Lens Development and Crystallin Gene Expression: Many Roles for Pax-6 Ale5 Cvekl and Joram Piatigorsky

Home , Eye development, Lens placode, Optic cup (embryology), Optic stalk, Optic vesicle

Review articles e Lens development and crystallin gene expression: many roles for Pax-6 Ale5 Cvekl and Joram Piatigorsky

Summary The vertebrate eye lens has been used extensively as a model for developmental processes such as determination, embryonic induction, cellular differentiation, transdifferentiation and regeneration, with the crystallin genes being a prime example of developmentally controlled, tissue-preferred gene expression. Recent studies have shown that Pax-6, a transcription factor containing both a paired domain and homeodomain, is a key protein regulating lens determination and crystallin gene expression in the lens. The use of Pax-6 for expression of different crystallin genes provides a new link at the developmental and transcriptional level among the diverse crystallins and may lead to new insights Accepted into their evolutionary recruitment as refractive proteins. 20 May 1996

Eye development and lens induction inward to form the inner layer of the (secondary) optic cup. Development of a multicellular organism is orchestrated The optic cup gives rise to the neural retina (a thicker inner by the action of specific transcription factors and other layer) and pigmented epithelium (a thin outer layer). The regulatory proteins and molecules, which control the pro- lens vesicle separates from the surface epithelium and gram of embryonic determination and differentiation. The contains a single layer of cells with columnar morphology mechanism of action of the majority of these factors is that differentiate into the posterior lens fiber cells and ante- believed to rely on a synergism between multiple factors. rior lens epithelial cells. Lens development is character- The eye is an advantageous model for studies of transcrip- ized by high, preferential expression of soluble proteins tion factors during development which control organogen- called crystallins (ref. 3; see below). Lens differentiation is esis and tissue-specific gene expression. Vertebrate eye also regulated by growth factors, especially FGFs and development involves a hierarchy of inductive interactions secreted molecules coming from the retina, an area between the embryonic forebrain and surface ecto- beyond the scope of this review. derm(lr2). During the course of gastrulation, a region of Although the identities of transcription factors involved in dorsal ectoderm is induced to form the neural plate, which eye morphogenesis are just beginning to be elucidated, it folds into the neural tube with anterior protrusions and has been shown recently that Pax-6 plays an essential role, gives rise to the future brain. At the end of gastrulation, both in vertebrates and Dr~sophi/a(~-’~).Pax-6 is a complex retinal fields are specified as a thickened zone of the neu- protein with a highly conserved paired domain and homeo- roepithelium, which folds to form the optic sulcus. Enlarge- domain, as described below. Overexpression of Pax-6 from ment of the sulcus generates optic pits in the region of the future forebrain and with the closure of the neural tube, the Drosophila [called eyeless (ey)], mouse [called small eye optic pits are pushed outward. Deepening of the optic pit (Se~)l(’~)or squid (S. Tomarev, P. Callaerts, L. Kos, R. results in the formation of the optic vesicle, which is con- Zinovieva, G. Halder, W. Gehring and J.P., manuscript in nected to the brain cavity by the primitive optic stalk. The preparation), resulted in the formation of ectopic compound first manifestation of lens induction is the appearance of a eyes in the fly, indicating that Pax-6 may have a universal dish-shaped thickening of the surface ectodermal epi- and critical role in eye development. The aim of the present thelium, the lens placode, closely apposed to the anterior review is to summarize recent findings concerning the role surface of the optic vesicle (Fig. 1). The lens placode of Pax-6 in the development and disorders of the eye, in indents to form the lens pit and subsequently the lens vesi- particular to lens induction and transcription of crystallin cle, while the outer part of the optic vesicle collapses genes.

BioEssays Vol. 18 no. 8 621 QlCSU Press1996 pp. 621-630 810969 Review art ides

Transcription factors implicated in eye development associated with Pax-6 mutations, resulting in a central The molecular events specifying different eye tissues are corneal opacity and physical connection of the lens and being studied by genetic techniques and various gene cornea(33). Other homozygous Pax-6 mutations have selection procedures, with both strategies producing an resulted in the absence of eyes and in brain defects(34). increasing number of candidate genes for involvement in These phenotypes are characterized by severe defects in eye development. A list of selected eye transcription factors, eye morphogenesis and, in homozygous cases, the preferentially expressed in the developing lens and retina, is absence of the eyes and nose indicate that Pax-6 is an given in Table 1. Additional homeobox genes expressed in essential factor acting early during development and that its vertebrate ocular tissues are compiled elsewhere(11).Thus, loss cannot be readily compensated for by another function- while Pax-6 plays a prominent role in eye and lens develop- ally related gene. ment, it is but one of a growing list of factors that must interact in numerous ways. Lens development and Pax-6 During development of the mouse eye, a broad Pax-6 Phenotypes and expression pattern of Pax-6 expression pattern appears in the head surface ectoderm Pax-6 was cloned initially by four groups of investigators and becomes restricted progressively to the area of the from human@),mouse(7), zebrafish@) and The high future lens and cornea(7). Pax-6 mRNA is then detected amino acid sequence conservation (more than 96Oh) of Pax- sequentially in the optic pit, the optic sulcus and the optic 6 indicated that the whole protein is critical for function, con- vesicles. The expression of Pax-6 in the optic vesicle is sistent with the idea that Pax-6 has a very fundamental and associated with development of the inner layers of the specialized role, like other paired domain proteins. There neural retina (Fig. 1). Pax-6 mRNA is also present in the pri- are distinct phenotypes associated with Pax-6. In the mary fiber cells and later in the secondary fiber cells (the mouse, the heterozygous mutations in Pax-6 result in small cortical cells derived at the equatorial margin by division of eye (Sey), a microphthalmia phenotype(4). Homozygous the epithelial cells) of the embryonic len~(~~~~).In addition to Pax-6 mutations (Sey/Sey) are lethal at birth; in addition to the lens, Pax-6 mRNA is found in the surface ectoderm giv- brain defects, the eyes and nose are absent. In the human, ing rise to the cornea and later in the corneal epithelium(7).A a heterozygous Pax-6 phenotype, aniridia (AN), is charac- slightly different pattern of Pax-6 expression occurs in the terized by various ocular malformations including the lens, beginning stages of eye development in the embryonic iris, cornea and retina, leading to cataracts and glau- chicken, where Pax-6 mRNA is limited at first to the coma(6z8).Peters’ anomaly is another rare human disorder prospective lens ectoderm and only later is detected in the

