Intestinal Transcriptomes in Kazakh Sheep with Different Haplotypes After Experimental Echinococcus Granulosus Infection

Parasite 28, 14 (2021) Ó X. Li et al., published by EDP Sciences, 2021 https://doi.org/10.1051/parasite/2021011 Available online at: www.parasite-journal.org

RESEARCH ARTICLE OPEN ACCESS

Intestinal transcriptomes in Kazakh sheep with different haplotypes after experimental Echinococcus granulosus infection

Xin Li1,2,a, Song Jiang2, Xuhai Wang2, and Bin Jia2,*

1 College of Life Sciences, Shihezi University, Road Beisi, Shihezi 832003, Xinjiang, PR China 2 College of Animal Science and Technology, Shihezi University, Road Beisi, Shihezi 832003, Xinjiang, PR China Received 8 October 2020, Accepted 4 February 2021, Published online 5 March 2021

Abstract – Cystic echinococcosis (CE) is a chronic zoonosis caused by infection with the larval stage of the cestode Echinococcus granulosus. As the intermediate host, sheep are highly susceptible to this disease. Our previous studies have shown that sheep with haplotype MHC Mva Ibc-Sac IIab-Hin1I ab were resistant to CE infection, while their counterparts without this haplotype were not. In order to reveal the molecular mechanism of resistance in Kazakh sheep, after selecting the differential miRNA in our previous study, herein, transcriptome analyses were conducted to detect the differential expression genes in the intestinal tissue of Kazakh sheep with resistant and non-resistant MHC haplotypes, after peroral infection with E. granulosus eggs. A total of 3835 differentially expressed genes were identiﬁed between the two groups, with 2229 upregulated and 1606 downregulated. Further function analysis showed that the most signiﬁcant genes were related to both innate immune response and adaptive response participating in the defense against E. granulosus infection and the metabolic changes associated with it. The results suggest that genes related to lectin receptors, NK cells activation, chemokines, and tumor necrosis factor, may play important roles in the response of intestinal tissue to E. granulosus.

Key words: Differentially expressed genes, Disease resistance, Echinococcus granulosus, Intestinal tissue, Transcriptome analysis.

Re´sume´ – Transcriptomes intestinaux chez des moutons kazakhs de différents haplotypes après une infection expérimentale avec Echinococcus granulosus. L’échinococcose kystique (EK) est une zoonose chronique qui est causée par une infection au stade larvaire du cestode Echinococcus granulosus. En tant qu’hôte intermédiaire, les moutons sont très sensibles à cette maladie. Nos études précédentes ont montré que les moutons avec l’haplotype MHC Mva Ibc-Sac IIab-Hin1I ab étaient résistants à l’EK, alors que leurs homologues sans cet haplotype ne l’étaient pas. Afin de révéler le mécanisme moléculaire de la résistance chez le mouton kazakh, après avoir sélectionné le miARN différentiel dans notre étude précédente, des analyses de transcriptome ont été menées dans ce travail pour détecter les gènes d’expression différentielle dans le tissu intestinal de mouton kazakh avec des haplotypes MHC résistants et non résistants, après une infection pérorale par des œufs d’E. granulosus. Un total de 3835 gènes différentiellement exprimés ont été identifiés entre les deux groupes, avec 2229 régulés à la hausse et 1606 à la baisse. Une analyse fonctionnelle plus poussée a montré que les gènes les plus significatifs étaient liés à la fois à la réponse immunitaire innée et à la réponse adaptative participant à la défense contre l’infection à E. granulosus et aux changements métaboliques qui y étaient associés. Les résultats suggèrent que les gènes liés aux récepteurs de la lectine, à l’activation des cellules NK, aux chimiokines et au facteur de nécrose tumorale peuvent jouer un rôle important dans la réponse du tissu intestinal à E. granulosus.

