, it is clear that there are many different clinical, pathological, and genetic variations of FTLD and related disorders (Figure 20). While there appear to be trends for certain early clinical syndromes to be associated with certain pathologies and genes, clinical management still remains a challenge. Until the remainder of causative genes are identified and the details of the biochemical pathways affected by these genes are well established, FTLD will remain a significant burden on our society.
Figure 20. Phenotypes, proteotypes and genotypes of frontotemporal lobar degeneration (FTLD). bvFTD Behavioural variant frontotemporal dementia, PPA Primary progressive aphasia, SD Semantic dementia, AD Alzheimer’s disease, CBS Corticobasal syndrome, PSP-S Progressive supranuclear palsy syndrome, MND Motor neuron disease, IBMPFD Inclusion body myopathy with Paget’s disease of bone and frontotemporal dementia, PiD Pick’s disease, CBD Corticobasal degeneration, PSP Progressive supranuclear palsy, AGD Argyrophilic grain disease, FTLD-ni FTLD with no inclusions, MAPT Microtubule associated protein tau, GRN Progranulin, VCP Valosin containing protein, TARDBP TAR DNA Binding protein, CHMP2B chromatin- modifying protein 2B, FUS Fused in sarcoma (Figure adapted from Kumar-Singh and Van Broeckhoven, 2007)
67 1.3 Aim
Up to 40% of patients with FTLD have a family history of dementia suggesting a strong genetic influence in this form of disease. Our current understanding of the biological processes underlying neurodegeneration has stemmed primarily from the identification of gene mutations in familial forms of dementia. To date, mutations in MAPT, GRN, CHMP2B, and VCP have been identified but account for less than half of hereditary FTLD and associated syndromes. Therefore, significant genetic contributors remain to be identified. Identification of these genes will not only provide insights into the aetiology of the complexities underlying familial FTLD but also may provide relevant clues to the pathogenesis of the sporadic forms of the disease ultimately enabling the development of therapeutics.
Therefore, the aim of this thesis is to: x Using immunohistochemical techniques characterise the underlying neuropathology in two large FTLD-MND families x Using linkage analysis, positional cloning, and candidate gene analysis identify the gene(s) involved in the pathogenesis of FTLD-MND x Screen a large cohort of unaffected individuals to establish the pathogenicity of the identified mutations x Conduct functional studies and identify the role of the mutations in the pathogenesis of FTLD-MND x Identify the nature and frequency of pathogenic mutations in the identified gene(s) in other dementia cohorts
Hypothesis
The hypothesis underlying this thesis is that phenotypic and genetic analysis of large FTLD-MND families will result in the identification of novel clinical, pathological and genetic variants which will aid in the appropriate diagnosis, lead to an understanding of the underlying pathophysiology and contribute to improved managemet of these neurodegenerative diseases.
68 Chapter 2 Paper I Corticobasal pathology in a large FTLD-MND family with suggestive linkage to chromosome 15q21-q23
Agnes A Luty 1,2, John B J Kwok 1,2, Elizabeth M Thompson 3, Peter Blumbergs 4, William S Brooks 1,2, Cathy L Short 5, Colin D Field 6, Peter K Panegyres 7,8, Jane Hecker 9, Ian P Blair 10, Glenda M Halliday 1,2, Peter R Schofield 1,2.
1. Neuroscience Research Australia, Sydney, NSW, Australia 2. University of New South Wales, Sydney, NSW, Australia 3. SA Clinical Genetics Service, SA Pathology, Women’s and Children’s Hospital, Adelaide, SA, Australia 4. Institute of Medical and Veterinary Science, Adelaide, SA, Australia 5. Department of Neurology, The Queen Elizabeth Hospital, Woodville, SA, Australia 6. Memory Clinic, Division of Rehabilitation & Aged Care, Repatriation General Hospital, Daw Park, SA, Australia 7. Neurosciences Unit, Department of Health, Perth, WA, Australia 8. Neurodegenerative Disorders Research, Subiaco, WA, Australia 9. College Grove Private Hospital, Adelaide, SA, Australia 10. Northcott Neuroscience Laboratory, ANZAC Research Institute, Concord Hospital, Sydney, NSW, Australia
69 ABSTRACT
Frontotemporal lobar degeneration (FTLD) with motor neuron disease (MND) is one of the subtypes of FTLD with ubiquitinated and phosphorylated TAR DNA binding protein 43 (TDP) inclusion pathology (FTLD-TDP). The clinical phenotype of FTLD-MND has only rarely been associated with ubiquitinated and phosphorylated tau protein. We describe a unique pedigree that presents with dementia and motor deficits most consistent with FTLD-MND, but with additional phosphorylated tau pathology consistent with corticobasal pathology. No mutations in any of the known dementia genes including MAPT, GRN and VCP were identified indicating that a novel as yet unidentified locus may be associated with this unique FTLD phenotype. A genome-wide scan was performed to identify the putative causative loci. Negative LOD scores were observed for the microsatellite markers mapping to chromosome 17q and 9p loci associated with FTLD-Tau and FTLD-MND, respectively. Linkage analysis provided suggestive evidence (maximum LOD score of 1.63) of a locus on chromosome 15q21.3-q23 flanked by the markers D15S1016 and D15S131.
70 Introduction
Frontotemporal lobar degeneration (FTLD) is the third most common neurodegenerative cause of dementia after Alzheimer’s disease and dementia with Lewy bodies (Neary et al., 1998; Ratnavalli et al., 2002). It stems from the degeneration of neurons in the superficial frontal cortex and anterior temporal lobes. Typically, this results in several distinct clinical presentations characterised by changes in personality and behaviour, including a decline in manners and social skills representative of behavioural variant frontotemporal dementia (bvFTD), as well as language disorders of expression and comprehension, known as progressive aphasia and semantic dementia, respectively (Neary et al., 2005). A closely related condition is corticobasal syndrome characterised clinically by marked motor symptoms including progressive asymmetric bradykinesia and dystonia accompanied by cortical signs such as apraxia and mycoclonous (Boeve, 2003). Contributing to the spectrum of clinical FTLD phenotypes is the co-occurrence of FTLD with motor neurone disease (MND) (Lilo and Hodges, 2009). MND, also referred to as amyotrophic lateral sclerosis, is characterised by degeneration of upper and lower motor neurons, leading to progressive muscle wasting, weakness and spasticity which ultimately results in profound global paralysis and death, usually due to respiratory failure.
Familial cases account for approximately 40% of all FTLD, indicating a significant genetic contribution (Rosso et al., 2003; Rohrer et al., 2009). Genetic linkage studies have led to the identification of several chromosomal loci linked to FTLD. Causal mutations have been identified in the microtubule associated protein tau (MAPT) (Hutton et al., 1998) and progranulin (GRN) (Baker et al., 2006; Cruts et al., 2006) genes, both located on chromosome 17q21.3 Normally tau is involved in microtubule assembly and stabilisation however, in individuals with MAPT mutations, the molecule becomes hyperphosphorylated and assembles into filaments leading to FTLD-tau (van Swieten and Spillantini, 2007). GRN mutations on the other hand, do not lead to progranulin protein deposition. Instead hyperphosphorylated TAR DNA binding protein 43 (TDP) is deposited in a distinct pattern consisting of neuronal cytoplasmic inclusions (NCI), neuronal intranuclear inclusions (NII) and dystrophic neurites (FTLD-TDP) (Arai et al., 2006; Davidson et al., 2007; Neumann et al., 2006). TDP-43 is a heterogeneous nuclear ribonucleoprotein (hnRNP) implicated in exon splicing and transcription regulation. Mutations in the TARDBP gene have been reported in familial and sporadic forms of MND
71 (Sreedharan et al., 2008; Kabashi et al., 2008) and familial FTLD-TDP (Gitcho et al., 2009). More recently, mutations in the gene encoding a related hnRNP known as fused in sarcoma (FUS) were identified in familial MND cases (Kwiatkowski et al., 2009; Vance et al., 2009) and FTLD cases (Van Langenhove et al., 2010). Neuropathological review of FTLD cases identified FUS as a major protein in the inclusions found in FTLD patients (FTLD-FUS) without TDP-43 (or tau) inclusions (Neumann et al., 2009; Seelaar et al., 2010). Mutations in these two hnRNP genes are consistent with suggestions that altered RNA production and processing play a major role in FTLD-MND (Lemmens et al., 2010). Moreover, mutations in the charged multivesicular body protein 2B (CHMP2B) gene on chromosome 3 have been associated with the rare form of TDP-43 and tau negative FTLD (Holm et al., 2007; Skibinski et al., 2005). An even more complex phenotype consisting of the unusual triad of inclusion body myopathy (IBM), Paget’s disease of the bone (PDB) and FTLD (IBM-PDB-FTLD) has been attributed to mutations in the valosin-containing protein (VCP) (Watts et al., 2004). Finally, an additional major FTLD-MND locus is located on chromosome 9p with 11 pedigrees having definite or suggestive linkage to a 7.7 Mb minimal disease region between markers AFM218xg11 and D9S1817 (Momeni et al., 2006; Morita et al., 2006; Valdmanis et al., 2007; Vance et al., 2006, Luty et al., 2008; Le Ber et al., 2009).
FTLD is a pathologically heterogeneous disorder, with most cases containing ubiquitinated filamentous inclusions made of one of three constitutive neuronal proteins; tau (FTLD-tau), TDP (FTLD-TDP) or fused in sarcoma (FTLD-FUS) (Mackenzie et al. 2010). Cases with FTLD-MND most commonly have type 3 FTLD-TDP pathology characterized by motor neuron-like NCI (Sampathu et al., 2006). In contrast, corticobasal degeneration (CBD) has a distinctive FTLD-tau pathology with ballooned neurons and tau-immunoreactive astrocytic plaques and threads (Dickson et al., 2002). In this study we describe a large multigenerational family (Aus-12) with a clinical spectrum of FTLD and MND, and neuropathology consistent with CBD FTLD-tau as well as type 3 FTLD-TDP. Genetic analyses of the pedigree have failed to identify a causal mutation within the known dementia genes, including MAPT and GRN. Instead, linkage analysis provided suggestive evidence that this FTLD locus maps to a region on chromosome 15q21.3-q23.
72 Materials and Methods
Family Recruitment
The proband (IV:23) was referred to a memory clinic at age 56 with symptoms suggesting cognitive decline in the context of a family history of young onset dementia. She was then seen by a clinical genetics service who arranged genetic studies and compiled a detailed family history including available medical records. Twelve individuals with dementia and two with MND were identified over four generations in a pattern consistent with Mendelian dominant inheritance. Approval to approach relatives for a family study was granted by the Ethics Committee of the Women’s and Children’s Hospital, Adelaide, SA, and the laboratory genetic studies were approved by the Ethics Committee of Concord Hospital in Sydney, consistent with the guidelines of the National Health and Medical Research Council. The next of kin of both individuals IV:5 and IV:7 consented to an autopsy study for brain research at the time of death and tissue sections and neuropathological reports for this study were obtained from the South Australian Brain Bank, part of the National Health and Medical Research Council’s Australian Network of Brain Banks, through their approval mechanism. To determine final diagnoses for IV:5 and IV:7, a retrospective review of their neuropathology was performed using current diagnostic criteria for Alzheimer’s disease (Hyman and Trojanowski, 1997), dementia with Lewy bodies (McKeith et al., 2005), FTLD (Mackenzie et al. 2010), MND (Brooks, 1994), and other neurodegenerative syndromes including CBD (Dickson et al., 2002), progressive supranuclear palsy (Hauw et al., 1994) and vascular dementia (Nagata et al., 2007).
Autopsy cases for comparison
A previously published familial FTLD-TDP case with a R493X GRN mutation (Pickering-Brown et al., 2006) was examined for comparison (male with FTLD onset age 52 years, age at death of 55 years, and postmortem delay of 15 hours), along with two neuropathologically confirmed CBD FTLD-tau cases (males with FTLD onset age at 68 and 77 years, age at death of 79 years, and postmortem delay of 35 and 17 hours). For these cases, the Sydney Brain Bank collected the brain tissue with appropriate consent, as approved by the Human Research Ethics Committee of the University of New South Wales, and generated the neuropathological reports.
73
Tissue preparation and neuropathological examination
For this study, 7-10 micron thick sections from the frontal and hippocampal regions, and spinal cord when available, were cut on a microtome and mounted onto salinized slides and standard peroxidase immunohistochemistry performed with 0.5% cresyl violet counterstaining (Luty et al., 2008). Sections were microwaved for 3 min in 0.2M citrate buffer, pH 6.0, prior to immunohistochemistry. Antibodies used were for ubiquitin (Z0458, DAKO, Denmark, diluted 1:200), phosphorylated tau (MN1020, PIERCE, USA, diluted 1:10,000), phosphorylated TDP (BC001487, PTG, USA, diluted 1:500), FUS (HPA008784, Sigma, Australia, diluted 1:1000), D-internexin (32-3600, ZYMED Laboratories, USA, diluted 1:50) and phosphorylated 200kD neurofilament (MAS330, Seralab, UK, diluted 1:200) as recommended for FTLD screening. Immunohistochemistry specificity was tested by omitting primary antibody with no resultant peroxidase reaction observed.
In cases where both phospho-tau and phospho-TDP immunoreactivity were found, double immunofluorescent labelling was carried out. For this procedure sections were microwaved for 3 min in 0.2M citrate buffer, pH 6.0, then treated for autofluorescence by immersion in 0.25% potassium permanganate solution for 7 min, rinsed with water and placed in solution containing 1% potassium metabisulphite and 1% oxalic acid until the sections returned to their original colour. Tau and TDP immunoreactivity was visualised with Alexa Fluor 568 goat anti-rabbit (Invitrogen) and Alexa Fluor 488 goat anti-mouse (Invitrogen) secondary antibodies respectively on a confocal microscope (C190 Nikon, Japan). To ensure specificity of the immunohistochemical reactions and non-cross-reactivity of secondary fluorescent probes, a section without primary antibodies was included for each staining procedure as a negative control. Additionally, a mixture of the secondary antibodies was applied to sections with only one primary antibody incubated on each section. No cross-reactivity was observed in these sections.
FTLD-TDP was classified into one of four subtypes (Sampathu et al., 2006) based on the morphology and laminar distribution of TDP-immunopositive inclusions in the affected brain regions.
74 Genetic Evaluation of Family
Blood was collected from 13 family members and DNA extracted. Direct DNA sequencing of the coding regions and 50 base pairs of flanking intronic sequences was performed in two affected and one unaffected individuals to screen the known dementia and MND causative genes (APP, PSEN1, PSEN2, MAPT, VCP, GRN, CHMP2B, TARDBP, FUS and SOD1). The amplified products were run on the Applied Biosystems 3730 DNA Analyser at the Ramaciotti Centre, University of New South Wales and analysed using DNA Star Lasergene Software, SeqMan Pro. Primer sequences and details of methods are available on request.
Simulation analysis using SIMLINK version 4.12 (Ploughman and Boehnke, 1989) was carried out to evaluate the power of the pedigree to detect linkage. The estimated maximum logarithm-of-odds (LOD) score was based on 1000 simulations for a single marker with three alleles and equal allele frequencies where all clinical variants were assumed affected. A 10cM genome-wide scan was performed on DNA from 13 individuals by the Australian Genome Research Facility (AGRF) with microsatellite markers from the ABI-400 set (ABI Prism Linkage Mapping Set, version 2.5, MD-10). Parametric pair-wise and multipoint LOD scores were calculated using the MLINK and LINKMAP computer programs in the LINKAGE 5.2 package. Linkage analysis was carried out where a single genetic locus was considered causal for all clinical variants. Autosomal dominant inheritance was assumed with age dependent penetrance, a phenocopy rate of 0.005, a disease gene frequency of 0.001 and equal allele frequencies. Seven liability classes were established based on pedigree data with 1% penetrance – age <25 years, 8% - between 26 and 34 years, 22% - between 35 and 44 years, 46% - between 45 and 54 years, 71% - between 55 and 64 years, 91% - between 65 and 74 years, and 95% - age > 75 years. Individuals were assigned a liability class based on age-of-onset for affected cases and age at last consultation for asymptomatic cases.
High-resolution fine mapping was performed using microsatellite markers with an average heterozygosity of 0.76 and spaced ~5 cM apart. Markers were selected from the Marshfield Medical Research Foundation genetic framework map (http://research.marshfieldclinic.org/genetics/GeneticResearch/maps/indexmap.html). Primers were fluorescently labelled with FAM and PCR was carried out according to standard protocols. The
75 amplified products were run on the Applied Biosystems 3730 DNA Analyser at the Ramaciotti Centre, University of New South Wales and analysed using ABI software (Genotyper 2.5 and GeneScan 3.1, Applied Biosystems).
76 Results
Clinical and neuropathological description of the Aus-12 family
A summary of the available clinical details of affected family members of pedigree Aus-12 (Fig. 1) is presented in Table 1.
Figure 1. Pedigree diagram showing affection status of family Aus-12. Squares indicate males and circles females; arrow indicates proband; black symbols, show individuals clinically diagnosed with dementia, either AD or FTLD; symbols with diagonal stripes, individuals diagnosed with MND; and horizontal stripes represent individuals diagnosed with FTLD-MND. A diagonal line marks deceased subjects. Individuals with DNA available are asterixed (*).
77 Table 1. Clinical summary of family Aus-12
Case IV:23 - The proband, IV:23, was referred to a specialist geriatrician at age 56 because over the previous year she had begun to repeat questions, misplace items and become lost when driving. She would forget the names of friends and would fail to recognise familiar faces. She was unable to manage her previous tasks of helping with the accounts and with managing horses. She was less fastidious about her personal appearance than before. Initially she felt she was deteriorating like her mother, but at the time of referral she denied having problems. Friends were concerned about her driving. She had become verbally aggressive at times and made inappropriate comments, which was a change from her previous personality. Despite this, she scored 27/30 on the Mini-Mental State Examination (Folstein et al., 1975), losing 2 points for recall and 1 for copying intersecting pentagons. However, on a 10-word learning task she was able to recall 5/10 after an interval. There were some
78 difficulties with higher intellectual function including description of word similarities and differences and rather concrete proverb definition, but she had reasonable verbal fluency. Calculation was impaired. Drawings and constructional tasks were initially well preserved, and it was noted that she was easily able to copy complex figures or spontaneously sketch faces and figures. Prominent early memory symptoms and geographical disorientation, together with the strong family history of clinically diagnosed Alzheimer’s disease (AD), led to an initial clinical suspicion of AD. However after a year she developed significant personality and behavioural change, with disinhibition, socially inappropriate and obsessional behaviour, and a lack of insight. This, together with continuing intact constructional skills and left frontotemporal hypoperfusion on a SPECT scan, led to a diagnosis of FTLD. Her condition gradually progressed. She has required residential care since age 66 for management of her behavioural and self-care deficits and is now severely impaired at age 69 years. Interestingly her drawing skills remain one of the few areas of preservation, implying relative preservation of parietal function.
The proband’s mother, III:17, died at 61 with dementia; four of her nine siblings were affected and died before age 65; a fifth sibling was also thought to be affected and died at 74 years of kidney failure. The proband’s grandmother and great-grandmother were affected, dying at 64 and 40, respectively. Four first cousins of the proband had presenile dementia; two died of MND aged 45 and 49 years, respectively.
Case IV:5 - This former forklift driver moved interstate and lived alone after a divorce. His behaviour became increasingly odd from his early to mid-fifties. A brain CT scan when he was 59 was reported as normal. His house was squalid and unsafe, with the rooms filled with garbage. There was no running water or electricity as he had disconnected the wires. He was admitted to a psychiatric institution at 63, by which time he was largely mute. He hoarded the belongings of other residents and displayed challenging, repetitive and impulsive behaviour. Some extrapyramidal features noted at the time were thought to be related to previous treatment with haloperidol. Brain CT was reported as showing temporal lobe atrophy. The clinical diagnosis was FTLD. He became less mobile, developed swallowing difficulties and pneumonia and died at age 64 years. Autopsy revealed bilateral bronchopneumonia.
79 On examination the brain of IV:5 weighed 1003 grams. Microscopy of the brain according to a standard protocol confirmed severe fronto-temporal atrophy with diffuse neuronal loss and reactive gliosis maximal in the temporal poles where status spongiosis was present. The main immunocytochemical pathology was that of a tauopathy with the phospho-tau (AT8) immunostains showing prominent cytoplasmic neuronal reactivity ("pre-tangles") and occasional neurofibrillary tangles involving subsets of hippocampal CA1 pyramidal neurons, temporal neocortex, frontal and parietal cortex in association with numerous AT8 immunoreactive neuronal threads (Figure 2A-E). Many of the dentate granule cells showed phospho-tau cytoplasmic immunoreactivity (Figure 2C). Occasional phosphorylated neurofilament and tau immunopositive "ballooned neurons" were noted in the frontal and hippocampal sections but this was a rare finding (Figure 2E). Phospho-tau immunoreactive astrocytic plaques (Figure 2D) and coiled fibres were also present. A prominent subset of neurons in the nucleus basalis of Meynert showed AT8 immunoreactive cytoplasmic staining in association with numerous positive neuronal threads. Subsets of neurons and astrocytes in the caudate nucleus showed positive AT8 cytoplasmic immunostaining whereas in the putamen and globus pallidus astrocyte immunoreactivity was more prominent than neuronal staining. Phospho-TDP-43 immunoreactive neuronal cytoplasmic inclusions (NCIs) were found in both superficial and deep cortical laminae of the frontal (Figure 2F - inset) and temporal cortex. A subset of the dentate granule cells showed phospho-TDP-43 immunopositive NCIs (Figure 2F). Double labelling immunofluorescence revealed that cytoplasmic phospho-tau immunoreactivity and phospho- TDP-43 immunopositive NCIs were found together in approximately 20% of hippocampal dentate granule cells and 5% of cortical neurons (Figure 3C,F,J,K). While many neurons and glia contained AT8 immunoreactivity (Figure 3A,D,G), a minority of phospho-TDP-43 immunopositive NCIs were found in neurons that were not immunoreactive for phospho-tau (Figure 3C,K). No FUS or D- internexin immunoreactive inclusion pathology was observed. In the midbrain there was neuronal loss, pigmentary incontinence and gliosis of the substantia nigra. A subset of surviving substantia nigra neurons showed cytoplasmic AT8 immunopositivity as did scattered periaqueductal nerve cells in association with immunoreactive neurites. The AT8 immunostains also showed intracytoplasmic staining in neurons of the locus coeruleus, scattered neurons of midline raphe nuclei, dorsal motor vagal nuclei, nuclei ambiguii and reticular formation in association with immunoreactive neurites. The findings are those of CBD FTLD-tau associated with type 3 FTLD-TDP.
80
81 Figure 2. Phospho-tau and phospho-TDP neuropathology in case IV:5 (A-F), case IV:7 (G-I) and an independent CBD FTLD-tau case (J-L). Numerous phospho-tau-immunopositive threads in the frontal cortex (A) and hippocampal white matter (B). (C) Dentate granule cells showing extensive phospho-tau immunopositivity. Phospho-tau-immunoreactive astrocytic plaque (D) and ballooned neuron (E) in frontal cortex. Phospho-TDP-immunopositive NCIs (arrows) in the dentate gyrus (F) and frontal cortex (inset). Ubiquitin- (G, scale in inset = 25 μm) and phosphorylated 200kD neurofilament- (H) immunopositive motor neurones, NCI and neurites in the cervical spinal cord. (I) Rare phopsho-tau immunoreactivity was observed in neurites, glia and small spinal cord neurones. In the case of sporadic CBD (J-L), phospho-tau-immunoreactive astrocytic plaques, neurons and threads where seen in the frontal cortex (J), phospho-tau-immunoreactive glia and threads in the white matter (K), and diffuse cytoplamsic phospho-tau immunoreactivity was observed in the dentate granule cells (L).
82
Figure 3. Double label immunofluorescence of the dentate granule cells in case IV:5 with phospho-tau (green) and phospho-TDP (red). Merged images of neurons in panels A-C, D-F, G-I, J and K show overlapping (yellow) and separate phospho-tau (green) and phospho-TDP (red) pathologies. Image (I) shows immunoreactivity of a fibrillar inclusion.
83 Case IV:7 - This former welder had not worked since being retrenched at age 54 years. He had Paget’s disease of both hips as well as ischaemic heart disease. His wife reported that he had given away many of his hobbies and interests from age 50. After a coronary bypass operation at 62 he developed progressive problems with memory, orientation and language. When seen by a neurologist at 67 he had become withdrawn and lacked emotion. There was some evidence of disinhibited behaviour. He had parkinsonian features including expressionless face, increased tone and shuffling gait together with pout and grasp reflexes and some utilisation behaviour. He had some fluctuating alertness but no hallucinations. Mini-Mental State score was 12/30 (Folstein et al., 1975) and he scored 0/18 on the Frontal Assessment Battery (Dubois et al., 2000). The clinical diagnosis was FTLD with parkinsonism, but by age 68 he had developed widespread fasciculations which were confirmed by EMG, indicating that he had FTLD-MND. The parkinsonian features continued, however, and were treated with L-dopa and carbidopa, with improvement in his mobility. He developed pneumonia and died aged 69 years. Autopsy revealed bilateral bronchopneumonia.
On examination the brain of IV:7 weighed 1160 grams. There was severe frontotemporal atrophy, and the substantia nigra was depigmented. Microscopy of the brain showed similar neuropathological features to that described above consistent with CBD FTLD-tau and type 3 FTLD-TDP. The spinal cord was also available in this case and segmental sections showed preservation of the corticospinal tracts (myelin stain). There was patchy loss of anterior horn cells in the cervical and thoracic spinal cord segments and ubiquitinated, neurofilament-immunoreactive motor neurones, neurites (Figure 2G,H) and NCI (Figure 2G – inset) were observed in these sections, along with rare phospho-tau immunoreactivity (Figure 2I). The phospho-tau immunoreactivity is consistent with previous descriptions of spinal cord involvement in CBD (Iwasaki et al. 2005). In contrast, ubiquitinated, neurofilament-negative skein-like or round, hyline NCIs are known to characterise MND (Kato, 2008). Phospho-TDP immunoreactivity was restricted to small neurons and neurites and absent in anterior horn cells, No FUS or D-internexin immunoreactivity was observed in these spinal cord sections.
84 Pathological comparison of Aus-12 cases with familial FTLD-TDP and sporadic CBD FTLD-Tau
As previously described (Pickering-Brown et al., 2006), the familial FTLD-TDP with a GRN mutation had typical type 3 FTLD-TDP neuropathology with numerous phospho-TDP-immunopositive NCIs, glial cytoplasmic inclusions, short dystrophic neurites, and the occasional NII. Limited abnormal phospho-tau, FUS, D-internexin or neurofilament immunoreactivity was observed in this case. In contrast, the two CBD FTLD-tau cases had phospho-tau-immunopositive astrocytic plaques and coiled bodies as well as phospho-tau immunopositive threads and neurons (Figure 2J,K,L). Ballooned neurons were also immunopositive for phosphorylated neurofilament and to a lesser extent phospho-tau, as previously described (Dickson et al., 2002). Limited abnormal phospho-TDP, FUS or D-internexin immunoreactivity was observed in these cases.
The phospho-tau neuropathology of Aus-12 closely resembled the CBD FTLD-tau cases, but was slightly less severe. The most similar features were the considerable dentate involvement (Figure 2C,L) and the very prominent glial phospho-tau immunoreactivity in the white matter (Figure 2B,K). The TDP-43 neuropathology on the other hand was similar to the familial FTLD-TDP case with a GRN mutation which had phospho-TDP-immunoreactive NCI and neurites in the cortical regions examined. Although greater phospho-TDP deposition occurred in the dentate gyrus and less frequent phospho-TDP-immunopositive neurites were found in family Aus-12 (Figure 2F) compared to the GRN mutation case.
Mutation Screen of Pedigree Members
DNA from the IV:5, IV:6 and IV:24 was subjected to DNA sequence analysis of the coding regions and flanking intronic sequences for the known dementia and MND genes. No mutations were detected in the known dementia genes, namely APP, PSEN1, PSEN2, MAPT, GRN, VCP, CHMP2B gene. The genes known to give rise to MND, namely SOD1, TDP-43 and FUS were also negative for mutations.
The theoretical maximal two-point LOD score that could be obtained from the Aus-12 pedigree is 1.72 according to the power calculations using SIMLINK, with an average expected LOD score of
85 0.40. A genome-wide linkage analysis using the 400 ABI Linkage Mapping Set II markers was undertaken on 13 pedigree members, four of whom were classed as affected. Three regions generated two-point LOD scores >1, including chromosome 3 (D3S1285, LOD = 1.07), chromosome 16 (D16S415, LOD = 1.32). The maximum two-point LOD score was located on chromosome 15 (D15S117, LOD = 1.63) where one of the adjacent markers also had a positive LOD score (D15S153, LOD = 0.59) (Table 2). The LOD scores for microsatellite markers around the MAPT and VCP genes were negative. The only positive LOD score on chromosome 17 was 0.16 (marker D17S928) while all the remaining markers, including markers D17S798 (LOD score = -0.22) and D171868 (LOD score = -1.47) around the MAPT gene, had negative scores (Table 3). Similarly, the LOD scores for the two markers (D9S161 LOD score = -1.18 and D9S273 LOD score = -0.06) around the VCP gene on chromosome 9p were negative as well (Table 4).
Haplotypes were constructed using the microsatellite information from the three candidate regions identified by the genome-wide scan. We were able to construct a common disease haplotype only for chromosome 15. Fine mapping with three additional microsatellite markers D15S1033, D15S1016 and D15S155 was undertaken. Recombination breakpoints were identified between markers D15S1016 and D15S117 at the centromeric end and D15S153 and D15S131 at the telomeric end. All affected individuals share an identical haplotype consisting of 4 consecutive markers (D15S117- D15S1033-D15S155-D15S153) spanning a physical distance of 18 Mb. These results provide evidence of suggestive linkage of a FTLD locus to the chromosome 15q21.3-q23.
86 Table 2. Two-point LOD scores for chromosome 15. The highest LOD score is highlighted in bold.
Chromosome 15 4 Marker Name 0 0.01 0.05 0.1 0.2 0.3 0.4 D15S128 0.39 0.37 0.33 0.27 0.16 0.08 0.02 D15S1002 0.16 0.15 0.14 0.13 0.09 0.05 0.01 D15S165 0.46 0.45 0.41 0.36 0.25 0.14 0.04 D15S1007 -0.2 -0.19 -0.14 -0.1 -0.04 -0.01 0 D15S1012 -1.28 -0.79 -0.28 -0.09 0.02 0.03 0.01 D15S994 -0.4 -0.39 -0.34 -0.27 -0.15 -0.06 -0.02 D15S978 -1.03 -0.79 -0.37 -0.16 0 0.03 0.02 D15S1016 -1.32 -1.08 -0.62 -0.36 -0.11 -0.02 0 D15S117 1.63 1.59 1.46 1.29 0.91 0.51 0.15 D15S1033 0.74 0.72 0.64 0.55 0.35 0.18 0.05 D15S155 0.8 0.78 0.71 0.62 0.42 0.22 0.06 D15S153 0.59 0.56 0.47 0.36 0.16 0.04 0 D15S131 -0.43 -0.45 -0.46 -0.38 -0.19 -0.08 -0.02 D15S205 0.31 0.3 0.27 0.24 0.16 0.08 0.02 D15S127 0.93 0.91 0.81 0.69 0.45 0.23 0.06 D15S120 -0.21 -0.19 -0.13 -0.07 -0.01 0.01 0.01
Table 3. Two-point LOD score for chromosome 17. The MAPT gene is located between markers D17S798 and D17S1868 (highlighted in bold)
Chromosome 17 4 Marker Name 0 0.01 0.05 0.1 0.2 0.3 0.4 D17S849 -1.26 -1.08 -0.71 -0.48 -0.23 -0.09 -0.02 D17S831 -1.4 -1.25 -0.87 -0.6 -0.29 -0.11 -0.02 D17S938 -1.01 -0.99 -0.81 -0.57 -0.25 -0.09 -0.02 D17S1852 -1.52 -1.42 -0.95 -0.57 -0.22 -0.08 -0.02 D17S799 -1.97 -1.81 -1.24 -0.8 -0.33 -0.11 -0.02 D17S921 -1.97 -1.81 -1.24 -0.8 -0.33 -0.11 -0.02 D17S1857 -1.63 -1.52 -1.04 -0.65 -0.26 -0.09 -0.02 D17S798 -0.22 -0.2 -0.15 -0.11 -0.06 -0.03 -0.01 D17S1868 -1.47 -1.42 -1.13 -0.78 -0.35 -0.14 -0.04 D17S787 -2 -1.9 -1.27 -0.79 -0.32 -0.11 -0.02 D17S944 -1.37 -1.24 -0.89 -0.61 -0.28 -0.11 -0.03 D17S949 -1.27 -1.07 -0.67 -0.42 -0.17 -0.06 -0.01 D17S785 0.16 0.16 0.16 0.14 0.09 0.04 0.01 D17S784 -0.1 -0.11 -0.13 -0.13 -0.11 -0.06 -0.02 D17S928 0.16 0.15 0.1 0.04 -0.04 -0.04 -0.02
87 Table 4. Two-point LOD scores for chromosomes 9. The VCP gene is located between markers D9S161 and D9S273 (highlighted in bold)
Chromosome 9 4 Marker 0 0.01 0.05 0.1 0.2 0.3 0.4 D9S288 -0.97 -0.76 -0.4 -0.23 -0.1 -0.05 -0.01 D9S286 -1.11 -1.05 -0.86 -0.65 -0.33 -0.14 -0.04 D9S285 0.17 0.17 0.18 0.17 0.13 0.08 0.03 D9S157 0.6 0.59 0.55 0.49 0.34 0.17 0.05 D9S171 -0.88 -0.72 -0.4 -0.22 -0.06 0 0.01 D9S259 -0.23 -0.21 -0.15 -0.1 -0.04 -0.02 0 D9S169 -0.15 -0.13 -0.06 0 0.04 0.03 0.01 D9S161 -1.18 -1.15 -0.93 -0.65 -0.29 -0.11 -0.03 D9S273 -0.06 -0.05 -0.03 -0.01 0.01 0.01 0 D9S175 -1.09 -0.96 -0.62 -0.36 -0.08 0.03 0.03 D9S1834 0.2 0.2 0.2 0.19 0.15 0.1 0.04 D9S1674 -0.18 -0.15 -0.06 0.01 0.09 0.09 0.04 D9S1843 -0.16 -0.15 -0.11 -0.08 -0.03 -0.01 0 D9S1167 -1.21 -1.07 -0.71 -0.43 -0.13 -0.01 0.01 D9S283 -1.96 -1.9 -1.52 -1.08 -0.53 -0.22 -0.06 D9S287 -1.56 -1.52 -1.2 -0.84 -0.4 -0.16 -0.04 D9S1690 -1.49 -1.21 -0.72 -0.44 -0.17 -0.05 -0.01 D9S1677 -2.45 -2.2 -1.51 -1.02 -0.48 -0.2 -0.05 D9S1776 -1.75 -1.65 -1.3 -0.96 -0.48 -0.2 -0.05 D9S1682 -1.32 -1.09 -0.66 -0.42 -0.18 -0.07 -0.01 D9S290 0.3 0.29 0.28 0.25 0.18 0.1 0.03 D9S164 -0.9 -0.56 -0.12 0.04 0.11 0.07 0.02 D9S1826 0.32 0.31 0.27 0.23 0.15 0.08 0.02 D9S158 -1.53 -0.96 -0.4 -0.18 -0.03 0 0
88 Discussion
In this study we describe a complex FTLD family with co-existing CBD and TDP neuropathology. The clinical presentations in this family are heterogeneous and did not appear to fit in with other FTLD paradigms. The majority of the affected individuals presented with AD-like symptoms and/or motor disorders. Unlike the typical presentation of FTLD patients, the proband IV:23 presented with AD-like symptoms, but soon after developed significant personality and behavioural change, with disinhibition, socially inappropriate and obsessional behaviour, and a lack of insight and was diagnosed with FTLD. Although early memory impairment suggestive of AD is also frequently observed amongst GRN mutation carriers (Kelley et al., 2009; Rademakers et al., 2007), these cases do not normally have pronounced motors disorders. The patient IV:7 initially diagnosed with Paget’s disease later developed clinical symptoms consistent with parkinsonism and recently developed fasciculations consistent with MND. MND was also present as a pure syndrome in two other family members. In MAPT mutation carriers, MND tends to be a late manifestation in patients already afflicted with parkinsonism, rather than a separate entity (Lynch et al., 1994; Wszolek et al., 1997). Thus, whilst such clinical heterogeneity is not uncommon and has been described in other families with defined GRN and MAPT mutations, the combination of memory and motor deficits appears to be unique.
Aus-12 represents the first pedigree in which affected individuals have neuropathologically confirmed CBD FTLD-tau as well as type 3 FTLD-TDP. Concomitant phospho-tau and phospho-TDP neuropathology is not rare and has now been reported in many different sporadic neurodegenerative disorders, but particularly in AD and CBD (Uryu et al. 2008). However in AD and CBD, type 1 rather than type 3 TDP neuropathology is observed, although the significance of the type or relationship between the two pathologies remains unclear. The underlying phospho-TDP neuropathology of IV:5 and IV:7 was consistent with type 3 TDP-43 neuropathology, pathology described in most familial FTLD-MND cases linked to chromosome 9p (Cairns et al., 2007a). However, the spinal cord involvement was more consistent with CBD neuropathology (Iwasaki et al. 2005). Co- immunofluorescence experiments revealed considerable overlap between the brain regions affected by the phospho-tau and phospho-TDP pathology, although both pathologies occurred independently, and more phospho-tau was observed in these cases. While the neuropathological depositions appear
89 unique in family Aus-12, the relationship between the two pathologies observed remains to be determined.
Genetic screen of family Aus-12 failed to identify mutations in any of the known dementia genes. Moreover, linkage analyses of chromosome 17 markers generated negative LOD scores for the entire chromosome 17q11.2 region, and was consistent with the absence of mutations in both MAPT and GRN. Preliminary linkage analysis resulted in the identification of a plausible locus on chromosome 15q21.3–q23. The potential for chromosome 15 having major involvement in neurodegeneration is further supported by Hentati et al. (1998) who reported linkage to chromosome 15q15.1–q21.1 in a large recessive MND family and designated the locus ALS5. This locus was later confirmed in 4 other families, 3 from Tunisia and 1 from Germany. While several candidate genes have been proposed, no causative genes have been reported to date. Interestingly, a gene encoding the transient receptor potential cation channel (TRPM7), located just upstream of our FTLD-MND locus on chromosome 15q21.3–q23, has been shown to be a causative gene for MND-parkinsonism- dementia complex of Guam (Hermosura et al., 2005) which is characterised by tau and TDP neuropathology somewhat similar to that described for Aus-12. However, Guam cases have more considerable neuropathological overlap, including the abnormal deposition of many other proteins like D-synuclein and amyloid (Hasegawa et al., 2007). This was not observed in Aus-12 affected members. The positional cloning of the major FTLD causative loci have been instrumental in the elucidation of pathogenic mechanisms underlying the various neuropathological variants, including MAPT (Hutton et al., 1998) and GRN (Baker et al., 2006). Genetic evaluation of family Aus-12 will further aid our understanding of disease pathogenesis in cases with both phospho-tau and phospho- TDP deposition.
90 Funding
Australian Postgraduate Award (AAL), National Health & Medical Research Council (Australia) RD Wright Fellowship 230862 (JBJK), Research Fellowships 157209 (PRS) and 350827 (GMH), and Project Grants 276407 and 510217.
Acknowledgements
We thank all patients and family members who participated in this study. We would like to thank Amanda Gybers, Karen E Murphy and Heather McCann for laboratory assistance, and Heidi Cartwright for figurework. Tissues were received from the South Australian Brain Bank and the Sydney Brain Bank which are supported by the National Health and Medical Research Council of Australia. The Sydney Brain bank is also supported by Neuroscience Research Australia and the University of New South Wales.
91 References
Abalkhail H, Mitchell J, Habgood J, Orrell R, de Belleroche J. A new familial amyotrophic lateral sclerosis locus on chromosome 16q12.1-16q12.2. Am J Hum Genet 2003; 73: 383-9.
Amador-Ortiz C, Lin WL, Ahmed Z, Personett D, Davies P, Duara R, et al. TDP-43 immunoreactivity in hippocampal sclerosis and Alzheimer's disease. Ann Neurol 2007; 61: 435-45.
Arai T, Hasegawa M, Akiyama H, Ikeda K, Nonaka T, Mori H, et al. TDP-43 is a component of ubiquitin-positive Tau-negative inclusions in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Biochem Biophys Res Commun 2006; 351: 602-11.
Baker M, Mackenzie IR, Pickering-Brown SM, Gass J, Rademakers R, Lindholm C, et al. Mutations in progranulin cause Tau-negative frontotemporal dementia linked to chromosome 17. Nature 2006; 442: 916-9.
Benussi L, Binetti G, Sina E, Gigola L, Bettecken T, Meitinger and Ghidoni R. A novel deletion in progranulin gene is associated with FTDP-17 and CBS. Neurobiol Aging 2008; 29: 427-435.
Boeve BF, Lang AE and Litvan I. Corticobasal degeneration and its relationship to progressive supranuclear palsy and frontotemporal dementia. Ann Neurol 2003; 54 (suppl 5): S15-19.
Brooks BR. El Escorial World Federation of Neurology criteria for the diagnosis of amyotrophic lateral sclerosis. Subcommittee on Motor Neuron Diseases/Amyotrophic Lateral Sclerosis of the World Federation of Neurology Research Group on Neuromuscular Diseases and the El Escorial "Clinical limits of amyotrophic lateral sclerosis" workshop contributors. J Neurol Sci 1994; 124 Suppl: 96-107.
Cairns NJ, Bigio EH, Mackenzie IR, Neumann M, Lee VM, Hatanpaa KJ, et al. Neuropathologic diagnostic and nosologic criteria for frontotemporal lobar degeneration: consensus of the Consortium for Frontotemporal Lobar Degeneration. Acta Neuropathol (Berl) 2007; 114: 5-22.
92
Cairns NJ, Grossman M, Arnold SE, Burn DJ, Jaros E, Perry RH, et al. Clinical and neuropathologic variation in neuronal intermediate filament inclusion disease. Neurology 2004; 63: 1376-84.
Cairns NJ, Neumann M, Bigio EH, Holm IE, Troost D, Hatanpaa KJ, et al. TDP-43 in familial and sporadic frontotemporal lobar degeneration with ubiquitin inclusions. Am J Pathol 2007a; 171: 227-40.
Cairns NJ, Bigio EH, Mackenzie IR, Neumann M, Lee VM, Hatanpaa KJ, et al. Neuropathologic diagnostic and nosologic criteria for frontotemporal lobar degeneration: consensus of the Consortium for Frontotemporal Lobar Degeneration. Acta Neuropathol (Berl) 2007b; 114: 5-22.
Cruts M, Gijselinck I, van der Zee J, Engelborghs S, Wils H, Pirici D, et al. Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21. Nature 2006; 442: 920-4.
Daoud H, Valdmanis PN, Kabashi E, Dion P, Dupre N, Camu W, et al. Contribution of TARDBP mutations to sporadic amyotrophic lateral sclerosis. J Med Genet 2009; 46: 112-4.
Davidson Y, Kelley T, Mackenzie IR, Pickering-Brown S, Du Plessis D, Neary D, et al. Ubiquitinated pathological lesions in frontotemporal lobar degeneration contain the TAR DNA-binding protein, TDP-43. Acta Neuropathol 2007; 113: 521-33.