Table 1. Examples of transcription factors expressed in the developing vertebrate eye Class/Name Major sites of expression (eye only) Reference Paired domain Pax-6 Optic vesicle, presumptive lens ectoderm, lens, corneal epithelium, 4-7 neuroretina, iris Pax-2 Optic vesicle, optic cup, optic stalk 12-14 Homeodomain Otx-2 Optic cup, RPE, presumptive lens ectoderm 15-17 Msx-1 Mesenchyme between the surface epithelium and the lens, optic cup 18 MSX-2 Optic cup, lens, retina, iris, corneal epithelium 18 Proxl Optic vesicle, lens, retina 19,20 Xlim-3 Inner nuclear layer of the retina 21 ChxlO Optic vesicle, neuroretina 22 Emxl Lens 23 Six3 Optic vesicle, neural retina, lens, optic stalk 24 Optx-l Neural plate, optic vesicle, retina 25 Optx-2 Anterior ectoderm (prospective eye area), optic vesicle, lens/corneal 25 placode, retina, optic nerve Helix-loop-helix mi Pigment layer of retina 26 Forkhead BF-l,2 Asymmetric expression in the retinal neuroepithelium 27 Leucine-zipper sw3-3 Optic cup, lens epithelium, neuroretina 28 Nuclear receptors RARP Pigmented retina, vitreous body, mesenchyme around the eye 29 RXRa Eye 30 HMG sox-1 Lens fibers 31 sox-2 Lens placode, lens, retina 31

622 Vol. 18 no. 8 BioEssays Review articles e

Inner Layer B - (Froswtlve Neuroretina)

.Newoectcderm

Pigment Epithelium)

D E

Pigmented Layer 'ofRetin0

Fig. 1. Highly schematic diagram of the early events in mouse eye development('*). The developing lens is shown in blue. (A) At embryonic day 9 to 9.5 (E9-9.9, the optic vesicle is attached to the ventral wall of the prosencephalon via the optic stalk. The lens placode (prospective lens) becomes apparent as a thickened area of the surface ectoderm. (6)At E9.5-10, the area of the lens placode has enlarged. (C) At E10.5, the central part of the lens placode indents to form the lens pit and the optic vesicle invaginates to form the optic cup. (D) At about El1.5, the lens pit is converted into the lens vesicle, which is surrounded by a capsule. (E) At E13.5, the lens comprises the anterior cuboidal epithelial cells and the posterior elongationg fiber cells. The neural retina layer behind the lens begins to differentiate and the primitive cornea develops in front of the lens. neural tube(36). In contrast to the situation in mouse The rSey/rSey surface ectoderm never embryos, the olfactory placodes of chicken embryos formed lenses when it was cultivated with rSey/+ or +/+ express little, if any, Pax-6 mRNA. optic vesicles. In contrast, rSey/rSey optic vesicles induced Analysis of the mouse Sey/+ or Sey/Sey embryos has lens differentiation when they were cultivated with the wild provided insights into the role of Pax-6 in the early steps of type or heterozygous surface ectoderm explants. These the lens induction(35).Mouse Sey/Sey embryos lack the lens observations indicate that the surface ectoderm requires placode, lens pit and lens vesicle, consistent with Pax-6 Pax-6 for induction of the lens placode, while the signal being necessary for lens placode formation. Early Sey/Sey coming from the optic vesicle does not appear to depend on embryos have abnormally shaped brains and optic vesicles, functional Pax-6. This conclusion is supported by recent and later in development Sey/Sey optic vesicles form optic analyses of chimeric mouse embryos composed of +/+ and cups and optic stalks in which morphological abnormalities Sey/Sey cells, which provided evidence that Pax-6 acts prevail. It is likely that these abnormalities are initiated by directly and cell autonomously in the lens and optic cup(3a). the absence of Pax-6 in the neural ectoderm and are The abnormalities in the optic cup of the chimeric embryo enhanced later by the absence of the lens and other indirect suggested that Pax-6 regulates expression of cell adhesion phenomena. molecules or extracellular matrix proteins. The role of Pax-6 for lens induction was studied by com- bining the surface ectoderm and the optic vesicle of rat Sey Other possible lens developmental control factors (rSey) and wild-type embryos at the 20-somite stage of In addition to Pax-6, there has been a recent proliferation of