Introduction E. granulosus is complex and involves two hosts: definitive and intermediate. Infection with E. granulosus occurs after oral Cystic echinococcosis (CE), a zoonotic disease caused by ingestion of infective eggs (an oncosphere containing the inva- Echinococcus granulosus, poses a great threat to the health of sive hexacanth [9]). The hexacanth then hatches in the small humans and domestic animals [51]. The life cycle of intestine of the intermediate host, penetrates the mucosal tissue, enters the blood circulation system, and migrates to various * Corresponding author: [email protected] organs (e.g. the liver and lungs), where it develop cysts filled a Institutes 1 and 2 contributed equally. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 2 X. Li et al.: Parasite 2021, 28,14 with fluid and protoscoleces [6]. However, in definitive hosts Transcriptome sequencing aims at the set of all transcripts, like dogs, adult parasites develop from the protoscolex in the including mRNAs, rRNA, tRNA, and other noncoding RNAs, intestine. In domestic animals, especially in sheep, which produced in one or a population of cells in a specific develop- appear to be highly susceptible to infection [38], CE causes mental stage or physiological condition [13]. In the present considerable health problems and thereby significantly affects study, using high-throughput transcriptome sequencing, we the income of herders [32]. screened a number of differential genes in the small intestinal Echinococcus granulosus infection in the host is a complex tissue of Kazakh sheep after infection with E. granulosus.In dynamic process, which involves the recognition and interac- terms of their functions, we concluded that innate immune tion of a variety of biological molecules, including genes response plays the first defense role in CE resistance in sheep. [33], proteins [1], and miRNAs [42]. Upregulation or downreg- In addition, adaptive immune response played an important role ulation of molecular expression likely causes different individ- in defense against E. granulosus infection. Moreover, our study uals of the same host to have different resistance, similarly to revealed that metabolic changes contribute to defense against reports about Plasmodium homocircumflexum [17]. It is very E. granulosus infection. These findings laid the foundation important to understand the interaction mechanisms between for a discussion of the molecular mechanism of Kazakh sheep the host and the parasite. Research and discussions about these resistance to E. granulosus. mechanisms will help to determine the key factors of immune regulation in the host from the perspective of molecular biology, and further explore the mechanism of disease resistance. Materials and methods This research will also provide new ideas for mining molecular Ethics statement markers of disease resistance and directional genetic breeding [19]. This study was performed in strict compliance with the rec- Previously, we carried out a series of studies to research the ommendations of the National Institutes of Health guideline for relationship between MHC polymorphisms and resistance or the care and use of laboratory animals (NIH Publication susceptibility to CE in native Chinese sheep, including Chinese No. 8023, revised 1978), and the Animal Care and Use Com- Merino [21], Duolang [28], and Kazakh sheep [29]. Our previ- mittee of Shihezi University approved all procedures and exper- ous studies indicated that in Kazakh sheep, when exposed to the iments (Approval No. A2018-138-01). Local strain dogs and same number of parasites, the rate of E. granulosus infection in Kazakh sheep were purchased from farmers around Shihezi the internal organs of sheep with haplotype MHC MvaI city. The farmers gave oral consent for the use of their animals bc-SacII ab-Hin1I ab haplotype was significantly lower than in this research after they were provided with explanations in sheep without this haplotype. Statistical results and analysis about the purpose of the research and on efforts to ensure the showed that sheep with this haplotype have an increased welfare of animals. genetic capability to respond to and subsequently reject E. granulosus when infected. The haplotype MHC MvaI bc-SacII ab-Hin1I ab was therefore identified as a genetic mar- Animals and experimental design ker of CE resistance in Kazakh sheep [29]. Afterwards, studies were conducted to reveal the mecha- The preparation method of the experimental materials was nism of CE resistance in Kazakh sheep, and most of our similar to previous research reports [22]. Since no studies have research was focused on intestinal tissue. It has been found that shown that the CE resistance of sheep is related to sex, 2-year- when sheep were infected with oncospheres (larvae of old Kazakh ewes with CE-resistant [MvaIbc-SacII ab-Hin1I ab E. granulosus), the small intestine tissue was the first mucosal (R)] and CE-non-resistant [MvaIbc-SacIIab-Hin1Iab (NR)] immune barrier that must be passed through, where various haplotypes were selected, as described previously, and raised antibodies, cytokines, and other immune molecules are on the farm of Shihezi University. All animals were raised expressed in response to exogenous stimuli [12]. These mole- under the same conditions of free access to water and food, cules could be involved in stopping larval growth of E. granu- in natural lighting. They were divided into two groups accord- losus at the very first stages [11, 21, 28, 29]. Hence, we were ing to their MHC haplotype: three sheep with the CE-resistant interested to see the molecular mechanisms of CE resistance haplotype were referred to as the CE-R group, three sheep with in Kazakh sheep with the resistant haplotype, at the very first the CE-non-resistant haplotype constituted the CE-NR group, stage of infection. Against this background, we previously per- and a single sheep with the CE-non-resistant haplotype formed formed microRNA sequencing, and found several microRNAs the CK (Control Check) group. All the sheep were screened for in the intestinal tissue, which were related to the inflammatory the absence of hydatid cysts and were healthy prior to the pathway and played important roles in CE resistance in sheep experiment. In line with the previous approach, all the sheep [22]. Since microRNAs exert their functions by regulating the were orally infected with E. granulosus eggs. Since our previ- expression of target genes, we were curious to see whether ous research showed that there were already significant differ- genes related to inflammation and immune response were var- ences in miRNAs in the small intestine at 8 h after infection, ied in these sheep, including innate immune cells activation, we speculated that differential gene expression may occur at chemokines, and tumor necrosis factor. It is, therefore, neces- the same time point. As a result, all animals were sacrificed sary to conduct genome-wide characterization of transcriptome 8 h after infection. Immediately afterward, the intestinal tissue profiles involved in resistance to CE infection in sheep, espe- of every sheep was removed. Approximately 100-mm3-sized cially in sheep with different CE resistance. intestinal tissue blocks were collected and frozen immediately X. Li et al.: Parasite 2021, 28,14 3 in liquid nitrogen prior to long-term storage at 80 °Cuntil directly used to compare the differences in gene expression RNA extraction. between samples.

Experimental pipeline of RNA-seq and quality Screening and veriﬁcation of differentially control expressed genes (DEGs)

Total RNA was isolated from every sample using TRIZOL After the alignment result passed QC, according to the sig- reagent, and divided into two parts, one for RNA-seq, and the nificance of digital gene expression profiles which were other for real-time PCR to verify the expression of genes reported on genome research by Audio [2], only genes with a detected by RNA-seq. value of FDR 0.001 and |log2 ratio| 1 were selected as During the RNA-seq process, after DNase I treatment, mag- DEGs. Since DEG analysis generated a large number of prob- netic beads with Oligo (dT) were used to isolate mRNA. Mixed lems in which thousands of hypotheses (is gene x differentially with the fragmentation buffer, the mRNA was fragmented into expressed between the two groups) were tested simultaneously, short fragments. Then, cDNA was synthesized using mRNA correction for false-positive (type I errors) and false-negative fragments as templates. cDNA fragments were purified and (type II) errors was performed using the False Discovery Rate resolved with EB buffer for end reparation and adenine addi- (FDR) method [4]. We assumed that we picked out R differen- tion. After that, the fragments were connected to adapters. After tially expressed genes in which S genes actually showed differ- agarose gel electrophoresis, the suitable fragments were ential expression and the other V genes were false positives. As selected for the polymerase chain reaction (PCR) amplification we decided that the error ratio “Q = V/R” must stay below a cut- as templates. During the quality control (QC) steps, an Agilent off, we preset the FDR to a number no larger than 0.001. 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR Sys- In addition, before transcriptome functional annotation, nine tem were used for the quantification and qualification of the differentially expressed genes were randomly selected to con- sample library. In this process, the intestinal tissue of every duct real-time PCR analysis to verify the expression of genes sheep in the CE-R group was prepared to an individual detected by RNA sequence. The GAPDH gene was used as paired-end library for RNA-seq, like in the CE-NR group. Each an internal control (for PCR verifications only). Primer library was sequenced using Illumina HiSeq 2000 (BGI, Huada sequences are listed in Table 1. The mRNA expression levels Genomics Institute, Shenzhen, China). for all samples were normalized to the level for GAPDH house- Primary sequencing data produced using Illumina HiSeq keeping genes. The expression level in every sample group was 2000, called raw reads, were filtered with the SOAPnuke pro- expressed by the mean ± standard deviation (x ± s). The data gram (version 1.5.0) [27] by (1) removing reads containing were analyzed by SPSS17.0 software. sequencing adapters; (2) removing reads whose low quality base ratio (base quality less than or equal to 5) was more than 20%; and (3) removing reads whose unknown base (“N” base) Functional annotation ratio was more than 5%, after clean reads were obtained and stored in FASTQ format. After the above quality control Gene Ontology (GO) enrichment analysis provides all GO (QC) step, raw reads were filtered into clean reads. Because terms that significantly enriched in a list of DEGs, compared to the CE-R group contained the clean data from three individual a genome background, and filter the DEGs that correspond to libraries (for three samples), these data were combined to form specific biological functions. All DEGs between two groups the clean data of the CE-R group, and were aligned to the ref- were mapped to GO terms in the database (http://www.geneon- erence genome with SOAPaligner/SOAP2 [26], like in the CE- tology.org/), calculating gene numbers for every term. We then NR group. In this search, the sheep oar3.1 database of livestock used hypergeometric tests to find significantly enriched genomics was selected as the reference genome (http://www. GO terms in the input list of DEGs, based on the GO:TermFin- livestockgenomics.csiro.au/sheep/oar3.1.php/). der program (http://smd.stanford.edu/help/GO-TermFinder/ fi The clean data were used to calculate the distribution of GO_TermFinder_help.shtml/). GO terms ful lling a threshold fi fi reads on reference genes and perform coverage analysis. Gene of p-value 0.05 were de ned as signi cantly enriched GO coverage was calculated as the percentage of a gene covered by terms in DEGs. This analysis was able to recognize the main reads. This value is equal to the ratio of the base number in a biological functions that DEGs exercise. gene covered by unique mapping reads to the total base number Functional annotations of the DEGs were conducted using of that gene by the SAMtools program. the Blast2GO program against the public the NCBI nr database. The Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg/) library was used to classify and Normalization of expressed genes group these identified DEGs.