Dickson DW, Bergeron C, Chin SS, Duyckaerts C, Horoupian D, Ikeda K, et al. Office of Rare Diseases neuropathologic criteria for corticobasal degeneration. J Neuropathol Exp Neurol 2002; 61: 935-46.
Dubois B, Slachevsky A, Litvan I, Pillon B. The FAB: a Frontal Assessment Battery at bedside. Neurology 2000; 55: 1621-6.
93 Folstein MF, Folstein SE, McHugh PR. "Mini-mental state". A practical method for grading the cognitive state of patients for the clinician. J Psychiatr Res 1975; 12: 189-98.
Forman MS, Mackenzie IR, Cairns NJ, Swanson E, Boyer PJ, Drachman DA, et al. Novel ubiquitin neuropathology in frontotemporal dementia with valosin-containing protein gene mutations. J Neuropathol Exp Neurol 2006; 65: 571-81.
Foster NL, Wilhelmsen K, Sima AA, Jones MZ, D'Amato CJ, Gilman S. Frontotemporal dementia and parkinsonism linked to chromosome 17: a consensus conference. Conference Participants. Ann Neurol 1997; 41: 706-15.
Freeman SH, Spires-Jones T, Hyman BT, Growdon JH, Frosch MP. TAR-DNA binding protein 43 in Pick disease. J Neuropathol Exp Neurol 2008; 67: 62-7.
Fujishiro H, Uchikado H, Arai T, Hasegawa M, Akiyama H, Yokota O, et al. Accumulation of phosphorylated TDP-43 in brains of patients with argyrophilic grain disease. Acta Neuropathol 2009; 117: 151-8.
Geser F, Winton MJ, Kwong LK, Xu Y, Xie SX, Igaz LM, et al. Pathological TDP-43 in parkinsonism- dementia complex and amyotrophic lateral sclerosis of Guam. Acta Neuropathol 2008; 115: 133-45.
Gitcho MA, Bigio EH, Mishra M, Johnson N, Weintraub S, Mesulam M et al. TARDBP 3'-UTR variant in autopsy-confirmed frontotemporal lobar degeneration with TDP-43 proteinopathy. Acta Neuropathol. 2009 118: 633-645.
Hasegawa M, Arai T, Akiyama H, Nonaka T, Mori H, Hashimoto T, et al. TDP-43 is deposited in the Guam parkinsonism-dementia complex brains. Brain 2007; 130: 1386-94.
94 Hauw JJ, Daniel SE, Dickson D, Horoupian DS, Jellinger K, Lantos PL, et al. Preliminary NINDS neuropathologic criteria for Steele-Richardson-Olszewski syndrome (progressive supranuclear palsy). Neurology 1994; 44: 2015-9.
Hentati A, Ouahchi K, Pericak-Vance MA, Nijhawan D, Ahmad A, Yang Y, et al. Linkage of a commoner form of recessive amyotrophic lateral sclerosis to chromosome 15q15-q22 markers. Neurogenetics 1998; 2: 55-60.
Hermosura MC, Nayakanti H, Dorovkov MV, Calderon FR, Ryazanov AG, Haymer DS, et al. A TRPM7 variant shows altered sensitivity to magnesium that may contribute to the pathogenesis of two Guamanian neurodegenerative disorders. Proc Natl Acad Sci U S A 2005; 102: 11510-5.
Higashi S, Iseki E, Yamamoto R, Minegishi M, Hino H, Fujisawa K, et al. Concurrence of TDP-43, Tau and alpha-synuclein pathology in brains of Alzheimer's disease and dementia with Lewy bodies. Brain Res 2007; 1184: 284-94.
Holm IE, Englund E, Mackenzie IR, Johannsen P, Isaacs AM. A reassessment of the neuropathology of frontotemporal dementia linked to chromosome 3. J Neuropathol Exp Neurol 2007; 66: 884- 91.
Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, et al. Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature 1998; 393: 702-5.
Hyman BT, Trojanowski JQ. Consensus recommendations for the postmortem diagnosis of Alzheimer disease from the National Institute on Aging and the Reagan Institute Working Group on diagnostic criteria for the neuropathological assessment of Alzheimer disease. J Neuropathol Exp Neurol 1997; 56: 1095-7.
Iwasaki Y, Yoshida M, Hattori M, Hashizume Y, Sobue G. Widespread spinal cord involvement in corticobasal degeneration. Acta Neuropathol 2005;109: 632-638.
95
Kabashi E, Valdmanis PN, Dion P, Spiegelman D, McConkey BJ et al. TARDBP mutations in individuals with sporadic and familial amyotrophic lateral sclerosis. Nat Genet 2008; 40: 572- 574.
Kato S. Amyotrophic lateral sclerosis models and human neuropathology: similarities and differences. Acta Neuropathol 2008; 115: 97–114.
Kelley BJ, Haidar W, Boeve BF, Baker M, Graff-Radford NR, Krefft T, et al. Prominent phenotypic variability associated with mutations in Progranulin. Neurobiol Aging 2009; 30: 739-751.
Kuhnlein P, Sperfeld AD, Vanmassenhove B, Van Deerlin V, Lee VM, Trojanowski JQ, et al. Two German kindreds with familial amyotrophic lateral sclerosis due to TARDBP mutations. Arch Neurol 2008; 65: 1185-9.
Kwiatkowski TJ Jr, Bosco DA, Leclerc AL, Tamrazian E, Vanderburg CR et al. Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science 2009; 323: 1205-1208.
Le Ber Le Ber I, Camuzat A, Berger E, Hannequin D, Laquerrière A, Golfier V et al. Chromosome 9p- linked families with frontotemporal dementia associated with motor neuron disease. Neurology 2009; 72: 1669-1676.
Lemmens R, Moore MJ, Al-Chalabi A, Brown RH Jr, Robberecht W. RNA metabolism and the pathogenesis of motor neuron diseases. Trends Neurosci 2010; 33: 249-258.
Lillo P and Hodges JR. Frontotemporal dementia and motor neurone disease: Overlapping clinico- pathological disorders. J Clin Neurosci 2009; 16: 1131-1135.
96 Lopez de Munain A, Alzualde A, Gorostidi A, Otaegui D, Ruiz-Martinez J, Indakoetxea B, et al. Mutations in progranulin gene: clinical, pathological, and ribonucleic acid expression findings. Biol Psychiatry 2008; 63: 946-52.
Luty AA, Kwok JB, Thompson EM, Blumbergs P, Brooks WS, Loy CT, et al. Pedigree with frontotemporal lobar degeneration--motor neuron disease and Tar DNA binding protein-43 positive neuropathology: genetic linkage to chromosome 9. BMC Neurol 2008; 8: 32.
Lynch T, Sano M, Marder KS, Bell KL, Foster NL, Defendini RF, et al. Clinical characteristics of a family with chromosome 17-linked disinhibition-dementia-parkinsonism-amyotrophy complex. Neurology 1994; 44: 1878-84.
Mackenzie IR, Neumann M, Bigio EH, Cairns NJ, Alafuzoff I, Kril J et al. Acta Neuropathol 2010;119:1-4)
Martinaud O, Laquerriere A, Guyant-Marechal L, Ahtoy P, Vera P, Sergeant N, et al. Frontotemporal dementia, motor neuron disease and Tauopathy: clinical and neuropathological study in a family. Acta Neuropathol 2005; 110: 84-92.
Masellis M, Momeni P, Mschino W, Heffner R, Elder J, Sato C et al. Novel splicing mutation in the progranulin gene causing familial corticobasal syndrome. Brain 2006; 129: 3115-3123.
McKeith IG, Dickson DW, Lowe J, Emre M, O'Brien JT, Feldman H, et al. Diagnosis and management of dementia with Lewy bodies: third report of the DLB Consortium. Neurology 2005; 65: 1863-72.
Momeni P, Schymick J, Jain S, Cookson MR, Cairns NJ, Greggio E, et al. Analysis of IFT74 as a candidate gene for chromosome 9p-linked ALS-FTD. BMC Neurol 2006; 6: 44.
Morita M, Al-Chalabi A, Andersen PM, Hosler B, Sapp P, Englund E, et al. A locus on chromosome 9p confers susceptibility to ALS and frontotemporal dementia. Neurology 2006; 66: 839-44.
97
Nagata K, Saito H, Ueno T, Sato M, Nakase T, Maeda T, et al. Clinical diagnosis of vascular dementia. J Neurol Sci 2007; 257: 44-8.
Neary D, Snowden JS, Gustafson L, Passant U, Stuss D, Black S, et al. Frontotemporal lobar degeneration: a consensus on clinical diagnostic criteria. Neurology 1998; 51: 1546-54.
Neary D, Snowden J, Mann D. Frontotemporal dementia. Lancet Neurol 2005; 4: 771-80.
Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, 2Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, Miller BL, Masliah E, Mackenzie IR, Feldman H, Feiden W, Kretzschmar HA, Trojanowski JQ, Lee VM. Ubiquitinated TDP-43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 2006; 314: 130-133.
Neumann M, Mackenzie IR, Cairns NJ, Boyer PJ, Markesbery WR, Smith CD, et al. TDP-43 in the ubiquitin pathology of frontotemporal dementia with VCP gene mutations. J Neuropathol Exp Neurol 2007; 66: 152-7.
Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Chou TT, et al. Ubiquitinated TDP- 43 in frontotemporal lobar degeneration and amyotrophic lateral sclerosis. Science 2006; 314: 130-3.
Neumann M, Rademakers R, Roeber S, Baker M, Kretzschmar HA, Mackenzie IR. A new subtype of frontotemporal lobar degeneration with FUS pathology. Brain 2009; 132: 2922-2831.
Pickering-Brown SM, Baker M, Gass J, Boeve BF, Loy CT, Brooks WS, et al. Mutations in progranulin explain atypical phenotypes with variants in MAPT. Brain 2006; 129: 3124-6.
Ploughman LM, Boehnke M. Estimating the power of a proposed linkage study for a complex genetic trait. Am J Hum Genet 1989; 44: 543-51.
98 Ratnavalli E, Brayne C, Dawson K, Hodges JR. The prevalence of frontotemporal dementia. Neurology 2002; 58: 1615-21.
Rademakers R, Baker M, Gass J, Adamson J, Huey ED, Momeni P, et al. Phenotypic variability associated with progranulin haploinsufficiency in patients with the common 1477C-->T (Arg493X) mutation: an international initiative. Lancet Neurol 2007; 6: 857-68.
Rohrer JD, Guerreiro R, Vandrovcova J, Uphill J, Reiman D, Beck J et al. The heritability and genetics of frontotemporal degeneration. Neurology 2009 73:1451-1456.
Rosso SM, Donker Kaat L, Baks T, Joosse M, de Koning I, Pijnenburg Y, et al. Frontotemporal dementia in The Netherlands: patient characteristics and prevalence estimates from a population-based study. Brain 2003; 126: 2016-22.
Ruddy DM, Parton MJ, Al-Chalabi A, Lewis CM, Vance C, Smith BN, et al. Two families with familial amyotrophic lateral sclerosis are linked to a novel locus on chromosome 16q. Am J Hum Genet 2003; 73: 390-6.
Rutherford NJ, Zhang YJ, Baker M, Gass JM, Finch NA, Xu YF, et al. Novel mutations in TARDBP (TDP-43) in patients with familial amyotrophic lateral sclerosis. PLoS Genet 2008; 4: e1000193.
Sampathu DM, Neumann M, Kwong LK, Chou TT, Micsenyi M, Truax A, et al. Pathological heterogeneity of frontotemporal lobar degeneration with ubiquitin-positive inclusions delineated by ubiquitin immunohistochemistry and novel monoclonal antibodies. Am J Pathol 2006; 169: 1343-52.
Sapp PC, Hosler BA, McKenna-Yasek D, Chin W, Gann A, Genise H, et al. Identification of two novel loci for dominantly inherited familial amyotrophic lateral sclerosis. Am J Hum Genet 2003; 73: 397-403.
99 Schwab C, Arai T, Hasegawa M, Yu S, McGeer PL. Colocalization of transactivation-responsive DNA-binding protein 43 and huntingtin in inclusions of Huntington disease. J Neuropathol Exp Neurol 2008; 67: 1159-65.
Seelaar H, Klijnsma KY, de Koning I, van der Lugt A, Chiu WZ, Azmani A et al. Frequency of ubiquitin and FUS-positive, TDP-43-negative frontotemporal lobar degeneration. J. Neurol. 2010; 257: 747-753.
Skibinski G, Parkinson NJ, Brown JM, Chakrabarti L, Lloyd SL, Hummerich H, et al. Mutations in the endosomal ESCRTIII-complex subunit CHMP2B in frontotemporal dementia. Nat Genet 2005; 37: 806-8.
Sreedharan J, Blair IP, Tripathi VB, Hu X, Vance C, Rogelj B, et al. TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. Science 2008; 319: 1668-72.
Stanford PM, Halliday GM, Brooks WS, Kwok JB, Storey CE, Creasey H, et al. Progressive supranuclear palsy pathology caused by a novel silent mutation in exon 10 of the Tau gene: expansion of the disease phenotype caused by Tau gene mutations. Brain 2000; 123 ( Pt 5): 880-93.
Uryu K, Nakashima-Yasuda H, Forman MS, Kwong LK, Clark CM, Grossman M, et al. Concomitant TAR-DNA-binding protein 43 pathology is present in Alzheimer disease and corticobasal degeneration but not in other Tauopathies. J Neuropathol Exp Neurol 2008; 67: 555-64.
Valdmanis PN, Dupre N, Bouchard JP, Camu W, Salachas F, Meininger V, et al. Three families with amyotrophic lateral sclerosis and frontotemporal dementia with evidence of linkage to chromosome 9p. Arch Neurol 2007; 64: 240-5.
Van Deerlin VM, Leverenz JB, Bekris LM, Bird TD, Yuan W, Elman LB, et al. TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathological analysis. Lancet Neurol 2008; 7: 409-16.
100
Van Swieten J and Spillantini MG. Hereditary frontotemporal dementia caused by Tau gene mutations. Brain Pathology 2007; 17: 63-73.
Vance C, Al-Chalabi A, Ruddy D, Smith BN, Hu X, Sreedharan J, et al. Familial amyotrophic lateral sclerosis with frontotemporal dementia is linked to a locus on chromosome 9p13.2-21.3. Brain 2006; 129: 868-76.
Vance C, Rogelj B, Hortobágyi T, De Vos KJ, Nishimura AL et al. Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science 323:1208-1211 (2009).
Van Langenhove T, van der Zee J, Sleegers K, Engelborghs S, Vandenberghe R et al. Genetic contribution of FUS to frontotemporal lobar degeneration. Neurology 2010 74: 366-371.
Wang H-Y, Wang I-F, Bose J and Shen C-K J. Structural diversity and functional implications of the eukaryotic TDP gene family. Genomics 2004; 83(1): 130-139.
Watts GD, Wymer J, Kovach MJ, Mehta SG, Mumm S, Darvish D, et al. Inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia is caused by mutant valosin-containing protein. Nat Genet 2004; 36: 377-81.
Wilhelmsen KC, Forman MS, Rosen HJ, Alving LI, Goldman J, Feiger J, et al. 17q-linked frontotemporal dementia-amyotrophic lateral sclerosis without Tau mutations with Tau and alpha-synuclein inclusions. Arch Neurol 2004; 61: 398-406.
Wszolek ZK, Vieregge P, Uitti RJ, Gasser T, Yasuhara O, McGeer P, et al. German-Canadian family (family A) with parkinsonism, amyotrophy, and dementia - Longitudinal observations. Parkinsonism Relat Disord 1997; 3: 125-39.
101 Zhang YJ, Xu YF, Dickey CA, Buratti E, Baralle F, Bailey R, et al. Progranulin mediates caspase- dependent cleavage of TAR DNA binding protein-43. J Neurosci 2007; 27: 10530-4.
102 Chapter 3 Paper II Pedigree with frontotemporal lobar degeneration- motor neuron disease and Tar DNA binding protein-43 positive neuropathology: genetic linkage to chromosome
103
BMC Neurology BioMed Central
Research article Open Access Pedigree with frontotemporal lobar degeneration – motor neuron disease and Tar DNA binding protein-43 positive neuropathology: genetic linkage to chromosome 9 Agnes A Luty1,2,3, John BJ Kwok1,2,3, Elizabeth M Thompson4, Peter Blumbergs5, William S Brooks1,2, Clement T Loy1,2,3, Carol Dobson- Stone1,2, Peter K Panegyres6,7, Jane Hecker8, Garth A Nicholson9,10, Glenda M Halliday1,2 and Peter R Schofield*1,2,3
Address: 1Prince of Wales Medical Research Institute, Sydney, NSW, Australia, 2University of New South Wales, Sydney, NSW, Australia, 3Garvan Institute of Medical Research, Sydney, NSW, Australia, 4SA Clinical Genetics Service, Women's and Children's Hospital, Adelaide, SA, Australia, 5Institute of Medical and Veterinary Science, Adelaide, SA, Australia, 6Neurosciences Unit, Department of Health, Perth, WA, Australia, 7Neurodegenerative Disorders Research, Subiaco, WA, Australia, 8College Grove Private Hospital, Adelaide, SA, Australia, 9Northcott Neuroscience Laboratory, ANZAC Research Institute, Concord Hospital, Sydney, NSW, Australia and 10Faculty of Medicine, University of Sydney, Sydney, Australia Email: Agnes A Luty - [email protected]; John BJ Kwok - [email protected]; Elizabeth M Thompson - [email protected]; Peter Blumbergs - [email protected]; William S Brooks - [email protected]; Clement T Loy - [email protected]; Carol Dobson-Stone - [email protected]; Peter K Panegyres - [email protected]; Jane Hecker - [email protected]; Garth A Nicholson - [email protected]; Glenda M Halliday - [email protected]; Peter R Schofield* - [email protected] * Corresponding author
Published: 29 August 2008 Received: 20 June 2008 Accepted: 29 August 2008 BMC Neurology 2008, 8:32 doi:10.1186/1471-2377-8-32 This article is available from: http://www.biomedcentral.com/1471-2377/8/32 © 2008 Luty et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract Background: Frontotemporal lobar degeneration (FTLD) represents a clinically, pathologically and genetically heterogenous neurodegenerative disorder, often complicated by neurological signs such as motor neuron-related limb weakness, spasticity and paralysis, parkinsonism and gait disturbances. Linkage to chromosome 9p had been reported for pedigrees with the neurodegenerative disorder, frontotemporal lobar degeneration (FTLD) and motor neuron disease (MND). The objective in this study is to identify the genetic locus in a multi-generational Australian family with FTLD-MND. Methods: Clinical review and standard neuropathological analysis of brain sections from affected pedigree members. Genome-wide scan using microsatellite markers and single nucleotide polymorphism fine mapping. Examination of candidate genes by direct DNA sequencing. Results: Neuropathological examination revealed cytoplasmic deposition of the TDP-43 protein in three affected individuals. Moreover, we identify a family member with clinical Alzheimer's disease, and FTLD-Ubiquitin neuropathology. Genetic linkage and haplotype analyses, defined a critical region between markers D9S169 and D9S1845 on chromosome 9p21. Screening of all candidate genes within this region did not reveal any novel genetic alterations that co-segregate with disease haplotype, suggesting that one individual carrying a meiotic recombination may represent a phenocopy. Re-analysis of linkage data using the new affection status revealed a
Page 1 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
maximal two-point LOD score of 3.24 and a multipoint LOD score of 3.41 at marker D9S1817. This provides the highest reported LOD scores from a single FTLD-MND pedigree. Conclusion: Our reported increase in the minimal disease region should inform other researchers that the chromosome 9 locus may be more telomeric than predicted by published recombination boundaries. Moreover, the existence of a family member with clinical Alzheimer's disease, and who shares the disease haplotype, highlights the possibility that late-onset AD patients in the other linked pedigrees may be mis-classified as sporadic dementia cases.
Background some 9q21-22 from linkage data from 5 American FTLD- Frontotemporal lobar degeneration (FTLD) is the third MND families. Subsequently, both Vance et al. [16] and most common neurodegenerative cause of dementia after Morita et al. [17] reported linkage to chromosome Alzheimer's disease (AD) and dementia with Lewy bodies 9p13.2-21.3 in large FTLD-MND kindreds from Holland (DLB). [1,2] It stems from the degeneration of neurons in and Scandinavia, respectively. Finally, three other families the superficial frontal cortex and anterior temporal lobes. were identified by Valdmanis et al. [18] with linkage to Typically, this results in several distinct clinical presenta- the chromosome 9p locus. Yan et al. [19] have also pro- tions characterised by changes in personality and behav- vided a preliminary abstract report of significant linkage iour, including a decline in manners and social skills in 15 FTLD-MND families. To date, only one gene, IFT74 representative of frontotemporal dementia, as well as lan- has been postulated to be the causative gene of chromo- guage disorders of expression and comprehension, some 9p-linked FTLD-MND. [20] However, only a single known as progressive aphasia and semantic dementia, family has been identified with a mutation in the IFT74 respectively. [3] Contributing to the spectrum of clinical gene, suggesting genetic heterogeneity in this region. phenotypes seen in FTLD is the co-occurrence of FTLD Here, we report a large FTLD-MND family from Australia with motor neurone disease (MND). [4] MND, also with linkage to chromosome 9p21.1-q21.3 and TDP-43 referred to as amyotrophic lateral sclerosis (ALS) is charac- positive pathology, further supporting the evidence for a terised by degeneration of upper and lower motor neu- novel gene associated with this type of neurodegenerative rons, leading to progressive muscle wasting, weakness and disorder. spasticity which ultimately results in profound global paralysis and death, usually due to respiratory failure. Methods Neuropathology FTLD is also a pathologically heterogeneous disorder and The brains of patients III:2, III:3 and III:12 and the spinal can be categorised into cases without detectable inclu- cord of patient III:12 were obtained at the time of autopsy sions known as dementia lacking distinctive histopathol- with consent. Routine neuropathological assessment, ogy (DLDH), cases with tau-positive pathology known as including immunohistochemical screening, was per- tauopathies, and the most frequently recognised cases formed and reviewed and standardised for the present have ubiquitin-positive, tau-negative inclusions (FTLD- study. For all cases, retrospective review of standardised U). [5] The TAR DNA binding protein (TDP-43) is a immunoperoxidase slides using antibodies for tau nuclear protein implicated in exon splicing and transcrip- (MN1020, PIERCE, USA, diluted 1:10,000/cresyl violet), tion regulation, [6] and was recently identified as a major ubiquitin (Z0458, DAKO, Denmark, diluted1:200/cresyl protein component of the ubiquitin-immunoreactive violet), AE (gift from Professor Masters, University of Mel- inclusions characteristic of sporadic and familial FTLD-U, bourne, dilution 1:200/cresyl violet), and a-synuclein with and without MND, as well as in sporadic cases of (610787, Pharmigen, USA, diluted1:200/cresyl violet) MND [7-9]. Recently, mutations in the TDP-43 (TARDBP) were undertaken as previously described. [21] TDP-43 gene have recently been reported in familial and sporadic protein was visualised following microwave antigen forms of MND. [10-14] retrieval (sections were boiled for 3 min in 0.2 M citrate buffer, pH 6.0) using commercially available antibody There is increasing evidence that FTLD and MND may rep- (BC001487, PTG, USA, diluted 1:500), peroxidase visual- resent two phenotypic variants resulting from a common isation and counterstaining with 0.5% cresyl violet. To underlying genetic cause. This is supported by both the determine final diagnoses all cases were screened using presence of ubiquitin/TDP-43 pathology and also by current diagnostic criteria for AD, [22] dementia with genetic loci on chromosome 9 in families with FTLD and Lewy bodies, [23] FTLD, [9] MND, [24] and other neuro- MND. Hosler et al. [15] identified a region on chromo- degenerative syndromes including corticobasal degenera-
Page 2 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
tion, [25] progressive supranuclear palsy [26] and vascular formed with microsatellite markers (ABI Prism Linkage dementia. [27] Mapping Set, version 2.5, MD-10). Parametric pair-wise and multipoint LOD scores were calculated using the Genetic analyses MLINK and LINKMAP computer programs in the LINK- The study was approved by the University of New South AGE 5.2 package. Autosomal dominant inheritance was Wales Human Research Ethics Committee and complies assumed with age dependent penetrance, a phenocopy with the guidelines of the National Health and Medical rate of 0.005, a disease gene frequency of 0.001 and allele Research Council and the Helsinki Declaration. After writ- frequencies derived from a normal Australian population. ten informed consent was obtained, blood was collected [28] Seven liability classes were established based on ped- from 16 family members (seven of whom are affected) igree data with 1% penetrance – age < 25 years, 8% – and DNA extracted. A 10 cM genome-wide scan was per- between 26 and 34 years, 22% – between 35 and 44 years,
PedigreeFigure 1 diagram showing affection status and disease haplotype Pedigree diagram showing affection status and disease haplotype. Squares indicate males and circles females; filled arrow indi- cates proband; black symbols show individuals clinically diagnosed with dementia, either AD or FTLD; diagonal stripes, individ- uals diagnosed with MND; and combined black and diagonal stripes, individuals diagnosed with FTLD-MND. A diagonal line marks deceased subjects. Individual I:1, lived until his 80s, but was thought to have had some personality changes. Alleles in parentheses are inferred. 'X' indicates upper and lower recombination breakpoints that define the minimal disease haplotype.
Page 3 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
46% – between 45 and 54 years, 71% – between 55 and MND (Figure 1). Over three generations, five family mem- 64 years, 91% – between 65 and 74 years, and 95% – age bers (II:2, III:3, III:5, III:7, IV:1) presented with symptoms > 75 years. Individuals were assigned a liability class based consistent with the behavioural variant of FTLD (Figure on age-of-onset for affected cases and age at last consulta- 1). Another two family members (III:8, III:12) presented tion for asymptomatic cases. High-resolution fine map- with progressive bulbar and limb weakness consistent ping was performed using microsatellite markers with an with MND. Two family members presented with a combi- average heterozygosity of 0.79 and spaced no further apart nation of FTLD and MND features (II:5, III:6). One of the than 2 cM. Haplotypes were constructed using Merlin other family member presented with early-onset demen- (Version 2.01), double checked manually, and displayed tia (II:7) and had a son with MND (III:12). Of particular using HaploPainter V.029.5. [29] The haplotype of indi- interest is the eleventh affected family member. She pre- vidual III:5 was inferred from her spouse and offspring. sented with an amnestic picture and subsequently devel- oped impairment in multiple cognitive domains Mutation screen of candidate genes including visuospatial function, prompting a clinical Intronic polymerase chain reaction (PCR) primers were diagnosis of Alzheimer's disease (III:2). A full description designed to amplify each non-coding and coding exon, as of her clinical presentation is available [see Additional file well as flanking intronic sequence of candidate genes 1]. Of the eleven affected family members, two also devel- using the ExonPrimer program accessed using the UCSC oped paranoid delusions in their middle age, at the begin- Genome Bioinformatics Site (primer sequences available ning of their illnesses (III:6 and III:8). Average age of onset on request). PCR products amplified from genomic tem- was 53 years (range 43 to 68 years) with a mean disease plates were sequenced using Big Dye Chemistry (Applied duration of 9 years (range 1 to 16 years), and mean age of Biosystems). Total RNAs were extracted from lymphoblas- death of 61 years (range 46 to 75 years). An overall clinical toid cell lines or frozen brain tissue for RT-PCR analysis. 1 summary is provided in Table 1. Pg of total RNA from each sample was reverse transcribed using the Superscript III First Strand Synthesis System The location of the abnormal TDP-43-immunoreactive (Invitrogen) and a oligodT primer (Invitrogen), followed protein deposits within layer II neurons of the frontal cor- by PCR amplification using overlapping primers designed tex and hippocampal granule cells was identified as either to amplify the entire coding sequence of each candidate cytoplasmic, intranuclear or neuritic. These features were gene (primer sequences available on request). Each over- used to classify the cases into histological subtypes accord- lapping pair was designed to avoid exon/intron bounda- ing Cairns et al. [5] Histopathological examination was ries in order to detect splicing mutations. Each PCR available for one family member with FTLD (III:3), find- fragment was analysed for abnormalities by size fraction- ing TDP-43 inclusions consistent with type 2 FTLD-U [9] ation using agarose gel electrophoresis. (Figure 2). Histopathological examination was available for one family member with MND (III:12), again finding Results TDP-43 inclusions in the dentate gyrus and anterior horn Clinical and neuropathological examinations of affected cells (Figure 3). The individual (III:2) with clinical Alzhe- members imer's disease was found to have TDP-43 inclusions con- We describe an Australian family of Anglo-Celtic origin sistent with type 2 FTLD-U (Figure 2), with co-existing where eleven family members were affected with FTLD- hippocampal sclerosis, as well as sufficient densities of
Table 1: Clinical summary
Individual Gender First symptoms Disease duration APOE genotype Clinical presentation (years) (years) Psychosis FTD ALS Dementia*
II-2 M ~45 ~18 - + - - III-3 M ~59 ~7 e3/e4 - + # -- III-5 F ~45 ~11 - + - - III-7 F ~59 2 (alive) e3/e4 - + - - IV-1 F 43 3 (alive) e3/e4 - + - - II-5 F 63 1 - + + - III-6 M 58 3 (alive) e4/e4 + + + - III-8 F 46 4 e2/e4 + - + - III-12 M 46 5 e4/e4 - - + # - III-2 F 68 7 e3/e4 - - - + # II-7 F 50 16 - - - +
* Refer to the text for details. # Diagnosis confirmed by neuropathological examination
Page 4 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
TheFigure neuropathology 3 of case III:12 The neuropathology of case III:12. (A) C7 cervical cord showing symmetrical Wallerian degeneration of lateral corti- cospinal tracts and anterior corticospinal tract. Note atrophy of anterior nerve roots in comparison to dorsal nerve roots. TDP-43 immunopositive skein-like (B) and punctate (C) cytoplasmic inclusions within anterior horn cells of the spinal cord. (D) Normal TDP-43 positive nuclear staining of the TheFigure neuropathology 2 of patients III:2 and III:3 anterior horn cell. (E) Anterior horn cell showing Bunina The neuropathology of patients III:2 and III:3. (A) Severe bodies. (F) Spongiosis in layers 2 and 3 of parasagittal motor pyramidal neuronal loss from CA1 region Ammon's horn cortex. (G) Residual Betz cell in motor cortex. Bar = 10 Pm (III:2). (B) Temporal neocortex showing AE immunopositive in B, C, D, E and G; 20 Pm in F. plaques and cerebrovascular amyloidosis (III:2). Positive staining with ubiquitin (C-F) and TDP-43 (G-I) antibodies of neuronal cytoplasmic inclusions (NCI) in the granule cells of the dentate gyrus. Ubiquitin-positive neuronal cytoplasmic Linkage of causative locus to chromosome 9 inclusions in III:2 (C, E and F) and in III:3 (D). TDP-43 posi- DNA from the proband (III:3), III:6, III:12 and III:1 was tive neuronal cytoplasmic inclusions in III:2 (G and I) and III:3 subjected to DNA sequence analysis of the coding regions (H). Bar = 50 Pm in A and B; 20 Pm in C and G; 10 Pm in D, and flanking intronic sequences for known dementia and E, F, H and I. MND genes. No mutations were detected in the APP, PSEN1, PSEN2, MAPT, PGRN, VCP, CHMP2B or the IFT74 gene. No SOD1 or TDP-43 mutations were detected cortical plaques and tangles but insufficient CA1 hippoc- in individuals III:8 and III:12. ampal neuritic pathology to fulfil criteria for Alzheimer's disease. Overall the severity of the FTLD-U histology for A genome-wide linkage analysis was undertaken on 16 III:2 was more severe than the Alzheimer's disease histol- pedigree members, some of whom are not included in the ogy. A detailed description of the clinical and pathological pedigree diagram for ethical reasons. Seven individuals presentation of affected pedigree members is presented in were classed as affected and one was classified as Additional file 1. unknown as she had psychosis, a possible FTLD prodro-
Page 5 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
Table 2: Two-point LOD scores for chromosome 9p21.2-q22.32 telomeric boundary was marked by a recombination markers event in individual II:2 between markers D9S169 and III:8 Affected III:8 Unaffected D9S161, and has been inherited by all five affected off- spring within the sibship (Figure 1). The centromeric Marker Location TTboundary was defined by a single cross-over in individual III:8. However, using the microsatellite data, the exact (cM) 0.00 0.20 0.40 0.00 0.20 0.40 recombination breakpoint could not be determined as markers D9S1118 and D9S304 are both homozygous for D9S259‡ 47.19 -2.1 -0.07 0.03 -2.21 -0.09 0.03 the '2' allele and could not be excluded from the disease D9S169‡ 49.20 -0.54 0.53 0.08 -0.99 0.33 0.07 haplotype. Therefore, we can only deduce with confidence D9S161† 51.81 2.51 1.39 0.26 2.14 1.17 0.20 that the cross-over occurred between markers D9S304 and D9S319‡ 54.50 3.25 * 1.96 0.51 2.82 1.70 0.43 D9S1845. All affected individuals share an identical hap- D9S1118‡ 58.26 1.08 0.59 0.13 1.05 0.57 0.43 D9S304‡ 58.26 0.34 0.14 0.01 0.31 0.11 0.00 lotype consisting of 4 consecutive markers (D9S161- D9S1845‡ 58.80 1.15 1.36 0.37 2.90 1.72 0.44 D9S319-D9S1118-D9S304) spanning a 9.6 cM region D9S1817† 59.34 1.47 1.55 0.43 3.24* 1.97 0.53 corresponding to a physical distance of 5.9 Mb. D9S1805‡ 59.34 0.75 1.2 0.26 2.46 1.41 0.30 D9S163‡ 59.87 1.34 0.53 0.04 0.94 0.31 0.00 Fine mapping haplotype analysis and mutation screen of † D9S273 65.79 1.03 1.36 0.37 2.77 1.62 0.40 candidate genes D9S175† 70.33 0.50 1.01 0.28 2.26 1.40 0.36 The 5.9Mb minimal disease region contains 14 known D9S167† 83.41 -3.58 -0.30 0.01 -1.85 0.11 0.07 genes as listed by the UCSC Bioinformatics page, consist- * Peak LOD Scores. ing of C9orf11 (ACR formation associated factor), † ABI Prism Linkage Mapping Set markers. MOBKL2B, IFNK, c9orf72, LINGO2, ACO1, DDX58, ‡ Marshfield Medical Research Foundation genetic framework TOPORS, NDUFB6, TAF1L, APTX, DNAJA1, SMU1, and markers. B4GALT1 (Figure 4). The coding and non-coding exonic All map distances are derived from the Marshfield Genetic Map except for marker D9S163 that was inferred from the Kong human sequence and flanking intronic regions of 11 of the initial genetic map. [33] set of candidate genes (excluding TAF1L, SMU1 and B4GALT1) were screened by direct sequencing of PCR products amplified from genomic template. Screening of mal feature. [16] Linkage analysis was carried out where a the candidate genes detected 42 polymorphisms, of which single genetic locus was considered causal for all clinical six were considered novel, including two variants in variants. Over the entire genome, the only region with a C9orf11 (IVS1 +33 GT insertion/deletion, IVS4 -44 G/A); two-point LOD score greater than the established cut-off three in DDX58 (Arg71His CGT to CAT, IVS16 -23 C/A, of 2.0 for suggestive linkage was located on chromosome IVS16 + 11 G/A) and one in APTX (IVS6 -12 insertion/ 9. Marker D9S161 (9p21.3) gave a maximum LOD score deletion T). We considered the DDX58 amino acid change of 2.57. Three adjacent markers also had positive LOD to be a polymorphism as it was found in unaffected and scores with the closest marker D9S1817 having a maxi- aged controls obtained from the Sydney Older Persons mum LOD score of 0.99. The highest LOD score on a Study cohort [30] with a frequency of 0.03. chromosome other than 9 was 1.40 on 3p14.3. Otherwise all other LOD scores were all consistently negative or non- The additional SNP genotypes from the mutation screen significant and were used to exclude other reported MND were used to create an informative SNP haplotype and we linked loci, namely 2p13, 15q15-q22, 18q, 16q, and were able to further fine map the centromeric recombina- 20q13. These results indicate that the pedigree may be tion breakpoint. SNP haplotypes from ACO1 and DDX58 linked to the chromosome 9p FTLD-MND locus. The can- (the two genes in closest proximity to the D9S304 didate chromosome 9p region was subjected to high reso- marker) revealed that III:8 did not inherit the same alleles lution fine mapping with 8 additional markers (D9S259, of ACO1 and DDX58 as the other affected individuals. D9S169, D9S319, D9S1118, D9S304, D9S1845, This allowed us to place the meiotic cross-over to between D9S1805, D9S163) surrounding D9S161 and D9S1817 ACO1 and D9S304. As there are no known genes in the 60 and the data was re-analysed using MLINK. This resulted kb region between ACO1 and D9S304, we have placed the in a significant two-point LOD score of 3.25 at marker final position of the cross-over to between D9S1118 and D9S319 (Table 2). D9S304 (Figure 4). This haplotype analysis left 4 known genes (IFNK, LINGO2, MOBKL2B, C9orf11), and a hypo- To further evaluate the reliability of the detected linkage, thetical protein C9orf72 within the candidate region. No and to determine recombination breakpoints, haplotypes mutations were detected in the exons (coding and non- were constructed using Merlin (Figure 1). Recombination coding) or flanking intronic sequences of these five genes. breakpoints were defined by two affected individuals. The In addition, we analysed three of the five genes/transcripts
Page 6 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
FinepedigreeFigure mapping 4 member haplotype III:8 analysis using microsatellite and SNP markers to resolve the position of a meiotic recombination in Fine mapping haplotype analysis using microsatellite and SNP markers to resolve the position of a meiotic recombination in pedigree member III:8. Four SNPs from representative genes are indicated (rs10812616, rs10812615, rs17769294 and rs10122902 for C9orf11; rs2383768, rs13296489, rs1331870 and rs10968460 for LINGO2; rs2026739, rs3780473, rs10970975 and rs12985 for ACO1; rs10813831, Arg71His, rs17289927 and rs6476363 for DDX8). The informative SNP hap- lotypes definitively place the recombination breakpoint between D9S1118 and D9S304. The black box indicates the portion of the disease haplotype which is not shared by pedigree member III:8. Transcript map indicating the relative positions of known genes and transcripts (open boxes) (not drawn to scale).
Page 7 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
DiagramFigure 5 of chromosome 9p-linked families with FTLD-MND Diagram of chromosome 9p-linked families with FTLD-MND. by RT-PCR of lymphoblastoid and brain cDNAs. The (Figure 1) as identified in seven affected individuals II:2, exceptions were C9orf11, which had been annotated to III:2, III:3, III:5, III:6, III:7 and IV:1. The disease haplotype have testes specific expression (UCSC Bioinformatics spans 57 Mb (34 cM) on chromosomal region 9p21- Site), and LINGO2, whose coding sequence is encom- 9q12. This region overlaps the three previously reported passed within a single large 3' exon (UCSC Bioinformatics FTLD-MND regions on chromosome 9p (Figure 5). The Site). No altered splicing or small-scale deletions in the recombination breakpoint observed in this study at RT-PCR products from the transcripts of these candidate D9S169 narrows the telomeric boundary of the combined genes were detected by size fractionation using agarose gel published minimal disease region by 1.1 Mb. electrophoresis (data not shown). The absence of any mutations led us to conclude that III:8 may be a pheno- Conclusion copy and that the centromeric recombination breakpoint Frontotemporal lobar degeneration (FTLD) is a clinically, defined by that individual (between D9S1118 and pathologically and genetically heterogeneous disorder. To D9S304) is not valid for defining the minimal disease date, at least 22 families with FTLD and/or MND have region. now been reported with genetic linkage to chromosome 9p [13-16] providing strong evidence that an additional Identification of an extended disease haplotype FTLD gene exists. In this study we describe a large Austral- We re-analysed our linkage data with the phenotype of ian FTLD-MND family that shows linkage to the chromo- III:8 altered to an unaffected status using the same auto- some 9p21.1-21.2 locus. With a significant two-point somal dominant inheritance model (Table 2). Again, only LOD score of 3.24 and a multi-point LOD score of 3.41, a single locus achieved a significant two-point LOD score this is the only study that have provided statistically signif- of 3.24 at the marker D9S1817. The flanking markers, icant evidence for linkage from a single pedigree, the other D9S1845 and D9S1805 also achieved positive LOD scores pedigrees having two-point LOD scores of 2.41 [16], 2.81 of 2.90 and 2.46, respectively (Table 2). A multi-point [18] and 2.33 [17]. This means that we can rely on our LOD score of 3.41 was observed at marker D9S1817. haplotype analysis with greater statistical certainty. In From the haplotype analysis (Figure 1), a new extended addition, the family shows considerable clinical heteroge- disease haplotype was defined using the distal telomeric neity, compared to some other families that have been meiotic cross-over between markers D9S175 and D9S167 linked to the same locus.
Page 8 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
Our genome-wide linkage analysis led to the identifica- The first reported linkage of a novel FTLD-MND locus to tion of a genetic locus on chromosome 9p21.1-9q21.3. chromosome 9p was in 2006, although no convincing The resulting 57 Mb disease haplotype region overlaps candidate genes have yet been identified. The issue of phe- with three other FTLD-MND loci identified by Morita et nocopies and the error of reliance on a single meiotic al., [17] Vance et al., [16] and Valdmanis et al. [18] (Figure recombination events to define minimal disease regions 5) providing further evidence for this region as the disease could be a crucial factor in the failure to identify the dis- locus. In combination, the four linkage studies collec- ease gene. The recombination breakpoints reported in the tively define a likely disease haplotype of 7.0 Mb between literature by Morita et al. [17] and Valdmanis et al. [18] are D9S169 and D9S1805 (Figure 5). We note that this hap- based on a single recombination event in a single pedi- lotype does not overlap with the most recent preliminary gree. Moreover, both of these pedigrees have two-point abstract report of a 7.4 cM haplotype on the 9p region by LOD scores less than 3. Vance et al. [16], using a pedigree Yan et al. [31] although, it does overlap with a region that with a LOD score of 2.4, showed recombination in multi- was originally reported in abstract form by Yan et al. [19] ple individuals. However, several of the individuals with Given that Yan's latest reported region is probably based the disease haplotype do not have FTLD-MND, [16] call- on recombination events drawn from multiple families it ing into question the relevance of this recombination is possible that one of the defining break points may be a breakpoint. Our reported increase in the minimal disease false positive due to the low statistical power of individual region should inform the other groups that the chromo- pedigrees, [31] or that a disease haplotype boundary was some 9 locus may be more significantly more telomeric defined by a phenocopy as observed in our pedigree. The than predicted by the existing recombination breakpoints. region defined by D9S169 and D9S1118 (Figure 4) har- Moreover, we report the existence of a case with clinical bours the five transcripts that have been thoroughly Alzheimer's disease, and FTLD-U neuropathology, who screened in this study and by Momeni et al. [20] with no shares the disease haplotype. This result highlights the plausible mutations having been detected. possibility that the classification of late-onset AD patients in the other linked pedigrees as sporadic dementia cases Changes in personality and behaviour, motor dysfunction or unaffected may be erroneous, thereby reducing statisti- as well as Ub/TDP-43 positive pathology represent the cal power, or possibly even excluding pedigrees from link- core clinical and neuropathological features characteristic age analysis. In summary, multiple families with FTLD- of FTLD-MND families linked to 9p. In this study we MND, without mutations in the known dementia genes, describe an FTLD-MND family with additional clinical have been linked to chromosome 9p. This strongly sug- and pathological findings, not previously described in the gests that the locus on chromosome 9 play a major role in chromosome 9p-linked families. Early and severe mem- pathogenic pathways that lead to FTLD-MND, making it ory impairment is generally held to be an exclusion crite- imperative to identify the causative gene(s). rion for the clinical diagnosis of FTLD. [1] None of the other chromosome 9-linked pedigrees have reported Competing interests major memory impairment as their primary diagnoses, The authors declare that they have no competing interests. although Morita et al. [17] mentioned that memory defi- cits were detected in three affected individuals in their Authors' contributions pedigree. However this aspect was not reported as their JBJK, PRS conceived this study. AAL, CDS acquired the primary diagnosis as their memory deficits were detected data. EMT, JH, GAN, WSB, PKP, CTL collected blood and during neuropsychological tests three years before death. clinical data from family. PB, GMH performed the neu- Moreover, Momeni et al. [20] reported that one of their ropathological analyses. JBJK, AAL, PP, GMH and PRS par- patients had additional AD-like pathology, namely dif- ticipated in the mamangement, analysis, interpretation of fuse E-amyloid (AE) positive plaques in the absence of data and drafting of manuscript. All have critically revised neuritic plaques and tangles. We too describe a patient the manuscript for important intellectual content and (III:2) who presented with clinical symptoms typical of seen and approved the final version. AD and at autopsy not only had indisputable TDP-43 pos- itive neuronal cytoplasmic inclusions but also had amy- Additional material loid-plaques and neurofibrillary tangles characteristic of AD (Figure 2). It has been postulated that Apolipoprotein E (APOE) may play a role in the development of AE dep- Additional file 1 Detailed clinical and neuropathological descriptions of pedigree members. osition in FTLD cases [32]. There is no apparent associa- Click here for file tion of APOE status with the presence of AE deposition in [http://www.biomedcentral.com/content/supplementary/1471- family 14 as the individual who was homozygous e4/e4 2377-8-32-S1.doc] (III:12) had less AE deposition than the two individuals who were heterozygous e3/e4 (III:2 and III:3).