BioEssays Vol. 18 no. 8 623 c)Review articles other transcription factors controlling eye development. (see above); the lens remains attached to the surface ecto- Some of these are given in Table 1 and in ref. 11. The gene derm and rotates When double mutants were for a homeodomain protein, Otx2, is expressed very early examined, an increased severity of eye malformations was during mouse development in the embryonic ectoderm and observed(40).A RXRa-I- and RARy-/- mouse lacked the later in the neuroectoderm of the prosencephalon and the ventral iris and had a persistent corneal-lenticular stalk. diencephalon, and eventually in the lens placode(15).The These similarities with Pax-6 mutants may be coincidental inactivation of Otx2 gene in -/- ‘knockout’ mouse embryos or they may indicate cross-talk between biochemical resulted in the absence of the lens and nasal placodes, processes governed by Pax-6 and retinoic acid. regions of the forebrain and midbrain, and alterations of the node(16.17). Six3, the murine homolog of Drosophila sine oculis, is Paxd as a transcription factor another interesting factor that appears to be important for It has been estimated that the formation of compound early eye and lens development(24).The expression pattern Drosophila eyes involves the action of about 2,500 for the Six3 gene overlaps with many regions expressing genes(l0). It is thus likely that Pax-6 possesses a wide reper- Pax-6. Although not detected in the presumptive lens ecto- toir of molecular mechanisms. Pax-6 may not only regulate derm, Six3 mRNA is found progressively in the optic stalk, downstream factors that generate embryonic fields and optic vesicle, neuroretina and lens. Six3 expression in the underlying patterns for development, but may also partici- brain of Sey/Sey mouse embryos appears to be normal. A pate directly in controlling genes of terminal differentiation, regulatory hierarchy or possible cross-talk between Six3 as indicated by its presence in adult tissues. In addition, and Pax-6 remains to be determined. A recent report multiple forms of Pax-6 have been detected in cell extracts describes a novel family of homeobox genes, Optx-1 and 2, (Fig. 2). The prevailing protein (Pax-6/p46) has a canonical that are also related to sine oculis of Drosophila and that are 128-amino acid paired domain. A less abundant form, Pax- selectively expressed in the developing eyes of vertebrates 6/p48, includes a 14-amino acid insertion (5a) in the paired and Dro~ophila(~~).Optx-2 mRNA already appears in the domain as a result of alternative RNA splicing. Like other chicken embryo at the gastrula stage and in proliferating paired-domain proteins, Pax-6 may activate or repress tran- lens, corneal and retinal tissues. scription and probably can participate in autoregulatory Msx-2, a homeodomain protein, is transiently expressed IOO~S(~~~~~).Another level of complexity is that the Pax-6 in the embryonic mouse eye(18), where its mRNA is gene is transcribed from at least two promoters and may be detected only in the surface epithelium and in the invaginat- activated and/or repressed in different cells by different sets ing lens. The gene for Proxl, a homeodomain protein of transcription factors(41).Finally, in addition to its C-termi- homologous to prosper0 in Drosophila, is expressed in the nal activation domain, Pax-6 contains two different DNA- mouse embryo in the region of the optic vesicle and subse- binding domains, the N-terminal paired domain and an inter- quently in the elongating lens fiber cells(1g).In the chicken nal homeodomain, suggesting that it may interact with a embryo Proxl mRNA is present in the lens placode, in the number of different proteins and DNA sequence^(^^^^^). lens epithelial and fiber cells and in the horizontal cells of the The 128-amino acid paired domain contains consecutive retina(20). Emxl and Emx2, mouse homeobox genes modules of a-helix, p-sheet and p-turn secondary structures related to Drosophila empty spiracles, are expressed early which are, according to crystallographic studies, essential in the developing central nervous system, and Emxl is for its specific interaction with DNA(44).The paired domain expressed later in the lens(23). Chicken sw 3-3, a basic interacts with 20-26 bp of DNA, which is larger than the typi- leucine-zipper protein, seems to be important for the prolif- cal 6-10 bp recognition sequence for most DNA-bindingpro- eratioddifferentiation transition of lens and retinal cells(28). teins (Fig. 2B). The N-terminal half is more highly conserved sw 3-3 mRNA is found in the anterior lens epithelial cells but than the C-terminal half of the paired domain of different Pax not in the elongating fiber cells. In the chicken, the mRNA for proteins(45).Alternative splicing of Pax-6 mRNA (see Fig. 2) Sox-2, a HMG box containing protein, is expressed in the disrupts the ability of the N-terminal paired subdomain to lens placode and developing lend3’). The present data thus interact with DNA(46). Binding to DNA with a different indicate that Pax-6, as well as some other transcription fac- sequence specificity thus depends on the C-terminal subdo- tors, are expressed in the presumptive lens ectoderm when main of the paired d~main(~~-~~). lens-forming competence and determination oc~ur(~1~~). The isolated Pax-6 homeodomain cooperatively dimer- It has been known for a long time that retinoids are essen- izes with DNA, recognizing tandem TAAT core motifs with a tial for vision. Recent experiments generating a series of preferred spacing of 3 bp(48).The Pax-6 60-amino acid null mutants of retinoic acid receptors in the mouse revealed homeodomain diverges considerably from the consensus a broad role of retinoic acid transcription factors (RAR or homeodomain ~equence(~3).The recognition specificity of RXR families) for eye devel~pment(~~~~~).Some phenotypes Pax-6 is affected by the presence of Ser50 (ninth residue in of these null mutants were similar to those of the Sey/+ the recognition a-helix) within the homeodomain instead of mouse. An RXRa-I- phenotype resembles Peters’ anomaly a consensus Gln residue, a substitution shared with Pax-3,