There are many different patterns to normalize the gene expression level. In this search, we used the RPKM method Results [36] (Reads per kilobase transcriptome per million mapped reads), because it is able to eliminate the inﬂuence of different In the present study, ﬁrstly, RNA-sequence analysis showed gene lengths and sequencing discrepancy on the calculation of that 46,934,632 reads were obtained in the CE-R group, gene expression. Therefore, the calculated results can be 76.60% of which matched the reference genome. The number 4 X. Li et al.: Parasite 2021, 28,14

Table 1. Primer sequences for qRT-PCR analysis of gene transcripts. Gene Primer sequences (50–30) Expected size (bp) Annealing temperature (°C) NTNG1 F: CAAAGACAGGTTCGCATT 214 59.5 R: CCTTCCGTGCACTTTTAT EphA3 F: CCAGCGATGTATGGAGTTA 180 58.5 R: CTTTCTGCCAGCAGTCTAG NCOA1 F: GATCTAACCTCCCTTCTGCTTTT 228 61 R: GGAACAGAGAGGACAACGCA SCD F: CGCTGGCACATCAACTTTACC 124 56.6 R: TTTCCTCTCCAGTTCTTTTCATCC GHR F: AGGTTGCTCAGCCACAAA 281 58.9 R: TGGGGAAAGGACCACATT SMAD3 F: CGACTACAGCCATTCCATCC 120 60.5 R: TGGTCACTGGTCTCTCCATCT TGFBR1 F: ATTCTGTGGCTTTGCCTGAA 175 60 R: GCAGTTTCCTGGGTCTGAAG IGF1 F: GACAGGAATCGTGGATGAGTG 270 57 R: AACAGGTAACTCGTGCAGAGC LPL F: GTCATCGTGGTGGACTGG 398 59.3 R: TGGAAAGTGCCTCCGTTA GAPDH F: CTGACCTGCCGCCTGGAGAAA 149 59.0 R: GTAGAAGAGTGAGTGTCGCTGTT

Table 2. Alignment statistics of reads and reference genome. Alignment types CE-R CE-NR CK Total reads 46934632 47203918 47241022 Total base pairs 4224116880 4248352620 4251691980 Total mapped reads 35950168(76.60%) 38570247 (81.71%) 35662569 (75.49%) Perfect matched reads 24082846 (51.31%) 24897763 (52.75%) 21930554 (46.42%) 5 bp Mismatched reads 11867322 (25.28%) 13672484 (28.96%) 13732015 (29.07%) Unique match 30693890 (65.40%) 27695773 (58.67%) 28046058 (59.37%) Multi-position match 5256278 (11.20%) 10874474 (23.04%) 7616511 (16.12%) Total unmapped reads 10984464 (23.40%) 8633671 (18.29%) 11578453 (24.51%)

of unique match reads was 30,693,890, accounting for 65.40% lectin receptors, including CLEC9A, CLEC10A,andCLEC4G of the total reads. Similarly, 47,203,918 reads were obtained in were significantly more highly expressed in the CE-R group than the CE-NR group, with 81.71% matching to the reference gen- in the CE-NR group. Secondly, we found that a large number of ome. The number of unique match reads was 27,695,773, DEGs related to NK cell activation (KLRC2, IRAK1, FCRL6,and accounting for 58.67% of the total. Detailed information is NKG7), mast cell activation (MCP1 and IRCP1), and T cells were listed in Table 2. significantly more highly expressed in the CE-R group than in the Results showed that 16,346 genes were detected in CE-R CE-NR group. Additionally, genes related to chemokines group samples, while 16,038 were detected in the CE-NR group (CXCL12, CXCL14, CCL4, CCL5, CCL11, CCL25,and (Fig. 1A). Furthermore, the analysis of DEGs showed 3835 CCL28), compensatory inflammation repair mechanisms genes which were different in the CE-R group compared with (CYP17A1, CYP1A1, CYP2C19,andCYP3A24), and tumor CE-NR group, of which 2229 were upregulated and 1606 were necrosis factor (TNFRSF13B, TNFRSF17, TNFRSF1A, downregulated. The Venn diagrams of DEGs between groups TNFRSF4, TNFSF10, TNFSF13, TNFSF15, TNFSF18)were are shown in Figures 1B and 1C. Scatter charts of detected genes more highly expressed in the CE-resistant group than in the CE- are shown in Figure 2, where the X-axis and Y-axis present two non-resistant sheep (Table 3). In addition, some genes related to samples log2 value of expression, red (up) and green (down) MHC were also significantly more highly expressed in the CE- dots mean the gene has significant differences (FDR 0.001, R group than in the CE-NR group, including LOC101103957, two fold difference), and the blue dot means no significant dif- LOC101108696, LOC101109747, LOC101120148, LOC10 ference. A heatmap highlights the patterns of expression for 1109080, LOC101105609 and LOC101107908. many DEGs between two sample groups (Fig. 3). Furthermore, nine genes with a differential expression level In summary, GO functional clustering and KEGG pathway were randomly selected to conduct real-time PCR validation of analysis showed that various DEGs related to immune response the transcriptome analysis. The results from real-time PCR are were significantly more highly expressed in the CE-R group than shown in Figure 4, and strongly correlated with those generated in the CE-NR group. Firstly, we found that some genes related to from transcriptome analysis. X. Li et al.: Parasite 2021, 28,14 5