Page 9 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
Acknowledgements Galasko DR, Montine TJ, Trojanowski JQ, Lee VM, Schellenberg GD, Australian Postgraduate Award (AAL), the National Health & Medical Yu CE: TARDBP mutations in amyotrophic lateral sclerosis with TDP-43 neuropathology: a genetic and histopathologi- Research Council (Australia) Project Grants 276407 and 510217, RD cal analysis. Lancet Neurol 2008, 7(5):409-16. Wright Fellowship 230862 (JBJK), Medical Postgraduate Scholarship 14. Kabashi E, Valdmanis PN, Dion P, Spiegelman D, McConkey BJ, Velde 325640 (CTL) and Research Fellowships 350827 (GMH) and 157209 (PRS), C Vande, Bouchard JP, Lacomblez L, Pochigaeva K, Salachas F, Pradat and the Rebecca Cooper Medical Research Foundation Ltd. Blundy family PF, Camu W, Meininger V, Dupre N, Rouleau GA: TDRDBP muta- tions in familial and sporadic frontotemporal lobar degener- donation. We thank all patients and family members who participated in ation with ubiquitin inclusions. Nat Genet 2008, 40(5):572-574. this study. We also thank Jim McBride and the staff of the Peter Wills Bio- 15. Hosler BA, Siddique T, Sapp PC, Sailor W, Huang MC, Hossain A, informatic Centre, Garvan Institute of Medical Research for IT assistance, Daube JR, Nance M, Fan C, Kaplan J, Hung WY, McKenna-Yasek D, Heather McCann for assistance with immunohistochemistry and Robyn Haines JL, Pericak-Vance MA, Horvitz HR, Brown RH Jr: Linkage of familial amyotrophic lateral sclerosis with frontotemporal Flook of the South Australian Brain Bank. dementia to chromosome 9q21-q22. JAMA 2000, 284(13):1664-1669. References 16. Vance C, Al-Chalabi A, Ruddy D, Smith BN, Hu X, Sreedharan J, Sid- 1. Ratnavalli E, Brayne C, Dawson K, Hodges JR: The prevalence of dique T, Schelhaas HJ, Kusters B, Troost D, Baas F, de Jong V, Shaw frontotemporal dementia. Neurology 2002, 58(11):1615-1621. CE: Familial amyotrophic lateral sclerosis with frontotempo- 2. Neary D, Snowden J, Mann D: Frontotemporal dementia. Lancet ral dementia is linked to a locus on chromosome 9p13.2- Neurol 2005, 4(11):771-780. 21.3. Brain 2006, 129(Pt 4):868-876. 3. Neary D, Snowden JS, Gustafson L, Passant U, Stuss D, Black S, Freed- 17. Morita M, Al-Chalabi A, Andersen PM, Hosler B, Sapp P, Englund E, man M, Kertesz A, Robert PH, Albert M, Boone K, Miller BL, Cum- Mitchell JE, Habgood JJ, de Belleroche J, Xi J, Jongjaroenprasert W, mings J, Benson DF: Frontotemporal lobar degeneration: a Horvitz HR, Gunnarsson LG, Brown RH Jr: A locus on chromo- consensus on clinical diagnostic criteria. Neurology 1998, some 9p confers susceptibility to ALS and frontotemporal 51(6):1546-1554. dementia. Neurology 2006, 66(6):839-844. 4. Talbot K, Ansorge O: Recent advances in the genetics of amyo- 18. Valdmanis PN, Dupre N, Bouchard JP, Camu W, Salachas F, Meininger trophic lateral sclerosis and frontotemporal dementia: com- V, Strong M, Rouleau GA: Three families with amyotrophic lat- mon pathways in neurodegenerative disease. Hum Mol Genet eral sclerosis and frontotemporal dementia with evidence of 2006, 15(Spec No 2):R182-R187. linkage to chromosome 9p. Arch Neurol 2007, 64(2):240-245. 5. Cairns NJ, Bigio EH, Mackenzie IR, Neumann M, Lee VM, Hatanpaa KJ, 19. Yan J, Siddique N, Slifer S, Bigio E, Mao H, Chen W, Liu E, Shi Y, Khan White CL 3rd, Schneider JA, Grinberg LT, Halliday G, Duyckaerts C, S, Haines J, Pericak-Vance M, Siddique T: A Major Novel Locus for Lowe JS, Holm IE, Tolnay M, Okamoto K, Yokoo H, Murayama S, ALS/FTD on Chromosome 9p21 and its Pathological Corre- Woulfe J, Munoz DG, Dickson DW, Ince PG, Trojanowski JQ, Mann lates. Neurology 2006, 67(S61.006):186-b. DM, Consortium for Frontotemporal Lobar Degeneration: Neu- 20. Momeni P, Schymick J, Jain S, Cookson MR, Cairns NJ, Greggio E, ropathologic diagnostic and nosologic criteria for fronto- Greenway MJ, Berger S, Pickering-Brown S, Chiò A, Fung HC, Holtz- temporal lobar degeneration: consensus of the Consortium man DM, Huey ED, Wassermann EM, Adamson J, Hutton ML, for Frontotemporal Lobar Degeneration. Acta Neuropathol Rogaeva E, St George-Hyslop P, Rothstein JD, Hardiman O, Grafman (Berl) 2007, 114(1):5-22. J, Singleton A, Hardy J, Traynor BJ: Analysis of IFT74 as a candi- 6. Wang H-Y, Wang I-F, Bose J, Shen C-KJ: Structural diversity and date gene for chromosome 9p-linked ALS-FTD. BMC Neurol functional implications of the eukaryotic TDP gene family. 2006, 6:44. Genomics 2004, 83(1):130-139. 21. Halliday GM, Davies L, McRitchie DA, Cartwright H, Pamphlett R, 7. Neumann M, Sampathu DM, Kwong LK, Truax AC, Micsenyi MC, Morris JG: Ubiquitin-positive achromatic neurons in cortico- Chou TT, Bruce J, Schuck T, Grossman M, Clark CM, McCluskey LF, basal degeneration. Acta Neuropathol (Berl) 1995, 90(1):68-75. Miller BL, Masliah E, Mackenzie IR, Feldman H, Feiden W, 22. Hyman BT, Trojanowski JQ: Consensus recommendations for Kretzschmar HA, Trojanowski JQ, Lee VM: Ubiquitinated TDP-43 the postmortem diagnosis of Alzheimer disease from the in frontotemporal lobar degeneration and amyotrophic lat- National Institute on Aging and the Reagan Institute Work- eral sclerosis. Science 2006, 314(5796):130-133. ing Group on diagnostic criteria for the neuropathological 8. Arai T, Hasegawa M, Akiyama H, Ikeda K, Nonaka T, Mori H, Mann assessment of Alzheimer disease. J Neuropathol Exp Neurol 1997, D, Tsuchiya K, Yoshida M, Hashizume Y, Oda T: TDP-43 is a com- 56(10):1095-1097. ponent of ubiquitin-positive tau-negative inclusions in fron- 23. McKeith IG, Dickson DW, Lowe J, Emre M, O'Brien JT, Feldman H, totemporal lobar degeneration and amyotrophic lateral Cummings J, Duda JE, Lippa C, Perry EK, Aarsland D, Arai H, Ballard sclerosis. Biochem Biophys Res Commun 2006, 351(3):602-611. CG, Boeve B, Burn DJ, Costa D, Del Ser T, Dubois B, Galasko D, 9. Cairns NJ, Neumann M, Bigio EH, Holm IE, Troost D, Hatanpaa KJ, Gauthier S, Goetz CG, Gomez-Tortosa E, Halliday G, Hansen LA, Foong C, White CL 3rd, Schneider JA, Kretzschmar HA, Carter D, Hardy J, Iwatsubo T, Kalaria RN, Kaufer D, Kenny RA, Korczyn A, Taylor-Reinwald L, Paulsmeyer K, Strider J, Gitcho M, Goate AM, Kosaka K, Lee VM, Lees A, Litvan I, Londos E, Lopez OL, Minoshima Morris JC, Mishra M, Kwong LK, Stieber A, Xu Y, Forman MS, Tro- S, Mizuno Y, Molina JA, Mukaetova-Ladinska EB, Pasquier F, Perry RH, janowski JQ, Lee VM, Mackenzie IR: TDP-43 in familial and spo- Schulz JB, Trojanowski JQ, Yamada M, Consortium on DLB: Diagno- radic frontotemporal lobar degeneration with ubiquitin sis and management of dementia with Lewy bodies: third inclusions. Am J Pathol 2007, 171(1):227-240. report of the DLB Consortium. Neurology 2005, 10. Gitcho MA, Baloh RH, Chakraverty S, Mayo K, Norton JB, Levitch D, 65(12):1863-1872. Hatanpaa KJ, White CL 3rd, Bigio EH, Caselli R, Baker M, Al-Lozi MT, 24. Brooks BR: El Escorial World Federation of Neurology crite- Morris JC, Pestronk A, Rademakers R, Goate AM, Cairns NJ: TDP- ria for the diagnosis of amyotrophic lateral sclerosis. Sub- 43 A315T mutation in familial motor neuron disease. Ann committee on Motor Neuron Diseases/Amyotrophic Lateral Neurol 2008, 63(4):535-538. Sclerosis of the World Federation of Neurology Research 11. Sreedharan J, Blair IP, Tripathi VB, Hu X, Vance C, Rogelj B, Ackerley Group on Neuromuscular Diseases and the El Escorial "Clin- S, Durnall JC, Williams KL, Buratti E, Baralle F, de Belleroche J, Mitch- ical limits of amyotrophic lateral sclerosis" workshop con- ell JD, Leigh PN, Al-Chalabi A, Miller CC, Nicholson G, Shaw CE: tributors. J Neurol Sci 1994, 124(Suppl):96-107. TDP-43 mutations in familial and sporadic amyotrophic lat- 25. Dickson DW, Bergeron C, Chin SS, Duyckaerts C, Horoupian D, eral sclerosis. Science 2008, 319(5870):1668-1672. Ikeda K, Jellinger K, Lantos PL, Lippa CF, Mirra SS, Tabaton M, Von- 12. Yokoseki A, Shiga A, Tan CF, Tagawa A, Kaneko H, Koyama A, Eguchi sattel JP, Wakabayashi K, Litvan I: Office of Rare Diseases of the H, Tsujino A, Ikeuchi T, Kakita A, Okamoto K, Nishizawa M, Taka- National Institutes of Health. Office of Rare Diseases neu- hashi H, Onodera O: TDP-43 mutation in familial amyotrophic ropathologic criteria for corticobasal degeneration. J Neu- lateral sclerosis. Ann Neurol 2008, 63(4):538-542. ropathol Exp Neurol 2002, 61(11):935-946. 13. Van Deerlin VM, Leverenz JB, Bekris LM, Bird TD, Yuan W, Elman LB, 26. Hauw JJ, Daniel SE, Dickson D, Horoupian DS, Jellinger K, Lantos PL, Clay D, Wood EM, Chen-Plotkin AS, Martinez-Lage M, Steinbart E, McKee A, Tabaton M, Litvan I: Preliminary NINDS neuropatho- McCluskey L, Grossman M, Neumann M, Wu IL, Yang WS, Kalb R, logic criteria for Steele-Richardson-Olszewski syndrome
Page 10 of 11 (page number not for citation purposes) BMC Neurology 2008, 8:32 http://www.biomedcentral.com/1471-2377/8/32
(progressive supranuclear palsy). Neurology 1994, 44(11):2015-2019. 27. Nagata K, Saito H, Ueno T, Sato M, Nakase T, Maeda T, Satoh Y, Komatsu H, Suzuki M, Kondoh Y: Clinical diagnosis of vascular dementia. J Neurol Sci 2007, 257(1–2):44-48. 28. Badenhop RF, Moses MJ, Scimone A, Mitchell PB, Ewen-White KR, Rosso A, Donald JA, Adams LJ, Schofield PR: A genome screen of 13 bipolar affective disorder pedigrees provide evidence for susceptibility loci on chromosome 3 as well as chromosome 9, 13 and 19. Mol Psychiatry 2002, 7(6):594-603. 29. Thiele H, Nurnberg P: HaploPainter: a tool for drawing pedi- grees with complex haplotypes. Bioinformatics 2005, 21(8):1730-1732. 30. Waite LM, Broe GA, Creasey H, Grayson DA, Cullen JS, O'Toole B, Edelbrock D, Dobson M: Neurodegenerative and other chronic disorders among people aged 75 years and over in the com- munity. Med J Aust 1997, 167(8):429-432. 31. Yan J, Siddique N, Slifer S, Bigio E, Mao H, Chen W, Liu E, Shi Y, Khan S, Haines J, Pericak-Vance M, Siqque T: Fine-Mapping and Candi- date Gene Sequencing of the Chromosome 9p Locus of ALS/ FTD: P07.054. American Academy of Neurology, 59th Annual Meeting 2007. 32. Mann DM, McDonagh AM, Pickering-Brown SM, Kowa H, Iwatsubo T: Amyloid beta protein deposition in patients with fronto- temporal lobar degeneration: relationship to age and apoli- poprotein E genotype. Neurosci Lett 2001, 304(3):161-164. 33. Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shl- ien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K: A high-resolution recombination map of the human genome. Nat Genet 2002, 31(3):241-247.
Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2377/8/32/prepub
Publish with BioMed Central and every scientist can read your work free of charge "BioMed Central will be the most significant development for disseminating the results of biomedical research in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed Central yours — you keep the copyright
Submit your manuscript here: BioMedcentral http://www.biomedcentral.com/info/publishing_adv.asp
Page 11 of 11 (page number not for citation purposes) SUPPLEMENTARY DATA
Detailed clinical and neuropathological descriptions of pedigree members
Case III:3 - The proband (Fig. 1) presented at age 62 with definite and progressive behavioural changes for two and a half years, but the duration of illness was possibly longer. These changes were characterised by poor insight, loss of empathy, disinhibition (including sexual advances), deteriorating self-care and shop-lifting. Neuropsychological examination found impaired attention and working memory, marked deficits in frontal executive function with preservation of visuospatial and other posterior cortical functions. Taken together, his clinical findings were consistent with the behavioural variant of FTLD. He died of aspiration pneumonia aged 66.
At autopsy, the brain weighed 1243 grams and had no evidence of significant gyral atrophy. In particular the frontal lobes appeared macroscopically preserved. The ventricular system was symmetrical and of normal size. The basal ganglia, thalamus, hypothalamus and hippocampi were all normal. Histopathology was largely confined to cortical and medial temporal lobe structures with sparing of the basal ganglia, brainstem and cerebellum. There was ubiquitin- and TDP-43-immunopositive NCI in the entorhinal cortex, mild cortical vacuolation in the temporal pole, ‘granular’ NCI in the dentate granule cells (Fig. 2), granulovacuolar degeneration in the hippocampal CA1 pyramidal neurons, occasional ubiquitin- and TDP-43-immunopositive NCI in the superior frontal cortex, and mild spongiform change in the right parietal lobe. In the superior frontal and temporal neocortices, widespread diffuse plaque formation (up to 80 per X100 field) was observed following AE immunostaining. Rare tau immunopositivity was also present in the granular layer of the dentate gyrus, however no significant neurofibrillary tangle or Pick body formation was seen with either the Bielschowsky silver stain or immunostaining with AT8 (anti- phospho tau) antibody. No Lewy bodies were evident following D-synuclein immunostaining. The morphology and distribution of TDP-43 inclusions is consistent with type 2 FTLD-U histology according to the composite scheme adopted by Cairns et al. (2007).
Case III:12 - This man presented at age 45 with progressive lower limb weakness, necessitating a walking frame by age 47. By the age of 49 he had developed bulbar weakness, was unable to vocalise and required nasogastric tube feeding. Neurological examination found mixed upper and lower motor neuron signs including wasting, fasciculations and pathologically brisk reflexes in the
115 tongue/jaw, upper and lower limbs. Verbal and written comprehension appeared intact, he was able to communicate by non-verbal means, and there were no unusual behaviours. His bedside findings satisfied the criteria for clinically definite MND. He died aged 51 of cardiorespiratory failure.
The brain weighed 1153 grams. External inspection of the left cerebral hemisphere showed mild atrophy of the left precentral gyrus. The left hemi-brain stem and cerebellum were normal. Coronal sections of the cerebral hemisphere were normal. Microscopic assessment revealed severe status spongiosis of layers 2 and 3 of the parasagittal motor cortex (Fig. 3) and mild spongiosis of middle and inferior portions of the motor cortex. There was subtotal loss of Betz cells (Fig. 3). There was mild patchy status spongiosis in layers 2 and 3 of the primary sensory cortex and mild focal spongiosis of the hippocampal CA1 neuropil. Many ubiquitin- and TDP-43- immunopositive, but D-internexin immunonegative NCI were present in the granule cells of the dentate gyrus. The Bielschowsky silver stains showed no plaques or tangles and AT8, AE and D- synuclein immunostains were negative. There was mild pallor of the mid-third of the cerebral peduncle (Weil stain) and of the medullary pyramidal tract consistent with descending Wallerian degeneration.
Macroscopic examination of the external spinal cord and segmental sections of the spinal cord showed atrophy of the anterior nerve roots. Microscopic examination of the spinal cord showed marked symmetrical loss of myelin staining (Weil stain) in the lateral and anterior corticospinal tracts (Fig. 3) consistent with descending Wallerian degeneration. There was severe loss of anterior horn cells which varied from segment to segment and side to side and was almost total in the cervical cord segments. Rare Bunina bodies were evident (Fig. 3) and skein-like cytoplasmic ubiquitin and TDP-43 immunopositive (Fig. 3) inclusions were present in some surviving anterior horn cells. There was marked atrophy of anterior nerve roots (Fig. 3). The neurons of the intermediolateral cell columns and Clarke’s column were intact.
Case III:2 – This woman's medical history included a dystonic neck tremor from age 35, which was also present in her mother and two of her five siblings (one with and one without FTLD- MND). She began repeating herself in conversation aged 68 and became increasingly forgetful after that. When assessed at the age of 69, she scored 18/30 on the mini-mental state examination. She was disoriented at the time and had difficulties with verbal recall,
116 confrontational naming and visuospatial tasks. She started wandering a year later and was unable to self care by the age of 70. Her speech and verbal comprehension became limited by the time she was 72, and she was chairbound and no longer able to feed herself by the age of 74. When examined shortly before her death at age 75, she was mute and unable to obey simple verbal commands. There were myoclonic jerks involving her right upper and lower limbs, a dystonic neck tremor and she was hyper-reflexic in all four limbs with bilateral upgoing plantars. There were no fasciculations. She was diagnosed with myeloma soon after and died in a palliative care setting.
On examination, the brain weighed 936 grams. External inspection of the left cerebral hemisphere showed atrophy of the superior temporal gyrus and mild atrophy of the frontal lobe. The left hemi-brainstem and cerebellum appeared normal. A small hippocampus and amygdala was observed in coronal sections of the cerebral hemisphere. This corresponded with the microscopic finding of severe pyramidal cell loss from Ammon’s horn (Fig. 2), particularly involving the CA1 region, and the amygdala. No extracellular neurofibrillary tangles, TDP-43-, tau- or ubiquitin-immunoreactivity was evident in the region of hippocampal sclerosis. More abundant ubiquitin- and TDP-43-immunoreactive inclusions were found in the frontal and temporal sections sampled where there was severe loss of cortical neurons, prominent reactive fibrous astrogliosis and status spongiosus. These inclusions were similar in morphology to that seen in case III:3. However, the most significant depositions were found in the hippocampal dentate gyrus with a four-fold increase in ubiquitin/TDP-43-immunopositive NCIs (Fig. 2). A small number of these dentate NCI also showed moderate tau immunopositivity, although the greatest deposition of tau was observed in neuritic threads throughout the cerebral tissue sampled. Tau- positive neurofibrillary tangles were also found in some remaining hippocampal neurons, in the amygdala, and in neurons in most of the cortical regions sampled. There was an abundance of plaques and cerebrovascular amyloidosis, particularly in the temporal neocortex (Fig. 2). No significant abnormalities were observed in basal ganglia, brainstem or cerebellar regions, and no Lewy bodies were evident following D-synuclein immunostaining. The morphology and distribution of TDP-43 inclusions is consistent with type 2 FTLD-U histology according to the composite scheme adopted by Cairns et al. (2007). The case also had hippocampal sclerosis, as well as sufficient densities of cortical plaques and tangles to fulfil criteria for Alzheimer's disease (although not sufficient CA1 hippocampal neuritic pathology). Overall the severity of the FTLD-U histology was more severe than the Alzheimer's disease histology.
117 Case III:6 - This man first came to medical attention aged 58 with an acute psychotic episode characterised by auditory hallucinations and persecutory delusions involving his family and neighbours. With hindsight, this was preceded by subtle personality changes (poor empathy and overspending) for ten years, and impaired work performance with mild paranoia in the preceding twelve months. The psychotic episode resolved within a month and had not recurred despite his decision to stop risperidone of his own accord. In the two years following this he became increasingly impulsive, inflexible and uncaring. He overspent without discussion with his wife, undertook a number of unwise investment decisions and remained without insight. Neurological examination was normal until age 60 when frontal release signs were first noted. At the age of 61 he was found to have slurred speech with tongue fasciculations and wasting. Investigations at the time including lumbar puncture, routine Magnetic Resonance Imaging and an 18F- fluorodeoxyglucose Positron Emission Tomography scan were all within normal limits. Neuropsychological examination found borderline frontal executive function but impairment was not severe enough for a definitive diagnosis. In the ensuing twelve months, the patient developed mixed upper and lower motor neuron signs in both his upper and lower limbs. He is currently anarthric but still able to walk with a severe left foot drop.
118 Chapter 4
Paper III SIGMAR1 mutations cause frontotemporal lobar degeneration - motor neuron disease
119
RAPID COMMUNICATION
Sigma Nonopioid Intracellular Receptor 1 Mutations Cause Frontotemporal Lobar Degeneration–Motor Neuron Disease
Agnes A. Luty, BSc,1–3* John B.J. Kwok, PhD,1–3* Carol Dobson-Stone, PhD,1–3* Clement T. Loy, MD,1–3 Kirsten G. Coupland, BSc,1 Helena Karlstro¨ m, PhD,4 Tomasz Sobow, MD,5 Joanna Tchorzewska, MD,5 Aleksandra Maruszak, BSc,6 Maria Barcikowska, MD,6 Peter K. Panegyres, MD,7,8 Cezary Zekanowski, PhD,6 William S. Brooks, MD,1,2 Kelly L. Williams, BSc,9 Ian P. Blair, PhD,9,10 Karen A. Mather, PhD,11 Perminder S. Sachdev, MD,11,12 Glenda M. Halliday, PhD,1,2 and Peter R. Schofield, PhD, DSc1–3
Objective: Frontotemporal lobar degeneration (FTLD) is the most common cause of early-onset dementia. Pathological ubiquitinated inclusion bodies observed in FTLD and motor neuron disease (MND) comprise trans- activating response element (TAR) DNA binding protein (TDP-43) and/or fused in sarcoma (FUS) protein. Our objective was to identify the causative gene in an FTLD-MND pedigree with no mutations in known dementia genes. Methods: A mutation screen of candidate genes, luciferase assays, and quantitative polymerase chain reaction (PCR) was performed to identify the biological role of the putative mutation. Neuropathological characterization of affected individuals and western blot studies of cell lines were performed to identify the pathological mechanism of the mutation. Results: We identified a nonpolymorphic mutation (c.672*51G>T) in the 30-untranslated region (UTR) of the Sigma nonopioid intracellular receptor 1 (SIGMAR1) gene in affected individuals from the FTLD-MND pedigree. The c.672*51G>T mutation increased gene expression by 1.4-fold, corresponding with a significant 1.5-fold to 2-fold change in the SIGMAR1 transcript or Sigma-1 protein in lymphocyte or brain tissue. Brains of SIGMAR1 mutation carriers displayed a unique pathology with cytoplasmic inclusions immunopositive for either TDP-43 or FUS but not Sigma-1. Overexpression of SIGMAR1 shunted TDP-43 and FUS from the nucleus to the cytoplasm by 2.3-fold and 5.2- fold, respectively. Treatment of cells with Sigma-1 ligands significantly altered translocation of TDP-43 by up to 2-fold. Interpretation: SIGMAR1 is a causative gene for familial FTLD-MND with a unique neuropathology that differs from other FTLD and MND cases. Our findings also suggest Sigma-1 drugs as potential treatments for the TDP-43/FUS proteinopathies. ANN NEUROL 2010;68:639–649
rontotemporal lobar degeneration (FTLD) is the most common cause of dementia under the age of 65 Fthird most common cause of dementia, after Alzhei- years.1 The spectrum of FTLD phenotypes includes the mer’s disease and dementia with Lewy bodies, and the co-occurrence of FTLD with motor neuron disease
View this article online at wileyonlinelibrary.com. DOI: 10.1002/ana.22274
Received May 26, 2010, and in revised form Aug 30, 2010. Accepted for publication Sep 17, 2010.
Address correspondence to Dr Schofield, PhD, DSc, Executive Director and CEO, Neuroscience Research Australia, Barker St, Randwick, Sydney, NSW 2031, Australia. E-mail: [email protected]
*These authors contributed equally to this work.
From 1Neuroscience Research Australia, Sydney, New South Wales, Australia; 2School of Medical Sciences, University of New South Wales, Sydney, New South Wales, Australia; 3Garvan Institute of Medical Research, Sydney, New South Wales, Australia; 4Karolinska Institute, Stockholm, Sweden; 5Department of Medical Psychology, Medical University of Lodz, Lodz, Poland; 6Department of Neurodegenerative Disorders, Polish Academy of Sciences, Warsaw, Poland; 7Neurosciences Unit, Department of Health, Perth, Western Australia, Australia; 8Neurodegenerative Disorders Research, Subiaco, Western Australia, Australia; 9Northcott Neuroscience Laboratory, ANZAC Research Institute, Concord, New South Wales, Australia; 10Faculty of Medicine, University of Sydney, Sydney, New South Wales, Australia; 11Brain and Ageing Research Program, School of Psychiatry, University of New South Wales, New South Wales, Australia; and 12Neuropsychiatric Institute, The Prince of Wales Hospital, Sydney, New South Wales, Australia.
Additional Supporting Information can be found in the online version of this article.
VC 2010 American Neurological Association 639 ANNALS of Neurology
(MND).2 FTLD is a pathologically heterogeneous disor- Consent and Ethics Approval der categorized into 2 main groups: cases with tau-posi- Written informed consent was obtained from the appropriate tive pathology known as tauopathies, and those without, legal guardians for blood donations for genetic studies and for previously known as FTLD-U.3 The trans-activating brain donations. Aus-14 family tissue was obtained from the response element (TAR) DNA binding protein (TDP- South Australian Brain Bank and other FTLD and control sam- 43), a heterogeneous nuclear ribonucleoprotein (hnRNP) ples from the Sydney Brain Bank at Neuroscience Research Australia. All studies were approved by the relevant institutional involved in exon splicing and transcription regulation,4 ethics committees. was identified as a major protein component of the ubiq- uitinated inclusions in many FTLD-U (FTLD-TDP) and FTLD, Familial Presenile Dementia, and Sydney 5,6 TARDBP MND patients. Mutations in the TDP-43 ( ) Older Person Study Cohorts gene have been reported in familial and sporadic FTLD- The FTLD-MND pedigree (family Aus-14) has been 7 8,9 U and MND cases. More recently, mutations in the described.21 The Australian familial FTLD cohort comprises 26 gene encoding a related hnRNP known as fused in sar- pedigrees selected on the basis of a positive family history.22 All coma (FUS) were identified in familial MND cases.10,11 probands fulfill current diagnostic criteria for FTLD.23 All pro- FUS protein colocalizes with TDP-43 in the motor neu- bands were negative for MAPT and GRN mutations. ron inclusions.12 A neuropathological review of FTLD Two independent Polish presenile dementia cohorts com- APP PSEN1 cases identified FUS as a major protein in the inclusions prise 158 familial cases. Cases were negative for , , PSEN2 MAPT 24,25 found in atypical FTLD-U patients (FTLD-FUS) with- , and mutations. The Polish cohort is also negative for GRN mutations. out TDP-43 inclusions,12–14 and these FUS inclusions The Sydney Older Person Study (SOPS) cohort com- are only rarely present in the brains of FTLD-TDP-43 12 prises 169 neurologically normal elderly individuals (mean age patients or in FTLD-MND cases. Neurons with cyto- ¼ 88; SD ¼ 4.3 years).26 An additional 350 neurologically plasmic inclusions containing either hnRNP show a par- normal controls who did not have a family history of MND 5,6 tial or total loss of normal nuclear TDP-43 or (mean age ¼ 61; SD ¼ 10.9 years)8 and 750 nondemented 12,13 FUS, raising the possibility that nuclear clearing and controls (mean age ¼ 79; SD ¼ 4.9 years) from the commu- cytoplasmic sequestration of these hnRNPs play a mecha- nity-based Memory and Aging cohort were screened.27 nistic role in disease pathogenesis. Genetic studies have identified FTLD-U causal muta- Brain Tissue Analyses SIGMAR1 tions in the progranulin (GRN) and valosin-containing pro- For western blot analyses, frozen brain tissue from 3 > tein (VCP) genes.15 A major FTLD-MND locus is situated c.672*51G T carriers (Fig 1; III:2, III:3, III:12) and 3 age- matched controls was used. Each sample was assayed twice. on chromosome 9p, with 12 pedigrees having definite or Crude total brain protein was extracted from the frontal cortex suggestive linkage to a 3.2Mb minimal disease region using methods described.28 Specific proteins were visualized D9S169 D9S251 16–21 between markers and . Chromosome using commercially available antibodies for TDP-43 9p–linked pedigrees are characterized by a combination of (BC001487 [ProteinTech Group, Chicago, IL; diluted 1:2000] 16–21 TDP-43 immunopositive FTLD and classical MND. and ab57105 [Abcam, Cambridge, UK; diluted 1:1000]), Progranulin and VCP mutation carriers and chromosome Sigma-1 (ab53852 [Abcam; diluted 1:500] or sc-22948 [Santa 9p–linked cases exhibit variation in ubiquitin, TDP-43, Cruz Biotechnology, Santa Cruz, CA; diluted 1:200]), and b- and FUS deposition, indicating that FTLD-U is clinically, actin (ab8226 [Abcam; diluted 1:2000]) and enhanced chemilu- neuropathogically, and genetically heterogenous.12–14 minescence according to the manufacturer’s instructions (Super- We previously reported on a multigenerational FTLD- signal West Pico Chemiluminescent Substrate; Thermo Scien- MND pedigree (Aus-14) with linkage to chromosome 9.21 tific, Rockford, IL). In this study, we examined a series of candidate genes for a Immunohistochemistry was performed on formalin-fixed paraffin-embedded sections of the superior frontal cortex and mutation that cosegregates with the disease phenotype in the hippocampus from SIGMAR1 c.672*51G>T carriers, an FTLD-MND pedigree. We present functional data that the 29 SIGMAR1 FTLD case with a GRN Arg493X mutation, a FTLD-FUS Sigma nonopioid intracellular receptor 1 ( )geneis case, and age-matched controls. Sigma-1 protein was visualized a novel causative locus for FTLD-MND. using a citrate buffer antigen retrieval and immunoperoxidase procedure (sc-22948 [Santa Cruz Biotechnology; diluted 1:25]).21 Specificity of the reaction was confirmed by omitting Patients and Methods the primary antibodies. Double immunofluorescence was per- Materials formed using mouse anti-phospho TDP-43 (pS409/410 Commercially available Sigma-1 ligands AC915 (A 3595), opi- [Cosmo Bio Co, Tokyo, Japan; diluted 1:5000]) antibody, rab- pramol (O 5889), and haloperidol (H 1512) were obtained bit anti-FUS antibody (ab70381 [Abcam; diluted 1:500]), and from Sigma-Aldrich (St. Louis, MO). rabbit anti-Sigma-1 antibodies (sc-22948 [Santa Cruz
640 Volume 68, No. 5 Luty et al: SIGMAR1 Mutations in FTLD-MND
FIGURE 1: Three pedigrees with FTLD and SIGMAR1 30-UTR mutations. Black figures indicate neuropathological and/or clinical diagnosis of presenile dementia. Gray figures indicate presence of MND. Half-gray figures indicate the presence of dementia and MND. Note that individual III:8 from Aus-14 has since died of MND but is believed to have been a phenocopy.17 DNA samples available for analyses are indicated by asterisks. Probands are indicated by arrows. The presence of familial SIGMAR1 mutations are indicated (1).
Biotechnology; diluted 1:25]). Antibodies were visualized with on request). PCR products amplified from genomic templates the relevant combination of Alexa Fluor 594 donkey anti-mouse, were sequenced using BigDye chemistry and a 3730 DNA Ana- Alexa Fluor 594 donkey anti-rabbit, Alexa Fluor 488 donkey lyzer (Applied Biosystems, Foster City, CA). anti-mouse and Alexa Fluor 488 donkey anti-goat secondary antibodies (Invitrogen, Carlsbad, CA) on a confocal microscope (C190; Nikon Corporation, Tokyo, Japan). To ensure specificity Luciferase Reporter Assay SIG- of the immunohistochemical reactions, a section without primary A 1223bp promoter fragment was amplified from the MAR1 antibodies was included for each staining procedure as a negative gene using the oligonucleotides SIGMAR1-PromF (50-CTGGGGAGTAGGACCATTGTTTC-30) and SIGMAR1- control. Additionally, a mixture of the secondary antibodies was 0 0 applied to sections with only 1 primary antibody incubated on PromR (5 -TATCTCTTCGCGCTGGAAGACG-3 ) and sub- each section. cloned into a pGL3 vector (Promega, Sydney, Australia) containing the luciferase reporter gene. A 1104bp genomic frag- ment was amplified corresponding to the entire 30-untranslated Mutation Screen of Candidate Genes region (30-UTR) of the SIGMAR1 gene using the oligonucleo- Intronic polymerase chain reaction (PCR) primers were tides SIGMAR1-3UTRF (50-ACTGTCTTCAGCACCCAG- designed to amplify each noncoding and coding exon and GACT-30) and SIGMAR1-3UTRR (50-ACCATGAATCACA- flanking intronic sequence of the candidate genes miR876, CAGCAAGAG-30). Genomic DNA from subjects with the miR873, NCRNA00032, UBE2R2, DNAJA1, PAX5, c.672*51G>T or c672*26C>T alleles or from normal subjects CNTNAP3, GDA, DNAI1, CNTFR, DCNT3, ILIIRA, GALT, was used as a template. Wild-type and mutant alleles were sub- CCL19, CCL21, CCL27, ARID3C, TLN1, MOBKL2B, cloned into a modified pGL3 vector containing the wild-type HINT2, AQP3, UBAP1, ALDH1B1, PLAA, IFNK, P23, SIGMAR1 promoter. The c.672*47G>A mutation was intro- UNIQ470, UBAP2, TOPORS, NDUFB6, APTX, BAG1, and duced into the luciferase reporter construct with the wild-type SIGMAR1 using the ExonPrimer program accessed using the SIGMAR1 promoter and wild-type 30-UTR by site-directed University of California Santa Cruz (UCSC) Genome Bioinfor- mutagenesis (Stratagene, Cedar Creek, TX). Each recombinant matics Site (http://genome.ucsc.edu; primer sequences available vector was transfected into human neuroblastoma SK-N-MC
November, 2010 641 ANNALS of Neurology
(ATCC HTB 10) or human embryonic kidney cells HEK293 (ATCC HTB 11) cells using Lipofectamine 2000 (Invitrogen). (CRL-1573) using Lipofectamine 2000 reagent according to Cells were left for 48 hours prior to western blot analyses of the manufacturer’s instructions (Invitrogen). Cells were lysed af- TDP-43 and FUS protein levels. For total protein extraction, ter 48 hours, and luciferase activities were assayed using the cells were lysed in 1 lysis buffer (50mM Tris HCl, pH 7.4; Readi-Glo reagent according to manufacturer’s instructions 150mM NaCl; 1 mM phenylmethylsulfonyl fluoride [PMSF]; (Promega). 1 complete cocktail protease inhibitor; Roche Diagnostics GmbH, Mannheim, Germany; and 0.05% Triton X-100). Sub- Quantification of SIGMAR1 and TDP-43 cellular fractions were isolated using a NE-PER Nuclear and Transcript Levels Cytoplasmic extraction kit (Thermo Scientific) according to the Total RNA was extracted from immortalized lymphocytes of manufacturer’s instructions. Lysates underwent electrophoresis affected individuals (Fig 1; III:2, III:6, III:7, and III:12) and on a 10% sodium dodecyl sulfate–polyacrylamide gel electro- nonmutation carriers (Fig 1; III:1, III:9, III:10, and III:11) phoresis (SDS-PAGE) gel and were transferred to a nitrocellu- from Aus-14 or from transfected cells using the SV Total RNA lose membrane (Trans-blot transfer medium; Bio-Rad, Hercu- extraction system (Promega). RNA quality was determined by les, CA). Densities of chemiluminescence bands were quantified the integrity of the 28S and 18S ribosomal RNA bands upon using the Bio-Rad Chemidoc system. Rabbit polyclonal anti- gel electrophoresis. RNAs were reverse-transcribed using a poly- bodies were used to detect the TDP-43 protein (BC001487; dT primer. SIGMAR1 transcript levels were determined by ProteinTech Group; diluted 1:2000) and FUS protein SYBR-green-chemistry quantitative PCR using SIGMAR1-RTF (ab23439; Abcam; diluted 1:2000). Difference in protein levels (50-ACCATCATCTCTGGCACCTT-30) and SIGMAR1-RTR between different samples were normalized using b-actin levels (50-CTCCACCATCCATGTGTTTG-30) primers. TDP-43 (ab8226; Abcam; diluted 1:2000). transcripts levels were determined using 2 different primer sets: 0 0 TDP43RT1F (5 -AAGAGCAGTCCAGA AAACATCC-3 ) and Statistical Analyses TDP43RT1R (50-CCTGCACCACATAA GAACTTCTCC-30); Mean differences in quantitative measures were compared using and TDP43RT2F (50-GATAGATGGACGATGGTGTGAC-30) 2-tailed Student t tests. Analysis of covariance (ANCOVA) and and TDP43RT2R (50-TCATCCTCAGTCATGTCCTC TG- regression analyses were performed using the SPSS13 statistical 30). Transcript levels between samples were normalized using package (SPSS, Inc., Chicago, IL), taking into account individ- primers that amplify the housekeeping genes, succinate dehy- ual data for age and disease status. Mean and standard error of drogenase complex subunit A (SDHA)orb-actin (ACTB). the mean (SEM) are reported for all variables. Mean values were derived from duplicate measurements.