624 Vol. 18 no. 8 BioEssays Review art ides * A.

Fig. 2. Multiple forms of Pax-6. (A) At least four variants of Pax-6 (p46, p48, p43 and p33/32) have been detected in cellular extracts using specific anti~era(~O-~~).The horizontal brackets indicate regions of 1.17._ 433 nuclear localization signals(4g).PD, paired 7 domain, comprising N- (blue) and C- (red) terminal halves; HD, homeodomain; Snip, swine-, threonine- and proline-enriched activation domain. (B) ‘Optimal’ DNA- recognition sequences known for both B. isolated paired domain^(^^,^^) and for the 1 20 1 1 11 isolated homeod~main(~~)of Pax-6. PDSa PD:ANNTTCACGC$T~ANT?$N; ~~%:ATGCTCAGTGAATGTTCATTGA dk!;~~~~~~~~~~~ is the alternatively spliced PD in Pax-6ip48.

4 and 7(43). The Pax-6 homeodomain may play at least three turtle, some fish, several birds) and quinone oxidoreduc- roles: it may recognize a class of binding sites different from tase/c-crystallin (guinea pig, camel, degu, some other mam- the paired domain; it may have an effect on the conforma- mals), among others. The lens crystallins of invertebrates tion of the other domains within the protein; or it may interact are also diverse, taxon-specific soluble proteins that are with other proteins. Pax-6 is targeted into the nucleus by two either novel proteins, or directly related to metabolic nuclear localization signals located in the paired domain enzymes such as glutathione S-transferase/S-crystallin and and at the N terminus of the home~domain(~~).The tran- aldehyde dehydrogenase/Q-crystallin in cephalop~ds(~~). scriptional activation domain resides in the C-terminal por- Like the enzyme-crystallins, the ubiquitous crystallins have tion of the protein, which is enriched in Ser, Thr and Pro been recruited from pre-existing proteins with non-refractive residues(35).Pax-6 can be phosphorylated, although its bio- functions. For example, the two a-crystallins (aA and a6) logical significance is not yet known(50). were derived from small heat shock proteins that can both In view of the bipartite structure of the Pax-6 binding sites act as molecular chaperones; aB remains stress-inducible recognized by the two flexible halves of the paired domain, and provides thermotolerance in numerous tissues(57). the existence of at least two protein variants with different Indeed, most if not all crystallins responsible for lens trans- recognition specificities and the presence of an additional parency appear to be multifunctional proteins and have putative DNA-binding entity, the homeodomain, it was clear been recruited for their refractive role from pre-existing pro- that the identification of target genes would help greatly in teins expressed outside the eye. understanding the functions and DNA binding mechanisms The developmental expression of crystallin genes is as of Pax-6. Recently in this connection Pax-6 binding sites complex as their diversity(55).There are differences in the that appear to be functional were found within its own dual temporal and spatial patterns of expression of the various promoters(41)and in the promoters and enhancers of sev- crystallin polypeptides, both within and between the crys- e ral crystall in genes@’-54). tallin classes, in the lens as well as in non-lens tissues in certain cases. There are also significant species differences in crystallin gene expression during lens development. For Diversity and developmental expression of crystallin example, the a-crystallins are the first to be expressed in genes mice, while the 6-crystallins (not present in mammals) are The soluble proteins present at high concentrations and the first to be expressed in chickens and are already present responsible for lens transparency - the crystallins - are sur- in the lens placode, with the a-crystallins being synthesized prisingly diverse and vary quantitatively and qualitatively last in this species. The regulated nature of crystallin gene among spe~ies(3,~~~~~).There are ubiquitous crystallins (the expression during development results in differences in a and by-crystallins) that are found in all vertebrate lenses their spatial distribution throughout the lens, and this too and taxon-specific crystallins that are present in selected may differ with species. species. The latter are either related or identical to metabolic enzymes and include lactate dehydrogenase Ble-crystallin (some birds, crocodiles), argininosuccinate lyase/b Pax-6 and crystallin gene regulation crystallin (birds, reptiles), a-enolaseh-crystallin (lamprey, Many crystallin gene regulatory sequences have been iden-