Figure 1. Venn diagram of all genes and differential expression genes (DEGs) between groups. Figure 1A shows all identiﬁed genes in each group. Figure 1B shows the upregulated DEGs between groups, while Figure 1C shows the downregulated DEGs between groups.

Figure 2. Scatter chart of differential expression genes between groups. Figure 2A shows differential expression genes between the CE-R and CE-NR groups. Figure 2B shows differential expression genes between the CE-R and CK groups. Figure 2C shows differential expression genes between the CE-NR and CK groups. X-axis and Y-axis presents two samples log2 value of gene expression, and the expression was calculated using the RPKM method (reads per kilobase transcriptome per million mapped reads) as shown in section “Materials and methods”, red (up) and green (down) dots mean the gene has signiﬁcant differences (FDR 0.001, two fold difference), and the blue dot means no signiﬁcant differences.

Discussion the immune response mechanism in the intestine might be related to disease resistance. The experimental results conﬁrmed Based on previous studies, we speculated that the small our hypothesis that DEGs related to innate immune response intestine of Kazakh sheep with different MHC genotypes was and adaptive immune response were found in different groups the ﬁrst line of defense against E. granulosus infection, and of sheep, some of which are worthy of attention. 6 X. Li et al.: Parasite 2021, 28,14

Table 3. Partial differential expression genes in the intestine, organized according to their function group. Gene Gene ID Description Fold change between CE-R and CE-NR Epithelial barrier-lectin secretion CLEC9A 101119033 C-type lectin domain containing 9A 11.73 CLEC10A 101117600 C-type lectin domain containing 10A 3.1 CLEC4G 101123627 -type lectin domain containing 4G 8.13 NK cell activation IRAK1 101121405 Interleukin-1 receptor-associated kinase 1 3.24 NKG7 101115817 Natural killer cell granule protein 7 7.65 Mast cell activation and immune killing MCP1 443546 Monocyte chemoattractant protein-1 4.59 IRAK1 101121405 Interleukin-1 receptor-associated kinase 1 3.24 T lymphocyte activation NFATC2 101119239 Recombinant nuclear factor of activated T cells, cytoplasmic 2 5.38 NFAT5 101113952 Nuclear factor 5 of activated T cells 2.93 Chemokine expression CXCL12 101121145 Chemokine (C-X-C motif) ligand 12 3.42 CXCL14 101105243 Chemokine (C-X-C motif) ligand 14 4.61 CCL4 101114285 Chemokine (C-C motif) ligand 4 2.88 CCL5 101115553 Chemokine (C-C motif) ligand 5 10.24 CCL11 101119832 Chemokine (C-C motif) ligand 11 5.41 CCL25 678679 Chemokine (C-C motif) ligand 25 4.2 CCL28 780500 Chemokine (C-C motif) ligand 28 4.48 Promote white blood cell migration TICAM1 101111016 Toll like receptor adaptor molecule 1 3.82 Compensatory inﬂammation repair mechanism CYP17A1 493968 Cytochrome P450, family 17, subfamily A, polypeptide 1 15 CYP1A1 100170113 Cytochrome P450, family 1, subfamily A, polypeptide 1 5.9 CYP2C19 100534653 Cytochrome P450, family 2, subfamily C, polypeptide 19 11 CYP3A24 100170111 Cytochrome P450, family 3, subfamily A, polypeptide 24 7.91 TNF expression related TNFRSF13B 101122200 Tumor necrosis factor receptor superfamily member 13B 4.18 TNFRSF17 101111149 Tumor necrosis factor receptor superfamily member 17 14.75 TNFRSF1A 100135698 Tumor necrosis factor receptor superfamily member 1A 3.03 TNFRSF4 101108407 Tumor necrosis factor receptor superfamily member 4 2.88 TNFSF10 101114153 Tumor necrosis factor receptor superfamily member 10 3.36 TNFSF13 101123054 Tumor necrosis factor receptor superfamily member 13 3.13 TNFSF15 101102957 Tumor necrosis factor receptor superfamily member 15 2.97 TNFSF18 101108765 Tumor necrosis factor receptor superfamily member 18 5.15 MHC related LOC101103957 101103957 / 6.11 LOC101108696 101108696 / 4.45 LOC101109747 101109747 / 3.38 LOC101120148 101120148 / 3 LOC101109080 101109080 / 12.71 LOC101105609 101105609 / 6.35 LOC101107908 101107908 / 4.92

fi Innate immune response plays the first defense CLEC10A,andCLEC4G genes was signi cantly higher in role in CE resistance in sheep the CE-R group than in the CE-NR group. All these genes are C-type lectin receptor family members, which has been The innate immune system is the first line of defense for the demonstrated for immunomodulatory effects against parasitic host to protect itself against invasion and infection by various infections in the epithelial layer [45]. Reports have shown that parasites. During the infection process, as important recognition upregulation of C-type lectin genes is beneficial to recognition receptors, lectins can bind with carbohydrate molecules on the of parasite antigens, thus activating antigen presentation more surface of parasites, initiate related immune response, kill and effectively [31], which has a positive effect on disease resis- eliminate invasive parasites, and play an important role in tance [18, 49]. Based on these reports and our findings, we innate immunity against parasite infection. speculated that the high regulation of lectin receptor genes in In this study, we found that when Kazakh sheep were the intestinal tissue may enhance the recognition of parasite infected with oncospheres, the expression of CLEC9A, antigens and present them to the internal immune cells, which X. Li et al.: Parasite 2021, 28,14 7