SIGMAR1 Expression Constructs Results SIGMAR1 A full-length wild-type complementary DNA Identification of a Putative Mutation (cDNA) was constructed by reverse-transcription (RT)-PCR of in SIGMAR1Gene lymphocyte RNA using the primers SIGMAR1-F (50-AAAA 0 We previously reported an FTLD-MND pedigree (Aus- GCTTATGCAGTGGGCCGTGGGC-3 ) and SIGMAR1-R 14) with neuronal TDP-43-immunopositive cytoplasmic (50-AGGATCCTGGTGGGGAGGAGGTGGGAA-30) and sub- inclusions (Fig 1) and maximal linkage at marker cloned into the expression vector pcDNA3.1 (Invitrogen) to D9S1817 on chromosome 9p (logarithm of odds [LOD] generate the pcDNA-SIGMAR1(wt) plasmid. The presence of a 21 FLAG motif at the amino-terminal end of the Sigma-1 protein 3.41). A mutation screen of the affected individuals did was introduced using the primers SIGMAR1-FLAGF (50- not reveal any pathogenic nucleotide changes in the AAAAGCTTATGGATTACAAGGATGACGACGATAAGCAG known dementia and MND causative genes (APP, PSEN1, TGGGCCGTGGGC-30) and SIGMAR1-FLAGR (50-AGGA PSEN2, MAPT, VCP, GRN, CHMP2B, TARDBP, FUS, TCCTGGTGGGGAGGAGGTGGGAA-30) to generate the and SOD1). We therefore commenced examination of pcDNA-FLAG-SIGMAR1(wt) plasmid. A Stealth RNA inter- approximately 200 genes within the candidate disease ference (RNAi) oligonucleotide (HSS145543; Invitrogen) was region (D9S169 to D9S1845) defined in Aus-14, initially SIGMAR1 used to knock down endogenous gene expression in focusing on genes with possible involvement in neurode- cell lines. Either a high GC negative RNAi control (12935- generation. Of the initial 30 genes examined, SIGMAR130 SIGMAR1 l 400; Invitrogen) or RNAi (20pmol/ l stock) was was the only gene that had a nonpolymorphic nucleotide transfected into cell lines according to the manufacturer’s change (c.672*51G>T) that cosegregated with the disease instructions. haplotype in the Aus-14 pedigree (Fig 2A,B). The > 0 Determination of Total TDP-43 and FUS Levels c.672*51G T nucleotide substitution is located in the 3 - and Subcellular Localization by Western UTR and was not detected in a cohort of 169 elderly nor- 26 Blotting mal controls from the SOPS or in an additional cohort 8,27 Recombinant vectors were transfected into SK-N-MC (ATCC of 1100 neurologically normal controls. We further HTB 10), HEK293 (ATCC CRL 1573), and SK-N-SH screened an Australian cohort of FTLD probands from 26
642 Volume 68, No. 5 Luty et al: SIGMAR1 Mutations in FTLD-MND pedigrees that were negative for MAPT and GRN muta- SOPS cohort26 and the 1100 neurologically normal con- tions,22 and 2 independent Polish presenile dementia trols8,27 as well. An additional 50 normal controls of Pol- cohorts comprising 158 unrelated familial cases that were ish descent were screened to confirm the absence of the negative for APP, PSEN1, PSEN2, GRN and MAPT muta- c.672*47G>A substitution. tions.24,25 A nucleotide substitution in the 30-UTR (c.672*26C>T) was identified in another Australian pedi- Effect of SIGMAR1 Mutations on Gene gree with FTLD (Aus-47) (see Figs 1 and 2A,B). Another Expression 0 SIGMAR1 0 3 -UTR substitution was identified in another family (Pol- The 3 -UTR alterations may alter the stability of 31 1) from the Polish cohorts (c.672*47G>A) (Figs 1 and the transcript. We constructed chimeric reporter vectors in 0 2A,B). No additional affected individuals were available which the entire 3 -UTR was placed downstream of the lucif- from these 2 pedigrees to demonstrate segregation of dis- erase gene. Luciferase activity from lysates of transfected SK- ease phenotype with the inheritance of the nucleotide sub- N-MC and HEK293 cells provided a measure of the stability > stitutions. However, the c.672*26C>T and c.672*47G>A of the chimeric transcripts. The c.672*51G T nucleotide substitutions were absent in the normal controls of the substitution significantly increased luciferase activity by 1.2- fold (p ¼ 0.014) and 1.4-fold (p ¼ 0.001) in SK-N-MC and HEK293 cells, respectively (see Fig 1C). Moreover, quantita- tive RT-PCR showed that the endogenous SIGMAR1 gene was overexpressed by 2-fold (p ¼ 0.001) in lymphocytes from c.672*51G>T carriers when compared to wild-type, neurologically normal controls from the same family, after adjustment for age as a covariate (see Fig 2D; Supporting Fig 1A). Conversely, the c.672*26C>T nucleotide substitution significantly decreased luciferase activity by 0.8-fold in HEK293 and SK-N-MC cells (p ¼ 0.003 and 0.006, respec- tively;seeFig2C).Asimilardecreasewasobservedforthe c.672*47G>A substitution with a 0.8-fold (p < 0.001) and 0.9-fold (p ¼ 0.001) decrease in luciferase activity in HEK293 and SK-N-MC cells, respectively (see Fig 2C). Quantitative PCR confirmed that the endogenous SIGMAR1 gene was underexpressed by 0.9-fold in lymphocytes from
3 FIGURE 2: Mutations in the SIGMAR1 gene and their role in altering gene expression. (A) SIGMAR1 gene comprises 4 coding exons, with translation start and stop sites indicated by open arrows. Nucleotide changes detected in the Australian FTLD-MND pedigrees Aus-14 and Aus-47 from the FTLD cohort (up-pointing arrows) and the Polish presenile dementia cohort (down-pointing arrow). (B) Electropherograms of the 30-UTR nucleotide substitutions (arrows) in probands compared with a normal individual. (C) The presence of the c.672*26C>T, c.672*47G>A, and c.672*51G>T mutations within the 30-UTR of SIGMAR1 affect transcript stability. Chimeric luciferase reporter constructs comprising the SIGMAR1 promoter sequence, the luciferase cDNA, and the entire SIGMAR1 30-UTR sequence were transfected into human neuroblastoma SK- N-MC (gray columns) and HEK293 (black columns) cells. Luciferase activity indicated that both 30-UTR mutations significantly increased levels of the chimeric transcripts compared with the wild-type (wt) sequence. Values are mean 6 SEM from 5 transfections. Significance of p < 0.05 (*) and p < 0.001 (**) are indicated. (D) Relative levels of SIGMAR1 transcript in lymphocyte in c.672*51G>T carriers (n 5 4) compared with related wild-type individuals (n 5 3) (left) and Sigma-1 protein in frontal cortex of c.672*51G>T carriers (n 5 3) compared with normal unrelated controls (n 5 4) (right), after adjusting for age as a covariate.
November, 2010 643 ANNALS of Neurology affected c.672*47G>A carriers when compared to wild-type, 1 protein, while a commercially validated RNAi effec- neurologically normal controls from the same family (Sup- tively knocked down endogenous Sigma-1 (Supporting porting Fig 1B). Sigma-1 occurs as a high-molecular-weight Fig 3). The level of total TDP-43 in transfected cells complex ( 100kDa), with the monomeric form (31kDa) that overexpressed SIGMAR1 increased by 1.7-fold in accounting for less than 5% of total protein (Supporting Fig SK-N-MC (p ¼ 0.092) and HEK293 cells (p ¼ 0.042) 2). Western blot analysis of brain lysates revealed a significant (Fig 4A) compared with cells that overexpressed the con- 1.6-fold (p < 0.001) increase in total Sigma-1 levels in the trol LacZ gene. No significant changes in total FUS lev- prefrontal cortex of the c.672*51G>T carriers compared els were observed in these cells (see Fig 4A). Conversely, with normal controls, after adjustment for age as a covariate knockdown of endogenous SIGMAR1 transcripts resulted (see Fig 2D). in a significant decrease in both TDP-43 and FUS levels in SK-N-MC (TDP-43: 0.7-fold, p < 0.001; FUS: 0.8- Neuropathological Characterization of Affected fold, p ¼ 0.049) and HEK293 cells (TDP-43: 0.7-fold, Members of the FTLD-MND Pedigree p ¼ 0.026; FUS: 0.6-fold, p ¼ 0.013). Related changes The neuropathological features of these cases were previ- in levels of both the 35kDa TDP-43 cleavage product 21 ously described in detail (refer to supporting data of and full-length 45kDa TDP-43 were observed (Support- 21 Luty et al. for additional information on neuropathology ing Fig 3A), indicating that there was no preferential of cases). Additional immunohistochemical examination increase in proteolytic cleavage of TDP-43 with altered of Sigma-1 and FUS in association with TDP-43 was per- SIGMAR1 expression. Quantification of TDP-43 tran- formed in 2 previously detailed cases from family Aus- script levels did not reveal any significant difference in 21 14, 2 unrelated FTLD cases (1 with FUS inclusions and transfected cells overexpressing or underexpressing SIG- an Arg493X progranulin mutation carrier with TDP-43 MAR1 (data not shown), indicating that the effect of 29 inclusions ), and 3 age-matched controls without neuro- SIGMAR1 on TDP-43 protein levels is not at the level logical or psychiatric features or other significant histopa- of gene transcription. thology. In control and unrelated FTLD brain tissue, We next explored the effect of SIGMAR1 overex- Sigma-1 was localized on membranes within the cytoplasm pression on the subcellular localization of TDP-43 and of most neurons (Fig 3A), astrocytes, and myelinated oli- FUS in transfected cells by measuring the levels of these > godendroglia (not shown). In 2 cases with c.672*51G T ribonuclear proteins in the cytoplasmic and nuclear sub- SIGMAR1 nucleotide substitution (III:2 and III:3), Sigma- cellular fractions by western blot analysis. Overexpression 1 was also concentrated within the nucleus of some neu- of SIGMAR1 significantly increased the ratio of cytoplas- rons in regions with significant neuronal degeneration mic to nuclear TDP-43 and FUS in SK-N-MC (TDP- (CA1 and dentate gyrus; see Fig 3B,C). In the 2 unrelated 43: 1.3-fold, p ¼ 0.005; FUS: 1.6-fold, p ¼ 0.044) and FTLD cases, either TDP-43 (see Fig 3D,F inset) or FUS HEK293 cells (TDP-43: 2.3-fold, p ¼ 0.037; FUS: 5.2- (see Fig 3I inset) immunoreactivity was observed in all fold, p ¼ 0.013) relative to control transfections with the inclusions, consistent with recent reports.13,14 However, in LacZ cDNA (see Fig 4B). We verified this result by the cases with c.672*51G>T SIGMAR1 nucleotide substi- immunohistochemistry of transfected neuronal SK-N-SH tution, both TDP-43 (see Fig 2D–F) and FUS immuno- cells using a FLAG-tagged SIGMAR1 cDNA expression positive inclusions (see Fig 3G–I) were observed in affected construct (Supporting Fig 4). We observed that higher regions (see supporting data of Luty et al.21 for detailed SIGMAR1 transcript levels were positively correlated (r2 description), although in different neurons (see Fig 3E, F, ¼ 0.852, p ¼ 0.013) with increased levels of the ratio of H, and I). There was a similar density of TDP-43 and cytoplasmic to nuclear TDP-43 (Supporting Fig 5). FUS inclusions in the different cases. No TDP-43 immu- Finally, quantification of nuclear TDP-43 and FUS levels noreactive inclusions occurred in neurons with enhanced nuclear Sigma-1 immunoreactivity (see Fig 3D), although in SK-N-MC cells revealed that a consistent effect of SIGMAR1 rare FUS immunoreactive inclusions occurred in neurons both overexpression and knockdown of was a with enhanced nuclear Sigma-1 immunoreactivity (see Fig decrease in nuclear levels of these hnRNPs relative to 3G). Brain tissue was not available from carriers of the control cells (see Fig 4C). A significant decrease in nu- c.672*26C>T or c.672*47G>A nucleotide substitutions. clear FUS levels was observed when SK-N-MC cells were transfected with SIGMAR1 expression constructs (0.49- p ¼ SIGMAR1 Alteration of SIGMAR1 Gene Expression in fold, 0.016) or with RNAi against (0.76- Transfected Cells fold, p ¼ 0.017), and a similar 0.75-fold trend (p > Constitutive expression of wild-type SIGMAR1 cDNA in 0.05) was observed for TDP-43 for both overexpression transfected cell lines resulted in increased levels of Sigma- and knockdown of SIGMAR1.
644 Volume 68, No. 5 Luty et al: SIGMAR1 Mutations in FTLD-MND
FIGURE 3: Sigma-1, TDP-43, and FUS in the hippocampus. Sigma-1 immunoperoxidase staining of hippocampal neurons (A) in a control and (B, C) in 2 cases with SIGMAR1 c.672*51G>T nucleotide substitutions. Asterisks indicate nuclei. Sigma-1 normally localizes to cytoplasmic membranes (A), while in the c.672*51G>T carriers some remaining (B) dentate granule and (C) CA1 pyramidal cells show intense Sigma-1 immunoreactivity in the nucleus (white asterisks). Double immunofluorescence labeling of phosphorylated TDP-43 (red in D, green in E, F, H, I) and FUS (red in E–I) in dentate granule cells of 2 cases with SIGMAR1 c.672*51G>T nucleotide substitutions (D–I), a FTLD-TDP-43 case with a progranulin mutation (D, F insets), and a FTLD-FUS case (I inset). All nuclei indicated by white asterisks. Only phosphorylated TDP-43 inclusions (arrowheads in D, F insets) were observed in the progranulin case, and only FUS inclusions (arrowhead in I inset) were observed in the FTLD-FUS case. In cases with SIGMAR1 c.672*51G>T nucleotide substitutions, both types of inclusions were observed, (E, F, H, I) with TDP-43 inclusion-bearing neurons maintaining nuclear FUS immunoreactivity but (H, I) reduced nuclear FUS staining observed in FUS inclusion-bearing neurons. Double immunofluorescence labeling of Sigma-1 (green) and either TDP-43 (red) or FUS (red) indicated that most neurons with nuclear localization of Sigma-1 did not contain either (D) TDP-43 or FUS immunoreactive inclusions, (G) although FUS immunoreactive inclusions were infrequently observed in such neurons.
Sigma-1 Ligands and TDP-43 Translocation opipramol had a significant effect on TDP-43 localiza- We used 3 Sigma-1 ligands, AC915 (N-(2-(3,4-dichloro- tion, whereby 50nM of AC915 (antagonist) or 15nM of phenyl)acetoxy)-ethylpyrrolidine (specific Sigma-1 antag- opipramol (agonist) significantly decreased (1.5-fold, p ¼ onist),32 haloperidol (Sigma-1 antagonist),33 and opipra- 0.038) or increased (1.5-fold, p ¼ 0.020), respectively, mol (specific Sigma-1 agonist)34 to determine whether the relative level of TDP-43 in the cytoplasm compared these small molecules can mimic the effect of altered with untreated cells. Haloperidol, a therapeutically signif- expression of SIGMAR1 on TDP-43 subcellular localiza- icant compound, was also effective in modulating the tion (see Fig 4D). We observed that both AC915 and localization of TDP-43, where both 24nM and 2.4nM
November, 2010 645 ANNALS of Neurology
FIGURE 4: Altered expression of SIGMAR1 in human cell lines affect TDP-43 and FUS expression and subcellular location. (A) Modulation of SIGMAR1 expression by transfection of expression constructs with the full-length wild-type SIGMAR1 cDNA under the control of the constitutive CMV promoter or RNAi against endogenous SIGMAR1 transcripts led to altered total TDP-43 and FUS levels. Western blot analysis of endogenous full-length TDP-43 (black columns) or FUS (gray columns) in transfected cells (left) showed differences in protein levels in SK-N-MC and HEK293 cells after normalization to b-actin levels (right). Values are mean 6 SEM from 5 transfections. Significance of p < 0.05 (*) is indicated. (B) SIGMAR1 cDNA expression constructs transfected into either HEK293 or SK-N-MC cells followed by extraction of cytoplasmic (cyto-) or nuclear (nuc-) fractions. Western blot analysis shows TDP-43 and FUS protein levels in the 2 subcellular fractions of transfected cells overexpressing SIGMAR1 compared with LacZ. Chemiluminescent band intensities were quantified and the levels of proteins were expressed as a ratio of cytoplasmic versus nuclear levels. Values are mean 6 SEM from 5 transfections. Significance of p < 0.05 (*) is indicated. (C) Quantification of nuclear TDP-43 or FUS in SK-N-MC cells transfected with SIGMAR1 cDNA constructs or RNAi against endogenous SIGMAR1 transcripts. Western blot analysis of endogenous full-length TDP-43 (black columns) or FUS (gray columns) in transfected cells showed differences in protein levels compared with control treatments after normalization to b-actin levels. Values are mean 6 SEM from 5 transfections. Significance of p < 0.05 (*) is indicated. (D) Effect of Sigma-1 ligands on TDP-43 subcellular localization. Western blot analysis of TDP-43 protein levels in subcellular fractions of cells exposed to 3 concentrations of opipramol (agonist), AC915 (antagonist), and haloperidol (antagonist). Chemiluminescent band intensities were quantified and the levels of TDP-43 were expressed as a ratio of cytoplasmic (cyto-) vs nuclear (nuc-) TDP-43. Values are mean 6 SEM from 5 transfections. Significance of p < 0.05 (*) is indicated. significantly decreased (0.5-fold, p < 0.001 and p ¼ Discussion 0.004, respectively) the relative level of TDP-43 in Significant progress in the understanding of FTLD and the cytoplasm compared with untreated cells (see MND has occurred with the recent discoveries of the Fig 4D). TDP-43 and FUS proteins as the major components of
646 Volume 68, No. 5 Luty et al: SIGMAR1 Mutations in FTLD-MND
TABLE 1: Summary of In Vitro and In Vivo Observations of SIGMAR1 Mutations Family SIGMAR1 Gene Gene Expression Predicted Neuropathology Mutation Expression In Vivo Pathological In Vitro Mechanism Aus-14 c.672*51G>T ::Lymphocyte; : Cytoplasmic Frequent TDP-43 : brain hnRNP;; nuclear and FUS immunopositive hnRNP cytoplasmic inclusions Aus-47 c.672*26C>T ; NA ; Nuclear hnRNP NA Pol-1 c.672*47G>A ;;Lymphocyte ; Nuclear hnRNP NA FUS, fused in sarcoma gene; hnRNP, heterogeneous nuclear ribonucleoprotein; NA, not available for testing. ubiquitinated inclusion bodies in both of these diseases the neurotoxic effect of Sigma-1 antagonists and SIGMAR1 and that mutations in the genes encoding these proteins RNAi.37 However, as the effect of the c.672*26C>Tand cause these diseases. We determined that the neuropa- c.672*47G>A on gene expression was small (<1.2-fold) thology in our largest pedigree (family Aus-14) is unique and without the ability to demonstrate segregation of the in that it includes similar densities of TDP-43 and FUS mutations with disease in the 2 pedigrees, we cannot draw inclusions in different neurons in vulnerable cortical and firm conclusions on their pathogenic nature. hippocampal (see Fig 3) regions. While a recent study Neuropathological examination of FTLD patients showed colocalization of these proteins in spinal motor has revealed widespread nuclear clearing of TDP-43,5 con- neuron inclusions in MND,12 the majority of TDP-43 sidered to be the precursor of inclusion formation.38 Path- and FUS inclusions in family Aus-14 were not colocal- ological mutations in FUS10,11 and TDP-438 genes both ized but found in separate neurons. This novel cortical result in mislocalization of the respective hnRNP, with nu- neuropathology differs from all other FTLD and MND clear clearing and an increase in cytoplasmic levels. We cases,12 including other FTLD-MND cases previously observed the same effect when we overexpressed SIGMAR1 linked to a major FTLD-MND region on chromosome in transfected cells (see Fig 4B,C). We also observed a simi- 9.13 As summarized in the Table, our data are consistent lar decrease in FUS when we knocked down expression of with the marked effect of SIGMAR1 overexpression on SIGMAR1, corresponding to an overall decrease in total the subcellular localization of both TDP-43 and FUS levels of the respective hnRNP (see Fig 4C). Moreover, as (see Fig 4) and provide evidence that the aberrant patho- both TDP-43 and FUS are predominantly nuclear pro- logical activity of TDP-43 and FUS could be ameliorated teins with important roles in gene transcription and RNA by the modulation of Sigma-1 activity. biogenesis,39 it is likely that a decrease in nuclear protein The c.672*51G>T nucleotide substitution identified levels would have a cytotoxic effect. We propose that this in the Aus-14 pedigree increased gene expression by 1.4- may be the common mechanism on which the three 30- fold as determined by luciferase reporter assays (see Fig UTR mutations cause a pathogenic alteration of TDP-43 2C), corresponding with a significant 1.5-fold to 2-fold and FUS levels despite having differential effects on SIG- change in SIGMAR1 transcript or Sigma-1 protein in lym- MAR1 expression (see Table 1). Finally, our data indicate phocyte or brain tissue of c.672*51G>T carriers (see Fig that the known Sigma-1 ligands (see Fig 4D), such as halo- 2D). We postulate that the 30-UTR nucleotide substitution peridol and opipramol, may have direct therapeutic poten- is a mutation that alters transcript stability and hence gene tial for Sigma-1 drugs to be used as clinical treatments for expression. There is increasing evidence that 30-UTRs con- TDP-43 and FUS proteinopathies (including frontotem- tain regulatory elements that have an important role in poral dementia and MND), disorders that currently lack posttranslational control of gene expression31 and can bind effective therapeutic strategies. not only to proteins but to small noncoding regulatory Numerous studies have reported linkage of FTLD- RNAs (microRNAs) as well.35 Indeed, 30-UTRs can be MND pedigrees to chromosome 9.16–21 If all the reported hotspots for mutations, such as for the transcription factor meiotic recombinations from the various pedigrees are gene GATA4 in which 60% of all putative mutations fall reliable, then the minimal disease haplotype is defined by within the 30-UTR.36 We observe that nucleotide substitu- the markers D9S169 and D9S251 and comprise only 10 tions that decrease SIGMAR1 expression (c.672*26C>T known or predicted genes. These have all been sequenced and c.672*47G>A) (see Fig 2; Table ) may be deleterious exhaustively by several groups, including the 3 noncoding as well, consistent with previous studies that demonstrated RNAs (miR876, miR873, and NCRNA00032) that were
November, 2010 647 ANNALS of Neurology screened by Boxer et al.20 and by our laboratory. No advocates for increased national support for neuroscience mutations have been found in any of these genes. This research; he is a former member of the Scientific Advisory leaves the possibility that either the chromosome 9p locus Board of Apollo Life Sciences Ltd.; he has provided expert is genetically heterogeneous or our current screening testimony for CSIRO and Sydney IVF; he has grants methodology is not capable of detecting complex small- pending from the National Health and Medical Research scale genetic rearrangements. Based on our cell culture Council (NHMRC) Australia, Australian Research Coun- and gene-expression data, we conclude that SIGMAR1 is a cil, National Institute of Aging at the National Institutes of causative gene for a familial form of FTLD-MND. How- Health, and other charitable trusts and foundations; he has ever, it still remains to be determined whether SIGMAR1 received honoraria from the Peter MacCallum Cancer is the major FTLD-MND locus on chromosome 9p or Institute on behalf of the KConFab Consortium, National whether the region is highly genetically and neuropatho- Health and Medical Research Council (NHMRC) Aus- logically heterogeneous, with VCP15 and now SIGMAR1 tralia, University of Sydney, and University of Melbourne; identified as causative loci and additional genes yet to be he is the inventor on several patents that are owned by his identified. current or previous employer; none are currently licensed although negotiations are being conducted for one patent; he has stock options in Brain Resource Ltd.; he has received Acknowledgments travel and accommodation expenses for participation in This research was supported by an Australian Postgradu- conferences and symposia from various scientific societies ate Award (to A.A.L.); UNSW Vice-Chancellor’s Post- and not-for-profit conferences. C.D.-S. and her institution doctoral Research Fellowship (C.D.S.); National Health have received money from NHMRC Project Grants 510217 and Medical Research Council (Australia) RD Wright and 630428. C.T.L. has received money from NHMRC Fellowship 230862 (J.B.J.K.), Career Development Medical Postgraduate Scholarship 324640. K.G.C.’s in- Award 511941 (I.P.B.), Medical Postgraduate Scholarship stitution has received money from NHMRC Project Grant 325640 (C.T.L.), Research Fellowships 157209 (P.R.S.) 630428; she has been employed by Neuroscience Research and 350827 (G.M.H.), and Project Grants 276407 and Australia; and her partner works at the Garvan Institute. 510217; The Swedish Society of Medicine (H.K.); Min- G.M.H.’s institution has received money from the National istry of Science (Poland) grant number PBZ-MEiN-9/2/ Health & Medical Research Council of Australia for her 20/17 (A.M., M.B., C.Z.); The Rebecca Cooper Medical full-time research fellowship salary. J.B.J.K.’s institution has Research Foundation Ltd (J.B.J.K.); and a donation from received money from NHMRC project grant 510217. the Blundy family (J.B.J.K.). M.B., I.P.B., H.K., A.A.L., W.S.B., P.K.P., T.S., J.T., We thank all patients and family members who par- K.L.W., A.M., K.A.M., P.S.S., and C.Z. have none to ticipated in this study, as well as Heather McCann for as- report. sistance with immunohistochemistry and Robyn Flook from the South Australian Brain Bank. Tissue were received from the Australian Brain Do- References nor Programs Sydney Brain Bank, which is supported by 1. Panegyres PK, Frencham K. Course and causes of suspected de- mentia in young adults: a longitudinal study. Am J Alz Disord Neuroscience Research Australia, University of New 2007;22:48–56. South Wales, and NHMRC. Tissue were also received 2. Lillo P, Hodges JR. Frontotemporal dementia and motor neurone from the South Australian Brain Bank which is sup- disease: overlapping clinico-pathological disorders. J Clin Neuro- ported by the Australian Brain Bank Network, with sci 2009;16:1131–1135. funding from the NHMRC and the FMC. 3. Mackenzie IR, Neumann M, Bigio EH, et al. Nomenclature and nosology for neuropathologic subtypes of frontotemporal lobar degeneration: an update. Acta Neuropathol 2010;119:1–4. Potential Conflicts of Interest 4. Lagier-Tourenne C, Cleveland DW. Rethinking ALS: the FUS about TDP-43. Cell 2009;136:1001–1004. P.R.S.’s institution has received money from a National 5. Neumann M, Sampathu DM, Kwong LK, et al. Ubiquitinated TDP- Health and Medical Research Council (Australia) Project 43 in frontotemporal lobar degeneration and amyotrophic lateral Grant; he is the Executive Director & CEO of his sclerosis. Science 2006;314:130–133. Institution, POWMRI Ltd. (trading as Neuroscience 6. Cairns NJ, Neumann M, Bigio EH, et al. TDP-43 in familial and Research Australia), a not-for-profit independent medical sporadic frontotemporal lobar degeneration with ubiquitin inclu- sions. Am J Pathol 2007;171:227–240. research institute; he is in receipt of salary for that role and 7. Benajiba L, Le Ber I, Camuzat A, et al. TARDBP mutations in is a member of the Board of Directors; he is a Director of motor neuron disease with frontotemporal lobar degeneration. Neuroscience Australia Ltd., a not-for profit company that Ann Neurol 2009;65:470–473.
648 Volume 68, No. 5 Luty et al: SIGMAR1 Mutations in FTLD-MND
8. Sreedharan J, Blair IP, Tripathi VB, et al. TDP-43 mutations in fam- 24. Zekanowski C, Pepłon´ska B, Styczyn´ska M, et al. Mutation screen- ilial and sporadic amyotrophic lateral sclerosis. Science 2008;319: ing of the MAPT and STH genes in Polish patients with clinically 1668–1672. diagnosed frontotemporal dementia. Dement Geriatr Cogn Disord 2003;16:126–131. 9. Kabashi E, Valdmanis PN, Dion P, et al. TARDBP mutations in indi- viduals with sporadic and familial amyotrophic lateral sclerosis. 25. Zekanowski C, Styczyn´ska M, Pepłon´ska B, et al. Mutations in pre- Nat Genet 2008;40:572–574. senilin 1, presenilin 2 and amyloid precursor protein genes in 10. Kwiatkowski TJ Jr, Bosco DA, Leclerc AL, et al. Mutations in the patients with early-onset Alzheimer’s disease in Poland. Exp Neu- FUS/TLS gene on chromosome 16 cause familial amyotrophic lat- rol 2003;184: 991–996. eral sclerosis. Science 2009;323:1205–1208. 26. Waite LM, Broe GA, Creasey H, et al. Neurodegenerative and 11. Vance C, Rogelj B, Hortoba´gyi T, et al. Mutations in FUS, an RNA other chronic disorders among people aged 75 years and over in processing protein, cause familial amyotrophic lateral sclerosis the community. Med J Aus 1997;167:429–432. type 6. Science 2009;323:1208–1211. 27. Sachdev PS, Brodaty H, Reppermund S, et al. The Sydney Mem- 12. Deng HX, Zhai H, Bigio EH, et al. FUS-immunoreactive inclusions ory and Ageing Study (MAS): methodology and baseline medical are a common feature in sporadic and non-SOD1 familial amyo- and neuropsychiatric characteristics of an elderly epidemiological trophic lateral sclerosis. Ann Neurol 2010;67:739–748. non-demented cohort of Australians aged 70-90 years. Int Psycho- geriatr (epub). DOI: 10.1017/S1041610210001067. 13. Neumann M, Rademakers R, Roeber S, et al. A new subtype of frontotemporal lobar degeneration with FUS pathology. Brain 28. Lee VM, Wang J, Trojanowski JQ. Purification of paired helical fil- 2009;132:2922–2931. ament tau and normal tau from human brain tissue. Methods Enzymol 1999;309:81–89. 14. Seelaar H, Klijnsma KY, de Koning I, et al. Frequency of ubiquitin and FUS-positive, TDP-43-negative frontotemporal lobar degener- 29. Pickering-Brown SM, Baker M, Gass J, et al. Mutations in progra- ation. J Neurol 2010;257:747–753. nulin explain atypical phenotypes with variants in MAPT. Brain 15. Rohrer JD, Guerreiro R, Vandrovcova J, et al. The heritability and 2006;129:3124–3126. genetics of frontotemporal degeneration. Neurology 2009;73: 30. Prasad PD, Li HW, Fei YJ, et al. Exon-intron structure, analysis of 1451–1456. promoter region, and chromosomal localization of the human 16. Vance C, Al-Chalabi A, Ruddy D, et al. Familial amyotrophic lat- type 1 sigma receptor gene. J Neurochem 1998;70:443–451. eral sclerosis with frontotemporal dementia is linked to a locus on 31. Cheadle C, Fan J, Cho-Chung YS, et al. Stability regulation of chromosome 9p13.2–21.3. Brain 2006;129:868–876. mRNA and the control of gene expression. Ann N Y Acad Sci 17. Morita M, Al-Chalabi A, Andersen P, et al. A locus on chromo- 2005;1058:196–204. some 9p confers susceptibility to ALS and frontotemporal demen- 32. Maeda DY, Williams W, Bowen WD, et al. A sigma-1 receptor selective tia. Neurology 2006;66:839–844. analogue of BD1008: a potential substitute for (þ)-opioids in sigma re- 18. Valdmanis PN, Dupre N, Bouchard JP, et al. Three families with ceptor binding assays. Bioorg Med Chem Lett 2000;10:17–18. amyotrophic lateral sclerosis and frontotemporal dementia with evidence of linkage to chromosome 9p. Arch Neurol 2007;64: 33. Chaki S, Tanaka M, Muramatsu M, et al. NE-100, a novel potent 240–245. sigma ligand preferentially binds to sigma 1 binding sites in guinea pig brain. Eur J Pharmacol 1994;251:R1–R2. 19. Le Ber I, Camuzat A, Berger E, et al. Chromosome 9p-linked fami- lies with frontotemporal dementia associated with motor neuron 34. Holoubek G, Muller WE. Specific modulation of sigma binding sites by disease. Neurology 2009;72:1669–1676. the anxiolytic drug opipramol. J Neural Transm 2003;110:1169–1179. 20. Boxer AL, Mackenzie IR, Boeve BF, et al. Clinical, neuroimaging 35. Eacker SM, Dawson TM, Dawson VL. Understanding microRNAs in and neuropathological features of a new chromosome 9p-linked neurodegeneration. Nat Rev Neurosci 2009;10:837–841. FTD-ALS family. J Neurol Neurosurg Psychiatry 2010; DOI: 0- 10.1136/jnnp.2009.204081. 36. Reamon-Buettner SM, Cho SH, Borlak J. Mutations in the 3 untranslated region of GATA4 as molecular hotspots for congeni- 21. Luty AA, Kwok JB, Thompson EM, et al. Pedigree with frontotem- tal heart disease (CHD). BMC Med Genet 2007;8:38–49. poral lobar degeneration: motor neuron disease and TAR DNA binding protein-43 positive neuropathology: genetic linkage to 37. Hayashi T, Su TP. An update on the development of drugs for chromosome 9. BMC Neurology 2008;8:32. neuropsychiatric disorders: focusing on the sigma-1 receptor ligand. Expert Opin Ther Targets 2008;12:45–58. 22. Stanford PM, Brooks WS, Teber ET, et al. Frequency of tau muta- tions in familial and sporadic frontotemporal dementia and other 38. Giordana, MT, Piccinini M, Grifoni S, et al. TDP-43 redistribution is tauopathies. J Neurol 2004;251:1098–1104. an early event in sporadic amyotrophic lateral sclerosis. Brain Pathol 2009;20:351–360. 23. McKhann GM, Albert MS, Grossman M, et al. Clinical and patho- logical diagnosis of frontotemporal dementia: report of the Work 39. Lagier-Tourenne C, Polymenidou M, Cleveland DW. TDP-43 and Group on Frontotemporal Dementia and Picks Disease. Arch Neu- FUS/TLS: emerging roles in RNA processing and neurodegenera- rol 2001;58:1803–1809. tion. Hum Mol Genet 2010;19:R46–R64.
November, 2010 649 SUPPLEMENTARY DATA
Supplementary Data 1 – Clinical description of SIGMAR1 3’UTR C.672*26 C > T Australian FTLD pedigree (Aus-47)
The proband IV:1 is a 64 year old Australian woman who developed a florid frontal lobe syndrome at age 62. She was unable to give a history and has no insight into her problem. Her husband described her progressive abnormal behaviour with unprovoked, explosive outbursts of temper. She had become domestically incompetent and was incontinent. There had been inappropriate spending.
The examination showed a woman with an inability to sit in one position. Comprehension of speech normal but speech output reduced with echolalia. She passed flatus and rubbed her hands. She frequently tapped her left foot. There were no grasp responses. She had a mild pout reflex and Myerson’s sign was positive. There were no features of motor neuron disease. She was unable to perform Luria 3 hand test, the Go-No-Go test, the alternating hands test and was unable to copy a sequence. Proverb interpretation was concrete with perseveration. Her cognitive estimates were idiosyncratic. Mini mental state examination 22/30, CAMCOG 71/106, FAS = 3. There is a positive family history of death from dementia around the age of 60 in her mother, two aunts and her mother’s cousin (Fig. 1).
The MRI scan revealed mild symmetrical frontal lobe without temporal lobe atrophy. The PET scan showed asymmetrical mild frontal and temporal hypometabolism more marked on the right than the left. The SPECT scan showed dramatic reduction in perfusion in the right frontal lobe and less so in the right temporal lobe with minimal changes on the left.
Supplementary Data 2 – Clinical description of SIGMAR1 3’UTR C.672*47 G > A Polish FTLD pedigree (Pol-1)
The proband III:1 is a 59-year-old right-handed Polish male. No educational or behavioural problems were reported during the first 50 years of his life. First symptoms of possible cognitive deterioration appeared at the age of 50, when the proband changed his job from a shop assistant in a small shop to a manager in a large mall. Symptoms started with aphatic symptoms (predominantly semantic aphasia). However, amnesic symptoms followed about one year later.
131 The symptoms encompassed short-term memory problems, e.g. forgetfulness, continuous checking and making notes. Due to growing cognitive disturbances (predominantly associated with short-term memory), at the age of 55 he was diagnosed at the memory clinic with progressive non-fluent aphasia. Detailed examination revealed memory impairment, word finding difficulties and attention impairment. However, on psychometric examination he scored 30/30 on the MMSE. No neurological symptoms or signs were detected. Only 1.5 years later he obtained a moderate dementia diagnosis (fulfilling formal criteria for AD according to DSM-IV). A cholinesterase inhibitor (Donepezil) was administered to manage memory loss, giving initially positive results. However, on serial examinations, continuous cognitive deterioration is documented with aphasia being the most prominent symptom. No typical FTD behavioural symptoms were observed at any time of longitudinal observation of proband. His final diagnosis was atypical AD with predominant progressive aphasia.
Brain CT scans performed at the ages of 55 and 57 showed very slight, symmetrical cortical and subcortical brain atrophy, with focal changes (in the posterior part of caudate nucleus and internal capsule), the latter apparently without clinical significance. A slight, continuous deterioration of the proband has been observed, with a MMSE score, performed at the age of 59, of 18 points. There are records of similar symptoms in the proband’s family (Fig.1). His father died at the age of 68 and supposedly suffered from a similar (family reported) disease. Among his father’s 11 siblings, three brothers and two sisters displayed similar cognitive problems and presenile dementia (all of them died in their sixties), however, no medical documentation is available. The proband has three cognitively healthy children as well as two younger siblings with no apparent symptoms of any cognitive decline.
There are no differences in the results of psychometric tests (MMSE, ADAS-cog, as well as tests measuring subject’s attention and task performance rate) between the brothers and the children of the proband, although two individuals carried the familial mutation. The only difference was recorded in the tests measuring letter fluency (COWAT) and categorical fluency (CFT) where those with the c.672*47G>A mutation tended to perform worse on some language tests as compared to those not affected. Longitudinal observations of all family members are required to confirm the importance of this finding.
132 Supplementary Figures
Supplementary Figure 1: Regression of SIGMAR1 transcript levels and age of individual for (a) SIGMAR1 3’UTR c.672*51G>T and (b) c672*47G>A mutation carriers (squares) and unaffected controls (circles) indicates that age and mutation status were significant predictors of SIGMAR1 expression. Regression analyses show that both age (p = 0.005) and affection status (p = 0.014) were significant predictors of SIGMAR1 transcript levels within Aus-14 pedigree members. Insufficient pedigree members from Pol-1 were available for regression analyses.
133
Supplementary Figure 2: Western blot analysis of brain tissue demonstrating increased Sigma- 1 expression, in SIGMAR1 mutation carriers (c.672*51G>T) compared with neuropathologically confirmed normal controls. No significant change in soluble TDP-43 levels was observed between the Aus-14 cases and normal controls. Variations in total protein between samples were adjusted using E-actin levels. Brain tissue was homogenised and soluble proteins were isolated using extraction buffer A (0.75 M NaCl, 100 mM 2-(N-morpholino) ethanesulfonic acid, 1 mM
EGTA, 0.5 mM MgSO4, 2 mM dithriothreitol at pH 6.8, supplemented with protease inhibitors). High molecular weight proteins are indicated (*). Note that the high molecular weight band for TDP-43 was detected with both a rabbit polyclonal antibody (BC001487, PTG, USA, diluted 1:2000) and a mouse monoclonal antibody (ab57105, Abcam, Cambridge, UK, diluted 1:1000). Specific proteins were visualised using commercially available antibodies for E-actin (ab6276, Abcam, Cambridge, UK, diluted 1:5000), and Sigma-1 (ab53852, Abcam, Cambridge, UK, diluted 1:500) and enhanced chemiluminescence according to manufacturer’s instructions (Supersignal West Pico Chemiluminescent Substrate, Thermo Scientific, Rockford IL, USA).
134
Supplementary Figure 3: (a) Expression constructs of the full length wildtype SIGMAR1 cDNA under the control of the constitutive CMV promoter were transfected into HEK293 and SK-N-MC cells. Knock-down of endogenous SIGMAR1 transcripts was achieved by the transfection of RNAi against SIGMAR1. Modulation of SIGMAR1 expression was detected by western blotting after normalisation with E-actin levels, with associated change in high molecular weight (*), monomeric (43kDa) and cleaved (35kDa) forms of TDP-43 levels. (b) Isolation of cytoplasmic and nuclear enriched fractions indicate that over-expression of SIGMAR1 does not lead to the translocation of the protein into the nucleus. Specific proteins were visualised using commercially available antibodies for E-actin (ab6276, Abcam, Cambridge, UK, diluted 1:5000), and Sigma-1 (ab53852, Abcam, Cambridge, UK, diluted 1:500) and enhanced chemiluminescence according to manufacturers instructions (Supersignal West Pico Chemiluminescent Substrate).
135
Supplementary Figure 4: (a) SIGMAR1 cDNA expression constructs transfected into the neuronal cell line SK-N-SH cells followed by extraction of cytoplasmic (cyto-) or nuclear fractions (nuc-). Western blot analysis shows TDP-43 levels in the two subcellular fractions of transfected cells over-expressing SIGMAR1 compared with LacZ. Chemiluminescent band intensities were quantified and the levels of proteins were expressed as a ratio of cytoplasmic versus nuclear levels. Mean and standard error of mean from 5 transfections. Significance of p < 0.05 (*) is indicated. (b) Fluorescence microscopy of transfected SK-N-SH cells (white arrow) over- expressing a FLAG-tagged version of SIGMAR1 (green) show higher levels of TDP-43 (red) in the cytoplasm compared with untransfected cells which had a predominantly nuclear staining of TDP-43. Note colocalisation of Sigma-1 and TDP-43 immunopositive fluorescence around nuclear membrane (white arrow head). Nuclei were stained with DAPI (blue).
136
Supplementary Figure 5: Linear regression of endogenous SIGMAR1 transcript levels and cytoplasmic TDP-43 levels (normalised against nuclear TDP-43 levels) show a significant correlation (p = 0.025) between over-expression of SIGMAR1 and movement of TDP-43 from the nucleus to the cytoplasm in lymphocyte samples. Gene expression levels were determined from five SIGMAR1 c.672*51G>T carriers (Supplementary Fig.1 III:2, III:6, III:7, III:12, IV:14).
137 Chapter 5 General discussion
138
5.1 Thesis summary
The field of FTLD research is expanding at an enormous rate and the complex array of clinical presentations and underlying pathologies is becoming more confusing rather than providing us with a clearer understanding of the disease. Moreover, the neuropathology and the clinical symptoms that arise as a result signify the end point of the disease, where currently no successful intervention exists. It is therefore vital that we identify the molecular causes that underpin the disease, as these will not only provide us with a greater understating of the pathogenesis but may also allow us to approach and treat the disease well before it shows its first signs. This thesis has investigated the underlying molecular cause of frontotemporal dementia.
In this study we have identified two multigenerational South Australian families with an FTLD and MND predominant clinical presentation and two distinct and quite characteristic neuropathologies. The neuropathology in family Aus-12 consists of both a tauopathy and TDP-43 proteinopathy while Aus-14 is characterised by concomitant TDP-43 and FUS pathology. In both instances the overlapping pathology is unique to each family, further expanding the already wide spectrum of underlying pathologies in FTLD and associated syndromes.
To date, three FTLD loci have been identified which map to chromosomes 3, 9 and 17 and harbour four pathogenic genes, namely MAPT, GRN, CHMP2B and VCP. Linkage analysis of family Aus-12 failed to show significant linkage to any of the known loci and showed suggestive linkage to chromosome 15 (Paper I). These findings together with the unusual pathology suggest that this family represents a novel genetic form of FTLD-MND. Identification of the causative gene will not only help to elucidate the disease aetiology in this family but may also shed some light on other neurodegenerative diseases with concurrent tau and TDP-43 deposition.
At the start of this thesis, the only significant linkage of FTLD-MND families was on chromosome 9q. Over the course of this study, 23 families with FTLD-MND including Aus-14 (Paper II) had been linked to chromosome 9p, strongly implicating this region in neurodegenerative disease. In this study, a positional candidate gene analysis of approximately 200 genes was initiated with particular focus on genes with possible involvement in neurodegeneration. A single nucleotide change (c.672*51G>T) was identified in the 3’ untranslated (3’UTR) region of the sigma-1 receptor (SIGMAR1) gene that 139 segregated with the disease phenotype in Aus-14 (Paper III). Its non-polymorphic nature was verified using multiple cohorts comprising a total of 1269 non-demented controls.
In order to identify the frequency of SIGMAR1 mutations in dementia population, a mutation screen in the SIGMAR1 gene was conducted in an Australian cohort of FTLD probands from 26 pedigrees and two independent Polish presenile dementia cohorts comprising of 160 unrelated familial cases. Two presumptive mutations were identified in the 3’UTR (c.672*26C>T and c.672*47G>A) of SIGMAR1 in an Australian and Polish pedigree respectively. None of the identified mutations had been previously reported in the literature and account for 0.6% of Polish presenile dementia probands and 7.4% of Australian familial FTLD cohort.
Functional studies were undertaken to investigate the effect of the three mutations identified in the 3’UTR region of SIGMAR1 and revealed significant dysregulation of gene expression. Using luciferase reporter assays, the c.672*51G>A mutation was found to increase SIGMAR1 gene expression while c.672*26C>T and c.672*47G>T mutations resulted in decreased SIGMAR1 gene levels. In order to elucidate pathophysiological consequences of changes in sigma-1R expression, SIGMAR1 cDNA-transfected cell lines and RNAi knocked-down SIGMAR1 cell lines were investigated for subcellular localisation of TDP-43 and FUS. Consistent with the identified cytoplasmic TDP-43 and FUS inclusions on immunohistochemistry in c.672*51G>T mutation carriers, overexpression of sigma-1R resulted in significant shunting of TDP-43 and FUS from the nucleus to the cytoplasm. Knocking down sigma-1R receptor on the other hand resulted in lowered cytoplasmic TDP-43 and FUS levels.
Sigma-1R binds many pharmacological agents. Therefore, investigations using AC915 (sigma-1R antagonist), haloperidol (sigma-1R antagonist) and opipramol (sigma-1R agonist) were carried out to determine if these ligands can mimic the effect of altered sigma-1R gene expression on TDP-43 subcellular localisation. The agonist opipramol significantly increased the relative level of TDP-43 in the cytoplasm, while the antagonists AC915 and haloperidol had the opposite effect. This provides a potential therapeutic strategy for treatment of dementia with underlying TDP-43 and/or FUS pathology.
140 Identification of mutations in the SIGMAR1 gene has major implications in the field of FTLD-MND as it not only provides us with new insights into the pathophysiology of dementia but also provides us with a potential therapeutic target in the treatment of neurodegenerative diseases.