BioEssays Vol. 18 no. 8 625 Review articles

Table 2. Examples of crystallin gene promoters and their specificities studied in transgenic mouse Crystallin Promoter fragment(s) Activity References Mouse aA -366 to +46, -1 11 to+46, and -88 to +46 Lens fibers see 57 -60 to +46 None see 57 Chicken aA -242 to +77 Lens see 57 Mouse a6 -5000 to +44 Lens, heart, muscle, other tissues 59 -661 to +44 Lens, skeletal muscle, heart, spleen, lung see 57 -164 to +44 and -1 15 to +44 Lens -68 to +44 None Mouse yF -759 to +45 Lens fibers 60 -1 71 to +45 and -67 to +45 Central lens fibers 60 Guinea pig 5 -756 to +70 Lens 54 -385 to +70 Lens and brain see 54 Chicken pB1 -434 to +30 Lens fibers 61 -1 52 to +30 Primary lens fibers 61 Chicken pA3/Al -382 to +22 Lens, eye 62 -143 to +22 Lens 62

*R. Gopal-Srivastava, A.C. and J.P., manuscript in preparation. tified by transient transfection and transgenic mouse exper- binding sites in transfected lens cells, and gain of function in iments (see refs 55 and 57). A summary of transgenic co-transfection experiments using fibroblasts; the (-crystallin mouse data obtained by using reporter genes fused to puta- experiments involved DNA-protein binding assays coupled tive regulatory sequences of crystallin genes is given in with loss-of-function tests in transgenic mice after deletion of Table 2. In general, minimal lens-specific promoter the Pax-6 binding site. Multiple Pax-6 binding sites have been sequences contain a TATA-box and reside relatively close implicated for all the genes tested except the l;-crystallin to the transcription initiation site. Additional regulatory gene, for which only a single Pax-6 binding site has been regions required for the spatial and temporal patterns of found so far. Current experiments (A.C., unpublished obser- crystallin gene expression are frequently situated close to vation) have revealed that the purified paired domains of Pax- and upstream of the minimal lens-specific promoters. An 6 can interact with other possible regulatory sequences of the exception to this arrangement is found in the chicken 6-crys- the crystallin genes (some of which are shown in Fig. 3), but tallin genes, where high lens expression is governed by an these have not been tested yet for function or binding to the enhancer in the third intron. These experiments have estab- complete Pax-6 protein. These sites are located in the 5’- lished that transcriptional control plays a major role in the flanking promoter regions except for 61 -crystallin, where highly enriched or specific and abundant expression of crys- binding occurs in the third intron enhancer. Although Pax-6 tallin genes in the lens. Moreover, as shown in Table 2, pref- has been associated with the activation of 5 different crystallin erential expression of crystallin genes in the lens is con- genes, it is noteworthy that there is no report yet that the lens- served across vertebrates in all cases examined. A striking specific yF-crystallin gene utilizes this transcription factor for example of this conservation of lens regulation is the high its expression(63). lens activity of the chicken 6-crystallin enhancer in trans- Localization of Pax-6 binding sites in the critical regula- genic mice, despite the fact that mice lack this crystallin tory regions of the mouse aA and aB, chicken uA and 61, altogether. and guinea pig 5 crystallin genes (see Fig. 3) fits well with A compilation of the transcription factors that have been the transgenic data summarized in Table 2. We are also implicated in crystallin gene expression is shown in Fig. 3. presently exploring the role of Pax-6 in the expression of p- This area of investigation is evolving rapidly, with some of crystallin genes in our laboratory. Recent data have indi- these factors having only been reported recently in scientific cated that Pax-6 unexpectedly represses the activity of the meetings. Since these factor binding sites are often tightly chicken pB1 (M. Duncan and J.P., unpublished) and PA3/Al clustered or physically overlap, it is possible that similar regu- (J. Haynes, II and J.P., unpublished observations) crystallin latory regions bind different factors at different times in devel- promoters in cotransfection tests. Possibly, then, Pax-6 is a opment or in different regions of the lens. There is substantial negative regulator of the P-crystallin genes. This is consis- evidence that the chicken aA (Fig. 3A)(51)and 61 (Fig. 3C)(53), tent with the inverse spatial relationships between the rela- mouse uA (Fig. 3B)(52)and a6 (R. Gopal-Srivastava, A.C. tive amounts of Pax-6 mRNA and the expression of P-crys- and J.P., manuscript in preparation), and guinea pig 5(54) tallin genes within the developing crystallin genes all use Pax6 for lens expression. The evidence that Pax-6 is required for expression of the aA,uB and Other crystallin transcription factors 61 crystallins in the lens of mice and chicken is based on a As shown in Fig. 3, Pax-6 must cooperate with numerous combination of DNA binding studies, immunological identifi- other transcription factors that bind to the different crystallin cation of proteins forming protein-DNA gel-shift complexes, genes. Indeed, functional protein interactions demonstrat- loss of function after site-specific mutagenesis of the Pax-6 ing lens specificity can be created artificially by multimeriz-