Figure 3. Heatmap of partial DEGs between sample groups. can induce the immune system to kill the parasite. This effect cells [5], and macrophages [8] can also be activated and was more significant in the CE-R sheep than in the CE-NR produce immune response when host tissues are infected by sheep, and it may lead to different E. granulosus resistance parasites. Reports have shown that if the expression levels of of Kazakh sheep with different MHC genotypes. genes related to the activation and receptor recognition of these Furthermore, MHC class I chain-related protein A (MICA) cells are upregulated, this may promote phagocytosis [37], kill- is a natural ligand of C-type lectin like activated receptor, which ing of parasites [43]andinflammatory response [20] of hosts, is mainly expressed in the human intestinal epithelium. Cellular and result in stronger resistance to parasites. stress such as parasitic infections and inflammation can upreg- Natural killer cells are responsible for activating the cyto- ulate the expression of MICA [3]. However, although we found toxic killing effect in infections, mainly to defend against early that CLEC9A and other genes were upregulated in CE-R group, infections by viruses [34], bacteria [15], and parasites [41]. The no evidence showed corresponding MHC natural ligand. This killing effect of NK cells on target cells depends on intracellular should be studied further. interaction of activated and inhibitory receptors on the cell sur- In addition to the antigen recognition system, innate face [10]. NKG7 (Natural killer cell granule protein 7) serves as immune cells, including natural killer (NK) cells [43], mast an activating receptor for NK cells, which is associated with 8 X. Li et al.: Parasite 2021, 28,14

Figure 4. Validation of transcriptome data by qRT-PCR on nine randomly selected genes. Real-time PCR was employed to verify the regulation of genes detected by transcriptome. Nine differential expression genes were randomly selected. GAPDH was used as an internal control. inflammatory diseases, since it could augment the production of and produce immediate inflammation. This can be evidenced inflammatory factors, including IFN-c, responsible for type I by the upregulation of genes related to inflammation and immune responses [44]. In this study, the expression of chemokines. NKG7 was significantly higher in the CE-R group than in the CE-NR group, with a fold change of 7.65 (p-value: 3.38E- Adaptive immune response played an important 211, FDR: 1.04E-209). A current study by Ng (personal com- role in defense against E. granulosus infection munication) showed that NKG7 was one of the most upregulated genes from the livers of mice infected with Leishmania It has been demonstrated that the mechanisms of host donovani. Results indicated that NKG7 regulated the proinflam- immune response to CE infection are complex. Response matory responses effectively, and the survival of the parasite involves not only the innate immune system but also the adap- was obviously affected [39]. Given these reports, and the results tive immune system. In addition, we found that adaptive of our study, we inferred that the high expression of NKG7 in immune response played an important role in defense against CE-R sheep is beneficial for the host to activate NK cells and E. granulosus infection. Nuclear factor of activated T cells kill parasites, which is beneficial for CE resistance. (NFAT) could activate T cell response, thus the transcription Mast cells are widely distributed around the capillaries of cytokines and other genes in immune response [24]. Besides under the skin and visceral mucosa, secreting a variety of T cells, NFAT is also expressed on many immune cells, such as cytokines, which participate in immune regulation (TB cell Blymphocytes[23]. In this study, we found that the expression and APC cell activation), and express MHC and B7 molecules of NFATC2 was higher in the CE-R group than in the CE-NR [16]. In our study, we found that mast cell-related genes, includ- group, with a 5.38 fold change (p-value: 4.04E-51, FDR: ing FCRL6 and IRAK-1, were highly expressed in the CE-R 3.17E-50). Furthermore, the NFAT5 was upregulated in the group. IRAK-1 is related to Toll-like receptors (TLRs). When CE-R group, with a 2.93 fold change (p-value: 1.84E-27, oncospheres of the parasite infect the small intestinal tissue, var- FDR: 8.91E-27). Therefore, it was speculated that the high ious antigens secreted by the parasite can be recognized by mast expression of NFAT-activated T cells, or expressed on B cells, cells through TLRs, which activate effective immune response induces adaptive immune response, and produces antibodies. X. Li et al.: Parasite 2021, 28,14 9