141 5.2 The heterogeneous nature of FTLD
What started off as a relatively simple classification system of neurodegenerative diseases 20 years ago, has expanded drastically and become extremely complex with advances in clinical, radiological, pathological, proteomic, and genetic characterisation. Quite often what begins as one clinical diagnosis progresses to symptoms that match different diagnostic criteria and frequently cognitive syndromes are also complicated by motor disturbances. The complexities of making correct diagnostic judgements are further compounded by the fact that certain syndromes may reflect a number of different underlying pathological processes and alternatively a single pathological entity may present with different clinical syndromes. For example, Whitwell et al. (2009) found that the pre- frontal dominant subtype bvFTD can be associated with FTLD-tau, FTLD-TDP, with non-specific ubiquitin inclusions and AD pathology while CBD (the pathology) can present as bvFTD, speech apraxia, PNFA, PSP-like syndrome, and posterior cortical atrophy syndrome. Furthermore, a single mutation in a gene can also generate multiple pathological and clinical phenotypes. For instance, a single mutation in the MAPT gene may generate a variable age at onset and clinically and neuropathologically heterogenous phenotypes involving either cognitive or motor systems or combinations of both, within a single family (Janssen et al., 2002; Lantos et al., 2002). The two FTLD families examined in this thesis are discussed below within the context of the heterogeneity seen in FTLD at the clinical, pathological and genetic level.
5.2.1 Clinical perspective
Hereditary FTLD presents with considerable intrafamilial as well as interfamilial heterogeneity. A single mutation can result in a vast array of clinical presentations while simultaneously a particular clinical presentation can result from many different underlying genetic causes.
The association between dementia, parkinsonism and MND was recognised as early as 1932, with even earlier suggestions of a common underlying cause. However, it wasn’t until almost 60 years later when multiple families with a vast array of clinical syndromes were linked to chromosome 17 and mutations in the MAPT gene were discovered that these claims were substantiated. With the recent discovery of GRN mutations in a subset of chromosome 17-linked families (Rademakers and
142 Rovelet-Lecrux, 2009) and linkage of multiple FTLD families with associated motor syndromes to chromosomes 9 and 3, the clinical spectrum of hereditary FTLD now includes bvFTD, PNFA and SD, as well as AD, PSP, CBS, MND, parkinsonism, and IBMPFD. Attempts have been made to establish some pattern that may be useful in distinguishing between the families. For instance, extrapyramidal features consistent with CBS present more often in families with GRN mutations than MAPT, while MND and parkinsonism are rare (Beck et al., 2008; Josephs et al., 2007). Behavioural changes in MAPT carriers often include disinhibition and complex compulsive behaviour, in contrast to apathy and social withdrawal in GRN mutation carriers (Rademakers et al., 2007; van Swieten et al., 1999). In addition, language deficits in MAPT mutation carriers appear to have more sematic features, compared to the PNFA often reported in association with GRN mutations (Mesulam et al., 2007; Rademakers et al., 2007; Snowden et al., 2006). However, despite best efforts, it is still extremely difficult to predict the underlying cause with any certainty. This is exemplified by family Aus-12 in this study where a patient presented with PD, FTLD and MND which is most consistent with families linked to chromosome 17 with MAPT mutations. On the other hand, the prominent AD features and MND are more characteristic of GRN mutation carriers and families linked to chromosome 9, respectively. Yet linkage to chromosomes 9 and 17 was negative and no mutations in the MAPT or GRN genes were identified. The clinical spectrum in family Aus-12 also includes psychosis and Paget’s disease. Paget’s disease in association with FTLD is suggestive of VCP mutations and characteristic intranuclear TDP-43 pathology, both of which are absent in family Aus-12. In fact, the underlying pathology is unique to family Aus-12 and demonstrates the unpredictable nature of FTLD. Overall, the broad clinical spectrum seen in family Aus-12 and unique pathology, in the absence of mutations in any of the known dementia genes, suggests that there is a novel genetic locus associated with this family.
5.2.1.1 FTLD and MND linked to chromosome 9
Compared to chromosome 17, families linked to chromosome 9 appear to be more distinct in that the associated motor syndrome is either MND or IBM and Paget’s disease while other extrapyramidal signs do not appear to be a feature. The clinical presentation observed amongst the affected individuals in Aus-14 included typical changes in personality and behaviour as well as motor dysfunction characteristic of FTLD-MND families linked to chromosome 9p. However, in addition
143 several patients presented with clinical manifestations of AD, schizophrenia and dystonia not previously reported in the other chromosome 9-linked families. These features are discussed in more detail here.
Aus-14 and Alzheimer’s disease
Early and severe memory impairment was generally held to be an exclusion criterion for the clinical diagnosis of FTLD (Graham et al., 2005). However, there is growing evidence suggestive of major memory impairments in some patients with pathologically proven FTLD. Graham et al. (2005) found that in a cohort of 71 patients, FTLD was the pathological diagnosis in the 11% in whom early and severe memory impairment was the major presenting clinical feature. Similarly, Tsuchiya et al. (2001) reported two patients with Pick-body positive FTLD and a clinical diagnosis of AD. Further evidence comes from a single case study reported by a Japanese group of a patient with a novel MAPT gene mutation and amnesia without personality change (Hayashi et al., 2002). The most significant finding however is the increasing number of clinical AD cases reported amongst FTLD families with GRN mutations (Benussi et al., 2008; Brouwers et al., 2007; Josephs et al., 2007; Kelley et al., 2009; Rademakers et al., 2007). This is consistent with our findings, where patient III:2 (Paper II) presented with typical clinical features of AD but at autopsy had indisputable TDP-43 positive inclusions consistent with that reported in other 9p-linked families. The additional tau and plaque pathology, somewhat reminiscent of AD, did not meet CERAD criteria and was more likely to be age related given the individual died aged 85 and also because other relatives lacked similar pathology.
Aus-14 and schizophrenia
Schizophrenia-like symptoms are described quite frequently as a feature of neurodegenerative disorders such as MND and FTLD. Interestingly, the reverse is also true where dementia features in some psychotic illnesses such as schizophrenia. Often psychotic episodes become apparent with close proximity or in conjunction with MND and FTLD onset. Vance et al. (2006) described visual and paranoid auditory hallucinations with inappropriate behaviour in one MND patient. Three other MND cases in the same family were also reported to have had psychiatric signs. Consistent with these findings, we describe a patient initially presenting with psychotic behaviour who soon after developed FTLD and MND. However, this is thought to be a result of disturbed brain function due to FTLD or
144 MND in a manner that reproduces some fundamental aspects of the pathophysiology of schizophrenia. More intriguing though are cases where schizophrenia sometimes precedes FTLD or MND by more than 30 years. Kitabayashi et al. (2005) describe a 24 year old patient diagnosed with schizophrenia who did not develop FTLD until she was 62. In addition, Howland (1990) describes two patients with a 14 and 30 year history, respectively, of chronic paranoid schizophrenia before they developed MND. Wilhelmsen et al. (2004) also report decades of psychiatric disturbances in multiple family members of an FTLD-PD-MND family. Finally, an Ontario family has been reported by Kertesz et al. (2000) where a patient diagnosed with manic depression and schizophrenia has a family history of FTLD and/or PSP-S and MND. This mirrors our findings, where a 23 year-old patient diagnosed with schizophrenia had a parent affected with FTLD. Interestingly, both families have ubiquitin- positive, tau-negative, D-synuclein-negative pathology supporting the view that schizophrenia may be a prodrome or another clinical manifestation in the aetiology for FTLD and MND. This highlights that schizophrenia in the context of a family with dementia may be an early and significant indicator for early intervention. This is particularly pertinent to Aus-14 with SIGMAR1 mutations, as sigma-1R has been implicated to play a role in schizophrenia. In addition, drugs such as haloperidol and rimcazole bind sigma-1R with high affinity and may therefore be of therapeutic significance.
Aus-14 and dystonia
Finally, several members in Aus-14 also present with dystonic head tremors. Intriguingly, brain regions such as the cerebellum and the red nucleus that are clearly related to dystonic reactions are also enriched in sigma receptors (Bouchard and Quirion, 1997; McLean and Weber, 1988). Several studies have shown that sigma antagonists can attenuate facial dyskinesias and dystonic reactions while sigma agonists injected into the red nucleus can elicit dystonic reactions (Matsumoto et al., 1990 and 1995; Tran et al., 1998). The dystonic features are therefore consistent with the increased sigma-1R expression resulting from the 3’UTR mutation in this family.
5.2.1.2 Summary
It is currently unclear why patients with the same mutations can develop such a wide range of clinical presentations. However, this does raise the possibility that other genetic, epigenetic and environmental factors exist, highlighting the complexity underlying FTLD and its associated
145 syndromes. These findings also extend the disease phenotype of chromosome 9-linked families beyond FTLD and MND. This has important implications for clinicians who may otherwise not consider such varied clinical presentation to be part of a common underlying cause.
5.2.2 Pathological perspective
Analogous to the vast array of clinical phenotypes associated with hereditary FTLD, there is also considerable variability in neuropathology. A very small subset of sporadic cases have no identifiable pathology while ubiquitin only is found in one Danish family with a CHMP2B mutation (Josephs et al., 2008; Skibinski et al., 2005). A larger proportion of cases can be divided into three broad categories where the pathology consists of tau, TDP-43 or the newly identified FUS protein. Based on the biochemistry, the cell type that is affected and distribution within the different brain and spinal cord regions, several subtypes have been defined. For instance, tauopathies can be further classified as PiD, CBD, PSP, AGD and MSTD (Cairns et al., 2007a). Amongst familial cases, tauopathies are generally associated with MAPT mutations and often but not always reflect a particular clinical syndrome. For example, PiD pathology is mostly associated with bvFTD and PNFA rather than SD, while PSP pathology is clinically characterised by axial and symmetric parkinsonism and early vertical supranuclear gaze palsy (Litvan and Hutton, 1998). CBD most commonly results in distinct motor disturbances including asymmetric parkinsonism and limb ideomotor apraxia collectively known as CBS. The TDP-43 pattern and distribution falls into four categories (types 1-4) (Cairns et al., 2007a). Type 1 is most often associated with SD (Davidson et al., 2007). Type 2 is invariably reported in familial FTLD-MND with confirmed linkage to chromosome 9 (Cairns et al., 2007b). Type 3 is characteristic (although not exclusive) to FTLD cases with GRN mutations and is most often associated with the bvFTD and PNFA phenotypes (Cairns et al., 2007b; Mackenzie et al., 2006b) while type 4 pathology is unique to IBMPFD with VCP mutations (Forman et al., 2006; Neumann et al., 2007b). However, while initial reports suggested that pathological TDP-43 was specific to these conditions, several recent studies have found TDP-43-positive inclusions in a significant proportion of cases with other neurodegenerative diseases such as AD, LBD, HD and some primary tauopathies (Amador-Ortiz et al., 2007; Freeman et al., 2008; Fujishiro et al., 2009; Geser et al., 2008; Hasegawa et al., 2007; Higashi et al., 2007; Schwab et al., 2008; Uryu et al., 2008). Therefore, it is currently unknown if TDP-43 represents a coincidental primary pathological process which contributes to the clinical phenotype, or a secondary change of little pathogenic significance, occurring in susceptible 146 neuronal populations (Mackenzie et al., 2009). Certainly in family Aus-12, tau pathology is the predominating feature and therefore it is plausible that the TDP-43 pathology is of little pathogenic significance. Although tau pathology within the context of an FTLD/AD-MND clinical picture is unusual, two clinically similar families with predominant tau deposition and no tau mutations have been previously described. The San Francisco family A reported by Wilhelmsen et al. (2004) consists of family members with FTLD, variable extrapyramidal symptoms and prominent MND. The underlying pathology is most consistent with CBD and AGD similar to family Aus-12, although additional D-synuclein pathology is also present. Widespread neuronal and glial tau deposition was also described in an FTLD-MND French family implicating tau as the major pathological hallmark (Martinaud et al., 2005). Therefore, the associated TDP-43 pathology in family Aus-12 or Lewy body formation in San Francisco family A may be of little consequence under circumstances where tau predominates. Interestingly, ubiquitin-only-immunoreactive rounded or skein-like inclusions were also observed in the spinal cord and medulla in the French family. It would be of interest to see if these inclusions are also TDP-43 positive. Identification of concomitant tau and TDP-43 pathology in two independent FTLD-MND families would perhaps have greater bearing on our understanding of the true contribution of TDP-43 in FTLD pathogenesis. Combining the two families may also provide us with enough power to detect statistically significant linkage and will aid in the elucidation of the gene involved. With family Aus-12 bearing clinical and pathological features consistent with families linked to both chromosomes 9 and 17, it is plausible that the gene involved plays a significant role upstream of the pathway that involves both tau and TDP-43 regulation. Identification of this gene will help clarify the process that leads to tau and TDP-43 deposition independent of MAPT and TARDBP mutations and may also have important therapeutic implications.
FUS pathology was initially identified in familial MND cases with FUS mutations (Kwiatkowski et al., 2009; Vance et al., 2009) and in HD where FUS forms characteristic NII (Doi et al., 2008). More recently, FUS pathology has also been identified in NIFID, BIBD, sporadic MND cases and MND cases with dementia (Deng et al., 2010; Munoz et al., 2009; Neumann et al., 2009b). Furthermore, in a subset of patients with MND, Deng et al. (2010) found that TDP-43 and FUS co-localise in the same inclusions. This is similar to our findings although in this study FUS and TDP-43 inclusions most commonly occurred in separate neurons (Paper III). It is currently unclear why in some neurons TDP-43 is affected while in others FUS. Nevertheless, the fact that dysregulation of sigma-1R elicits
147 changes in the subcellular localisation of both TDP-43 and FUS suggests a common pathway in their aetiology. It remains to be seen whether TDP-43 and FUS are just the by-product of an apoptotic process already taking place or whether the accumulation of the proteins themselves is the cause of neurodegeneration.
Overall, the significance of multiple pathologies identified in both family Aus-12 and 14 in this study remains unknown. However, given that even within a single family with the same mutation the underlying pathology can differ significantly the reliability of making diagnoses purely on pathology becomes questionable. In addition, the pathology often bears no reflection on the topography of neurologic dysfunction and the associated clinical features, as exemplified by Aus-14 where the same pathology results in different clinical presentations. Therefore, while investigations into pathological hallmarks of certain diseases have provided researchers with some important clues as to the aetiology of certain neurodegenerative processes and may well form the basis for future therapies, the value of pathology in disease diagnosis should be questioned. This is particularly true as more proteins are discovered and concomitant pathology is more frequently reported. Identification of the underlying genetic cause is likely the better key to proper diagnosis.
148 5.2.3 Genetic perspective
The heterogeneity of FTLD is not only reflected in the myriad of clinical presentations and the various pathologies but also in the underlying genetics. To date, two FTLD genes have been identified on chromosome 17: MAPT and GRN. Mutations in these genes account for 10-25% of familial FTLD cases and 5-10% of all FTLD (Baker et al., 2006; Cruts et al., 2006; Rademakers and Hutton, 2007). Linkage studies of San Francisco family A with FTLD, MND and parkinsonism suggest that a third FTLD gene distal to GRN and MAPT also exists on chromosome 17 (Wilhelmsen et al., 2004). Rare mutations have also been identified in the CHMP2B and VCP genes that account for a very specific group of families characterised by FTLD-MND and ubiquitin-only pathology or IBMPFD, respectively (Josephs et al., 2008; Skibinski et al., 2005; Watts et al., 2004). TARDBP and FUS mutations have also been identified in FTLD (Gitcho et al., 2008; Kabashi et al., 2008; Kwiatkowski et al., 2009; Sreedharan et al., 2008; Vance et al., 2009). However, while TDP-43 and FUS pathology has been reported in multiple FTLD cases, mutations in the TARDBP and FUS genes in FTLD are rare and are most common in familial MND (Yan et al., 2010).
The detection and characterisation of these major genes has shaped our current understanding of the pathogenic mechanisms underlying FTLD and its associated motor syndromes. Several common themes related to pathogenesis have begun to emerge including axonal transport, RNA metabolism and transcription, calcium homeostasis and lipid transport. However, despite these major advances, the cause of FTLD in most cases still remains unknown.
5.2.3.1 The role of variable expression in frontotemporal lobar degeneration
With the discovery of GRN mutations in FTDP-17, an interesting concept of genetic variability in the expression of proteins is beginning to emerge as a possible means of causing dementia. The majority of GRN mutations are nonsense, frameshift and splice-site mutations that introduce a premature stop codon leading to the degradation of mutant RNA by the process of nonsense-mediated decay and the subsequent loss of 50% functional GRN (Baker et al., 2006). Rademakers et al. (2008) explored an alternative mechanism for decreased levels of functional GRN by investigating the role of micro- RNAs (miRNAs). miRNAs are short ~22 nucleotide RNA sequences that bind to partially complementary sequences in the 3’UTR region of the target gene and function as post transcriptional
149 regulators, usually resulting in translational silencing. Rademakers et al. (2008) identified a common genetic variant in the 3’UTR which was predicted to result in stronger binding of miR-659 and showed that this variant significantly increases the risk of developing FTLD, most likely through suppressed translation of GRN. More recently, Gitcho et al. (2008) identified a rare variant in the 3’UTR region of the TARDBP gene in three FTLD and/or MND cases and showed a significant increase in TARDBP gene expression. We have also identified a number of mutations in the 3’UTR of SIGMAR1 that result in either the upregulation or downregulation of the gene transcript. Analysis of the 3’UTR sequence using multiple search engines for candidate miRNA-binding sites (microRNA.org, miRBase Target Database, RePPGRNA) revealed that the mutations c.672*47G>A and c.672*51G>T fall within predicted binding sites for a cluster of miRNAs. In addition, the miRanda miRNA target detection software has revealed that introduction of the c.672*51G>T mutation reduces or totally abrogates the binding of several miRNAs, suggesting that this may be the mechanism for the elevated sigma-1R levels in carriers of this mutation. These findings suggest that translational regulation by miRNAs may represent a common mechanism underlying complex neurodegenerative diseases.
The role of miRNAs in neurodegeneration has been previously explored (Hebert et al., 2008; Kim et al., 2007). Overexpression of neurodegenerative disease proteins such as APP in AD and Down’s syndrome and D-synuclein in PD has been demonstrated to be sufficient to cause disease which further supports that regulatory mutations affecting the interaction between miRNAs and their targets may present a common mechanism underlying complex neurodegenerative disorders. Interestingly, similar to triplication of APP in Down’s Syndrome, trisomy of either a portion of the short arm of chromosome 9 (9p), the entire short arm, or the short arm and a portion of the long arm (9q) of chromosome 9 results in mental retardation and distinctive malformations of the skull and facial (craniofacial) region (CIGNA, 2008). In another case study, the investigators showed that trisomy of the short arm of chromosome 9 can result in spinal muscular atrophy (SMA) (Tolksdorf et al., 1977). SMA is a form of childhood/adolescent motor neuron disease characterised by loss of anterior horn cells in the spinal cord resulting in progressive muscular atrophy and weakness (Kostova et al., 2007). Some parallels can be drawn between APP trisomy resulting in earlier age at onset of AD in Down’s syndrome and Tolksdorf et al’s study, where sigma-1R triplication may lead to an earlier age at onset of SMA. Intriguingly, TDP-43, which binds to the DNA and RNA and regulates transcription and splicing was recently found to be involved in exon 7 inclusion of the survival of motor neuron
150 gene (SMN). Exon 7 is crucial for the stability and oligomerisation ability of the SMN protein, where the loss of function causes spinal muscular atrophy (Bose et al., 2008). One could speculate that the overexpression of sigma-1R could be modulating TDP-43, which in turn affects SMN splicing. Moreover, TDP-43 is also involved in the regulation of CFTR splicing by promoting CFTR exon 9 skipping (by binding to the GU-repeated motifs in the polymorphic region near the 3’-splice site of this exon) (Buratti and Baralle, 2001; Buratti et al., 2001). Although not previously reported in this thesis, it is interesting to note that two siblings from Aus-14 (Paper II) have cystic fibrosis, further supporting the speculation that sigma-1R may play a significant role in the modulation of TDP-43 function.
There is also some supporting evidence showing that chromosome 9 deletions can also play a role in neurodegeneration. McSweeny et al. (1993) reported two brothers with 9p monosomy that led to cognitive abnormalities involving general retardation of intellectual capabilities and specific problems with the production of behaviour including speech articulation and graphomotor skills suggesting that chromosome 9 is crucial in the development of normal brain function as reflected by cognitive and language skills in the two siblings. The pattern of cognitive deficits described suggests that the frontal lobes are at particular risk and reflect the type of symptoms seen in patients with FTLD.
Chromosome 9 aberrations such as pericentric inversions have also been described in relation to psychosis (Axelsson and Wahlstrom, 1984; Lee et al., 1998; Nanko, 1993). One group has demonstrated multiple times that schizophrenic patients have a relatively high frequency of pericentric inversions of chromosome 9, implicating this chromosome in the physiology of psychosis (Axelsson and Wahlstrom, 1981; Axelsson and Wahlstrom, 1984).
5.2.3.2 Role of lipids in neurodegeneration
Sigma-1R is implicated in a number of cellular mechanisms including cholesterol homeostasis. To date, a number of mutations have been identified in genes involved in lipid transport and metabolism that lead to FTLD and associated motor syndromes, highlighting that perturbed cholesterol homeostasis plays a significant role in neurodegeneration. For instance, Sugama et al. (2001) report a 44year old woman with progressive frontal lobe dementia and spastic paraplegia with a heterozygous mutation in the sterol 27-hydroxylase gene (CYP27), abnormal cholesterol metabolism and increased levels of circulating serum cholestanol. Nishimura et al. (2004) identified a single
151 missense mutation (P56S) in the VAPB gene associated with 3 different clinical courses, including a rare slowly progressing form of MND (ALS8), typical severe MND with rapid progression, and late- onset form of SMA. VAPB interacts with many different proteins and functions as an adaptor to recruit binding partners to the surface of the ER where they play a key role in the regulation of lipid metabolism and in non-vesicular lipid transfer between the ER and other organelles. Mutant VAPB protein rapidly form inclusions within the ER membrane, that subsequently concentrate in the perinuclear region and perturb cholesterol homeostasis (Fasana et al., 2010). Finally, mutations in CHMP2B also perturb cholesterol homeostasis. CHMP2B encodes a component of the heteromeric endosomal complex required for transport III (ESCRT-III complex) (Martin-Serrano et al., 2003). The sorting of cell surface receptors for recycling to the plasma membrane or Golgi complex, or for degradation by the lysosome is mediated by the MVB pathway. MVBs are late endosomal structures that fuse with the lysosome and are formed by invagination and budding of vesicles from the limiting membrane of endosomes into the endosomal lumen. This requires a transient formation of three ESCRT complexes I-III (van der Zee et al., 2008). Mutation in CHMP2B disrupts its localisation and results in the formation of dysmorphic organelles of the late endosomal pathway (Skibinski et al., 2005). Late endosomes/MVBs are enriched in neutral phospholipids, including triglycerides and cholesterol esters and appear to have a crucial role in regulating the distribution of cholesterol in endocytic compartments. Lysobisphosphatidic acid (LBPA) is a phospholipid located almost exclusively on the lumenal membranes of MVBs. Treatment of cultured cells with anti-LBPA antibodies leads to cholesterol accumulation in late endosomes. This accumulation is reminiscent of a phenotype seen in cells of patients that have the cholesterol-storage disorder Niemann–Pick type C, which results in harmful quantities of lipid accumulation in the spleen, liver, lungs, bone marrow and brain (Katzmann et al., 2002). Accumulation of cholesterol within LBPA-rich internal membranes alters membrane properties and inhibits protein sorting and trafficking to the detriment of the cell.
Interestingly, dysfunction of the late endosomal pathway also contributes to amyloid fibril formation (Yuyama and Yanagisawa, 2009) and histopathological abnormalities are seen in endosomes in preclinical stages of neuropathological disease such as AD and Down’s syndrome (Cataldo et al., 2000).
152 The identification of mutations in multiple genes (including SIGMAR1) that are involved in lipid homeostasis highlights the significance of this pathway within the context of neurodegeneration.
5.2.3.3 Gene clustering in FTLD
Genomic clustering of genes involved in a particular pathway is not present in most eukaryotes, the operon being a characteristic genetic unit in prokaryotes. However, there does appear to be clustering of pathway members that assist in co-regulation of a set of functionally cooperating genes. It is interesting to note that particularly in the case of chromosomes 9 and 17 there appear to be clusters of genes that could potentially be involved in regulating pathways that ultimately lead to neurodegeneration. So far, VCP and SIGMAR1 account for the FTLD families linked to chromosome 9p. However, with the SIGMAR1 gene outside of the common linked region of the classic 9p family, it is highly likely that yet another FTLD gene is located on chromosome 9p. In fact, SIGMAR1 mutation screening of two independent 9p-linked MND families failed to identify any mutations (personal communication; IP Blair and J van Swieten). This highlights the importance of this chromosome in neuronal process regulation. Chromosome 15 could be another such multigenic locus with a number of MND and AD families linked to that region including family Aus-12 where a gene is yet to be identified. Finding the identity of these genes will hopefully provide us some of the missing links and clarify some of the mechanisms underlying the clinical and pathological complexities of FTLD and its associated syndromes.
5.2.3.4 Difficulties of gene identification in FLTD
Our ability to predict the underlying proteinopathy in the various neurodegenerative syndromes is far from perfect and even if we are successful, the pathology rarely reflects the topography of neurologic dysfunction. Accurate identification of the underlying cause of the disease is the only way to ensure that targeted therapies are administered. However, for targeted therapies to be meaningful, they must be administered early in the course of the disease, preferably in the pre-symptomatic phase. To date, the best way to achieve this has been through the identification of causative genes and screening of affected individuals for mutations that will allow for early intervention.
153 Since the completion of the human genome project, the major mode of disease gene identification has been through the positional candidate gene approach. Most commonly the chromosomal region is identified using genetic linkage analysis and databases are searched for an attractive candidate gene within that subregion. The candidate gene is then screened for disease-causing mutations. The identity of the disease gene is usually confirmed by demonstration of a strict correlation between the mutations within the gene and the disease followed by functional analysis demonstrating its role in neurodegeneration.
The positional candidate gene approach has been successful in identifying many dementia genes, most notably the presenilins and tau. This approach has also been used in this study to identify SIGMAR1. However, in many instances it has failed to yielded results, as exemplified by the many families linked to different chromosomal regions where causative genes have been difficult to identify. For example, it took some years after the identification of MAPT mutations in FTDP-17 for the nearby GRN gene to be identified as the cause of FTLD-U. Similarly, there appear to be a number of pedigrees that show linkage to chromosome 9, but disease genes have not been identified and our preliminary analysis suggests that they do not carry SIGMAR1 mutations.
Linkage analysis
From a linkage perspective, FTLD is particularly problematic to study because of the phenotypic heterogeneity associated with it. Consequently, a vast array of clinical spectra is assumed to belong to a single underlying cause. While this approach has yielded some positive results, it may also be creating false positive loci and preventing the identification of the true genetic locus or even multiple loci. The presence of phenocopies is also problematic. Phenocopies are individuals whose non- hereditary phenotype mimics individuals whose phenotype is produced by a gene. Not only does this have the potential to create false positive or false negative linkage score through the inclusion of non- genetic causes but it also complicates the process of accurately identifying disease mutations where a gene may be excluded on the basis that an affected individual (ie. phenocopy) does not carry the common mutation. The rate of phenocopies in FTLD families especially in GRN mutation carriers is relatively high which may explain why this gene took so long to identify. A large proportion of phenocopies has also been reported in other neurodegenerative diseases like PD, where in one
154 family more than 15% of family members accounted for non-Parkin gene-related presentations (Pramstaller et al., 2005). Given this high frequency, Kruger (2008) suggests the idea of an intrinsic susceptibility allelic profile, which aggregates and in concert with environmental factors may drive the accumulated risk over the critical threshold to cause neurodegeneration. The Aus-14 family described in this thesis also includes a phenocopy (individual III:8) that initially led to the exclusion of a large chromosomal region that included the SIGMAR1 gene. However, the alternate view, that individual III:8 is not a phenocopy and therefore the variant identified in the SIGMAR1 gene is not the causative mutation should also be considered. The original haplotype constructed with individual III:8 as an affected member of the family is consistent with all other families linked to this region, suggesting that Aus-14 may share a common genetic variant. Recently published genome-wide association studies of sporadic and familial MND/FTLD cases have also identified chromosome 9p as a potential locus (Laaksovirta et al., 2010; Shatunov et al., 2010; Van Deerlin et al., 2009; van Es et al., 2009). However, Shutanov et al. (2010) question whether the same variation is responsible for both sporadic and familial cases as the penetrance of the associated risk allele in sporadic ALS that the group identified is only equivalent to the background risk of ALS (0.35-0.45%) compared to a 20% penetrance of familial variants. Nevertheless, despite all the evidence, this additional 9p mutation remains elusive. To date, all the genes identified in this region have been screened extensively for single nucleotide changes, small and large scale deletions, as well as gene copy number variations without an outcome. This argues for a complex mutation that cannot be identified using conventional screening methods. Alternatively, miRNA, a mutation in a non-annotated gene or an inversion may be the disease-causing variant. Until this mutation is identified and excluded from family Aus-14, we cannot say with certainty that individual III:8 is a phenocopy and therefore conclude that SIGMAR1 is the sole causative gene in Aus-14. However, independent reports of SIGMAR1 mutations in FTLD/MND cohorts and independent pedigrees provide support for this disease gene and thus support our assignment of III:8 as a phenocopy. In this regard, a recent paper by Al-Saif et al. (in press) describes a novel missesnse mutation in the transmemebrane domain of the SIGMAR1 gene in a family with juvenile MND (Al-Saif et al., in press). This suggests that SIGMAR1 plays a role in MND pathogenesis and that Aus-14 is in fact a unique family not related genetically to the other 9p linked families especially since the FUS pathology is also unique.
155 Finally, incomplete penetrance may also obscure the true pattern of inheritance and prevent appropriate application of linkage analysis. This also complicates the ability to accurately establish recombination breakpoints, particularly when using multiple familles linked to the same region and may ultimately result in an inappropriate exclusion of the disease gene region. Therefore, unless multiple independent families show significant linkage to the same region, it is relatively difficult to establish a genetic FTLD locus with a high level of confidence.
Identification of disease gene by sequence analysis
Identifying the disease gene is proving to be equally problematic. One of the problems with the positional candidate gene approach is the subjective process of choosing specific genes from a group where background knowledge on the genes may be relatively poor or completely unknown. Therefore, prioritising genes for screening can be difficult. This process is further complicated by the fact that some genes have not been annotated. This includes a large proportion of non-protein coding genes important in several cellular processes including RNA processing, regulation of transcript abundance, translation regulation and protein translocation. Mutations or imbalances in these genes have the capacity to cause a variety of diseases. For instance, the antisense RNA (BACE1-AS) transcribed from the opposite strand to BACE1 (E-site of APP cleaving enzyme) is upregulated in AD patients where it regulates BACE1 expression by increasing its mRNA stability. BACE1-AS also generates additional BACE1 through a post-transcriptional feed-forward mechanism and raises AE levels (Faghihi et al., 2008).
The most common approach to mutation screening is by sequencing. Screening often focuses on the gene coding regions and flanking regions that may be implicated in aberrant splicing (Boxer et al. 2010). Promoter and untranslated regions of the gene are not as rigorously examined and may therefore miss significant gene variations as exemplified in the initial exclusion of MAPT mutations in FTDP-17 (Baker et al., 1997) and the subsequent identification of intronic mutations that affect alternate splicing (Hutton et al., 1998). Similarly, the 3’UTR, in which we deteced mutations in SIGMAR1, was not an obvious site for a disease-causing mutation. Sequencing is also limited by only being able to detect single nucleotide changes and small-scale deletions or insertions. Therefore, for whole gene copy number variations, chromosomal rearrangements and large scale deletions or insertions, alternative screening methods need to be employed. For example, without 156 gene expression studies the D-synuclein triplication in PD would not have been identified (Singleton et al., 2003). Finally, given the vast array of clinical presentations in FTLD-MND families, it is highly plausible that epigenetics may also play a role. For instance, different histone modifications associated with various neuronal gene expression states are required for long-lasting changes in synaptic plasticity that underlie learning and memory. Recently, Feng et al. (2010) generated DNA methyltransferase 1 and 3A conditional-knockout mice and demonstrated that the resulting reduced methylation regulation led to deficits in hippocampal synaptic plasticity, learning and memory, as well as altered gene function. APP hypomethylation (West et al., 1995) and methylation-regulated PSEN1 and BACE gene expression has also been demonstrated in AD cases demonstrating the role of epigenetics in neurodegeneration (Fuso et al., 2005).
Overall, gene identification can be a relatively complex and challenging task. However, given the increasing number of available approaches, it is not an impossible one.
Having now discovered SIGMAR1 as the Aus-14 FTLD-MND gene it would be relevant to review what is known about its function and offer some insights into possible mechanisms via which sigma- 1R dysregulation may lead to neurodegeneration.
157 5.3 Review of sigma-1 receptor
5.3.1 Introduction
The so-called sigma “opioid” receptor was first identified in 1976 when it was found to exhibit a binding profile that overlapped and was similar, yet different, to other opiate receptors (Martin et al., 1976). However, when the opioid receptor antagonists, naloxone and naltroxone showed no affinity for the receptor it was established that sigma binding sites represent different entities from opiate receptors (Quirion et al., 1987). Extensive pharmacological studies that followed led to the classification of two major subtypes of sigma binding sites (sigma-1 and sigma-2) based on their ligand stereoselectivity profiles (Quirion et al., 1992). Since then two more sigma sites (sigma-3 and sigma-4) have been proposed based on a series of experiments looking at different binding affinities of several drugs (Booth et al., 1993; Bowen et al., 1995). However, further studies are needed to determine conclusively the nature of these sites.
Sigma-1Rs have high affinity for (+) isomers of pharmacological ligands such as (+)-pentazocine (PTZ), (+)-SKF10047, carbetapentane (CBP) and dextromethorpan (DEX) (Quirion et al., 1992). Endogenous sigma-1R ligands are not known, although there is increasing evidence suggesting that progesterone may play a role (Monnet et al., 1995; Su, 1991; Su et al., 1988). Testosterone also binds sigma-1R and neuropeptide Y and related peptides are also gaining support as sigma-1R ligands (Bouchard et al., 1993; Monnet et al., 1992b; Riviere et al., 1990; Roman et al., 1989).
The sigma-1R was first cloned in guinea pig liver. In humans, the SIGMAR1 gene is located on chromosome 9p13.3 and encodes four exons (207, 201, 93 and 1,132 bp in size) and three introns (126, 130, and ~1,250 bp in size) (Prasad et al., 1998). There are 10 different transcripts that result from the SIGMAR1 gene, however, only five result in a protein product. Transcript SIGMAR1-001 is illustrated in Figure 1 A. It incorporates all 4 exons and codes for a 223 amino-acid protein that has a molecular mass of 25-29kDa (Prasad et al., 1998; Seth et al., 1998). The protein contains two transmembrane domains TMDI and TMDII (amino acids 9-28 and 81-101) (Aydar et al., 2002) and two additional hydrophobic segments (amino acids 91-109 and 176-194) identified as steroid binding domain-like sites I and II (SBDLI and SBDL II) based on their high sequence homology to the yeast
158 and fungal sterol isomerase (Pal et al., 2007). Several residues found within SBDLI as well as exons 3 and 4 contribute strongly to agonist binding (Figure 1 B) (Seth et al., 2001; Yamamoto et al., 1999). The sequences VEYGR and LFYTLRSYAR, located in the C-terminal region of sigma-1R, code for three cholesterol binding domains (ChBDs) and are predicted to form a cholesterol docking pocket (Palmer et al., 2007). The N-terminus encoded by exon 1 of SIGMAR1 has an amino acid sequence motif MQWAVGRR containing two arginine residues, which is consistent with an ER retention signal (Seth et al., 1998).
There is some evidence that sigma-1R may exist as oligomers or interact with protein partners either constitutively or through binding of ligands. Using radioiodinated photoaffinity labels, Pal et al. (2007) identified several high molecular weight protein bands (96.7kDa, 130kDa and 147kDa) with ligand binding properties consistent with that of sigma-1R. As sigma-1R has no putative N-glycosylation sites it was unlikely due to that. However, sigma-1R does contain two GXXXG motifs, which occur with high frequency in membrane proteins that favour helix-helix interactions (Kleiger et al., 2002; Russ and Engelman, 2000). Interestingly the high molecular weight complexes did not completely dissociate upon SDS-PAGE analysis. In this thesis, using western blotting and sigma-1R specific antibodies we have also consistently identified a high molecular weight band (~110 kDa), which is suggestive of a sigma-1R multimer. Further investigation is required to determine whether these bands arise from homo- or hetero-oligomers or whether they interact with other membrane proteins.
The primary structure of sigma-1R is very highly conserved across species and shows >90% similarity amongst mammals, highlighting its fundamental role in living systems. However, sigma-1R appears to be distinct from any other known receptor class and lacks significant homology with any other mammalian protein (Hanner et al., 1996; Seth et al., 1997).
159 A
B
Figure 1. Schematic summary of Sigma-1 receptor. A. Overview of the 4 SIGMAR1 exons showing coding regions in blue and non-coding regions in purple. The protein structure below shows corresponding transmembrane domains and ligand binding sites. B. Sigma-1R structure proposed by Pal et al. (2007) showing 3 hydrophobic segments and highlighting the different sigma-1R binding sites. TMDI - transmembrane domain I, TMDII - transmembrane domain II, SBDLI – steroid binding domain-like site I, SBDLII – steroid binding domain-like site II, ChBD – cholesterol binding domain (B adapted from Palmer et al. 2007)
160 5.3.2 Location
5.3.2.1 Anatomical distribution of sigma-1R
Sigma-1R expression has been reported in all tissues including the heart, spleen, stomach, colon, small intestine, pancreas, testis, prostate, ovaries as well as immune cells. However, the highest levels are reported most consistently in the liver, kidneys, thymus, brain and steroid-producing tissues like the placenta and adrenal glands, while lower levels are reported in the lungs and muscle tissue (Hanner et al., 1996; Mei and Pasternak, 2001; Pan et al., 1998; Seth et al., 1998). Sigma-1R is also highly expressed in tumour cell lines from various human cancer tissues (John et al., 1995; Moody et al., 2000; Vilner et al., 1995).
Sigma receptors are expressed extensively throughout the central and peripheral nervous system and their anatomical distribution has been well characterised. The highest density of sigma-1R is found in the olfactory bulb (Alonso et al., 2000). However, high concentrations of sigma-1R are also consistently reported in the hypothalamus, midbrain, pons, medulla, motor nuclei, and the cerebellum, particularly in Purkinje cell bodies and cell bodies in deeper cerebellar nuclei (Alonso et al., 2000; Gundlach et al., 1986; McCann et al., 1994; McLean and Weber, 1988; Palacios et al., 2003; Palacios et al., 2004; Seth et al., 2001). Within the hippocampus most intense immunostaining is localised to the granule cells of the dentate gyrus and the cell bodies and processes of pyramidal cells located in pyramidal cell layers CA1-CA3. Pyramidal cell layers (especially layers II-V) of the cerebral cortex also show sigma-1R staining. Interestingly, sigma-1R is also expressed in ependymocytes and oligodendroglia, suggesting that its function is fundamental to many different cellular processes. In the spinal cord, sigma-1R is localised to the grey matter, with most intense staining in small and medium sized cells located in the superficial layers of the dorsal horn. Cell bodies of motor neurons and large dendritic processes dispersed between them stain less intensely. In the peripheral nervous system, Schwann cells and parasympathetic intracardiac neurons also show sigma-1R expression (Zhang and Cuevas, 2002). This distribution of sigma-1R expression within the central and peripheral nervous systems is consistent with the regions that are affected in different neurodegenerative diseases including AD, FTLD and MND. This suggests that sigma-1Rs
161 may play a vital role in neuron viability and that dysregulation of sigma-1R may play a significant role in the pathophysiology of these diseases.
5.3.2.2 Cellular and subcellular distribution of sigma-1R
At a subcellular level various studies have indicated that sigma-1R’s are located in the cytoplasm, on the cell surface and the nucleus (Aydar et al., 2002; Jbilo et al., 1997; Lupardus et al., 2000; Morin- Surun et al., 1999). In the cytoplasm sigma-1R is most often associated with membranes including membranes of organelles such as mitochondria, the ER, and vesicles present in the vicinity of the Golgi apparatus or dispersed within dendrites. Detailed studies by Hayashi and Su (2003a; 2003b) further show that sigma-1Rs are highly clustered globular structures enriched in cholesterol and neutral lipids that translocate from the ER to the nucleus and plasma membrane upon ligand binding. Along the plasma membrane, the most intense immunostaining is found in postsynaptic membrane thickenings but not in presynaptic axonal structures, suggesting that sigma-1R may play a role in the modulation of synaptic neurotransmission (Hayashi and Su, 2005a). Indeed, sigma-1R has been shown to play a role in several neurotransmitter systems including N-methyl D-aspartate (NMDA), acetylcholine (ACh), dopaminergic, or adrenergic receptors (Monnet et al., 1992a; Monnet et al., 1990; Siniscalchi et al., 1987).
5.3.3 Genetics
Genetic studies investigating SIGMAR1 are sparse and to date only association studies using predominantly Japanese cohorts with either schizophrenia, AD or alcoholism have been published.
5.3.3.1 Schizophrenia
Genetic association studies between the sigma-1R and schizophrenia have only been investigated in the Japanese population and have yielded conflicting results. Ishiguro et al. (1998) identified two common genetic variations in SIGMAR1: G-241T/C-240T in the 5’UTR and Gln2Pro in Exon 1. The Gln2 allele is part of the sequence motif for the ER retention signal and therefore the substitution to Pro2 is thought to perturb appropriate regulation of the transport of sigma-1R from ER to plasma
162 membrane. Ishiguro et al. (1998) found a significant association between the TT/Pro2 haplotype and schizophrenia. However, two subsequent studies by Ohmori et al. (2000) and Uchida et al., (2003) failed to replicate these results. In addition, a meta-analysis combining all the results was also unsuccessful in finding any association between SIGMAR1 gene variations and schizophrenia. Satoh et al. (2004) identified two more polymorphisms: the 5’UTR T-485A and Arg211Glu and using gene reporter assays found that transcription of the A-485 and TT-240-241 alleles was significantly reduced compared to T-485 and GC--240-241 alleles, suggesting that these variants may be related to down-regulation of sigma-1R. However, as with previous studies they could not find any significant association with schizophrenia. Miyatake et al. (2004) showed that the transcription activity of the TT- 241-240/Pro2 haplotype was reduced by 33% in human cortical neuron cells suggesting that this polymorphism may be related to transcriptional regulation and expression of SIGMAR1 mRNA in human cerebral cortex (Ishiguro et al., 1998; Uchida et al., 2005). Interestingly, schizophrenics bearing the TT/Pro2 haplotype were recently found to have a significantly lower hemodynamic response in the prefrontal cortex to verbal fluency tasks compared to controls, suggesting that sigma- 1R expression level may indeed play a role (Takizawa et al., 2009). Moreover, the authors found that the antipsychotic medication dose in use was significantly different between the two SIGMAR1 genotype subgroups, suggesting that patients with a certain genotype might respond more favourably to antipsychotic treatments. This may have important future implications.
Finally, there is some evidence that susceptibility to drug dependence and manifestations of drug- induced psychosis as well as development of psychiatric symptoms resembling schizophrenia, is genetically determined. Inada et al. (2004) investigated the relationship between SIGMAR1 gene polymorphisms, methamphetamine drug dependence and the development of psychosis and found significant differences.