626 Vol. 18 no. 8 BioEssays Review articles m Fig. 3. Schematic representation of the chicken aA-, 61-, mouse aA-, aB-, yF- and guinea pig c-crystallin regulatory regions. DNA-binding regions are shown in boxes, and activators (repressors) are shown W above (under) the boxes, respectively. Functional binding of Pax-6 is colored dark blue for emphasis. Pax-6 binding by purified paired domains is indicated by light blue ovals; these sites have not been tested yet for function. c. +I (A) aA(c) is the chicken A- MHL Enhancer -7' 1. crystallin S-flanking region. Proteins TBP -. . C3 and E2 are undefined and have aB(m) 3 El I E4 I E2 I E3 LSRl I LSR2 ~TATA] only been detected in gel-shift aCE2 assays(5i). (B) aA(m) is the mouse -55 aA-crystallin 5'-flanking region(5z). In addition to Pax-6, non-tissue- specific protein C2 binds the Pax-6 -.. -. Ilb Ila 84 I6EF216EF1131 85 binding site; region PEl(64) also 83 I I I ] binds an additional undefined protein (not shown). (C) aB(m) is the mouse aB-crystallin 5'-flanking E. region, which contains a muscle/ headlens (MHL) enhancer(65). There are five regulatory elements aCE2 1' in the MHL enhancer: E4 is a heart- rIrI- specific SRF-like protein-binding -150.150 +1 site, and MRF (for muscle F. J regulatory factor) binds MyoD-family members. The ? factor binding to i(!3P) AaCE21 ZPE I LSRl is not identified. (D) 61(c) is ~I I, - the chicken 61 -crystallin 5-flanking region and the third intron enhancer(sl.53). Activator 6EF3 (a helix-loop-helix (HLH) protein) competes for binding with the repressor 6EF1(66). (E) yF(m) is the mouse -faystallin 5'-flanking regi~n(~*,~'-~*).(F) ((gp) is the guinea pig c-crystallin 5'-flanking region(54).The nCE2 sequence(69)has been reported recently to bind the activator L-maf (see text). ing essential but insufficient enhancer regions of the onic differentiation and specific gene expression(66).yFBP is chicken aA(6g)and 61 (31) crystallin genes. The interactions yet another negative regulatory factor that binds to the pro- of crystallin transcription factors can lead to both activation moter of the mouse yf-crystallin gene(67). and repression. For example, sites A and B situated just Sox proteins have recently been shown to activate upstream of the two Pax-6 binding sequences in site C in chicken 61- and mouse yF-crystallin genes in the lens(3l). the 5'-flanking region of the chicken aA-crystallin gene form These transcription factors are related to the sex-determin- a composite element(51). Identifications based upon ing proteins, SRY, and bend DNA by binding to the minor immunoreactivity in gel-shift experiments have indicated groove via HMG boxes, potentially allowing proteins bound that promoter activation in the lens is associated with USF to remote enhancer sequences to interact with proximal pro- binding to site A and CREB or CREM family members to site moter regions. Several Sox proteins bind to the 61 -crystallin B, while promoter repression is associated with USF on site enhancer and appear to be the factors forming the 6EF2a-d A interacting with AP-I family members (Fra2 and JunD) at complexes in gel-shift assays(31).Of the numerous Sox pro- site B in fibroblasts. Another site, D, interacts with USF in teins, Sox 2 probably forms FEF2a, since it can activate the lens and fibroblasts to repress the chicken aA promoter in 61-crystallin enhancer, is expressed in the lens placode and transfection tests. In the chicken 61 -crystallin enhancer, is enriched in the epithelium and fibers of the embryonic located in the third intron, a zinc finger/homeodomain pro- chicken lens. 6EF2b appears to be Sox 1, which may be tein, 6EF1, competitively represses a bHLH activating pro- used for yf-crystallin promoter activity, since it is localized in tein, called 6EF3@3. While the authentic 6EF3 has not been the fiber cells of the mouse embryo where the y-crystallins identified yet, it is noteworthy that USF has been shown to are expressed. 6EF2c and 6EF2d predominate in non-lens be able to protect the enhancer binding region from DNase 1 cells and thus may bind other Sox family members. digestion(53).6EF1 is expressed in many embryonic tissues, Retinoic acid receptors bind to retinoic acid response most notably in the notochord and myotomes, and can elements (RAREs) and enhance the lens expression of repress E2-box-mediatedactivation of different genes, sug- crystallin genes. While the proximal promoter fragment uti- gesting that it has a general role in the regulation of embry- lizing Sox is sufficient for lens-specific expression of the