As expected, in our study, we found that IgM and IgE were sig- organ. These types of inhibitory effects might be related to nificantly more highly expressed in CE-resistant sheep than in the artificial infection resistance in the small intestinal tissue non-resistant sheep. of Kazakh sheep reported by us previously [4, 5]. This is the first finding of a relationship between retinol metabolism and CE resistance in the host. Metabolic changes during defense responses In conclusion, we found a number of genes related to the against E. granulosus infection in Kazakh sheep resistance of Kazakh sheep to echinococcosis in the present Finally, our study revealed that cytochrome metabolism study, mainly related to lectin secretion, immune cell activation, may contribute to defense against E. granulosus infection. antigen binding, chemokine expression, and metabolic path- KEGG pathway enrichment analysis showed that many DEGs ways like retinol. Further studies, like using RNAi or Crispr/- associated with Cytochrome 450 (CYP450), including CYP1A, cas9 to verify the function of these genes are still needed in CYP3A and CYP26A in CE-resistant sheep were clearly higher the future. In addition to transcriptomics analysis, Multi-omics than in CE-non-resistant sheep. These DEGs were mainly research including proteomics, metabolomics, and lipidomics is enriched in the “metabolism of xenobiotics by cytochrome still needed to reveal the molecular mechanism of CE resistance P450” pathway (46 genes, p-value: 2.357955e-08; Pathway in Kazakh sheep with the resistant haplotype. We are currently ID: ko00980) and “drug metabolism – cytochrome P450” path- carrying out a proteomics study to select different proteins in way (39 genes, p-value: 5.695932e-08, Pathway ID: ko00982). the intestinal tissue of these Kazakh sheep. Combined with The CYP450 enzymes family includes membrane-bound hemo- the results of this study, we hope future results will enable us proteins that play a pivotal role in the detoxification of xenobi- to provide a comprehensive explanation of resistance to CE otics, cellular metabolism, and homeostasis [14]. It has been in Kazakh sheep. reported that genes of the CYP450 family varied similarly in Acknowledgements. This work was supported by the National the liver of experimental mice infected with E. multilocularis Natural Science Foundation of China (Grant Nos. 31260535 and [30]. Moreover, a recent study demonstrated that members of 31402048). the CYP family CYP1A could enhance inflammatory responses [48]. This aligns with the results of our previous study showing several upregulated miRNAs, which are related to NF-KB Conflict of interest inflammation pathways, and play important roles in the response of intestinal tissue to E. granulosus infection in sheep The authors declare that they have no conflicts of interest in with resistant haplotypes [22]. We can infer that the upregula- this work: we declare that we do not have any commercial or tion of the CYP family in the present study might enhance associative interest that represents a conflictofinterestincon- inflammatory responses, thus contributing more strongly to nection with the work submitted. defense responses to CE infection in CE-R sheep than in CE-NR sheep. In addition, we found that retinol metabolism is associated References with CE infection in sheep. After CE infection, 38 DEGs associated with retinol metabolism, including ADH [7], RDH [50], 1. Anand N, Kanwa R, Dubey M, Vahishta R, Sehgal R, Verma A, UGT [25], and LRAT [35], were significantly higher in Kanwar J. 2015. Effect of lactoferrin protein on red blood cells CE-resistant sheep than in non-resistant sheep. These genes and macrophages: mechanism of parasite-host interaction. Drug are already known to be associated with the binding, metabolic Design Development and Therapy, 9, 3821–3835. process, and transport of retinol. Reports have shown that reti- 2. Audic S, Claverie JM. 1997. The significance of digital gene nol plays an important role in maintaining host immune func- expression profiles. Genome Research, 7(10), 986. tion. Cotton rats lacking retinol had a significantly higher 3. Bauer S, Groh V, Wu J, Steinle A, Phillips JH, Lanier LL, Spies infection rate of filarial worms compared with normal cotton T. 1999. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science, 285(5428), 727– rats [46], and a similar finding was reported in research of fi 729. human infection with larial worms [40]. Parasites may take 4. Benjamini Y, Yekutieli D. 2005. False discovery rate–adjusted retinol preferentially from the host at the infected site for their multiple confidence intervals for selected parameters. Journal of own development, differentiation, growth, and reproduction. the American Statistical Association, 100(469), 71–81. High concentrations of retinol in worms have a significant 5. Bidri M, Vouldoukis I, Mossalayi MD, Debr P, Guillosson JJ, effect on their growth rate. Other studies have suggested that Mazier D, Arock M. 1997. Evidence for direct interaction retinol is critical to defense against parasite infections, and this between mast cells and Leishmania parasites. Parasite Immunol- is due to the fact that a lack of retinol damages the epithelial ogy, 19(10), 475–483. tissue barrier and helps filariae to penetrate and migrate in the 6. Bronnert J, Wulff A, Hillejan L, Reiter-Owona I. 2017. host, and local immune response of the mucosal surface thereby Pulmonary Echinococcus granulosus infection. Infection, 45 (4), 1–2. decreases [47]. Retinol is, therefore, vital in host resistance to fi 7. Chase JR, Poolman MG, Fell DA. 2009. Contribution of NADH parasitic infections. Based on these ndings, we speculated that increases to ethanol’s inhibition of retinol oxidation by human the high expression of these genes in the CE-R group might ADH isoforms. Alcoholism, Clinical and Experimental play an important role in intestinal defense against E. granulo- Research, 33(4), 571–580. sus infection, by hindering parasite damage to the epithelial tis- 8. Coakley G, Harris NL. 2020. Interactions between macrophages sue barrier, as well as penetration and migration to the host and helminths. Parasite Immunology, 42(7), e12717. 10 X. Li et al.: Parasite 2021, 28,14