5.3.3.2 Alzheimer’s disease
The first report investigating an association between sigma-1R and AD in a Japanese population found that the TT/Pro2 haplotype had a protective role. TT/Pro2 homozygosity significantly reduced the risk of AD in ApoE4 allele carriers by 75%, suggesting that the SIGMAR1 gene may influence ApoE function in lipid-delivery. Maruszak et al. (2007) investigated a Caucasian group and found that
163 there was no significant association between any of the polymorphisms and late-onset AD or mild cognitive impairment risk. However, they do suggest that this may be because of the very low frequency of the TT/Pro2 in the Polish population compared to the Japanese, or as a result of the different genetic background.
5.3.3.3 Alcoholism
Because sigma-1R is thought to be involved in regulating dopaminergic NMDA and glutamatergic neurotransmission in limbic areas including regions that comprise the “reward system” thought to be involved in alcohol dependence, Miyatake et al. (2004) investigated the effect of SIGMAR1 polymorphisms on alcoholism. They found that the A-485 allele and TT-241-240 allele haplotype may play a possible protective role against the development of alcoholism.
Overall, the evidence so far suggests that the likelihood of an association between sigma-1R and AD, schizophrenia or alcoholism is low. However, in order to definitively determine a relationship, larger cohorts will need to be examined. Moreover, other populations including an Australian cohort should be investigated. Once common variants are identified, association studies should be carried out not only in relation to AD and schizophrenia but also FTLD and MND given the findings in this thesis. There is also evidence that sigma-1R could exist as a multimer or interact with other proteins. Investigating the role of these single nucleotide polymorphisms in the ability of sigma-1R to oligomerise or modulate other proteins would perhaps give us clues as to why some patients are susceptible to certain diseases more than others. Finally, given that sigma-1R binds many pharmacological agents, it would also be important to definitively determine if certain polymorphisms in the SIGMAR1 gene do indeed affect the way a patient will respond to certain medications. Applying this knowledge may have significant impact on the way we will deliver therapies in the future.
5.3.3.4 Transgenic mice
Sigma-1R knockout mice (Sig-R1KO) are not lethal and do not display any unusual phenotype, suggesting that sigma-1R expression is not essential for mammalian development and physiological
164 homeostasis. However, when treated with SKF10047 (sigma agonist), there is a significant decrease in the hypermotility response in the Sig-R1KO mice compared to wild type (WT) mice. SKF10047 was shown to increase locomototor activity of WT mice, while was ineffective in the mutant mice supporting the known psychotomimetic effects of SKF10047 through the sigma-1R mechanism (Langa et al., 2003). However, memory and other cognitive domains were not investigated in these mice. It would be interesting to study these and look for any changes in underlying neuropathology in the form of TDP-43, FUS or diffuse amyloid plaque deposition. It is noteworthy that knockout mice for genes implicated in CNS functions can result in different phenotypes depending on the genetic background and mouse strains chosen for the analysis. Therefore another knockout model might produce different results.
5.3.4 Cholesterol, lipid rafts, and the sigma-1R
The brain is highly enriched in lipids and contains about 23% of the total unesterified cholesterol present in the human body (Dietschy and Turley, 2001). Cholesterol is an abundant component of the plasma membrane and plays an essential role in maintaining membrane integrity and fluidity (Silvius, 2003). However, cholesterol is also toxic and therefore is tightly regulated through transcription regulation of cholesterol biosynthesis, cellular uptake, deposition of cholesterol in fat droplets in esterified form, and by cellular efflux (Simons and Ikonen, 2000; Tabas, 2002).
Cholesterol is also an essential component of specialised membrane domains called lipid rafts (LRs). Alterations in cholesterol content of plasma membrane causes disruption of LRs and consequently affects many of the cellular processes that rely on proper LR function, including membrane sorting, signal transduction, cell adhesion, receptor internalisation, apoptosis and cell proliferation (Hooper, 1999; Simons and Toomre, 2000). LRs are assembled in the Golgi complex and are characterised by their cholesterol- and sphingomyelin-rich nature, cytoskeletal association and enrichment in glycosylphosphatidylinositol (GPI)-anchored proteins (Allen et al., 2007). The cholesterol and sphingolipid content is tightly regulated and limits the supply of LRs to organelles supplied by the Golgi apparatus (Simons and Ehehalt, 2002). In the brain, certain scaffold proteins, neurotransmitter or tropic factor receptors including NMDA, nicotinic-ACh, AMPA, tyrosine kinase-A and endothelial growth factor are also present in LRs (Bruses et al., 2001; Hering et al., 2003). During cell activation
165 LR’s are thought to cluster, forming a platform that functions to concentrate functional proteins and allowing them to interact with cytoplasmic signaling factors, facilitating the initiation of signaling events.
Sigma receptors localise on smooth ER (Hayashi and Su, 2001). The ER has a number of functions including cholesterol synthesis. Neutral lipids such as sterol esters and triglycerides are synthesized in the entire ER network and together with cholesterol are compartmentalised into ER lipid droplets (ER-LD). Cytoplasmic lipid droplets (c-LD) containing neutral lipids bud off from ER-LDs and play an important role in energy storage and/or transport of lipids (Murphy and Vance, 1999). The free cholesterol is transported to the plasma membrane either through the Golgi by vesicular transport along the protein secretory pathway or non-vesicular pathway using cytosolic transfer proteins where it forms the major constituent of plasma membrane as well as lipid rafts. Hayashi and Su (2003b) have shown using confocal fluorescence microscopy that sigma-1R predominantly targets ER-LDs. They postulated that sigma receptors play an important role in regulating the compartmentalisation of lipids on ER and their export from ER to plasma membrane and c-LDs. Transfecting a functionally negative sigma-1R (which cannot target ER-LDs) into NG108 cells resulted in a large amount of neutral lipids and free cholesterol being retained over the entire ER network, causing bulbous aggregations of ER. As a result no compartmentalisation of neutral lipids into ER-LDs occurred, causing a significant decrease in c-LDs as well as cholesterol levels at both the Golgi and the plasma membrane. Treatment of cells with (+)-PTZ, a sigma-1R ligand, also decreased ER-LDs (Hayashi and Su, 2003a). On the other hand, overexpression of sigma-1R not only increased cholesterol contents in LRs but also altered glycosphingolipid components (Takebayashi et al., 2004). Since almost all the enzymes involved in the synthesis of glycosphingolipids are in the Golgi apparatus, it was suggested that sigma-1Rs may play an important role in regulating lipid transport between ER and Golgi (Takebayashi et al., 2004). Overall, upregulation of sigma-1Rs seems to potentiate lipid raft formation and regulate their glycosphingolipid components, which in turn determines the constituent proteins of LRs that interact with specific glycosyl moieties of gangliosides (Hayashi and Su, 2005b).
This work is supported by a more recent study by Palmer et al. (2007) who demonstrated lowered cholesterol levels in lipid rafts following sigma receptor gene silencing in breast cancer cells. In addition, the group showed that sigma-1R is able to bind cholesterol through two ChBDs located in
166 the COOH terminus. However, cholesterol binding was not only abrogated by the introduction of mutations to ChBDs but was also reduced by treatment of cells with SKF10047 (a sigma-1R agonist). It was postulated that it is likely that there is some overlap between cholesterol and sigma ligand binding sites and it was suggested that endogenous ligands such as progesterone may affect the ability of sigma to bind cholesterol and in turn regulate LR cholesterol composition.
Overall, the basic function of sigma-1R is to transport and distribute cholesterol and lipids in the cell that are critical components in the formation of plasma membrane LRs, which play important roles in structural organisation and signal transduction for certain plasma membrane proteins. The sigma-1R does not alter total cholesterol levels in the cells (ie sigma-1R is not involved in biosynthesis of cholesterol) but redistributes it between LRs and other components of the cell. There is evidence suggesting dysregulation of cholesterol has the potential to disrupt cellular homeostasis and lead to abnormal processes identified in neurodegenerative diseases such as AD (Martins et al., 2009). Both abnormal APP processing and NFT deposition have been linked to cholesterol dyshomeostasis. Sigma-1R is also involved in the regulation/biosynthesis of sphingolipids or gangliosides which in turn alters the constituents of LRs modulating the type of proteins that are likely to bind. Interestingly, ganglioside composition of LR’s also plays an important part in amyloid fibril formation (Ariga et al., 2008).
In this study we identified three mutations in the 3’UTR region of SIGMAR1, one of which increases sigma-1R expression while the other two downregulate sigma-1R expression (Paper III). Based on previous reports, these mutations may have serious implications on cholesterol homeostasis and in turn be detrimental to the neurons. In order to determine the role of these mutations in cholesterol homeostasis, further investigations could look at changes in subcellular cholesterol distribution, APP processing and NFT formation in neuronal cell cultures transfected with SIGMAR1 mutation bearing constructs. In addition, since there is an abundance of diffuse plaque formation in brains of patients from Aus-14 where sigma-1R is upregulated, it would be interesting to investigate ganglioside composition of LR’s in these patients and determine a possible link to plaque formation. Finally, as TDP-43 and FUS accumulation is the pathological hallmark in this family, investigations looking at whether TDP-43 and FUS translocation or processing is a cholesterol-dependent process would also be if interest, especially as cholesterol-lowering drugs and sigma-1R ligands are readily available.
167
5.3.5 Calcium homeostasis and the sigma-1R
Calcium serves as an important intracellular signal in many cellular processes such as proliferation and differentiation, regulation of gene expression, and cellular stimulus-secretion coupling (Clapham, 1995; Simpson et al., 1995). Calcium is also toxic to cells and is involved in triggering of the events leading to apoptosis in various cell types. Therefore any perturbations in Ca2+ homeostasis can be detrimental to the cells and ultimately lead to cell death.
Sigma receptors are thought to play an important role in controlling Ca2+ homeostasis. The earliest studies suggesting that sigma-1Rs could be involved in the regulation of Ca2+ mobilisation came from Ela et al. (1994) who demonstrated that exposure of cultured cardiomyocytes to sigma-1R ligands exerted specific changes in contractility and beating rates. The experiments revealed drug-induced changes in the concentration of intracellular Ca2+ ([Ca2+]i) and led to later studies showing that sigma-
1R ligands can modulate the amplitudes of electrically evoked [Ca2+]i –transients and contractions in cardiac myocytes (Novakova et al., 1998). In 2000, Hayashi et al. demonstrated that sigma-1R ligands can modulate Ca2+ signalling by both an intracellular mode of action as well as at the plasma membrane. Intracellular Ca2+ mobilisation is thought to be regulated by a trimeric complex of sigma- 1R, ankyrin B and inositol trisphosphate receptor-subtype 3 (IP3R-3) that co-localises in perinuclear areas and in plasmalemmal regions of cell-to-cell communication in neuronal cells. Treatment of cells with sigma-1R agonists causes ankyrin B and sigma-1R to dissociate from IP3R-3 allowing the bradykinin (BDK)-induced IP3 to bind IP3R-3 and subsequently lead to increased cytosolic Ca2+ concentration. Overexpression of sigma-1R also results in significantly higher [Ca2+]i compared to controls. It is suggested that overexpressing sigma-1R enhances their interaction with ankyrin B and causes the cell lines to have a higher level of ankyrin-free IP3R, which in its active state can bind IP3 and induce Ca2+ release. Interestingly, Cheung et al. (2008) have recently demonstrated that mutant PSEN1 and PSEN2 also interact biochemically and functionally with IP3R. They showed that mutant presenilins enhance IP3R gating by sensitising the channel to IP3 and suggested a possible role for presenilins in IP3R regulation. In addition, they demonstrated that APP processing is strongly dependent on IP3R since production of pathogenic AE was substantially reduced in IP3R-deficient lines. These findings provide insights into possible mechanisms via which neurons overexpressing
168 sigma-1R in Aus-14 can lead to Ca2+ overload and in turn perturb normal cellular function involved in normal APP processing and possibly TDP-43 and FUS trafficking. To elucidate the role of the c.672*51 G>T 3’UTR mutation found in Aus-14 in intracellular Ca2+ homeostasis, electrophysiological techniques could be employed to measure BDK induced [Ca2+]i in neuronal cell lines transfected with mutation bearing constructs and compare them to controls. It would be of interest to see whether these conditions would affect TDP-43 and FUS trafficking. It would also be of interest to investigate the role of this mutation in APP processing. To address this, neuronal cells lines bearing the Swedish mutation (K670N/M671L) could be employed to determine if application of sigma-1R agonists versus antagonists in the presence of BDK can potentiate or reduce APP processing, respectively. This will have important implications in possible ways that we can regulate APP processing via sigma-1R ligands and in turn prevent build-up of toxic levels of AE.
5.3.5.1 NMDA receptor
The NMDA receptor (NMDA-R) is a major receptor linked to Ca2+ signalling and plays an important role in neurotransmission, neuronal development, synaptic plasticity, and neuronal degeneration. Over the years many studies have demonstrated sigma-1R ligand-dependent modulation of responses induced by NMDA-R activation including neurotransmitter release. However, the mechanism through which sigma-1R modulates NMDA-R is still not fully understood. There is evidence that protein kinase C (PKC) might play an important role as a second messenger in the action of sigma-1R. One study found that sigma-1R enhances NMDA-induced pain via PKC and protein kinase A (PKA)-dependent phosphorylation of the NMDA-R NR1 subunit (Kim et al., 2008). Phosphorylation of NMDA-R also increases synaptic strength making this a plausible model for sigma-1R-mediated potentiation of NMDA-R in hippocampal neurons. Interestingly, in AD patients, NR1/2B subunit levels decrease in hippocampal neurons as the disease progresses suggesting that abnormal phosphorylation of these subunits may induce neuronal death (Mishizen-Eberz et al., 2004).
Contrary to the above findings, Snell et al. (1994) demonstrated that pre-treatment of cells with PMA (a protein kinase activator) inhibits NMDA-induced increases in intracellular Ca2+ levels in primary cultures of cerebellar granule cells. They suggest that in cerebellar granule cells, the NMDA-R is
169 subject to feedback inhibition by PKC stimulation. The initial increase in Ca2+ resulting from NMDA-R stimulation leads to PKC activation and translocation, which might then reduce subsequent NMDA-R responses. The authors suggest that the subunit composition of the NMDA-R may play a role in the differences between different studies. NMDA-R2C is almost exclusively found in the cerebellar granule layer and phosphorylation of these receptors may mediate a different response to that described above.
A recent study using patch-clamp whole-cell recordings in CA1 pyramidal cell of rat hippocampus showed that sigma-1R activation using (+)-PTZ enhances NMDA-R currents and long term potentiation (LTP) by preventing small conductance Ca2+-activated K+ channels from opening (Martina et al., 2007). Regulation of NMDA-R is thought to be mediated through tyrosine phosphorylation of the NMDA-R subunit, NR2B. Calcium entry following the activation of NMDA-R opens Ca2+-dependent K+ channels (SK channels) that act to limit the amplitude of synaptic potentials and reduce the influx of Ca2+ through NMDA-R. Therefore, blocking SK channels from opening by sigma-1R activation increases NMDA-R currents and induced Ca2+ influx and subsequently triggers LTP (Bliss and Collingridge, 1993). Such forms of synaptic plasticity are considered to be important cellular mechanisms underlying learning and memory (van Waarde et al., 2010).
An alternative model for NMDA-R regulation via sigma-1R is through cholesterol homeostasis. NMDA-Rs have been reported to be associated with LRs. Ponce et al. (2008) showed that simvastatin (which inhibits the first step of cholesterol synthesis) and AY9944 (which inhibits the last step of cholesterol synthesis) reduced the association of NMDA receptor-subunit 1 (NMDA-R1) to LRs and significantly protected neurons from NMDA-induced neuronal death. This suggests that reduction of cholesterol levels protects cells from NMDA-induced neuronal damage probably by reducing the association of specific NMDA receptor subunits to lipid rafts.
Overall, the above studies suggest that activation of sigma-1R can induce intracellular Ca2+ increase in cells expressing specific NMDA-R subunits, whether it be via PKC, SK channels or regulation of LR content. Overexpression of sigma-1R as seen for the Aus-14 c.672*51G>T mutation would presumably amplify this effect in the presence of sigma-1R agonists and could potentially lead to the induction of toxic intracellular Ca2+ levels. Conversely, reduced levels of sigma-1R as seen in other
170 mutation carriers (c.672*26C>T and c.672*41G>A) can also be detrimental to cells. Feedback inhibition of specific NMDA-R subunits could be lost, again leading to increased [Ca2+]i. This NMDA-R subunit-dependent regulation by SIGMAR1 provides insights into the possible mechanisms underlying the differential neuronal loss seen only in specific brain regions. Elucidating if indeed NMDA-R subunits do play a significant role is vital in order to deliver appropriate drug therapies. It would be of interest to see whether specific NMDA-R subunits are particularly affected in FTLD cases carrying SIGMAR1 mutations. Cell culture experiments could then be used to demonstrate that neurons bearing a higher ratio of certain NMDA-R subunits are at a greater risk of death when overexpressing sigma-1R compared to controls. Use of sigma-1R antagonists should reduce this risk to the level of controls. Other experiments could also examine the NDMA-R subunit composition in LRs in cells overexpressing sigma-1R. This would provide clues to the possible mechanisms by which sigma-1R can induce neuronal death and provide a possible route for preventative treatment.
5.3.5.2 Sigma-1R and neuroprotection
Glutamate, an NMDA receptor agonist, when present in excess, leads to hyperactivation of NMDA-R.
This results in increases in [Ca2+]i mobilisation and subsequent signalling of apoptotic events which include increased expression of Bax levels and caspase-3 activation. Caspase-3 is responsible for the proteolytic cleavage of a broad spectrum of cellular targets, which ultimately leads to cell death (DeCoster et al., 1992; Mark et al., 2001; Schelman et al., 2004). Sigma-1R agonists have been shown to be protective against this response by reducing the activation of caspase-3 through Ca2+- mediated mechanisms (Tchedre and Yorio, 2008). In addition, in rat cortical neurons cultures AE- induced toxicity, sigma-1R agonists reduce the expression levels of Bax suggesting that activation of sigma-1R interferes with the execution of the apoptotic program initiated by AE (Marrazzo et al., 2005). Furthermore, oxygen–glucose deprivation or glutamate-induced neuronal injury is also reduced by cell pre-treatment with sigma-1R agonists, presumably by a mechanism involving the antiapoptotic protein Bcl-2 whose mRNA levels increase upon sigma-1R agonist treatment (Yang et al., 2007). These studies therefore imply that in cases where sigma-1R levels are low, the protective effect of sigma-1R agonists against apoptosis diminishes. Consequently, exposure of these neurons to cellular insults renders them more vulnerable to programmed cell death.
171 Apoptosis is considered a significant pathogenic factor in MND. Both morphological and molecular studies have consistently provided evidence that programmed cell death does take place in motor neurons. For instance, expression of antiapoptotic proteins such as Bcl-2 and Bcl-xL is usually decreased in both human MND cases and transgenic SOD1 mice while the proapoptotic Bax and Bad proteins are upregulated. In addition, caspases such as caspase 3 and caspase 7 are activated in spinal cords of transgenic mutant SOD1 mice in correlation with the neurodegenerative process. Caspase-3 is also activated in spinal cord samples from MND patients. Caspases-1, -2, -8 and –9 have also been implicated (Przedborski, 2004). Zhang et al. (2007) found that TDP-43 contains three caspase-3 cleavage consensus sites (DXXD) and demonstrated that caspase-3 can mediate cleavage and redistribution of TDP-43 from the nucleus to the cytoplasm, where one of the fragments forms toxic cytoplasmic inclusions. Furthermore, suppression of GRN expression favours caspase- dependent cleavage of TDP-43, leading to the accumulation of TDP-43 fragments (Zhang et al., 2007).
Neuronal injury has also been linked to the activation of acid-sensing ion channels (ASICs). ASICs are proton-gated cation channels found in peripheral and CNS neurons (Waldmann et al., 1997). The most common CNS subtype, ASIC1a, is permeable to both sodium (Na+) and Ca2+ ions and has been implicated in a number of physiological processes including synaptic plasticity, fear conditioning and learning and memory (Wemmie et al., 2002; 2003; 2004). The channels have also been linked to neuronal cell death during ischemic events and it has been suggested that Ca2+ influx through these channels is the key mechanism leading to neurodegeneration (Gao et al., 2005; Pignataro et al., 2007; Xiong et al., 2004). In their study Herrera et al. (2008) demonstrated that activation of sigma- 1R by DTG, (+)-PTZ, CBP and DEX depressed membrane currents and Ca2+ elevations mediated by ASIC1a in cortical neurons, suggesting that sigma-1R may play a neuroprotective role. They also showed that the increase in Ca2+ evoked by acid-induced ASIC1a activation is primarily the result of multiple ion channels downstream of ASIC1a activation, including the NMDA and AMPA/kinate receptors and voltage gated calcium channels (VGCC). Consistent with previous reports, Herrera et al. (2008) demonstrated the direct inhibitory effects of sigma-1R agonists on these channels. They concluded that sigma-1R plays an important role in neuronal protection, by not only mediating its effects on Ca2+ influx via ASIC1a, but also by blunting acidosis-evoked ionic fluxes and Ca2+ increases directly.
172 Many fundamental processes such as membrane excitability, neurotransmitter release, gene expression, neuronal growth and differentiation as well as apoptosis depend on Ca2+ homeostasis. Any significant disturbances in the system are therefore detrimental to the cells and lead to cell death.
Perturbed Ca2+ homeostasis has been studied extensively in neurodegenerative disorders such as AD, MND, HD and PD and is likely to contribute to these neurodegenerative processes. For example, NFT-bearing neurons derived from AD brain tissue display greater activity of Ca2+-dependent proteases and contain more free and protein-bound Ca2+ relative to tangle-free neurons (Murray et al., 1992; Nixon, 2003). Alterations in [Ca2+]i also induce changes in the cytoskeleton similar to those seen in NFTs (Mattson, 1990; Stein-Behrens et al., 1994). Tau mutations that cause FTLD have also been reported to disrupt Ca2+ homeostasis. For instance, overexpression of FTDP-17 MAPT mutations in cultured neural cells increases their vulnerability to apoptosis mediated by increased
[Ca2+]i (Furukawa et al., 2000). Other studies have shown that disruption of microtubules mediated by mutations in the MAPT gene lead to enhanced Ca2+ influx through VDCC. Significant increases in
Ca2+ content of motor neurons have also been documented in MND. Increased [Ca2+]i are thought to be mediated via AMPA and VGCC, and, coupled with inefficient buffering capacity are thought to result in toxic Ca2+ levels. Some evidence also implicates the ApoE4 isoform in dysregulation of Ca2+. Hartman et al. (1994) have shown that NMDA receptor-mediated Ca2+ influx and subsequent cytotoxicity can be induced by the application of low levels of ApoE4 to cultured neurons. Interestingly, in Aus-14 only those individuals that are homozygous for the E4 allele have MND. This could of course be purely incidental but it may also indicate that in individuals where Ca2+ overload is particularly high (ie. through sigma-1R overexpression and ApoE4 homozygosity) the age at onset of dementia is much earlier and the phenotype is modified from FTLD to MND. Individuals with AD caused by APP mutations for instance have a varied age at onset depending on their ApoE genotype (Sorbi et al., 1995).
Collectively, the evidence above demonstrates that Ca2+ dysregulation is an important component of different processes that ultimately lead to neurodegeneration. Sigma-1R is involved in a complex array of mechanisms associated with regulating intracellular Ca2+ concentration, including intracellular Ca2+ release via the IP3R and plasma membrane modulation of NMDA-R, AMPA, VGCC
173 and ASIC1a. It is therefore not unreasonable to suggest that the mutations identified in this study mediate their effects through these mechanisms and subsequently induce neuronal death by affecting Ca2+ homeostasis.
5.3.6 Potassium channel modulation by sigma-1R
Over the years, numerous studies have demonstrated that sigma-1R and its ligands control the electrical activity of various potassium channels including the delayed-rectifier potassium channel, type-A potassium channel and the Ca2+-dependent K+ channel (IBK) in a number of different cell types (Aydar et al., 2002; Kennedy and Henderson, 1990; Lupardus et al., 2000; Martina et al., 2007; Renaudo et al., 2004; Soriani et al., 1999a; Soriani et al., 1999b; Wilke et al., 1999; Zhang and Cuevas, 2005). However, unlike Ca2+ channels whose activation requires intermediate signalling molecules, sigma-1R ligands modulate potassium channels by a novel mechanism requiring close proximity between sigma-1R and channels within the plasma membrane. In 2002, Aydar et al. found that sigma-1R precipitates together with voltage-gated (Kv1.4) potassium channels and suggested that the sigma-1R acts as a ligand-regulated auxillary potassium channel subunit.
The notion that sigma-1R acts as a secondary subunit for the K+ ion channel is intriguing and may indeed apply to a number of target proteins involved in various cellular functions including TDP-43 and FUS. This may also explain the high molecular weight bands observed in the Western blots in this study supporting the hypothesis that under some circumstances sigma-1R receptor transduction is mediated by protein-protein interaction. Radioiodinated photoaffinity labels and mass spectroscopy could be employed to determine the types of proteins associated with sigma-1R in this study. The identification of these proteins would shed light on other potential mechanisms that may be involved in neurodegeneration.
5.3.7 Sigma-1R as a chaperone
The ER performs the synthesis, posttranslational modification, and proper folding of proteins. ER homeostasis is critical for proper protein function (Breckenridge et al., 2003; Paschen and Frandsen, 2001; Rao et al., 2004). Resident chaperones such as binding immunoglobulin protein (BiP), calnexin
174 and protein disulphide isomerase (PDI) serve to facilitate proper folding of proteins by preventing their aggregation, monitoring the processing of highly branched glycans and forming disulphide bonds to stabilise the folded protein (Ma and Hendershot, 2004). ER stresses such as perturbed Ca2+ homeostasis, expression of misfolded or mutant proteins, ischemic insults, nutrient or glucose reduction and cholesterol overload can lead to accumulation of unfolded or misfolded proteins which have the potential to cause cellular damage. The unfolded protein response (UPR) is a defence mechanism that employs three stress sensors (inositol requiring kinase 1 (IRE1), protein kinase-like ER kinase (PERK) and activating transcription factor 6 (ATF6)). They ultimately function to enhance the degradation of misfolded (mutant or unfolded) proteins, to upregulate the expression of specific proteins such as BiP required for chaperoning of misfolded or unfolded proteins and to attenuate the translation of other proteins to decrease the load within the ER (Friedlander et al., 2000; Ng et al., 2000). Under prolonged UPR where protein translation is significantly delayed and ER calcium is disrupted, genes and pathways leading to cell death and/or inhibition of survival are activated resulting in cell apoptosis (Breckenridge et al., 2003; Paschen and Frandsen, 2001; Rao et al., 2004).
In a recent report by Hayashi and Su (2007), sigma-1Rs were shown to function as mitochondrion- associated ER membrane (MAM) chaperones where they form a Ca2+-sensitive complex with the chaperone, BiP. Upon ER Ca2+ depletion, sigma-1Rs dissociate from BiP and stabilise IP3R by binding to it and preventing its aggregation and degradation suggesting its role as a chaperone. The authors further demonstrate sigma-1Rs chaperone activity by showing that sigma-1R expression can also suppress aggregations of secretory proteins like the low-density lipoprotein, insulin, and brain derived neurotrophic factor (BDNF). Furthermore, brief exposures of cells to stressors such as heat shock or glucose deprivation results in sigma-1R upregulation consistent with the activity of other chaperones. A possible mechanism for this upregulation is via the UPR system. BiP, which is also bound to the luminal domains of IRE1, ATF6 and PERK, dissociates from these proteins under ER stress and renders them active. An ATF6 domain migrates to the nucleus and promotes the transcription of ER-resident molecular chaperones and other assisting folding enzymes that may include sigma-1R (Kaufman et al., 2002; Yoshida et al., 2003). Similarly, activation of IRE1 also results in upregulation of genes essential for protein folding, maturation and degradation.
175 Overexpression of ER chaperones has been shown to suppress UPR (Schroder and Kaufman, 2005). Interestingly, Hayashi and Su (2007) demonstrated that overexpression of sigma-1R suppresses ER-stress-induced activation of ATF6 and PERK (involved in the UPR translational arrest), which may render cells more vulnerable to ER stress. However, as knocking down sigma-1R induces cell apoptosis, this suggests that sigma-1R functions to downregulate the overall deleterious effects of the UPR during prolonged ER stress rather than the early protective response. In our study we found that alterations in sigma-1R expression levels have significant effect on TDP-43 and FUS intracellular location, indicating that sigma may act as a TDP-43 and FUS chaperone. Alternatively, by downregulating UPR, sigma-1R may disrupt the normal chaperone response, which may also lead to TDP-43 and FUS aggregation and accumulation in the cytoplasm. The misfolded proteins in turn affect various cell signalling systems and mitigate the activation of the unbiquitin proteosome system either directly or by enhanced oxidative stress.
Mutant PSEN1 also suppresses the activation of UPR by binding and inhibiting IRE1 (Katayama et al., 1999). Attenuation of IRE1 levels was consistent with reduced BiP mRNA expression and resulted in increased vulnerability of cells to ER stress. Another study not only showed reduced induction of BiP, but also delayed translocation of ATF6 to the nucleus and reduced PERK and alpha subunit of eukaryotic translation initiation factor 2 (eIF2D (a down stream factor of PERK) phosphorylation after induced stress (Kudo et al., 2002). Consistent with these results, reduced levels of BiP were also reported in the brains of AD patients, further implicating early UPR dysregulation as a possible mechanism in neurodegeneration (Katayama et al., 1999). Indeed, failure of UPR has also been implicated in other neurodegenerative disorders such as MND, Creutzfeldt–Jakob disease, PD and HD (Lindholm et al., 2006). For instance, pre-symptomatic upregulation of BiP was reported in spinal motor neurons of certain SOD1 transgenic mice (Tobisawa et al., 2003). Numerous UPR elements including IRE1, PERK and ATF6 and their downstream targets were also activated in the spinal cord (Nagata et al., 2007). In sporadic PD, activation of PERK/eIF2D was also observed in dopaminergic neurons (Hoozemans et al., 2007). (for a detailed review see Matus et al., 2008). Therefore, UPR appears to be protective during early UPR responses but deleterious during prolonged response due to disturbance in ER homeostasis.
176 5.3.8 Therapeutic potential of sigma-1R ligands
Sigma-1Rs bind a wide spectrum of compounds with very heterogenous chemical structures including cocaine, (+)-benzomorphans such as (+)-PTZ and (+)-N-allyl-normetazocine and endogenous ligands such as progesterone and neuropeptide Y. Some compounds that bind sigma- 1Rs have already established therapeutic and pharmacological applications as neuroleptics (eg. haloperidol, nemopramide), antidepressants (eg. fluvoxamine, clorgyline), antitussives (CBP, DEX, dimemorphan) and drugs for treatment of neurodegenerative diseases such as PD (amantadine) or AD (memantine, donepezil) (Cobos et al., 2008). These findings, coupled with sigma-1Rs widespread distribution in the CNS and their modulatory role of many cellular functions have implicated this receptor as a plausible therapeutic target in a number of disorders including depression, AD and schizophrenia.
In this study we found a mutation in the SIGMAR1 gene in a family where the clinical spectrum includes AD and schizophrenia as well as FTLD and MND. There is currently no TGA-approved medication indicated for FTLD treatment, and Riluzole, the only drug approved for MND treatment, yields a mere 3-month increase in survival when taken for 18 months (Bensimon et al., 1994; Lacomblez et al., 1996). Approved AD treatments include ACh esterase inhibitors (eg, donepezil hydrochloride), which stabilise the neurotransmitter ACh in the synaptic cleft, and the NMDA-R antagonist, memantine, which counteracts the deleterious effects of high brain concentrations of the excitatory amino acid, glutamate. Beneficial effects have also been reported in AD clinical trials of dimebon, a drug that has been claimed to stabilise Ca2+ signalling by blocking NMDA-R and VGCC (Bachurin et al., 2001; Grigorev et al., 2003). Interestingly, sigma-1Rs are not only potent modulators of ACh release but have also been shown to alter NMDA-R and VGCC-function, making them perfect candidates as targets for AD therapy (van Waarde et al., 2010). Using a single sigma-1R ligand to modulate multiple targets simultaneously will not only improve the efficacy of the treatment but also reduce the therapeutic dose required to treat the patient.
Support for the use of sigma-1R ligands in AD therapy stems from animal models of amnesia. For instance, administration of sigma-1R agonists significantly attenuates memory impairments in a number of rat and mouse models with cholinergic deficits. (reviewed in Maurice and Su, 2009 and
177 van Waarde et al., 2010). Neurosteroids such as dehydroepiandrosterone sulphate (DHEA-S) and pregnenolone sulfate (PREG-S) also exert a potent modulation of the learning and memory process (Maurice et al., 1997; 1998; 2001; Meunier and Maurice, 2004; Zou et al., 2000). Using the spontaneous alternation test and place learning in water-maze, Urani et al. (1998) demonstrated that administration of sigma-1R agonists DHEA-S and PREG-S resulted in a dose-dependent attenuation of scopolamine-induced deficits in both tests. NMDA-Rs that are involved in the induction of different forms of synaptic plasticity have also been studied. Amnesia models induced by the blockade of NMDA-R have shown that dizocilpine-induced impairment of working memory can be reversed upon sigma-1R agonist administration (van Waarde et al., 2010). Finally, sigma-1R agonists also prevent learning impairments in non-transgenic models of AD induced in rats by infusion of the amyloid E1-40 protein or in mice by central injection with amyloid E25-35 peptide demonstrating that early intervention with sigma-1R ligands may be protective against AE-induced neuronal toxicity (Marrazzo et al., 2005; Maurice et al., 1998).
There is also speculation that sigma-1Rs may play a therapeutic role in schizophrenia. Sigma-1Rs are not only highly expressed in brain regions implicated in schizophrenia but also bind several antipsychotic agents such as haloperidol and rimcazole with high affinity. Clinical trials with the sigma-1R antagonist panamesine have shown positive antipsychotic effects (Frieboes et al., 1997; Huber et al., 1999; Muller et al., 1999). In addition, some sigma-1R antagonists with low affinity for dopamine receptors also show an antipsychotic profile in animal models (Ohmori et al., 2000) and drugs such as SKF10047 (a sigma agonist) have been shown to produce delirium in dogs, as well as delusions, hallucinations and depersonalisations in humans (Keats and Telford, 1964; Martin et al., 1976). Sigma-1R also modulates the NMDA-R and there is extensive support for the hypothesis that the hypofunction of NMDA-Rs is involved in schizophrenia (Goff and Coyle, 2001). Finally, studies have also found that sigma binding sites in the brain are significantly reduced in schizophrenic patients (Tam and Zhang, 1988; Weissman et al., 1988; 1991), suggesting that the receptor may play a role in the pathophysiology of schizophrenia and hence targeting the receptor may alleviate the symptoms.
Overall, these findings provide promising evidence that sigma-1R ligands may indeed prove to be valuable pharmacological tools in prevention and management of certain disorders.
178 5.3.9 Summary
The sigma-1R is a unique receptor widely expressed in many different tissues with the ability to modulate a myriad of cellular functions and the capacity to bind a wide array of natural and pharmacological compounds. The implications of identifying mutations in the SIGMAR1 gene in FTLD-MND families are enormous both with respect to the therapeutic potential and also in terms of providing novel insights into possible neurodegenerative pathways that may be applicable to sporadic cases. Clarification of which molecular mechanisms relate to neurodegenerative processes will aid significantly in diagnosis and early therapeutic intervention for the many people that would otherwise succumb to this severe and devastating disease.
5.4 Future studies
5.4.1 Chromosome 15 – family Aus-12
The major objective of future research associated with family Aus-12 is the identification of the responsible gene. The findings in this thesis suggest a putative novel FTLD-MND locus located on chromosome 15q21.3-q23. The disease locus spans a relatively large 18Mb region and contains approximately 90 known genes. Recruitment of further cases or ascertainment of affected status in existing pedigree members, would ideally confirm the locus and through fine mapping and haplotype analysis would allow further narrowing of the disease region. Identification of other families with the same clinical and neuropathological features would also be valuable in establishing chromosome 15 as an FTLD-MND locus. It is worth noting that some potential families with linkage to chromosome 15 have been reported (Hentati et al., 1998).
The 15q21.3-q23 locus harbours two genes that are of particular interest. The first of these is anterior-pharynx-defective-1 subtype B (APH1B). APH1 is a multipass transmembrane protein that interacts with presenilin and nicastrin as a functional component of the J-secretase complex. The J- secretase complex is required for the intramembrane proteolysis of a number of membrane proteins, including APP, implicated in AD. The other gene that maps to this region is A Disintegrin And Metallopeptidase 10 (ADAM10) which belongs to a family of cell surface proteins possessing potential adhesion and protease function. ADAM10 has D-secretase activity that mediates the effect
179 of cholesterol on APP metabolism. While both genes are associated with APP processing, substantial tau and sometimes TDP-43 deposition is also found in AD suggesting that these genes may also be involved in cellular processes associated with their function and therefore are suitable candidates for investigation in relation to family Aus-12. Another gene of interest is the neuronal ceroid lipofuscinoses 6 (NCL6). NCL6 belongs to a class of genes that encode for proteins involved in degradation of post-translationally modified proteins in lysosomes and are associated with a class of autosomal recessive neurodegenerative disorders affecting children. Other known genes mapping within the candidate region include genes involved in protein transport, NMDA receptor regulation, heat shock protein binding, neuronal cell adhesion and apoptosis.
Initially, sequencing of the genes including intronic and untranslated regions should be employed to identify potential mutations including single base alterations, micro-deletions and insertions. For investigation of large-scale chromosomal deletions, insertions or rearrangements, high resolution cytogenetics or gene chip arrays could be used. Quantitative real-time PCR analysis for detection of copy number variations could also be utilised. Failure to identify mutations in these genes will require other genes to be prioritised for mutation screening based on their expression in the brain and spinal cord as well as their relative function.
Once a nucleotide variation that segregates with the disease phenotype is identified, a large control cohort of unaffected individuals will need to be screened to establish that the mutation is not a rare polymorphism. Depending on where the mutation is identified, further investigations to determine how the mutation leads to altered gene function will be carried out. Eliciting the effects of the mutation on gene splicing, expression, RNA stability and protein folding would help to clarify the role of the disease gene. Biological investigations to validate the functional role of the specific nucleotide variant in the development and pathological process of FTLD-MND can initially employ cellular models. Overexpressing the gene of interest in cell culture lines or reducing the expression by using antisense techniques can examine cellular processes pertinent to tau and TDP-43 accumulation. Ultimately, transgenic animal models will be important in demonstrating how altered gene function may be related to tau and TDP-43 deposition as well as the clinical and neuropathological presentations seen in family Aus-12.
180 It is also important to establish the role of this gene in other neurodegenerative diseases. Therefore, a mutation screen should be carried out in a series of dementia cohorts including those containing other ethnic groups. Identification of novel mutations in other types of dementia will help to clarify the function of this gene. Furthermore, the gene should also be re-sequenced in a number of affected and control individuals to identify common variants. Using the identified polymorphisms, large-scale case-control studies can be carried out to determine if certain common polymorphisms in the gene increase disease risk.
Finally, the variability in age at onset and clinical presentation suggests that multiple genes may play an important role in the disease. Indeed, a recent study by Gijselinck et al. (2010), describes an FTLD-MND family with significant linkage to chromosome 9 and nearly significant linkage to chromosome 14. The authors suggest that the FTLD-MND phenotype may result from a digenic effect whereby mutations in two separate genes must be present in order for the disease to be expressed. Alternatively, a mutation in a gene in one locus has a modifying effect on the disease causing mutation at the other locus. Given the vast array of clinical presentations in family Aus-12, it is quite probable that multiple disease-modifying genes are involved. Therefore, once significant linkage can be established in family Aus-12, other positive loci should also be explored for additional disease genes.
Finding the genes responsible would have substantial effect on the understanding of the aetiology of tau and TDP-43 deposition, not only in this family but also for other neurodegenerative diseases, particularly those that lack TDP-43 and MAPT mutations.
5.4.2 Sigma-1R
The identification of mutations in the SIGMAR1 gene in multiple families with a broad clinical spectrum of FTLD and MND has opened up many avenues for future investigations looking into aspects of genetics, pathophysiology and sigma-1R pharmacology in relation to dementia. Cell culture experiments carried out in this study have already demonstrated that sigma-1R plays a significant role in regulating the intracellular location of TDP-43 and FUS proteins. Elucidating the mechanisms underlying this process will give us a greater insight into the pathways that ultimately
181 lead to neurodegeneration. Sigma-1R has been implicated in a number of different cellular processes including lipid regulation, calcium homeostasis, potassium channel regulation, neuroprotection and as a chaperone, highlighting potential avenues for cellular disruption and subsequent FUS and TDP-43 deposition. Therefore, throughout this chapter a range of experiments have been proposed, within the context of these cellular processes that will hopefully help to clarify the role of sigma-1Rs not only in FUS and TDP-43 deposition, but also in other neurodegenerative pathways.
5.4.2.1 Animal models
In order to confirm the functional relevance of sigma-1R dysregulation in the pathophysiology of dementia, a transgenic mouse model overexpressing sigma-1R will need to be established. Characterisation of behavioural and motor function will allow us to determine whether sigma-1R overexpression can induce changes consistent with other dementia models. Furthermore, given that all members in Aus-14 with MND are homozygous for the ApoE4 allele it would also be of interest to create a double knock-in mouse (ie. Sigma-1R and ApoE4) and see if introduction of the ApoE4 allele can modify the phenotype. Alternatively, sigma-1R overexpressing mice could be fed a high fat diet to determine if environmental factors such as high cholesterol can elicit any changes. Cholesterol- induced toxicity coupled with an abnormally functioning sigma-1R could also result in premature neuronal death and subsequently result in an earlier age of onset or faster disease progression which should also be investigated.
Mouse brains and spinal cords will also need to be analysed for age-related neuropathological changes including TDP-43 and FUS translocation, plaque deposition and neuronal loss. The identification of TDP-43 and FUS pathology especially, will not only reinforce sigma-1Rs role in neurodegeneration in Aus-14 but will also have important implications for other diseases that result in TDP-43, FUS or AE deposition. On the other hand, neuronal loss in the absence of pathology may also allow us to elucidate the yet-to-be determined significance of TDP-43 and FUS deposition in the neurodegenerative process.
Once it is established that overexpression of sigma-1Rs plays a role in the neurodegeneration, drug trials with sigma-1R antagonists in these mouse models will allow us to determine if early
182 pharmacological intervention can modify sigma-1R expression and in turn prevent the onset of dementia.
In order to gain further insight into the therapeutic potential of sigma-1R ligands in other neurodegenerative disorders, existing AD and MND mouse models could also be employed to determine if sigma-1R ligand treatment can prevent or delay neurodegeneration. The role of sigma- 1R ligands in AD therapy could be investigated in the J20 mouse which is transgenic for human APP. The K670N/M671L and V717F mutations result in amyloid plaque deposition and memory impairment. As many physiological functions regulated by sigma-1R can induce abnormal APP processing it would be of interest to see if modifying sigma-1R function with ligands can prevent AE deposition and memory impairment. Similarly, it would be of interest to see if sigma-1R ligands can inhibit TDP-43 or FUS cytoplasmic deposition and prevent motor neuron loss in mouse models of MND.