BioEssays Vol. 18 no. 8 627 Review articles

L-mar Prox-I ture, multifunctional properties and expression patterns activin A RARiRXR make it unclear precisely what common features or which of shh their non-refractive roles have been critical for their selection as lens refractive proteins. One connection among several, but not all, crystallins is that they are used in stress- related roles, with the small heat-shock protein/aB-crystallin Unknown factors being the prime example(57).This raises the possibility that 1 Comoetence Bias Determination Differentiation their high developmental expression in the lens evolved originally from inductive events serving to protect the lens ECTODERM + PLACODE VESICLE + LENS cells from environmental stress. ’I\(\,, // It is interesting to speculate briefly on the evolutionary Induction mechanisms invoked to recruit ubiquitous proteins to (Neural Plate) become refractive lens crystallins. One possibility is that any Fig. 4. Summary of vertebrate lens induction and possible roles for Pax-6. gene activated by one or more transcription factors used for Lens induction consists of four phases: lens-forming competence, bias, determination and differentiation(”). The possible role of Pax-6 before the lens development, such as Pax-6 and/or other proteins (see lens-determination phase is not known(35).Activin At7’) and sonic hedgehog, Table 1 and Fig. 3), could become a candidate crystallin ~hh(~~,~~)repress Pax-6 expression. Autoregulation of Pax-6 transcription gene. Thus, the acquisition of a functional Pax-6 site during (circular arrow) may be the mechanism used to a generate sufficient amount of pr~tein(~~,~l).A, activators of Pax-6; IS, inductive signals. evolution would allow a gene to have its encoded protein tested for crystallin function in the lens. Synergistic interactions with other transcription factors that are also prevalent in the lens could, of course, enhance expression of the can- mouse yf-crystallin gene(31160),an upstream enhancer con- didate gene and improve the chances of its encoded protein taining a novel everted RARE with an 8-bp spacer is used being selected as a crystallin, which must accumulate to a for maximum activity (Fig. 3E)@). This yF-crystallin RARE relatively high concentration to give the transparent lens a binds RAR, RXR or RORa. The regulation of crystallin proper refractive index. In addition to being subjected to the genes by retinoic acid is consistent with a role of this mor- selective forces required for developmental events, it has phogen during lens differentiation (see above). been suggested that transcription factors used for crystallin There are a number of exciting new studies implicating gene expression may also be subjected to selective pres- other transcription factors for crystallin gene expression cur- sures required for particular constraints needed for lens rently under investigation. One of these is L-maf, a lens- transparency(56).For example, one possible selective force specific member of the maf oncogene family of basic leucine might be the redox state. In any case, the final stages for a zipper proteins (K. Yasuda, H. Ogino, K. Ono, S. lshibashi candidate protein to be recruited as a crystallin would and S. Kawauchi, presented at the Taniguchi Symposium on depend on it having a phenotype that optimizes the optical Developmental Biology VII, Osaka, Japan, January 16-19, properties of the lens. These phenotyes would include the 1996). L-maf appears in the chicken lens placode, binds the ability to remain soluble at high concentration and to pack aCE2 sequence(6g)found in multiple crystallin genes, and properly within the lens. activates the chicken aA and 61 enhancers and the mouse yF promoter in cotransfection experiments (see Fig. 3). Another potentially important factor for crystallin gene Conclusions and perspectives expression is HSF2, a heat-shock transcription factor(70). Fig. 4 depicts an emerging view, which will certainly be mod- The chicken aA (Fig. 3A) and mouse yF (Fig. 3E) crystallin ified with additional information, of the role of Pax-6 during promoters contain a heat-shock-related dyad (HSRD) lens development in the vertebrate eye. The broad sequence that does not confer heat inducibility but does bind expression pattern of Pax-6 in the head surface ectoderm the heat-shock transcription factors, HSFl and HSF2 (P. and its subsequent restricted expression in the lens placode, Frederikse and J.P., manuscript in preparation). These the Pax-6 requirement for lens formation from surface ecto- HSRD sequences lie within critical regions of the regulatory derm, and the correlation of Pax-6 expression with the sequences used for lens expression. Since HSF2 is involved potential for transdifferentiation of various tissues into lens- in the developmental expression of stress proteins, it is con- like cells, argue for a pivotal role of Pax-6 in lens determina- sistent that HSF2 would be involved in expression of these tion(2z7,35-38).Moreover, the presence of Pax-6 in the cell crystallin genes with a stress-related~rigin(~!~~). nuclei of lens epithelial cells and elongating fibers in neonatal and even adult lenses suggests a maintenance role for Pax- 6(7235s54).Pax-6 is not sufficient for lens differentiation since it Crystallin recruitment: a role for Pax-6 is expressed in numerous tissues that do not form eyes, and Although the crystallins are water-soluble proteins that exist it clearly must work together with other DNA-binding tran- in high concentrations in the lens, their differences in struc- scription factors, tissue-specific co-activators and growth