9. Conn DB, Swiderski Z. 2008. A standardised terminology of the 26. Li R, Yu C, Li Y, Lam T-W, Yiu S-M, Kristiansen K, Wang J. embryonic envelopes and associated developmental stages of 2009. SOAP2: an improved ultrafast tool for short read tapeworms (Platyhelminthes: Cestoda). Folia Parasitologica, 55 alignment. Bioinformatics, 25(15), 1966–1967. (1), 42–52. 27. Li RQ, Zhu HM, Ruan J, Qian WB, Fang XD, Shi ZB, Li YR, 10. Cooper MA, Fehniger TA, Fuchs A, Colonna M, Caligiuri MA. Li ST, Shan G, Kristiansen K, Li SG, Yang HM, Wang J, Wang 2003. NK cell and DC interactions. Trends in Immunology, 25 J. 2010. De novo assembly of human genomes with massively (1), 47–52. parallel short read sequencing. Genome Research, 20(2), 265– 11. Du X, Hui W, Zhao B, Guo Y, Ma J, Ma S, Muyesaer B, Liu X, 272. Jia B. 2012. Construction of subtracted library of small intestine 28. Li RY, Hui WQ, Jia B, Shi GQ, Zhao ZS, Shen H, Peng Q, Lv in Kazakh sheep with two MHC-DRB1 genotype infected by LM, Zhou QW, Li HT. 2011. The relationship between MHC- Echinococcus oncosphere. Journal of Shihezi University DRB1 gene second exon polymorphism and hydatidosis (Natural Science), 30(5), 587–591. resistance of Chinese Merino (Sinkiang Junken type), Kazakh 12. Emrah E, Bora Ö, Fatih M, Serkan K, Izzet_ Sß. 2017. Molecular and Duolang sheep. Parasite, 18(2), 163–169. characterization of Echinococcus granulosus isolates obtained 29. Li RY, Jia B, Zhang WJ, Zhao ZS, Shi GQ, Shen H, Peng QA, from different hosts. Mikrobiyoloji Bulteni, 51(1), 79–86. Lv LM, Zhou QW, Du YC. 2010. Analysis of the relationship 13. Eng CHL, Lawson M, Zhu Q, Dries R, Koulena N, Takei Y, Yun between MHC-DRB1 gene polymorphism and hydatidosis in J, Cronin C, Karp C, Yuan GC, Cai L. 2019. Transcriptome-scale Kazakh sheep. Asian-Australasian Journal of Animal Sciences, super-resolved imaging in tissues by RNA seqFISH+. Nature, 23(9), 1145–1151. 568(7751), 235–239. 30. Lin R, Lü G, Wang J, Zhang C, Xie W, Lu X, Mantion G, 14. Feng S, He X. 2013. Mechanism-based Inhibition of CYP450: Martin H, Richert L, Vuitton DA, Wen H. 2017. Time course of An indicator of drug-induced hepatotoxicity. Current Drug gene expression profiling in the liver of experimental mice Metabolism, 14(9), 921–945. infected with Echinococcus multilocularis. PLoS One, 6(1), 15. Fink LN, Zeuthen LH, Christensen HR, Morandi B, Frøkiaer H, e14557. Ferlazzo G. 2007. Distinct gut-derived lactic acid bacteria elicit 31. Liu B, Li P, Yang G. 2015. The immunomodulatory role of divergent dendritic cell-mediated NK cell responses. Interna- c-type lectin receptors in parasitic infection. Chinese Journal of tional immunology, 19(12), 1319–1327. Parasitology & Parasitic Diseases, 33(3), 228–232. 16. Frossi B, Mion F, Pucillo C. 2016. Deciphering new mecha- 32. Liu C, Xu Y, Cadavid-Restrepo AM, Lou Z, Yan H, Li L, Fu B, nisms on T-cell costimulation by human mast cells. European Gray DJ, Clements AA, Barnes TS, Williams GM, Jia W, Journal of Immunology, 46(5), 1105–1108. Mcmanus DP, Yang Y. 2018. Estimating the prevalence of 17. Garcia-Longoria L, Palinauskas V, Ilgunas M, Valkiunas G, Echinococcus in domestic dogs in highly endemic for Hellgren O. 2020. Differential gene expression of Plasmodium echinococcosis. Infectious Diseases of Poverty, 7(1), 77. homocircumflexum (lineage pCOLL4) across two experimen- 33. Liu S, Zhou X, Hao L, Piao X, Hou N, Chen Q. 2017. Genome- tally infected passerine bird species. Genomics, 112(4), 2857– wide transcriptome analysis reveals extensive alternative splic- 2865. ing events in the protoscoleces of Echinococcus granulosus and 18. Geijtenbeek T, Gringhuis S. 2009. Signalling through C-type Echinococcus multilocularis. Frontiers in Microbiology, 8, 929. lectin receptors: shaping immune responses. Nature Reviews 34. Liu Y, Zheng J, Liu Y, Wen L, Huang L, Xiang Z, Lam K, Lv Immunology, 9(7), 465–479. A, Mao H, Lau YL, Tu W. 2018. Uncompromised NK cell fi 19. Glass EJ, Jensen K. 2007. Resistance and susceptibility to a activation is essential for virus-speci c CTL activity during fl protozoan parasite of cattle—Gene expression differences in acute in uenza virus infection. Cellular & Molecular Immunol- – macrophages from different breeds of cattle. Veterinary ogy, 15(9), 827 837. Immunology and Immunopathology, 120(1), 20–30. 35. Marwarha G, Berry DC, Croniger CM, Noy N. 2014. The 20. Gowda N, Wu X, Sanjeev K, Maria F, Channe G, Simona S. retinol esterifying enzyme LRAT supports cell signaling by 2013. CD36 Contributes to malaria parasite-induced pro- retinol-binding protein and its receptor STRA6. FASEB Journal, – inflammatory cytokine production and NK and T cell activation 28(1), 26 34. by dendritic cells. PlosOne, 8(10), e77604. 36. Mortazavi A, Williams BA, Mccue K, Schaeffer L, Wold B. 21. Hui W, Shen H, Jiang S, Jia B. 2012. MHC-DQB1 Variation 2008. Mapping and quantifying mammalian transcriptomes by – and its association with resistance or susceptibility to cystic RNA-Seq. Nature Methods, 5(7), 621 628. echinococcosis in Chinese Merino sheep. Asian-Australasian 37. Murta SM, Ropert C, Alves RO, Gazzinelli RT, Romanha AJ. Journal of Animal Sciences, 25(12), 1660–1666. 1999. In-vivo treatment with benznidazole enhances phagocy- 22. Jiang S, Li X, Wang X, Ban Q, Hui W, Jia B. 2016. MicroRNA tosis, parasite destruction and cytokine release by macrophages profiling of the intestinal tissue of Kazakh sheep after exper- during infection with a drug-susceptible but not with a derived imental Echinococcus granulosus infection, using a high- drug-resistant Trypansoma cruzi population. Parasite Immunol- – throughput approach. Parasite, 23, 23. ogy, 10(21), 535 544. 23. Khalid M, Hani A, Ralf M, Thuy PDA, Krisna M, Amiya KP, 38. Neves LBD, Teixeira PEF, Silva S, Oliveira FBD, Garcia DD, Andris A, Valesca B, Ugur S, Eisaku K, Stefan K-H, Edgar S. Almeida FBD, Rodrigues-Silva R, Machado-Silva JR. 2017. fi 2014. NF-jB factors control the induction of NFATc1 in B First molecular identi cation of Echinococcus vogeli and lymphocytes. European Journal of Immunology, 44(11), 3392– Echinococcus granulosus (sensu stricto) G1 revealed in feces 3402. of domestic dogs (Canis familiaris) from Acre, Brazil. Parasites 24. Lee N, Kim D, Kim W. 2019. Role of NFAT5 in the immune & Vectors, 10(1), 28. system and pathogenesis of autoimmune diseases. Frontiers in 39. Ng SS, Rivera FDL, Yan J, Corvino D, Das I, Zhang P, Kuns R, Immunology, 10, 270. Chauhan SB, Hou J, Li X, Frame TCM, Mcenroe BA, Moore E, 25. Li F, Fu C, Xie Y, Wang A, Li J, Gao J, Cui X. 2019. Na J, Engel JA, Soon MSF, Singh B, Kueh AJ, Herold MJ, Oca MMD, Singh SS, Bunn PT, Aguilera AR, Casey M, Braun M, Transcriptional responses to starvation stress in the hepatopan- creas of oriental river prawn Macrobrachium nipponense. Ghazanfari N, Wani S, Wang Y, Amante FH, Edwards CL, Haque A, Dougall WC, Singh OP, Baxter AG, Teng MWL, Environmental Pollution, 252, 14–20. Loukas A, Daly NL, Cloonan N, Degli-Esposti MA, Uzonna J, X. Li et al.: Parasite 2021, 28,14 11