5.4.2.2 Clinical trials
Many sigma-1R agonists and antagonists are already routinely used in therapeutics. Often, medications are shown to be effective against diseases different from those for which they are prescribed in clinical practice, which raises the possibility for new applications of existing sigma-1R drugs for the treatment of FTLD-MND. In fact, multiple selective serotonin reuptake inhibitors (SSRIs) including fluvoxamine, indicated for management of depression have already been demonstrated to have some efficacy in controlling behavioural disturbances and stereotypical movements of FTLD (Ikeda et al., 2004). A recent meta analysis suggested that the use of serotonergic drugs in FTLD is associated with a mean reduction of 15.4 points on the Neuropsychiatric Inventory (NPI). The NPI is used to assess 10 behavioural disturbances occurring in dementia patients including delusions, hallucinations, dysphoria, anxiety, agitation/aggression, euphoria, disinhibition, irritability/lability, apathy, and aberrant motor activity (Huey et al., 2006). The positive results in FTLD trials are thought to be mediated through selective serotonin reuptake inhibition. However, given that fluvoxamine is also a potent sigma-1Rs agonist, activity of sigma-1R is also likely to play a significant role. Indeed, other SSRIs such as sertraline and escitalopram, which also act as sigma-1R agonists, display enhanced antidepressant efficacy (Narita et al., 1996). Since sigma-1R agonists have also shown
183 promising results in animal models of amnesia, such SSRIs may therefore have particular benefits in the treatment of depressed patients with memory impairment.
Interestingly, sigma-1R can also mediate considerable antidepressant effects independent of serotonin reuptake inhibition through opipramol, a tricyclic antidepressant that has no effect on the serotonin, dopamine, or norepinephrine systems (Muller et al., 2004). A sigma-1R agonist like opipramol could be trialled in families where sigma-1R levels are low. Stimulating sigma-1R with opipramol may perhaps help restore cellular homeostasis, improve neuronal function and in turn stop clinical progression of symptoms. (+)-PTZ is also a potent sigma-1R agonist currently used for pain relief. Side-effects of (+)-PTZ include hallucinations consistent with sigma-1R overstimulation. Therefore, keeping in mind sigma-1Rs bell-shaped response to its ligands where inappropriate dosing can lead to an undesired effect, a low dose (+)-PTZ could be trialled in some FTLD patients and may prove to be beneficial.
Large-scale clinical control trials are currently underway investigating the role of memantine in the management of FTLD, following reports of behaviour improvement in some patients (Swanberg, 2007). Memantine is a low-affinity voltage-dependent uncompetitive antagonist at glutamatergic NMDA receptors currently used in the management of AD (Reisberg et al., 2003). However, memantine is also a sigma-1R agonist. Previous studies have shown that certain concentrations of sigma-1R agonists can potentiate NMDA-R activity and therefore may counteract the direct inhibitory effect of memantine on the NMDA-R. In fact, sigma-1R activity may predominate and therefore worsen the symptoms particularly in cases where sigma-1R is already overexpressed. This may explain why some trials resulted in mixed results (Boxer et al., 2009).
In this thesis we have demonstrated that one of the consequences of sigma-1R overexpression is TDP-43 and FUS translocation from the nucleus into the cytoplasm. We have also shown that sigma- 1R antagonists like haloperidol can reverse this effect. Theoretically, by reducing the cytoplasmic protein load and hence preventing subsequent neuronal death, FTLD progression may be able to be significantly slowed. Therefore, it would be interesting to examine the therapeutic potential of haloperidol initially in Aus-14 followed by a clinical trial of cases where abnormal TDP-43 and/or FUS translocation is suspected. Haloperidol is already an approved drug currently used in management of
184 schizophrenia and therefore can be easily translated into a clinical trial. As there is currently no proven therapy for FTLD, a double-blind placebo controlled trial can be applied. Initially, only patients that reach FTLD diagnostic criteria and have a high index of suspicion for TDP-43 and/or FUS abnormalities based on autopsy-proven family members would be included. A collaborative, multicentre approach would need to be established to recruit a minimum of 25 patients per group. Each group would be given either haloperidol or placebo for a period of 26 weeks during which several outcome measures would be assessed at regular intervals. Of primary interest would be haloperidol’s ability to effectively slow down the rate of behavioural and cognitive decline in FTLD. Secondly, it would also be of interest to see if haloperidol can delay or decrease the emergence of MND in FTLD patients. If successful the trial could also be extended to MND cases and later to other forms of dementia.
Successful application of sigma-1R ligands in the management of FTLD-MND could form the foundation for a new era in treatment of neurodegenerative diseases especially as sigma-1Rs are involved in many cellular processes already demonstrated to play a role in neurodegeneration.
185 5.5 Concluding remarks
Frontotemporal dementia represents approximately 5% of all dementia patients and is therefore an important neurodegenerative disease. The research presented in this thesis makes significant contributions towards enhancing our understanding of the growing spectrum of clinical, pathological and genetic aspects of FTLD. Characterisation of two multigenerational FTLD-MND families has expanded the FTLD clinical phenotype to include AD, dystonia, schizophrenia and Paget’s disease. Pathological and genetic evaluation of family Aus-12 has identified concomitant TDP-43 and tau deposition with a novel susceptibility locus on chromosome 15q21.3-q23. A genome-wide linkage scan of Aus-14 identified a locus on chromosome 9 which subsequently led to the identification of the SIGMAR1 gene. Mutation screening and functional analysis of sigma-1R verified its pathogenic role and demonstrated its potential as a therapeutic target in the management of FTLD-MND. Overall, this research has not only improved our understanding of the pathogenesis of FTLD-MND but will also hopefully lead to improved diagnosis, treatment and prevention of this debilitating disease.
186 References
187
References
Aarsland D, Ballard CG, Halliday G. Are Parkinson's disease with dementia and dementia with Lewy bodies the same entity? J Geriatr Psychiatry Neurol 2004; 17: 137-45.
Agamanolis DP. Degenerative Diseases. Chapter nine. In: Neuropathology An illustrated interactive course for medical students and residents. Northeastern Ohio Universities College of Medicine. Akron Children's Hospital. Accessed 15 March, 2010
Allen JA, Halverson-Tamboli RA, Rasenick MM. Lipid raft microdomains and neurotransmitter signalling. Nat Rev Neurosci 2007; 8: 128-40.
Alonso G, Phan V, Guillemain I, Saunier M, Legrand A, Anoal M, et al. Immunocytochemical localization of the sigma(1) receptor in the adult rat central nervous system. Neuroscience 2000; 97: 155-70.
Alzheimer A. Über eine eigenartige Erkrankung der Hirnrinde. Allgemeine Zeitschrift für Psychiatrie und Psychisch-Gerichtliche Medizin 1907; 64: 146-148.
Alzheimer's Australia, Dementia Facts and Statistics (2008). Accessed 20 January, 2010 < http://www.alzheimers.org.au/upload/StatisticsMar08.pdf>
Amador-Ortiz C, Lin WL, Ahmed Z, Personett D, Davies P, Duara R, et al. TDP-43 immunoreactivity in hippocampal sclerosis and Alzheimer's disease. Ann Neurol 2007; 61: 435-45.
Ariga T, McDonald MP, Yu RK. Role of ganglioside metabolism in the pathogenesis of Alzheimer's disease--a review. J Lipid Res 2008; 49: 1157-75.
Axelsson R, Wahlstrom J. Mental disorder and inversion on chromosome 9. Hereditas 1981; 95: 337.
Axelsson R, Wahlstrom J. Chromosome aberrations in patients with paranoid psychosis. Hereditas 1984; 100: 29-31.
Aydar E, Palmer CP, Klyachko VA, Jackson MB. The sigma receptor as a ligand-regulated auxiliary potassium channel subunit. Neuron 2002; 34: 399-410.
Bachurin S, Bukatina E, Lermontova N, Tkachenko S, Afanasiev A, Grigoriev V, et al. Antihistamine agent Dimebon as a novel neuroprotector and a cognition enhancer. Ann N Y Acad Sci 2001; 939: 425-35.
Bak TH. Overlap syndromes. In: Hodges JR, editor. Frontotemporal Dementia Syndromes (1st ed). Cambridge University Press; 2007: 80–101.
Baker M, Kwok JB, Kucera S, Crook R, Farrer M, Houlden H, et al. Localization of frontotemporal dementia with parkinsonism in an Australian kindred to chromosome 17q21-22. Ann Neurol 1997; 42: 794-8. 188
Baker M, Mackenzie IR, Pickering-Brown SM, Gass J, Rademakers R, Lindholm C, et al. Mutations in progranulin cause tau-negative frontotemporal dementia linked to chromosome 17. Nature 2006; 442: 916-9.
Bales KR, Dodart JC, DeMattos RB, Holtzman DM, Paul SM. Apolipoprotein E, amyloid, and Alzheimer disease. Mol Interv 2002; 2: 363-75, 339.
Beck J, Rohrer JD, Campbell T, Isaacs A, Morrison KE, Goodall EF, et al. A distinct clinical, neuropsychological and radiological phenotype is associated with progranulin gene mutations in a large UK series. Brain 2008; 131: 706-20.
Beck M, Sendtner M, Toyka KV. Novel SOD1 N86K mutation is associated with a severe phenotype in familial ALS. Muscle Nerve 2007; 36: 111-4.
Beffert U, Danik M, Krzywkowski P, Ramassamy C, Berrada F, Poirier J. The neurobiology of apolipoproteins and their receptors in the CNS and Alzheimer's disease. Brain Res Brain Res Rev 1998; 27: 119-42.
Bensimon G, Lacomblez L, Meininger V. A controlled trial of riluzole in amyotrophic lateral sclerosis. ALS/Riluzole Study Group. N Engl J Med 1994; 330: 585-91.
Benussi L, Binetti G, Sina E, Gigola L, Bettecken T, Meitinger T, et al. A novel deletion in progranulin gene is associated with FTDP-17 and CBS. Neurobiol Aging 2008; 29: 427-35.
Binder LI. Tau-Related Neurodegenerative Diseases: Corticobasal degeneration. Department of Cell & Molecular Biology. Northwestern University Medical School. Accessed 20 May, 2010a
Binder LI. Tau-Related Neurodegenerative Diseases: Progressive Supranuclear Palsy. Department of Cell & Molecular Biology. Northwestern University Medical School. Accessed 20 May, 2010b
Bliss TV, Collingridge GL. A synaptic model of memory: long-term potentiation in the hippocampus. Nature 1993; 361: 31-9.
Boeve BF. Links between frontotemporal lobar degeneration, corticobasal degeneration, progressive supranuclear palsy, and amyotrophic lateral sclerosis. Alzheimer Dis Assoc Disord 2007; 21: S31-8.
Booth RG, Wyrick SD, Baldessarini RJ, Kula NS, Myers AM, Mailman RB. New sigma-like receptor recognized by novel phenylaminotetralins: ligand binding and functional studies. Mol Pharmacol 1993; 44: 1232-9.
Bose JK, Wang IF, Hung L, Tarn WY, Shen CK. TDP-43 overexpression enhances exon 7 inclusion during the survival of motor neuron pre-mRNA splicing. J Biol Chem 2008; 283: 28852-9.
189 Bouchard P, Dumont Y, Fournier A, St-Pierre S, Quirion R. Evidence for in vivo interactions between neuropeptide Y-related peptides and sigma receptors in the mouse hippocampal formation. J Neurosci 1993; 13: 3926-31.
Bouchard P, Quirion R. [3H]1,3-di(2-tolyl)guanidine and [3H](+)pentazocine binding sites in the rat brain: autoradiographic visualization of the putative sigma1 and sigma2 receptor subtypes. Neuroscience 1997; 76: 467-77.
Bowen WD, Vilner BJ, Lee KS, He XS, de Costa B, Weinberger DR. A haloperidol-insensitive binding site for sigma-active aryl ethylene diamine-related compounds: a novel sigma receptor subtype? Soc Neurosci Abstr 1995; 21.
Boxer AL, Lipton AM, Womack K, Merrilees J, Neuhaus J, Pavlic D, et al. An open-label study of memantine treatment in 3 subtypes of frontotemporal lobar degeneration. Alzheimer Dis Assoc Disord 2009; 23: 211-7.
Boxer AL, Mackenzie IR, Boeve BF, Baker M, Seeley WW, Crook R, et al. Clinical, neuroimaging and neuropathological features of a new chromosome 9p-linked FTD-ALS family. J Neurol Neurosurg Psychiatry 2010 [PMID: 20562461].
Boxer AL, Miller BL. Clinical features of frontotemporal dementia. Alzheimer Dis Assoc Disord 2005; 19 Suppl 1: S3-6.
Braak H, Braak E. Argyrophilic grains: characteristic pathology of cerebral cortex in cases of adult onset dementia without Alzheimer changes. Neurosci Lett 1987; 76: 124-7.
Braak H, Braak E. Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol 1991; 82: 239-59.
Braak H, Braak E. Argyrophilic grain disease: frequency of occurrence in different age categories and neuropathological diagnostic criteria. J Neural Transm 1998; 105: 801-19.
Brandmeir NJ, Geser F, Kwong LK, Zimmerman E, Qian J, Lee VM, et al. Severe subcortical TDP-43 pathology in sporadic frontotemporal lobar degeneration with motor neuron disease. Acta Neuropathol 2008; 115: 123-31.
Breckenridge DG, Germain M, Mathai JP, Nguyen M, Shore GC. Regulation of apoptosis by endoplasmic reticulum pathways. Oncogene 2003; 22: 8608-18.
Brouwers N, Nuytemans K, van der Zee J, Gijselinck I, Engelborghs S, Theuns J, et al. Alzheimer and Parkinson diagnoses in progranulin null mutation carriers in an extended founder family. Arch Neurol 2007; 64: 1436-46.
Brouwers N, Sleegers K, Van Broeckhoven C. Molecular genetics of Alzheimer's disease: an update. Ann Med 2008; 40: 562-83.
190 Brown J, Ashworth A, Gydesen S, Sorensen A, Rossor M, Hardy J, et al. Familial non-specific dementia maps to chromosome 3. Hum Mol Genet 1995; 4: 1625-8.
Bruses JL, Chauvet N, Rutishauser U. Membrane lipid rafts are necessary for the maintenance of the (alpha)7 nicotinic acetylcholine receptor in somatic spines of ciliary neurons. J Neurosci 2001; 21: 504-12.
Buee L, Delacourte A. Comparative biochemistry of tau in progressive supranuclear palsy, corticobasal degeneration, FTDP-17 and Pick's disease. Brain Pathol 1999; 9: 681-93.
Buratti E, Baralle FE. Characterization and functional implications of the RNA binding properties of nuclear factor TDP-43, a novel splicing regulator of CFTR exon 9. J Biol Chem 2001; 276: 36337-43.
Buratti E, Dork T, Zuccato E, Pagani F, Romano M, Baralle FE. Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo CFTR exon 9 skipping. Embo J 2001; 20: 1774-84.
Cairns NJ, Bigio EH, Mackenzie IR, Neumann M, Lee VM, Hatanpaa KJ, et al. Neuropathologic diagnostic and nosologic criteria for frontotemporal lobar degeneration: consensus of the Consortium for Frontotemporal Lobar Degeneration. Acta Neuropathol 2007a; 114: 5-22.
Cairns NJ, Lee VM, Trojanowski JQ. The cytoskeleton in neurodegenerative diseases. J Pathol 2004a; 204: 438-49.
Cairns NJ, Neumann M, Bigio EH, Holm IE, Troost D, Hatanpaa KJ, et al. TDP-43 in familial and sporadic frontotemporal lobar degeneration with ubiquitin inclusions. Am J Pathol 2007b; 171: 227-40.
Cairns NJ, Zhukareva V, Uryu K, Zhang B, Bigio E, Mackenzie IR, et al. alpha-internexin is present in the pathological inclusions of neuronal intermediate filament inclusion disease. Am J Pathol 2004b; 164: 2153-61.
Case records of the Massachusetts General Hospital. Weekly clinicopathological exercises. Case 11- 2000. A 74-year-old man with memory loss, language impairment, and personality changes. N Engl J Med 2000; 342: 1110-7.
Cataldo AM, Peterhoff CM, Troncoso JC, Gomez-Isla T, Hyman BT, Nixon RA. Endocytic pathway abnormalities precede amyloid beta deposition in sporadic Alzheimer's disease and Down syndrome: differential effects of APOE genotype and presenilin mutations. Am J Pathol 2000; 157: 277-86.
Cedazo-Minguez A, Cowburn RF. Apolipoprotein E: a major piece in the Alzheimer's disease puzzle. J Cell Mol Med 2001; 5: 254-66.
Chaudhuri KR, Healy DG, Schapira AH. Non-motor symptoms of Parkinson's disease: diagnosis and management. Lancet Neurol 2006; 5: 235-45.
191 Chen YZ, Bennett CL, Huynh HM, Blair IP, Puls I, Irobi J, et al. DNA/RNA helicase gene mutations in a form of juvenile amyotrophic lateral sclerosis (ALS4). Am J Hum Genet 2004; 74: 1128-35.
Cheung KH, Shineman D, Muller M, Cardenas C, Mei L, Yang J, et al. Mechanism of Ca2+ disruption in Alzheimer's disease by presenilin regulation of InsP3 receptor channel gating. Neuron 2008; 58: 871-83.
CIGNA. Chromosome 9, Trisomy 9p (Multiple Variants). National Organization for Rare Disorders, Inc. 2008. Accessed 22 March, 2010
Clapham DE. Calcium signaling. Cell 1995; 80: 259-68.
Clark AW, Manz HJ, White CL, 3rd, Lehmann J, Miller D, Coyle JT. Cortical degeneration with swollen chromatolytic neurons: its relationship to Pick's disease. J Neuropathol Exp Neurol 1986; 45: 268-84.
Cobos EJ, Entrena JM, Nieto FR, Cendan CM, Del Pozo E. Pharmacology and therapeutic potential of sigma(1) receptor ligands. Curr Neuropharmacol 2008; 6: 344-66.
Cruts M, Gijselinck I, van der Zee J, Engelborghs S, Wils H, Pirici D, et al. Null mutations in progranulin cause ubiquitin-positive frontotemporal dementia linked to chromosome 17q21. Nature 2006; 442: 920-4.
Cudkowicz ME, McKenna-Yasek D, Sapp PE, Chin W, Geller B, Hayden DL, et al. Epidemiology of mutations in superoxide dismutase in amyotrophic lateral sclerosis. Ann Neurol 1997; 41: 210-21.
Cummings JL. The dementias of Parkinson's disease: prevalence, characteristics, neurobiology, and comparison with dementia of the Alzheimer type. Eur Neurol 1988; 28 Suppl 1: 15-23.
Cummings JL, Litvan I. Neuropsychiatric aspects of corticobasal degeneration. Adv Neurol 2000; 82: 147-52.
Daniel R, He Z, Carmichael KP, Halper J, Bateman A. Cellular localization of gene expression for progranulin. J Histochem Cytochem 2000; 48: 999-1009.
Davidson Y, Kelley T, Mackenzie IR, Pickering-Brown S, Du Plessis D, Neary D, et al. Ubiquitinated pathological lesions in frontotemporal lobar degeneration contain the TAR DNA-binding protein, TDP-43. Acta Neuropathol 2007; 113: 521-33.
Davies RR, Xuereb JH. The histopathology of frontotemporal dementia. In: Hodges JR, editor. Frontotemporal Dementia Syndromes (1st ed). Cambridge University Press; 2007: 161-207.
Davis DG, Ross GW, Petrovitch H, White LR, Harriman JM, Nelson JS, et al. Quantitation of Argyrophilic Grains in Hippocampal Ca-1 of Aged Japanese-American Men. Journal of Neuropathology & Experimental Neurology 1997; 56: 587.
192 de Lau LM, Breteler MM. Epidemiology of Parkinson's disease. Lancet Neurol 2006; 5: 525-35.
DeCoster MA, Koenig ML, Hunter JC, Tortella FC. Calcium dynamics in neurons treated with toxic and non-toxic concentrations of glutamate. Neuroreport 1992; 3: 773-6.
Deng HX, Hentati A, Tainer JA, Iqbal Z, Cayabyab A, Hung WY, et al. Amyotrophic lateral sclerosis and structural defects in Cu,Zn superoxide dismutase. Science 1993; 261:1047-51.
Deng HX, Zhai H, Bigio EH, Yan J, Fecto F, Ajroud K, et al. FUS-immunoreactive inclusions are a common feature in sporadic and non-SOD1 familial amyotrophic lateral sclerosis. Ann Neurol 2010; 67: 739-48.
Dickson DW. Neuropathology of Pick's disease. Neurology 2001; 56: S16-20.
Dickson DW, Braak H, Duda JE, Duyckaerts C, Gasser T, Halliday GM, et al. Neuropathological assessment of Parkinson's disease: refining the diagnostic criteria. Lancet Neurol 2009; 8: 1150-57.
Dietschy JM, Turley SD. Cholesterol metabolism in the brain. Curr Opin Lipidol 2001; 12: 105-12.
Doi H, Okamura K, Bauer PO, Furukawa Y, Shimizu H, Kurosawa M, et al. RNA-binding protein TLS is a major nuclear aggregate-interacting protein in huntingtin exon 1 with expanded polyglutamine-expressing cells. J Biol Chem 2008; 283: 6489-500.
Donkervoort S, Siddique T. Amyotrophic Lateral Sclerosis Overview. In: Pagon RA, Bird TC, Dolan CR, Stephens K, editors. GeneReviews [Internet]. Seattle (WA): University of Washington, Seattle; 1993.
Duyckaerts C, Delatour B, Potier MC. Classification and basic pathology of Alzheimer disease. Acta Neuropathol. 2009;118:5-36.
Ela C, Barg J, Vogel Z, Hasin Y, Eilam Y. Sigma receptor ligands modulate contractility, Ca++ influx and beating rate in cultured cardiac myocytes. J Pharmacol Exp Ther 1994; 269: 1300-9.
Esch FS, Keim PS, Beattie EC, Blacher RW, Culwell AR, Oltersdorf T, et al. Cleavage of amyloid beta peptide during constitutive processing of its precursor. Science 1990; 248: 1122-4.
Faghihi MA, Modarresi F, Khalil AM, Wood DE, Sahagan BG, Morgan TE, et al. Expression of a noncoding RNA is elevated in Alzheimer's disease and drives rapid feed-forward regulation of beta-secretase. Nat Med 2008; 14: 723-30.
Fasana E, Fossati M, Ruggiano A, Brambillasca S, Hoogenraad CC, Navone F, et al. A VAPB mutant linked to amyotrophic lateral sclerosis generates a novel form of organized smooth endoplasmic reticulum. Faseb J 2010; 24: 1419-30.
193 Feany MB, Dickson DW. Widespread cytoskeletal pathology characterizes corticobasal degeneration. Am J Pathol 1995; 146: 1388-96.
Feany MB, Mattiace LA, Dickson DW. Neuropathologic overlap of progressive supranuclear palsy, Pick's disease and corticobasal degeneration. J Neuropathol Exp Neurol 1996; 55: 53-67. Feng J, Zhou Y, Campbell SL, Le T, Li E, Sweatt JD, et al. Dnmt1 and Dnmt3a maintain DNA methylation and regulate synaptic function in adult forebrain neurons. Nat Neurosci 2010; 13: 423-30.
Ferrer I, Santpere G, van Leeuwen FW. Argyrophilic grain disease. Brain 2008; 131: 1416-32.
Ferri CP, Prince M, Brayne C, Brodaty H, Fratiglioni L, Ganguli M, et al. Global prevalence of dementia: a Delphi consensus study. Lancet 2005; 366: 2112-7.
Forman MS, Mackenzie IR, Cairns NJ, Swanson E, Boyer PJ, Drachman DA, et al. Novel ubiquitin neuropathology in frontotemporal dementia with valosin-containing protein gene mutations. J Neuropathol Exp Neurol 2006; 65: 571-81.
Fortini ME. Gamma-secretase-mediated proteolysis in cell-surface-receptor signalling. Nat Rev Mol Cell Biol 2002; 3: 673-84.
Foster NL, Wilhelmsen K, Sima AA, Jones MZ, D'Amato CJ, Gilman S. Frontotemporal dementia and parkinsonism linked to chromosome 17: a consensus conference. Conference Participants. Ann Neurol 1997; 41: 706-15.
Freeman SH, Spires-Jones T, Hyman BT, Growdon JH, Frosch MP. TAR-DNA binding protein 43 in Pick disease. J Neuropathol Exp Neurol 2008; 67: 62-7.
Frieboes RM, Murck H, Wiedemann K, Holsboer F, Steiger A. Open clinical trial on the sigma ligand panamesine in patients with schizophrenia. Psychopharmacology (Berl) 1997; 132: 82-8.
Friedlander R, Jarosch E, Urban J, Volkwein C, Sommer T. A regulatory link between ER-associated protein degradation and the unfolded-protein response. Nat Cell Biol 2000; 2: 379-84.
Frosch MP, Anthony DC, De Girolami U. The Central Nervous System. In: Kumar V, Abbas AK, Fausto N, editors. Robbins and Cotran Pathologic Basis of Disease 2005: 1396-1397.
Fujishiro H, Uchikado H, Arai T, Hasegawa M, Akiyama H, Yokota O, et al. Accumulation of phosphorylated TDP-43 in brains of patients with argyrophilic grain disease. Acta Neuropathol 2009; 117: 151-8.
Furukawa K, D'Souza I, Crudder CH, Onodera H, Itoyama Y, Poorkaj P, et al. Pro-apoptotic effects of tau mutations in chromosome 17 frontotemporal dementia and parkinsonism. Neuroreport 2000; 11: 57-60.
194 Fuso A, Seminara L, Cavallaro RA, D'Anselmi F, Scarpa S. S-adenosylmethionine/homocysteine cycle alterations modify DNA methylation status with consequent deregulation of PS1 and BACE and beta-amyloid production. Mol Cell Neurosci 2005; 28: 195-204.
Gao J, Duan B, Wang DG, Deng XH, Zhang GY, Xu L, et al. Coupling between NMDA receptor and acid-sensing ion channel contributes to ischemic neuronal death. Neuron 2005; 48: 635-46.
Geser F, Winton MJ, Kwong LK, Xu Y, Xie SX, Igaz LM, et al. Pathological TDP-43 in parkinsonism- dementia complex and amyotrophic lateral sclerosis of Guam. Acta Neuropathol 2008; 115: 133-45.
Giannakopoulos P, Hof PR, Bouras C. Dementia lacking distinctive histopathology: clinicopathological evaluation of 32 cases. Acta Neuropathol 1995; 89: 346-55.
Giasson BI, Wilson CA, Trojanowski JQ, Y Lee VM. Tau and Alpha-Synuclein Dysfunction and Aberrant Aggregates Define Distinct Neurodegenerative Diseases. Center for Neurodegenrative Disease Research. Accessed June 20, 2010 < http://www.med.upenn.edu/cndr/TauSynuclein.shtml>
Gitcho MA, Baloh RH, Chakraverty S, Mayo K, Norton JB, Levitch D, et al. TDP-43 A315T mutation in familial motor neuron disease. Ann Neurol 2008; 63: 535-8.
Gitcho MA, Bigio EH, Mishra M, Johnson N, Weintraub S, Mesulam M, et al. TARDBP 3'-UTR variant in autopsy-confirmed frontotemporal lobar degeneration with TDP-43 proteinopathy. Acta Neuropathol 2009; 118: 633-45.
Goedert M, Jakes R, Crowther RA. Effects of frontotemporal dementia FTDP-17 mutations on heparin-induced assembly of tau filaments. FEBS Lett 1999; 450: 306-11.
Goedert M, Spillantini MG, Jakes R, Rutherford D, Crowther RA. Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer's disease. Neuron 1989; 3: 519-26.
Goff DC, Coyle JT. The emerging role of glutamate in the pathophysiology and treatment of schizophrenia. Am J Psychiatry 2001; 158: 1367-77.
Goldmann Gross R, Siderowf A, Hurtig HI. Cognitive impairment in Parkinson's disease and dementia with lewy bodies: a spectrum of disease. Neurosignals 2008; 16: 24-34.
Graham A, Davies R, Xuereb J, Halliday G, Kril J, Creasey H, et al. Pathologically proven frontotemporal dementia presenting with severe amnesia. Brain 2005; 128: 597-605.
Graham NL, Bak TH, Hodges JR. Corticobasal degeneration as a cognitive disorder. Mov Disord 2003; 18: 1224-32.
195 Greenway MJ, Andersen PM, Russ C, Ennis S, Cashman S, Donaghy C, et al. ANG mutations segregate with familial and 'sporadic' amyotrophic lateral sclerosis. Nat Genet 2006; 38: 411- 3.
Grigorev VV, Dranyi OA, Bachurin SO. Comparative study of action mechanisms of dimebon and memantine on AMPA- and NMDA-subtypes glutamate receptors in rat cerebral neurons. Bull Exp Biol Med 2003; 136: 474-7.
Gundlach AL, Largent BL, Snyder SH. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1- propyl)piperidine. J Neurosci 1986; 6: 1757-70.
Gustafson L. Frontal lobe degeneration of non-Alzheimer type. II. Clinical picture and differential diagnosis. Arch Gerontol Geriatr 1987; 6: 506-8.
Haass C, Selkoe DJ. Cellular processing of beta-amyloid precursor protein and the genesis of amyloid beta-peptide. Cell 1993; 75: 1039-42.
Hadano S, Hand CK, Osuga H, Yanagisawa Y, Otomo A, Devon RS, et al. A gene encoding a putative GTPase regulator is mutated in familial amyotrophic lateral sclerosis 2. Nat Genet 2001; 29: 166-73.
Hanner M, Moebius FF, Flandorfer A, Knaus HG, Striessnig J, Kempner E, et al. Purification, molecular cloning, and expression of the mammalian sigma1-binding site. Proc Natl Acad Sci U S A 1996; 93: 8072-7.
Hansen LA, Masliah E, Galasko D, Terry RD. Plaque-only Alzheimer disease is usually the lewy body variant, and vice versa. J Neuropathol Exp Neurol 1993; 52: 648-54.
Hartmann H, Eckert A, Muller WE. Apolipoprotein E and cholesterol affect neuronal calcium signalling: the possible relationship to beta-amyloid neurotoxicity. Biochem Biophys Res Commun 1994; 200: 1185-92.
Hasegawa M, Arai T, Akiyama H, Nonaka T, Mori H, Hashimoto T, et al. TDP-43 is deposited in the Guam parkinsonism-dementia complex brains. Brain 2007; 130: 1386-94.
Hatano T, Kubo S, Sato S, Hattori N. Pathogenesis of familial Parkinson's disease: new insights based on monogenic forms of Parkinson's disease. J Neurochem 2009; 111: 1075-93.
Hauw JJ, Daniel SE, Dickson D, Horoupian DS, Jellinger K, Lantos PL, et al. Preliminary NINDS neuropathologic criteria for Steele-Richardson-Olszewski syndrome (progressive supranuclear palsy). Neurology 1994; 44: 2015-9.
Hayashi S, Toyoshima Y, Hasegawa M, Umeda Y, Wakabayashi K, Tokiguchi S, et al. Late-onset frontotemporal dementia with a novel exon 1 (Arg5His) tau gene mutation. Ann Neurol 2002; 51: 525-30.
196 Hayashi T, Maurice T, Su TP. Ca(2+) signaling via sigma(1)-receptors: novel regulatory mechanism affecting intracellular Ca(2+) concentration. J Pharmacol Exp Ther 2000; 293: 788-98.
Hayashi T, Su T. The sigma receptor: evolution of the concept in neuropsychopharmacology. Curr Neuropharmacol 2005a; 3: 267-80.
Hayashi T, Su TP. Regulating ankyrin dynamics: Roles of sigma-1 receptors. Proc Natl Acad Sci U S A 2001; 98: 491-6.
Hayashi T, Su TP. Intracellular dynamics of sigma-1 receptors (sigma(1) binding sites) in NG108-15 cells. J Pharmacol Exp Ther 2003a; 306: 726-33.
Hayashi T, Su TP. Sigma-1 receptors (sigma(1) binding sites) form raft-like microdomains and target lipid droplets on the endoplasmic reticulum: roles in endoplasmic reticulum lipid compartmentalization and export. J Pharmacol Exp Ther 2003b; 306: 718-25. Hayashi T, Su TP. The potential role of sigma-1 receptors in lipid transport and lipid raft reconstitution in the brain: implication for drug abuse. Life Sci 2005b; 77: 1612-24.
Hayashi T, Su TP. Sigma-1 receptor chaperones at the ER-mitochondrion interface regulate Ca(2+) signaling and cell survival. Cell 2007; 131: 596-610.
He Z, Bateman A. Progranulin (granulin-epithelin precursor, PC-cell-derived growth factor, acrogranin) mediates tissue repair and tumorigenesis. J Mol Med 2003; 81: 600-12.
He Z, Ong CH, Halper J, Bateman A. Progranulin is a mediator of the wound response. Nat Med 2003; 9: 225-9.
Hebert SS, Horre K, Nicolai L, Papadopoulou AS, Mandemakers W, Silahtaroglu AN, et al. Loss of microRNA cluster miR-29a/b-1 in sporadic Alzheimer's disease correlates with increased BACE1/beta-secretase expression. Proc Natl Acad Sci U S A 2008; 105: 6415-20.
Hentati A, Ouahchi K, Pericak-Vance MA, Nijhawan D, Ahmad A, Yang Y, et al. Linkage of a commoner form of recessive amyotrophic lateral sclerosis to chromosome 15q15-q22 markers. Neurogenetics 1998; 2: 55-60.
Hering H, Lin CC, Sheng M. Lipid rafts in the maintenance of synapses, dendritic spines, and surface AMPA receptor stability. J Neurosci 2003; 23: 3262-71.
Herrera Y, Katnik C, Rodriguez JD, Hall AA, Willing A, Pennypacker KR, et al. sigma-1 receptor modulation of acid-sensing ion channel a (ASIC1a) and ASIC1a-induced Ca2+ influx in rat cortical neurons. J Pharmacol Exp Ther 2008; 327: 491-502.
Higashi S, Iseki E, Yamamoto R, Minegishi M, Hino H, Fujisawa K, et al. Concurrence of TDP-43, tau and alpha-synuclein pathology in brains of Alzheimer's disease and dementia with Lewy bodies. Brain Res 2007; 1184: 284-94.
197 Hodges JR, Patterson K, Oxbury S, Funnell E. Semantic dementia. Progressive fluent aphasia with temporal lobe atrophy. Brain 1992; 115 ( Pt 6): 1783-806.
Hooper NM. Detergent-insoluble glycosphingolipid/cholesterol-rich membrane domains, lipid rafts and caveolae (review). Mol Membr Biol 1999; 16: 145-56.
Hoozemans JJ, van Haastert ES, Eikelenboom P, de Vos RA, Rozemuller JM, Scheper W. Activation of the unfolded protein response in Parkinson's disease. Biochem Biophys Res Commun 2007; 354: 707-11.
Hort J, O'Brien JT, Gainotti G, Pirttila T, Popescu BO, Rektorova I, et al. EFNS guidelines for the diagnosis and management of Alzheimer's disease. Eur J Neurol 2010 [PMID: 20482600].
Hosler BA, Siddique T, Sapp PC, Sailor W, Huang MC, Hossain A, et al. Linkage of familial amyotrophic lateral sclerosis with frontotemporal dementia to chromosome 9q21-q22. Jama 2000; 284: 1664-9. Howland RH. Schizophrenia and amyotrophic lateral sclerosis. Compr Psychiatry 1990; 31: 327-36.
Huber MT, Gotthardt U, Schreiber W, Krieg JC. Efficacy and safety of the sigma receptor ligand EMD 57445 (panamesine) in patients with schizophrenia: an open clinical trial. Pharmacopsychiatry 1999; 32: 68-72.
Huey ED, Putnam KT, Grafman J. A systematic review of neurotransmitter deficits and treatments in frontotemporal dementia. Neurology 2006; 66: 17-22.
Hughes AJ, Daniel SE, Blankson S, Lees AJ. A clinicopathologic study of 100 cases of Parkinson's disease. Arch Neurol 1993; 50: 140-8.
Hutton M, Lendon CL, Rizzu P, Baker M, Froelich S, Houlden H, et al. Association of missense and 5'-splice-site mutations in tau with the inherited dementia FTDP-17. Nature 1998; 393: 702-5.
Hyman BT, Trojanowski JQ. Consensus recommendations for the postmortem diagnosis of Alzheimer disease from the National Institute on Aging and the Reagan Institute Working Group on diagnostic criteria for the neuropathological assessment of Alzheimer disease. J Neuropathol Exp Neurol 1997; 56: 1095-7.
Ikeda M, Shigenobu K, Fukuhara R, Hokoishi K, Maki N, Nebu A, et al. Efficacy of fluvoxamine as a treatment for behavioral symptoms in frontotemporal lobar degeneration patients. Dement Geriatr Cogn Disord 2004; 17: 117-21.
Inada T, Iijima Y, Uchida N, Maeda T, Iwashita S, Ozaki N, et al. No association found between the type 1 sigma receptor gene polymorphisms and methamphetamine abuse in the Japanese population: a collaborative study by the Japanese Genetics Initiative for Drug Abuse. Ann N Y Acad Sci 2004; 1025: 27-33.
Ingram EM, Spillantini MG. Tau gene mutations: dissecting the pathogenesis of FTDP-17. Trends Mol Med 2002; 8: 555-62.
198
Ishiguro H, Ohtsuki T, Toru M, Itokawa M, Aoki J, Shibuya H, et al. Association between polymorphisms in the type 1 sigma receptor gene and schizophrenia. Neurosci Lett 1998; 257: 45-8.
Janssen JC, Warrington EK, Morris HR, Lantos P, Brown J, Revesz T, et al. Clinical features of frontotemporal dementia due to the intronic tau 10(+16) mutation. Neurology 2002; 58: 1161- 8.
Jbilo O, Vidal H, Paul R, De Nys N, Bensaid M, Silve S, et al. Purification and characterization of the human SR 31747A-binding protein. A nuclear membrane protein related to yeast sterol isomerase. J Biol Chem 1997; 272: 27107-15.
Jellinger KA, Bancher C. Senile dementia with tangles (tangle predominant form of senile dementia). Brain Pathol 1998; 8: 367-76.
John CS, Bowen WD, Varma VM, McAfee JG, Moody TW. Sigma receptors are expressed in human non-small cell lung carcinoma. Life Sci 1995; 56: 2385-92.
Josephs KA. Frontotemporal dementia and related disorders: deciphering the enigma. Ann Neurol 2008; 64: 4-14.
Josephs KA, Ahmed Z, Katsuse O, Parisi JF, Boeve BF, Knopman DS, et al. Neuropathologic features of frontotemporal lobar degeneration with ubiquitin-positive inclusions with progranulin gene (PGRN) mutations. J Neuropathol Exp Neurol 2007; 66: 142-51.
Josephs KA, Holton JL, Rossor MN, Godbolt AK, Ozawa T, Strand K, et al. Frontotemporal lobar degeneration and ubiquitin immunohistochemistry. Neuropathol Appl Neurobiol 2004; 30: 369-73.
Josephs KA, Lin WL, Ahmed Z, Stroh DA, Graff-Radford NR, Dickson DW. Frontotemporal lobar degeneration with ubiquitin-positive, but TDP-43-negative inclusions. Acta Neuropathol 2008; 116: 159-67.
Kabashi E, Valdmanis PN, Dion P, Spiegelman D, McConkey BJ, Vande Velde C, et al. TARDBP mutations in individuals with sporadic and familial amyotrophic lateral sclerosis. Nat Genet 2008; 40: 572-4.
Kakizuka A. Roles of VCP in human neurodegenerative disorders. Biochem Soc Trans 2008; 36: 105-8.
Katayama T, Imaizumi K, Sato N, Miyoshi K, Kudo T, Hitomi J, et al. Presenilin-1 mutations downregulate the signalling pathway of the unfolded-protein response. Nat Cell Biol 1999; 1: 479-85.
Katzmann DJ, Odorizzi G, Emr SD. Receptor downregulation and multivesicular-body sorting. Nat Rev Mol Cell Biol 2002; 3: 893-905.
199
Kaufman RJ, Scheuner D, Schroder M, Shen X, Lee K, Liu CY, et al. The unfolded protein response in nutrient sensing and differentiation. Nat Rev Mol Cell Biol 2002; 3: 411-21.
Keats AS, Telford J. Narcotic antagonists as analgesics: clinical aspects. In: Gould RF. editor. Molecular modification in drug design (Advances in chemistry series 45). Washington DC: American Chemical Society 1964: 170-176.
Kelley BJ, Haidar W, Boeve BF, Baker M, Graff-Radford NR, Krefft T, et al. Prominent phenotypic variability associated with mutations in Progranulin. Neurobiol Aging 2009; 30: 739-51.
Kennedy C, Henderson G. Inhibition of potassium currents by the sigma receptor ligand (+)-3-(3- hydroxyphenyl)-N-(1-propyl)piperidine in sympathetic neurons of the mouse isolated hypogastric ganglion. Neuroscience 1990; 35: 725-33.
Kertesz A. Frontotemporal dementia/Pick's disease. Arch Neurol 2004; 61: 969-71.
Kertesz A, Kawarai T, Rogaeva E, St George-Hyslop P, Poorkaj P, Bird TD, et al. Familial frontotemporal dementia with ubiquitin-positive, tau-negative inclusions. Neurology 2000; 54: 818-27.
Kim HW, Roh DH, Yoon SY, Seo HS, Kwon YB, Han HJ, et al. Activation of the spinal sigma-1 receptor enhances NMDA-induced pain via PKC- and PKA-dependent phosphorylation of the NR1 subunit in mice. Br J Pharmacol 2008; 154: 1125-34.
Kim J, Inoue K, Ishii J, Vanti WB, Voronov SV, Murchison E, et al. A MicroRNA feedback circuit in midbrain dopamine neurons. Science 2007; 317: 1220-4.
Kimonis VE, Fulchiero E, Vesa J, Watts G. VCP disease associated with myopathy, Paget disease of bone and frontotemporal dementia: review of a unique disorder. Biochim Biophys Acta 2008; 1782: 744-8.
Kitabayashi Y, Otakara C, Hirosawa R, Narumoto J, Fukui K. Frontotemporal dementia complicated with schizophrenia. Psychiatry Clin Neurosci 2005; 59: 749-50.
Kleiger G, Grothe R, Mallick P, Eisenberg D. GXXXG and AXXXA: common alpha-helical interaction motifs in proteins, particularly in extremophiles. Biochemistry 2002; 41: 5990-7.
Kostova FV, Williams VC, Heemskerk J, Iannaccone S, Didonato C, Swoboda K, et al. Spinal muscular atrophy: classification, diagnosis, management, pathogenesis, and future research directions. J Child Neurol 2007; 22: 926-45.
Kowalska A. Genetic basis of neurodegeneration in familial Alzheimer's disease. Pol J Pharmacol 2004; 56: 171-8.
Kruger R. LRRK2 in Parkinson's disease - drawing the curtain of penetrance: a commentary. BMC Med 2008; 6: 33.
200
Kruger R, Schulz JB. The alpha-synuclein pathway to neurodegeneration. In: Tolosa, E, Schulz JB, McKeith IG, Ferrer I, editors. Neurodegenerative disorders associated with alpha-synuclein pathology. Barcelona, Ars Medica 2002: 11-22.
Kudo T, Katayama T, Imaizumi K, Yasuda Y, Yatera M, Okochi M, et al. The unfolded protein response is involved in the pathology of Alzheimer's disease. Ann N Y Acad Sci 2002; 977: 349-55.
Kumar-Singh S, Van Broeckhoven C. Frontotemporal lobar degeneration: current concepts in the light of recent advances. Brain Pathol 2007; 17: 104-14.
Kwiatkowski TJ, Jr., Bosco DA, Leclerc AL, Tamrazian E, Vanderburg CR, Russ C, et al. Mutations in the FUS/TLS gene on chromosome 16 cause familial amyotrophic lateral sclerosis. Science 2009; 323: 1205-8.
Lacomblez L, Bensimon G, Leigh PN, Guillet P, Meininger V. Dose-ranging study of riluzole in amyotrophic lateral sclerosis. Amyotrophic Lateral Sclerosis/Riluzole Study Group II. Lancet 1996; 347: 1425-31.
Lagier-Tourenne C, Cleveland DW. Rethinking ALS: the FUS about TDP-43. Cell 2009; 136: 1001-4.
Langa F, Codony X, Tovar V, Lavado A, Gimenez E, Cozar P, et al. Generation and phenotypic analysis of sigma receptor type I (sigma 1) knockout mice. Eur J Neurosci 2003; 18: 2188-96.
Lantos PL, Cairns NJ, Khan MN, King A, Revesz T, Janssen JC, et al. Neuropathologic variation in frontotemporal dementia due to the intronic tau 10(+16) mutation. Neurology 2002; 58: 1169- 75.
Le Ber I, Camuzat A, Berger E, Hannequin D, Laquerriere A, Golfier V, et al. Chromosome 9p-linked families with frontotemporal dementia associated with motor neuron disease. Neurology 2009; 72: 1669-76.
Lee KB, Kunugi H, Nanko S. Familial schizophrenia with pericentric inversion of chromosome 9: a case report. Schizophr Res 1998; 32: 123-6.
Lee VM, Goedert M, Trojanowski JQ. Neurodegenerative tauopathies. Annu Rev Neurosci 2001; 24: 1121-59.
Lesage S, Durr A, Tazir M, Lohmann E, Leutenegger AL, Janin S, et al. LRRK2 G2019S as a cause of Parkinson's disease in North African Arabs. N Engl J Med 2006; 354: 422-3.
Lindholm D, Wootz H, Korhonen L. ER stress and neurodegenerative diseases. Cell Death Differ 2006; 13: 385-92.
201 Lindquist SG, Braedgaard H, Svenstrup K, Isaacs AM, Nielsen JE. Frontotemporal dementia linked to chromosome 3 (FTD-3)--current concepts and the detection of a previously unknown branch of the Danish FTD-3 family. Eur J Neurol 2008; 15: 667-70.
Liscic RM. Frontotemporal dementias: update on recent developments in molecular genetics and neuropathology. Arh Hig Rada Toksikol 2009; 60: 117-22.
Litvan I, Hutton M. Clinical and genetic aspects of progressive supranuclear palsy. J Geriatr Psychiatry Neurol 1998; 11: 107-14.
Lu YW, Tan EK. Molecular biology changes associated with LRRK2 mutations in Parkinson's disease. J Neurosci Res 2008; 86: 1895-901.
Lupardus PJ, Wilke RA, Aydar E, Palmer CP, Chen Y, Ruoho AE, et al. Membrane-delimited coupling between sigma receptors and K+ channels in rat neurohypophysial terminals requires neither G-protein nor ATP. J Physiol 2000; 526 Pt 3: 527-39.
Ma Y, Hendershot LM. The role of the unfolded protein response in tumour development: friend or foe? Nat Rev Cancer 2004; 4: 966-77.
Mackenzie IR, Baborie A, Pickering-Brown S, Du Plessis D, Jaros E, Perry RH, et al. Heterogeneity of ubiquitin pathology in frontotemporal lobar degeneration: classification and relation to clinical phenotype. Acta Neuropathol 2006a; 112: 539-49.
Mackenzie IR, Baker M, Pickering-Brown S, Hsiung GY, Lindholm C, Dwosh E, et al. The neuropathology of frontotemporal lobar degeneration caused by mutations in the progranulin gene. Brain 2006b; 129: 3081-90.
Mackenzie IR, Neumann M, Bigio EH, Cairns NJ, Alafuzoff I, Kril J, et al. Nomenclature and nosology for neuropathologic subtypes of frontotemporal lobar degeneration: an update. Acta Neuropathol 2010; 119: 1-4.
Mackenzie IR, Neumann M, Bigio EH, Cairns NJ, Alafuzoff I, Kril J, et al. Nomenclature for neuropathologic subtypes of frontotemporal lobar degeneration: consensus recommendations. Acta Neuropathol 2009; 117: 15-8.
Mahapatra RK, Edwards MJ, Schott JM, Bhatia KP. Corticobasal degeneration. Lancet Neurol 2004; 3: 736-43.
Mark LP, Prost RW, Ulmer JL, Smith MM, Daniels DL, Strottmann JM, et al. Pictorial review of glutamate excitotoxicity: fundamental concepts for neuroimaging. AJNR Am J Neuroradiol 2001; 22: 1813-24.
Marrazzo A, Caraci F, Salinaro ET, Su TP, Copani A, Ronsisvalle G. Neuroprotective effects of sigma-1 receptor agonists against beta-amyloid-induced toxicity. Neuroreport 2005; 16: 1223-6.
202 Martin WR, Eades CG, Thompson JA, Huppler RE, Gilbert PE. The effects of morphine- and nalorphine- like drugs in the nondependent and morphine-dependent chronic spinal dog. J Pharmacol Exp Ther 1976; 197: 517-32.
Martin-Serrano J, Yarovoy A, Perez-Caballero D, Bieniasz PD. Divergent retroviral late-budding domains recruit vacuolar protein sorting factors by using alternative adaptor proteins. Proc Natl Acad Sci U S A 2003; 100: 12414-9.
Martina M, Turcotte ME, Halman S, Bergeron R. The sigma-1 receptor modulates NMDA receptor synaptic transmission and plasticity via SK channels in rat hippocampus. J Physiol 2007; 578: 143-57.
Martinaud O, Laquerriere A, Guyant-Marechal L, Ahtoy P, Vera P, Sergeant N, et al. Frontotemporal dementia, motor neuron disease and tauopathy: clinical and neuropathological study in a family. Acta Neuropathol 2005; 110: 84-92.
Martins IJ, Berger T, Sharman MJ, Verdile G, Fuller SJ, Martins RN. Cholesterol metabolism and transport in the pathogenesis of Alzheimer's disease. J Neurochem 2009; 111: 1275-308.
Maruszak A, Safranow K, Gacia M, Gabryelewicz T, Slowik A, Styczynska M, et al. Sigma receptor type 1 gene variation in a group of Polish patients with Alzheimer's disease and mild cognitive impairment. Dement Geriatr Cogn Disord 2007; 23: 432-8.
Matsumoto RR, Bowen WD, Tom MA, Vo VN, Truong DD, De Costa BR. Characterization of two novel sigma receptor ligands: antidystonic effects in rats suggest sigma receptor antagonism. Eur J Pharmacol 1995; 280: 301-10.
Matsumoto RR, Hemstreet MK, Lai NL, Thurkauf A, De Costa BR, Rice KC, et al. Drug specificity of pharmacological dystonia. Pharmacol Biochem Behav 1990; 36: 151-5.
Mattson MP. Antigenic changes similar to those seen in neurofibrillary tangles are elicited by glutamate and Ca2+ influx in cultured hippocampal neurons. Neuron 1990; 4: 105-17.
Matus S, Lisbona F, Torres M, Leon C, Thielen P, Hetz C. The stress rheostat: an interplay between the unfolded protein response (UPR) and autophagy in neurodegeneration. Curr Mol Med 2008; 8: 157-72.
Maurice T, Junien JL, Privat A. Dehydroepiandrosterone sulfate attenuates dizocilpine-induced learning impairment in mice via sigma 1-receptors. Behav Brain Res 1997; 83: 159-64.
Maurice T, Phan VL, Urani A, Guillemain I. Differential involvement of the sigma(1) (sigma(1)) receptor in the anti-amnesic effect of neuroactive steroids, as demonstrated using an in vivo antisense strategy in the mouse. Br J Pharmacol 2001; 134: 1731-41.
Maurice T, Su TP. The pharmacology of sigma-1 receptors. Pharmacol Ther 2009; 124: 195-206.
203 Maurice T, Su TP, Privat A. Sigma1 (sigma 1) receptor agonists and neurosteroids attenuate B25-35- amyloid peptide-induced amnesia in mice through a common mechanism. Neuroscience 1998; 83: 413-28.
McCann DJ, Weissman AD, Su TP. Sigma-1 and sigma-2 sites in rat brain: comparison of regional, ontogenetic, and subcellular patterns. Synapse 1994; 17: 182-9.
McKeith IG, Dickson DW, Lowe J, Emre M, O'Brien JT, Feldman H, et al. Diagnosis and management of dementia with Lewy bodies: third report of the DLB Consortium. Neurology 2005; 65: 1863-72.
McKhann GM, Albert MS, Grossman M, Miller B, Dickson D, Trojanowski JQ. Clinical and pathological diagnosis of frontotemporal dementia. Arch Neurol 2001; 58: 1803-9.
McKhann GM, Knopman DS, Chertkow H, Hyman BT, Jack CRJ, Kawas CH, et al. The diagnosis of dementia due to Alzheimer's disease: Recommendations from the National Institute on Aging-Alzheimer's Association workgroups on diagnostic guidelines for Alzheimer's disease. Alzheimers Dement 2011; 7: 263-9.
McLean S, Weber E. Autoradiographic visualization of haloperidol-sensitive sigma receptors in guinea-pig brain. Neuroscience 1988; 25: 259-69.
McSweeny J, Wood-gottfried L, Chessarec JB, Kurczynski TW. Cognitive and language anomalies in two brothers with a rare form of genetic abnormality (deletion of 9p24) The Clinical Neuropsychologist 1993; 7: 460-466.
Mei J, Pasternak GW. Molecular cloning and pharmacological characterization of the rat sigma1 receptor. Biochem Pharmacol 2001; 62: 349-55.
Mesulam M, Johnson N, Krefft TA, Gass JM, Cannon AD, Adamson JL, et al. Progranulin mutations in primary progressive aphasia: the PPA1 and PPA3 families. Arch Neurol 2007; 64: 43-7.
Meunier J, Maurice T. Beneficial effects of the sigma1 receptor agonists igmesine and dehydroepiandrosterone against learning impairments in rats prenatally exposed to cocaine. Neurotoxicol Teratol 2004; 26: 783-97.
Mishizen-Eberz AJ, Rissman RA, Carter TL, Ikonomovic MD, Wolfe BB, Armstrong DM. Biochemical and molecular studies of NMDA receptor subunits NR1/2A/2B in hippocampal subregions throughout progression of Alzheimer's disease pathology. Neurobiol Dis 2004; 15: 80-92.
Miyatake R, Furukawa A, Matsushita S, Higuchi S, Suwaki H. Functional polymorphisms in the sigma1 receptor gene associated with alcoholism. Biol Psychiatry 2004; 55: 85-90.
Momeni P, Schymick J, Jain S, Cookson MR, Cairns NJ, Greggio E, et al. Analysis of IFT74 as a candidate gene for chromosome 9p-linked ALS-FTD. BMC Neurol 2006; 6: 44.
204 Monnet FP, Blier P, Debonnel G, de Montigny C. Modulation by sigma ligands of N-methyl-D- aspartate-induced [3H]noradrenaline release in the rat hippocampus: G-protein dependency. Naunyn Schmiedebergs Arch Pharmacol 1992a; 346: 32-9.
Monnet FP, Debonnel G, Fournier A, de Montigny C. Neuropeptide Y potentiates the N-methyl-D- aspartate response in the CA3 dorsal hippocampus. II. Involvement of a subtype of sigma receptor. J Pharmacol Exp Ther 1992b; 263: 1219-25.
Monnet FP, Debonnel G, Junien JL, De Montigny C. N-methyl-D-aspartate-induced neuronal activation is selectively modulated by sigma receptors. Eur J Pharmacol 1990; 179: 441-5.
Monnet FP, Mahe V, Robel P, Baulieu EE. Neurosteroids, via sigma receptors, modulate the [3H]norepinephrine release evoked by N-methyl-D-aspartate in the rat hippocampus. Proc Natl Acad Sci U S A 1995; 92: 3774-8.
Moody TW, Leyton J, John C. Sigma ligands inhibit the growth of small cell lung cancer cells. Life Sci 2000; 66: 1979-86.
Morin-Surun MP, Collin T, Denavit-Saubie M, Baulieu EE, Monnet FP. Intracellular sigma1 receptor modulates phospholipase C and protein kinase C activities in the brainstem. Proc Natl Acad Sci U S A 1999; 96: 8196-9.
Morita M, Al-Chalabi A, Andersen PM, Hosler B, Sapp P, Englund E, et al. A locus on chromosome 9p confers susceptibility to ALS and frontotemporal dementia. Neurology 2006; 66: 839-44.
Muller MJ, Grunder G, Wetzel H, Muller-Siecheneder F, Marx-Dannigkeit P, Benkert O. Antipsychotic effects and tolerability of the sigma ligand EMD 57445 (panamesine) and its metabolites in acute schizophrenia: an open clinical trial. Psychiatry Res 1999; 89: 275-80.
Muller WE, Siebert B, Holoubek G, Gentsch C. Neuropharmacology of the anxiolytic drug opipramol, a sigma site ligand. Pharmacopsychiatry 2004; 37 Suppl 3: S189-97.
Munch C, Sedlmeier R, Meyer T, Homberg V, Sperfeld AD, Kurt A, et al. Point mutations of the p150 subunit of dynactin (DCTN1) gene in ALS. Neurology 2004; 63: 724-6.
Munoz DG, Neumann M, Kusaka H, Yokota O, Ishihara K, Terada S, et al. FUS pathology in basophilic inclusion body disease. Acta Neuropathol 2009; 118: 617-27. Murphy DJ, Vance J. Mechanisms of lipid-body formation. Trends Biochem Sci 1999; 24: 109-15.
Murray FE, Landsberg JP, Williams RJ, Esiri MM, Watt F. Elemental analysis of neurofibrillary tangles in Alzheimer's disease using proton-induced X-ray analysis. Ciba Found Symp 1992; 169: 201-10; discussion 210-6.
Nagata T, Ilieva H, Murakami T, Shiote M, Narai H, Ohta Y, et al. Increased ER stress during motor neuron degeneration in a transgenic mouse model of amyotrophic lateral sclerosis. Neurol Res 2007; 29: 767-71.
205 Nanko S. Schizophrenia with pericentric inversion of chromosome 9: a case report. Jpn J Psychiatry Neurol 1993; 47: 47-9.
Narita N, Hashimoto K, Tomitaka S, Minabe Y. Interactions of selective serotonin reuptake inhibitors with subtypes of sigma receptors in rat brain. Eur J Pharmacol 1996; 307: 117-9.
Neary D, Snowden J. Fronto-temporal dementia: nosology, neuropsychology, and neuropathology. Brain Cogn 1996; 31: 176-87.
Neary D, Snowden JS, Gustafson L, Passant U, Stuss D, Black S, et al. Frontotemporal lobar degeneration: a consensus on clinical diagnostic criteria. Neurology 1998; 51: 1546-54.
Neumann M. Molecular neuropathology of TDP-43 proteinopathies. Int J Mol Sci 2009; 10: 232-46.
Neumann M, Kwong LK, Truax AC, Vanmassenhove B, Kretzschmar HA, Van Deerlin VM, et al. TDP-43-positive white matter pathology in frontotemporal lobar degeneration with ubiquitin- positive inclusions. J Neuropathol Exp Neurol 2007a; 66: 177-83.
Neumann M, Mackenzie IR, Cairns NJ, Boyer PJ, Markesbery WR, Smith CD, et al. TDP-43 in the ubiquitin pathology of frontotemporal dementia with VCP gene mutations. J Neuropathol Exp Neurol 2007b; 66: 152-7.
Neumann M, Rademakers R, Roeber S, Baker M, Kretzschmar HA, Mackenzie IR. A new subtype of frontotemporal lobar degeneration with FUS pathology. Brain 2009a; 132: 2922-31.
Neumann M, Roeber S, Kretzschmar HA, Rademakers R, Baker M, Mackenzie IR. Abundant FUS- immunoreactive pathology in neuronal intermediate filament inclusion disease. Acta Neuropathol 2009b; 118: 605-16.
Newman M, Musgrave IF, Lardelli M. Alzheimer disease: amyloidogenesis, the presenilins and animal models. Biochim Biophys Acta 2007; 1772: 285-97.
Ng DT, Spear ED, Walter P. The unfolded protein response regulates multiple aspects of secretory and membrane protein biogenesis and endoplasmic reticulum quality control. J Cell Biol 2000; 150: 77-88.
Nishimura AL, Mitne-Neto M, Silva HC, Richieri-Costa A, Middleton S, Cascio D, et al. A mutation in the vesicle-trafficking protein VAPB causes late-onset spinal muscular atrophy and amyotrophic lateral sclerosis. Am J Hum Genet 2004; 75: 822-31.
Nixon RA. The calpains in aging and aging-related diseases. Ageing Res Rev 2003; 2: 407-18.
Novakova M, Ela C, Bowen WD, Hasin Y, Eilam Y. Highly selective sigma receptor ligands elevate inositol 1,4,5-trisphosphate production in rat cardiac myocytes. Eur J Pharmacol 1998; 353: 315-27.
206 Ohmori O, Shinkai T, Suzuki T, Okano C, Kojima H, Terao T, et al. Polymorphisms of the sigma(1) receptor gene in schizophrenia: An association study. Am J Med Genet 2000; 96: 118-22.
Ozelius LJ, Senthil G, Saunders-Pullman R, Ohmann E, Deligtisch A, Tagliati M, et al. LRRK2 G2019S as a cause of Parkinson's disease in Ashkenazi Jews. N Engl J Med 2006; 354: 424-5.
Pal A, Hajipour AR, Fontanilla D, Ramachandran S, Chu UB, Mavlyutov T, et al. Identification of regions of the sigma-1 receptor ligand binding site using a novel photoprobe. Mol Pharmacol 2007; 72: 921-33.
Palacios G, Muro A, Vela JM, Molina-Holgado E, Guitart X, Ovalle S, et al. Immunohistochemical localization of the sigma1-receptor in oligodendrocytes in the rat central nervous system. Brain Res 2003; 961: 92-9.
Palacios G, Muro A, Verdu E, Pumarola M, Vela JM. Immunohistochemical localization of the sigma1 receptor in Schwann cells of rat sciatic nerve. Brain Res 2004; 1007: 65-70.
Palmer CP, Mahen R, Schnell E, Djamgoz MB, Aydar E. Sigma-1 receptors bind cholesterol and remodel lipid rafts in breast cancer cell lines. Cancer Res 2007; 67: 11166-75.
Pamphlett R, Kril J, Hng TM. Motor neuron disease: a primary disorder of corticomotoneurons? Muscle Nerve 1995; 18: 314-8.
Pan YX, Mei J, Xu J, Wan BL, Zuckerman A, Pasternak GW. Cloning and characterization of a mouse sigma1 receptor. J Neurochem 1998; 70: 2279-85.
Parkinson J. An essay on the shaking palsy. 1817. J Neuropsychiatry Clin Neurosci 2002; 14: 223- 36; discussion 222.
Paschen W, Frandsen A. Endoplasmic reticulum dysfunction--a common denominator for cell injury in acute and degenerative diseases of the brain? J Neurochem 2001; 79: 719-25.
Perry RH, Irving D, Blessed G, Fairbairn A, Perry EK. Senile dementia of Lewy body type. A clinically and neuropathologically distinct form of Lewy body dementia in the elderly. J Neurol Sci 1990; 95: 119-39.
Pickering-Brown SM. The complex aetiology of frontotemporal lobar degeneration. Exp Neurol 2007; 206: 1-10.
Pickering-Brown SM, Rollinson S, Du Plessis D, Morrison KE, Varma A, Richardson AM, et al. Frequency and clinical characteristics of progranulin mutation carriers in the Manchester frontotemporal lobar degeneration cohort: comparison with patients with MAPT and no known mutations. Brain 2008; 131: 721-31.
Pignataro G, Simon RP, Xiong ZG. Prolonged activation of ASIC1a and the time window for neuroprotection in cerebral ischaemia. Brain 2007; 130: 151-8.
207
Ponce J, de la Ossa NP, Hurtado O, Millan M, Arenillas JF, Davalos A, et al. Simvastatin reduces the association of NMDA receptors to lipid rafts: a cholesterol-mediated effect in neuroprotection. Stroke 2008; 39: 1269-75.
Pramstaller PP, Schlossmacher MG, Jacques TS, Scaravilli F, Eskelson C, Pepivani I, et al. Lewy body Parkinson's disease in a large pedigree with 77 Parkin mutation carriers. Ann Neurol 2005; 58: 411-22.
Prasad PD, Li HW, Fei YJ, Ganapathy ME, Fujita T, Plumley LH, et al. Exon-intron structure, analysis of promoter region, and chromosomal localization of the human type 1 sigma receptor gene. J Neurochem 1998; 70: 443-51.
Price DL. Aging of the Brain and Dementia of the Alzheimer Type. Chapter 58 In: Kandel ER, Schwartz JH, Jessell TM editors. Principles of Neural Science, Fourth Edition 2000: 1149- 1161.
Prince M, Jackson J. World Alzhimer's Report. World Alzheimer's International 2009. Accessed March 12, 2010
Przedborski S. Molecular targets for neuroprotection. Amyotroph Lateral Scler Other Motor Neuron Disord 2004; 5 Suppl 1: 14-8.
Puls I, Jonnakuty C, LaMonte BH, Holzbaur EL, Tokito M, Mann E, et al. Mutant dynactin in motor neuron disease. Nat Genet 2003; 33: 455-6.
Quirion R, Bowen WD, Itzhak Y, Junien JL, Musacchio JM, Rothman RB, et al. A proposal for the classification of sigma binding sites. Trends Pharmacol Sci 1992; 13: 85-6.
Quirion R, Chicheportiche R, Contreras PC, Johnson KM, Lodge D, Tam SW, et al. Classification and nomenclature of phencyclidine and sigma receptor sites. Trends in Neuroscience 1987; 10: 444-446.
Rademakers R, Baker M, Gass J, Adamson J, Huey ED, Momeni P, et al. Phenotypic variability associated with progranulin haploinsufficiency in patients with the common 1477C-->T (Arg493X) mutation: an international initiative. Lancet Neurol 2007; 6: 857-68.
Rademakers R, Eriksen JL, Baker M, Robinson T, Ahmed Z, Lincoln SJ, et al. Common variation in the miR-659 binding-site of GRN is a major risk factor for TDP43-positive frontotemporal dementia. Hum Mol Genet 2008; 17: 3631-42. Rademakers R, Hutton M. The genetics of frontotemporal lobar degeneration. Curr Neurol Neurosci Rep 2007; 7: 434-42.
Rademakers R, Rovelet-Lecrux A. Recent insights into the molecular genetics of dementia. Trends Neurosci 2009; 32: 451-61.
208 Rao RV, Ellerby HM, Bredesen DE. Coupling endoplasmic reticulum stress to the cell death program. Cell Death Differ 2004; 11: 372-80.
Reisberg B, Doody R, Stoffler A, Schmitt F, Ferris S, Mobius HJ. Memantine in moderate-to-severe Alzheimer's disease. N Engl J Med 2003; 348: 1333-41.
Renaudo A, Watry V, Chassot AA, Ponzio G, Ehrenfeld J, Soriani O. Inhibition of tumor cell proliferation by sigma ligands is associated with K+ Channel inhibition and p27kip1 accumulation. J Pharmacol Exp Ther 2004; 311: 1105-14.
Ringel SP, Murphy JR, Alderson MK, Bryan W, England JD, Miller RG, et al. The natural history of amyotrophic lateral sclerosis. Neurology 1993; 43: 1316-22.
Rinne JO, Lee MS, Thompson PD, Marsden CD. Corticobasal degeneration. A clinical study of 36 cases. Brain 1994; 117 ( Pt 5): 1183-96.
Riviere PJ, Pascaud X, Junien JL, Porreca F. Neuropeptide Y and JO 1784, a selective sigma ligand, alter intestinal ion transport through a common, haloperidol-sensitive site. Eur J Pharmacol 1990; 187: 557-9.
Roman FJ, Pascaud X, Duffy O, Vauche D, Martin B, Junien JL. Neuropeptide Y and peptide YY interact with rat brain sigma and PCP binding sites. Eur J Pharmacol 1989; 174: 301-2.
Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A, et al. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 1993; 362: 59-62.
Russ WP, Engelman DM. The GxxxG motif: a framework for transmembrane helix-helix association. J Mol Biol 2000; 296: 911-9.
Sampathu DM, Neumann M, Kwong LK, Chou TT, Micsenyi M, Truax A, et al. Pathological heterogeneity of frontotemporal lobar degeneration with ubiquitin-positive inclusions delineated by ubiquitin immunohistochemistry and novel monoclonal antibodies. Am J Pathol 2006; 169: 1343-52.
Satoh F, Miyatake R, Furukawa A, Suwaki H. Lack of association between sigma receptor gene variants and schizophrenia. Psychiatry Clin Neurosci 2004; 58: 359-63.
Schelman WR, Andres RD, Sipe KJ, Kang E, Weyhenmeyer JA. Glutamate mediates cell death and increases the Bax to Bcl-2 ratio in a differentiated neuronal cell line. Brain Res Mol Brain Res 2004; 128: 160-9.
Schroder M, Kaufman RJ. ER stress and the unfolded protein response. Mutat Res 2005; 569: 29-63.
Schwab C, Arai T, Hasegawa M, Yu S, McGeer PL. Colocalization of transactivation-responsive DNA-binding protein 43 and huntingtin in inclusions of Huntington disease. J Neuropathol Exp Neurol 2008; 67: 1159-65.
209
Selkoe DJ. Alzheimer's disease: genes, proteins, and therapy. Physiol Rev 2001; 81: 741-66.
Seth P, Fei YJ, Li HW, Huang W, Leibach FH, Ganapathy V. Cloning and functional characterization of a sigma receptor from rat brain. J Neurochem 1998; 70: 922-31.
Seth P, Ganapathy ME, Conway SJ, Bridges CD, Smith SB, Casellas P, et al. Expression pattern of the type 1 sigma receptor in the brain and identity of critical anionic amino acid residues in the ligand-binding domain of the receptor. Biochim Biophys Acta 2001; 1540: 59-67.
Seth P, Leibach FH, Ganapathy V. Cloning and structural analysis of the cDNA and the gene encoding the murine type 1 sigma receptor. Biochem Biophys Res Commun 1997; 241: 535- 40.
Shibata N, Hirano A, Kobayashi M, Siddique T, Deng HX, Hung WY, et al. Intense superoxide dismutase-1 immunoreactivity in intracytoplasmic hyaline inclusions of familial amyotrophic lateral sclerosis with posterior column involvement. J Neuropathol Exp Neurol 1996; 55: 481- 90.
Siddique T, Figlewicz DA, Pericak-Vance MA, Haines JL, Rouleau G, Jeffers AJ, et al. Linkage of a gene causing familial amyotrophic lateral sclerosis to chromosome 21 and evidence of genetic-locus heterogeneity. N Engl J Med 1991; 324: 1381-4.
Silvius JR. Role of cholesterol in lipid raft formation: lessons from lipid model systems. Biochim Biophys Acta 2003; 1610: 174-83.
Simons K, Ehehalt R. Cholesterol, lipid rafts, and disease. J Clin Invest 2002; 110: 597-603.
Simons K, Ikonen E. How cells handle cholesterol. Science 2000; 290: 1721-6.
Simons K, Toomre D. Lipid rafts and signal transduction. Nat Rev Mol Cell Biol 2000; 1: 31-9.
Simpson PB, Challiss RA, Nahorski SR. Neuronal Ca2+ stores: activation and function. Trends Neurosci 1995; 18: 299-306.
Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, et al. alpha-Synuclein locus triplication causes Parkinson's disease. Science 2003; 302: 841.
Siniscalchi A, Cristofori P, Veratti E. Influence of N-allyl-normetazocine on acetylcholine release from brain slices: involvement of muscarinic receptors. Naunyn Schmiedebergs Arch Pharmacol 1987; 336: 425-9.
Skibinski G, Parkinson NJ, Brown JM, Chakrabarti L, Lloyd SL, Hummerich H, et al. Mutations in the endosomal ESCRTIII-complex subunit CHMP2B in frontotemporal dementia. Nat Genet 2005; 37: 806-8.
210 Snell LD, Iorio KR, Tabakoff B, Hoffman PL. Protein kinase C activation attenuates N-methyl-D- aspartate-induced increases in intracellular calcium in cerebellar granule cells. J Neurochem 1994; 62: 1783-9.
Snowden JS, Neary D, Mann DM. Autopsy proven sporadic frontotemporal dementia due to microvacuolar-type histology, with onset at 21 years of age. J Neurol Neurosurg Psychiatry 2004; 75: 1337-9.
Snowden JS, Pickering-Brown SM, Mackenzie IR, Richardson AM, Varma A, Neary D, et al. Progranulin gene mutations associated with frontotemporal dementia and progressive non- fluent aphasia. Brain 2006; 129: 3091-102.
Sorbi S, Nacmias B, Forleo P, Piacentini S, Latorraca S, Amaducci L. Epistatic effect of APP717 mutation and apolipoprotein E genotype in familial Alzheimer's disease. Ann Neurol 1995; 38: 124-7.
Soriani O, Foll FL, Roman F, Monnet FP, Vaudry H, Cazin L. A-Current down-modulated by sigma receptor in frog pituitary melanotrope cells through a G protein-dependent pathway. J Pharmacol Exp Ther 1999a; 289: 321-8.
Soriani O, Le Foll F, Galas L, Roman F, Vaudry H, Cazin L. The sigma-ligand (+)-pentazocine depresses M current and enhances calcium conductances in frog melanotrophs. Am J Physiol 1999b; 277: E73-80.
Spillantini MG, Schmidt ML, Lee VM-Y, Trojanowski JQ, Jakes R, Goedert M. -Synuclein in Lewy bodies. Nature 1997; 388: 839-840.
Spillantini MG and Goedert M. Tau protein pathology in neurodegenerative diseases. Trends Neurosci. 1998; 21:428-33.
Sreedharan J, Blair IP, Tripathi VB, Hu X, Vance C, Rogelj B, et al. TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. Science 2008; 319: 1668-72.
Stanford PM, Shepherd CE, Halliday GM, Brooks WS, Schofield PW, Brodaty H, et al. Mutations in the tau gene that cause an increase in three repeat tau and frontotemporal dementia. Brain 2003; 126: 814-26.
Stein-Behrens B, Mattson MP, Chang I, Yeh M, Sapolsky R. Stress exacerbates neuron loss and cytoskeletal pathology in the hippocampus. J Neurosci 1994; 14: 5373-80.
Steuerwald GM, Baumann TP, Taylor KI, Mittag M, Adams H, Tolnay M, et al. Clinical characteristics of dementia associated with argyrophilic grain disease. Dement Geriatr Cogn Disord 2007; 24: 229-34.
Strong MJ, Hudson AJ, Alvord WG. Familial amyotrophic lateral sclerosis, 1850-1989: a statistical analysis of the world literature. Can J Neurol Sci 1991; 18: 45-58.
211 Su TP. Sigma receptors. Putative links between nervous, endocrine and immune systems. Eur J Biochem 1991; 200: 633-42.
Su TP, London ED, Jaffe JH. Steroid binding at sigma receptors suggests a link between endocrine, nervous, and immune systems. Science 1988; 240: 219-21.
Sugama S, Kimura A, Chen W, Kubota S, Seyama Y, Taira N, et al. Frontal lobe dementia with abnormal cholesterol metabolism and heterozygous mutation in sterol 27-hydroxylase gene (CYP27). J Inherit Metab Dis 2001; 24: 379-92.
Swanberg MM. Memantine for behavioral disturbances in frontotemporal dementia: a case series. Alzheimer Dis Assoc Disord 2007; 21: 164-6.
Tabas I. Consequences of cellular cholesterol accumulation: basic concepts and physiological implications. J Clin Invest 2002; 110: 905-11.
Takebayashi M, Hayashi T, Su TP. Sigma-1 receptors potentiate epidermal growth factor signaling towards neuritogenesis in PC12 cells: potential relation to lipid raft reconstitution. Synapse 2004; 53: 90-103.
Takizawa R, Hashimoto K, Tochigi M, Kawakubo Y, Marumo K, Sasaki T, et al. Association between sigma-1 receptor gene polymorphism and prefrontal hemodynamic response induced by cognitive activation in schizophrenia. Prog Neuropsychopharmacol Biol Psychiatry 2009; 33: 491-8.
Tam SW, Zhang AZ. Sigma and PCP receptors in human frontal cortex membranes. Eur J Pharmacol 1988; 154: 343-4.
Tchedre KT, Yorio T. sigma-1 receptors protect RGC-5 cells from apoptosis by regulating intracellular calcium, Bax levels, and caspase-3 activation. Invest Ophthalmol Vis Sci 2008; 49: 2577-88.
Tobisawa S, Hozumi Y, Arawaka S, Koyama S, Wada M, Nagai M, et al. Mutant SOD1 linked to familial amyotrophic lateral sclerosis, but not wild-type SOD1, induces ER stress in COS7 cells and transgenic mice. Biochem Biophys Res Commun 2003; 303: 496-503.
Tolksdorf M, Kunze J, Gross-Selbeck G, Sperling K, Wegner RD, Wieczorek V, et al. Familial trisomy 9p and spinal muscular atrophy: clinical, cytogenetic and embryological findings. Eur J Pediatr 1977; 126: 13-27.
Tolnay M, Clavaguera F. Argyrophilic grain disease: a late-onset dementia with distinctive features among tauopathies. Neuropathology 2004; 24: 269-83.
Tran TT, de Costa BR, Matsumoto RR. Microinjection of sigma ligands into cranial nerve nuclei produces vacuous chewing in rats. Psychopharmacology (Berl) 1998; 137: 191-200.
212 Tsuchiya K, Ikeda M, Hasegawa K, Fukui T, Kuroiwa T, Haga C, et al. Distribution of cerebral cortical lesions in Pick's disease with Pick bodies: a clinicopathological study of six autopsy cases showing unusual clinical presentations. Acta Neuropathol 2001; 102: 553-71.
Uchida N, Ujike H, Nakata K, Takaki M, Nomura A, Katsu T, et al. No association between the sigma receptor type 1 gene and schizophrenia: results of analysis and meta-analysis of case- control studies. BMC Psychiatry 2003; 3: 13.
Uchida N, Ujike H, Tanaka Y, Sakai A, Yamamoto M, Fujisawa Y, et al. A variant of the sigma receptor type-1 gene is a protective factor for Alzheimer disease. Am J Geriatr Psychiatry 2005; 13: 1062-6.
Ulrich J, Spillantini MG, Goedert M, Dukas L, Stähelin HB. Abundant neurofibrillary tangles without senile plaques in a subset of patients with senile dementia. Neurodegeneration 1992; 1: 257- 264.
Urani A, Privat A, Maurice T. The modulation by neurosteroids of the scopolamine-induced learning impairment in mice involves an interaction with sigma1 (sigma1) receptors. Brain Res 1998; 799: 64-77.
Uryu K, Nakashima-Yasuda H, Forman MS, Kwong LK, Clark CM, Grossman M, et al. Concomitant TAR-DNA-binding protein 43 pathology is present in Alzheimer disease and corticobasal degeneration but not in other tauopathies. J Neuropathol Exp Neurol 2008; 67: 555-64.
Valdmanis PN, Dupre N, Bouchard JP, Camu W, Salachas F, Meininger V, et al. Three families with amyotrophic lateral sclerosis and frontotemporal dementia with evidence of linkage to chromosome 9p. Arch Neurol 2007; 64: 240-5. van der Zee J, Urwin H, Engelborghs S, Bruyland M, Vandenberghe R, Dermaut B, et al. CHMP2B C-truncating mutations in frontotemporal lobar degeneration are associated with an aberrant endosomal phenotype in vitro. Hum Mol Genet 2008; 17: 313-22. van Swieten J, Spillantini MG. Hereditary frontotemporal dementia caused by Tau gene mutations. Brain Pathol 2007; 17: 63-73. van Swieten JC, Heutink P. Mutations in progranulin (GRN) within the spectrum of clinical and pathological phenotypes of frontotemporal dementia. Lancet Neurol 2008; 7: 965-74. van Swieten JC, Stevens M, Rosso SM, Rizzu P, Joosse M, de Koning I, et al. Phenotypic variation in hereditary frontotemporal dementia with tau mutations. Ann Neurol 1999; 46: 617-26. van Waarde A, Ramakrishnan NK, Rybczynska AA, Elsinga PH, Ishiwata K, Nijholt IM, et al. The cholinergic system, sigma-1 receptors and cognition. Behav Brain Res 2010 [PMID: 20060423].
213 Vance C, Al-Chalabi A, Ruddy D, Smith BN, Hu X, Sreedharan J, et al. Familial amyotrophic lateral sclerosis with frontotemporal dementia is linked to a locus on chromosome 9p13.2-21.3. Brain 2006; 129: 868-76.
Vance C, Rogelj B, Hortobagyi T, De Vos KJ, Nishimura AL, Sreedharan J, et al. Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science 2009; 323: 1208-11.
Vilner BJ, John CS, Bowen WD. Sigma-1 and sigma-2 receptors are expressed in a wide variety of human and rodent tumor cell lines. Cancer Res 1995; 55: 408-13.
Vucic S, Burke D, Kiernan MC. Diagnosis of motor neuron disease. In: Kiernan MC, ed. The Motor Neuron Disease Handbook. Sydney: Australasian Medical Publishing Company Limited, 2007: 89-115.
Waibel S, Neumann M, Rabe M, Meyer T, Ludolph AC. Novel missense and truncating mutations in FUS/TLS in familial ALS. Neurology 2010; 75: 815-7.
Wakabayashi T, De Strooper B. Presenilins: members of the gamma-secretase quartets, but part- time soloists too. Physiology (Bethesda) 2008; 23: 194-204.
Wakutani Y, Watanabe K, Adachi Y, Wada-Isoe K, Urakami K, Ninomiya H, et al. Novel amyloid precursor protein gene missense mutation (D678N) in probable familial Alzheimer's disease. J Neurol Neurosurg Psychiatry 2004; 75: 1039-42.
Waldmann R, Champigny G, Bassilana F, Heurteaux C, Lazdunski M. A proton-gated cation channel involved in acid-sensing. Nature 1997; 386: 173-7.
Walker MP, Ayre GA, Cummings JL, Wesnes K, McKeith IG, O'Brien JT, et al. The Clinician Assessment of Fluctuation and the One Day Fluctuation Assessment Scale. Two methods to assess fluctuating confusion in dementia. Br J Psychiatry 2000; 177: 252-6.
Watts GD, Wymer J, Kovach MJ, Mehta SG, Mumm S, Darvish D, et al. Inclusion body myopathy associated with Paget disease of bone and frontotemporal dementia is caused by mutant valosin-containing protein. Nat Genet 2004; 36: 377-81.
Weissman AD, Casanova MF, Kleinman JE, London ED, De Souza EB. Selective loss of cerebral cortical sigma, but not PCP binding sites in schizophrenia. Biol Psychiatry 1991; 29: 41-54.
Weissman AD, Su TP, Hedreen JC, London ED. Sigma receptors in post-mortem human brains. J Pharmacol Exp Ther 1988; 247: 29-33.
Wemmie JA, Askwith CC, Lamani E, Cassell MD, Freeman JH, Jr., Welsh MJ. Acid-sensing ion channel 1 is localized in brain regions with high synaptic density and contributes to fear conditioning. J Neurosci 2003; 23: 5496-502.
214 Wemmie JA, Chen J, Askwith CC, Hruska-Hageman AM, Price MP, Nolan BC, et al. The acid- activated ion channel ASIC contributes to synaptic plasticity, learning, and memory. Neuron 2002; 34: 463-77.
Wemmie JA, Coryell MW, Askwith CC, Lamani E, Leonard AS, Sigmund CD, et al. Overexpression of acid-sensing ion channel 1a in transgenic mice increases acquired fear-related behavior. Proc Natl Acad Sci U S A 2004; 101: 3621-6.
West RL, Lee JM, Maroun LE. Hypomethylation of the amyloid precursor protein gene in the brain of an Alzheimer's disease patient. J Mol Neurosci 1995; 6: 141-6.
Whitwell JL, Przybelski SA, Weigand SD, Ivnik RJ, Vemuri P, Gunter JL, et al. Distinct anatomical subtypes of the behavioural variant of frontotemporal dementia: a cluster analysis study. Brain 2009; 132: 2932-46.
Wilhelmsen KC, Forman MS, Rosen HJ, Alving LI, Goldman J, Feiger J, et al. 17q-linked frontotemporal dementia-amyotrophic lateral sclerosis without tau mutations with tau and alpha-synuclein inclusions. Arch Neurol 2004; 61: 398-406.
Wilke RA, Lupardus PJ, Grandy DK, Rubinstein M, Low MJ, Jackson MB. K+ channel modulation in rodent neurohypophysial nerve terminals by sigma receptors and not by dopamine receptors. J Physiol 1999; 517 ( Pt 2): 391-406.
Woulfe J, Gray DA, Mackenzie IR. FUS-immunoreactive intranuclear inclusions in neurodegenerative disease. Brain Pathol 2010; 20: 589-97.
Xiong ZG, Zhu XM, Chu XP, Minami M, Hey J, Wei WL, et al. Neuroprotection in ischemia: blocking calcium-permeable acid-sensing ion channels. Cell 2004; 118: 687-98.
Yamada M. Senile dementia of the neurofibrillary tangle type (tangle-only dementia): neuropathological criteria and clinical guidelines for diagnosis. Neuropathology 2003; 23: 311-7.
Yamamoto H, Miura R, Yamamoto T, Shinohara K, Watanabe M, Okuyama S, et al. Amino acid residues in the transmembrane domain of the type 1 sigma receptor critical for ligand binding. FEBS Lett 1999; 445: 19-22.
Yan J, Deng HX, Siddique N, Fecto F, Chen W, Yang Y, et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology 2010; 75: 807-14.
Yang S, Bhardwaj A, Cheng J, Alkayed NJ, Hurn PD, Kirsch JR. Sigma receptor agonists provide neuroprotection in vitro by preserving bcl-2. Anesth Analg 2007; 104: 1179-84.
Yang Y, Hentati A, Deng HX, Dabbagh O, Sasaki T, Hirano M, et al. The gene encoding alsin, a protein with three guanine-nucleotide exchange factor domains, is mutated in a form of recessive amyotrophic lateral sclerosis. Nat Genet 2001; 29: 160-5.
215 Yoshida H, Matsui T, Hosokawa N, Kaufman RJ, Nagata K, Mori K. A time-dependent phase shift in the mammalian unfolded protein response. Dev Cell 2003; 4: 265-71.
Yuyama K, Yanagisawa K. Late endocytic dysfunction as a putative cause of amyloid fibril formation in Alzheimer's disease. J Neurochem 2009; 109: 1250-60.
Zekanowski C, Religa D, Graff C, Filipek S, Kuznicki J. Genetic aspects of Alzheimer's disease. Acta Neurobiol Exp (Wars) 2004; 64: 19-31.
Zhang H, Cuevas J. Sigma receptors inhibit high-voltage-activated calcium channels in rat sympathetic and parasympathetic neurons. J Neurophysiol 2002; 87: 2867-79.
Zhang H, Cuevas J. sigma Receptor activation blocks potassium channels and depresses neuroexcitability in rat intracardiac neurons. J Pharmacol Exp Ther 2005; 313: 1387-96.
Zhang YJ, Xu YF, Dickey CA, Buratti E, Baralle F, Bailey R, et al. Progranulin mediates caspase- dependent cleavage of TAR DNA binding protein-43. J Neurosci 2007; 27: 10530-4.
Zou LB, Yamada K, Sasa M, Nakata Y, Nabeshima T. Effects of sigma(1) receptor agonist SA4503 and neuroactive steroids on performance in a radial arm maze task in rats. Neuropharmacology 2000; 39: 1617-27.
216