Heath WR, Bald T, Tey S-K, Nakamura K, Hill GR, Kumar R, 46. Storey DM. 1982. Vitamin A deficiency and the development of Sundar S, Smyth MJ, Engwerda CR. 2020. The NK cell granule Litomosoides carinii (Nematoda, Filarioidea) in cotton rats. protein NKG7 regulates cytotoxic granule exocytosis and Zeitschrift für Parasitenkunde, 67(3), 309–315. inflammation. Nature Immunology, 21(10), 1205–1218. 47. Taylor V, Velásquez C, Burgos L, Carmona J, Correa A, 40. Nmorsi OPG, Ukwandu NCD, Egwunyenga OA, Anyanwu LC, Maestre A, Uscátegui R. 2009. Retinol levels, iron status, Odike M. 2007. Vitamin A status and ocular lesions in some malaria and intestinal parasites: TH1/TH2 cytokines relation- rural Nigerians with onchocerciasis. African Journal of Biotech- ship. Revista Colombia Médica, 39(3), 276–286. nology, 6(11), 1293–1297. 48. Tian LX, Tang X, Zhu J, Luo L, Ma X, Cheng S, Zhang W, 41. O’brien K, Stacey S-C, Knoll LJ. 2011. Parasite-mediated Tang W, Ma W, Yang X, Lv C, Liang H. 2020. Cytochrome upregulation of NK cell-derived gamma interferon protects P450 1A1 enhances inflammatory responses and impedes against severe highly pathogenic H5N1 influenza virus infec- phagocytosis of bacteria in macrophages during sepsis. Cell tion. Journal of Virology, 85(17), 8680–8688. Communication and Signaling, 18(1), 70. 42. Paul S, Ruiz-Manriquez LM, Serrano-Cano FI, Estrada-Meza C, 49. Wang S, Hu D, Wang C, Tang X, Du M, Gu X, Suo J, Min H, Solorio-Diaz KA, Srivastava A. 2020. Human microRNAs in Fang R, Zhu X, Zhang X, Du A, Suo X, Liu X. 2018. host–parasite interaction: a review. 3 Biotech, 10(12), 510. Transcriptional profiling of innate immune responses in sheep 43. Roland J, Soulard V, Sellier C, Drapier AM, Santo JPD, PBMCs induced by Haemonchus contortus soluble extracts. Cazenave PA, Pied S. 2006. NK cell responses to Plasmodium Parasites & Vectors, 25, 182. infection and control of intrahepatic parasite development. 50. Yu YS, Wang LL, Shen Y, Yap MKH, Yip S, Han W. 2010. Journal of Immunology, 177(2), 1229–1239. Investigation of the association between all-trans-retinol dehy- 44. Schuster IS, Andoniou CE. 2020. NKG7 – regulating endoso- drogenase (RDH8) polymorphisms and high myopia in Chinese. mal pathways? Immunology and Cell Biology, 98(10), 802– Journal of Zhejiang University-Science Biomedicine & Biotech- 804. nology, 11(11), 836–841. 45. Silva A, Teixeira T, Teixeira S, Machado F, MaD Santos, 51. Zheng H, Zhang W, Zhang L, Zhang Z, Li J, Lu G, Zhu Y, Tomiosso TC, Tavares PCB, Brígido RTES, Martins FA, Silva Wang Y, Huang Y, Liu J, Kang H, Chen J, Wang L, Chen A, NSDL, Rodrigues CC, Roque-Barreira MC, Mortara RA, Lopes Yu S, Gao Z, Jin L, Gu W, Wang Z, Zhao L, Shi B, Wen H, Lin DS, Vila VDMR, Claudio VDS. 2017. Galectin-3: a friend but R, Jones MK, Brejova B, Vinar T, Zhao G, Mcmanus DP, Chen not a foe during Trypanosoma cruzi experimental infection. Z, Zhou Y, Wang S. 2013. The genome of the hydatid Frontiers in Cellular and Infection Microbiology, 7, 463. tapeworm Echinococcus granulosus. Nature Genetics, 45(10), 1168–1175.

Cite this article as: Li X, Jiang S, Wang X & Jia B. 2021. Intestinal transcriptomes in Kazakh sheep with different haplotypes after experimental Echinococcus granulosus infection. Parasite 28, 14.

An international open-access, peer-reviewed, online journal publishing high quality papers on all aspects of human and animal parasitology

Reviews, articles and short notes may be submitted. Fields include, but are not limited to: general, medical and veterinary parasitology; morphology, including ultrastructure; parasite systematics, including entomology, acarology, helminthology and protistology, and molecular analyses; molecular biology and biochemistry; immunology of parasitic diseases; host-parasite relationships; ecology and life history of parasites; epidemiology; therapeutics; new diagnostic tools. All papers in Parasite are published in English. Manuscripts should have a broad interest and must not have been published or submitted elsewhere. No limit is imposed on the length of manuscripts.

Parasite (open-access) continues Parasite (print and online editions, 1994-2012) and Annales de Parasitologie Humaine et Comparée (1923-1993) and is the official journal of the Société Française de Parasitologie.

Editor-in-Chief: Submit your manuscript at Jean-Lou Justine, Paris http://parasite.edmgr.com/