628 Vol. 18 no. 8 BioEssays Review art ic I e s m factors during eye development (see Table 1 and ref. 1 1); the 3 Wistow, G.J. and Piatigorsky, J. (1988). Lens crystallins: the evolution and studies identifying these lens and eye developmental factors expression of proteins for a highly specialized tissue. Annu. Rev. Biochem. 57, 479-504. are just beginning. Crystallin genes have been shown to be 4 Hill, R.E. etal. (1991). Mouse Small eye results from mutations in a paired-like candidate target genes for Pa~-6@-~~).Multiple binding of homeobox-containinggene. Nature 354, 522-525. 5 Krauss, S., Johansen, T., Korzh, V. and Fjose, A. (1991). Zebrafish pax[zf-a]: Pax-6 to the promoters and enhancers may also induce a paired box-containing gene expressed in the neural tube EM60 J. 10, 3609- changes in the chromatin structure of crystallin genes. The 3619. functions of the various isoforms of Pax-6 and the paired and 6 Ton, C.C. etal. (1991). Positional cloning and characterization of a paired box- and homeobox-containinggene from the aniridia region. CeN67, 1059-1074. homeodomains of Pax-6 require resolution. In addition, Pax- 7 Walther, C. and Gruss, P. (1991). Pax-6, a murine paired box gene, is 6 may repress some genes (i.e. P-crystallins)while activating expressed in the developing CNS. Development113, 1435-1449. 8 Glaser, T., Walton, D.S. and Maas, R.L. (1992). Genomic structure, others in certain regions of the lens. Pax-6 does not act alone evolutionary conservation and aniridia mutations in the human Pax6 gene. Nature and interacts with other transcription factors that are highly Genet. 2,232-239. 9 Quiring, R., Walldorf, U., Kloter, U. and Gehring, W.J. (1994). Homology of enriched in the lens, such as Sox, and with numerous ubiqui- the eyeless gene of Drosophila to the Small eye gene in mice and aniridia in tous transcription factors, such as AP-I , USF, CREB/CREM humans. Science 265,785-789. and HSF among others, which may play both positive and 10 Halder, G., Callaerts, P. and Gehring, W.J. (1995). Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science 267, 1788- negative regulatory roles. Certainly many more crystallin 1792. transcription factors, their mechanisms of action and possi- 11 Beebe, D.C. (1994). Homeobox genes and vertebrate eye development. Invest. Ophthal. Vis. Sci. 35,2897-2900. ble interaction with Pax-6, and their developmental involve- 12 Dressier, G.R., Deutsch, U., Chowdhury, K., Nornes, H.O. and Gruss, P. ment in the temporal and spatial expression of crystallin (1990). Pax2, a new murine paired-box-containinggene and its expression in the developing excretory system. Development109, 787-795. genes within the lens, remain to be discovered. 13 Macdonald, R. et a/. (1995). Midline signalling is required for Pax gene The regulation of Pax-6 itself in the lens and other tissues regulation and patterning of the eyes. Development 121, 3267-3278. is another area of great importance. As indicated by the cir- 14 Macdonald, R., Earth, K.A., Xu, Q., Holder, N., Mikkola, 1. and Wilson, S.W. (1994). Regulatory gene expression boundaries demarcate sites of neuronal cular arrow in Fig. 4, there is evidence that Pax-6 may regu- differentiation in the embryonic zebrafish forebrain. Neuron 13, 1039-1053. late its own pr~moter(~~,~~).In contrast to the yet-unknown 15 Simeone, A. eta/. (1993). A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the activators of the Pax-6 gene, it can be down-regulated by gastrulating mouse embryo. EM60 J. 12,2735-2747. activin A(71), sonic hedgeh~g(l~,~~)and possibly Pax-2(13). 16 Matsuo, I., Kuratani, S., Kimura, C., Takeda, N. and Aizawa, S. (1995). Mouse Otx2 functions in the formation and patterning of rostra1 head. Genes Dev. The roles of these and other lens-inducing signals and 9,2646-2658. repressors, which limit the initial diffuse expression pattern 17 Acampora, D. et a/. (1995). Forebrain and midbrain regions are deleted in of Pax-6 in the surface ectoderm to the presumptive lens Otx2’- mutants due to a defective anterior neuroectoderm specification during gastrulation. Development 121, 3279-3290. cells, remain to be established. 18 Monaghan, A.P. et a/. (1991). The Msh-like homeobox genes define domains The recent investigations indicating that Pax-6, in collab- in the developing vertebrate eye. Developmentll2, 1053-1061. 19 Oliver, G., Sosa-Pineda, B., Geisendorf, S., Spana, E.P., Doe, C.Q. and oration with other factors, may be used throughout the ani- Gruss, P. (1993). Prox-1, a prospero-related homeobox gene expressed during mal kingdorn(l0)and furthermore, that it may be used as an mouse development. Mech. Dev. 44,3-16. 20 Tomarev, S.I., Sundin, O., Banerjee-Basu, S., Duncan, M.K., Yang, J.-M. important transcription factor for lens determination and and Piatigorsky, J. (1996). A chicken homeobox gene Proxl related to crystallin gene expression in the lens, have brought exciting Drosophila Prosper0 is expressed in the developing lens. Dev. Dynam. (in press). new avenues of research for exploring the eye and lens. In 21 Taira, M., Hayes, W.P., Otani, H. and Dawid, 1.6. (1993). Expression of LIM class homeobox gene Xlim-3 in Xenopus development is limited to neural and addition, the growing number of crystallin genes that neuroendocrinetissues. Dev. Biol. 159,245-259. depend upon Pax-6 for their lens-preferred expression may 22 Lieu, I.S.C. et a/. (1994). Developmental expression of a novel murine homeobox gene (CHx 10): evidence for roles in determination of the neuroretina also provide new insights concerning the evolutionary and inner nuclear layer. Neuron 13,377-393. mechanisms used for recruiting a diverse set of multifun- 23 Simeone, A., Gulisano, M., Acampora, D., Stornaiulo, A., Rambaldi, M. and Boncinelli, E. (1992). Two vertebrate homeobox genes related to the Drosophila tional proteins to become the refractive crystallins of the empty spiracles gene are expressed in the embryonic cerebral cortex. EM60 J. transparent lens. 11,2541 -2550. 24Oliver, G., Mailhos, A., Wehr, R., Copeland, N.G., Jenkins, N.A. and Gruss, P. (1995). Six3, a murine homologue of the sine oculisgene, demarcates the most Acknowledgements anterior border of the developing neural tube and is expressed during eye development. Development 121,4045-4055. We thank Drs M. Duncan, P. Frederikse, R. Gopal-Srivas- 25 Sundin, O., Toy, J., Leppert, G., Yang J.-M. and Kang, R. (1996). Optx: a tava, J. Haynes, C. Sax and S. Tomarev from our laboratory novel family of homeobox genes selectively expressed in the developing eye. lnvest. Ophthal. Vis. Sci. 37 (Suppl.), 200. and Dr K. Yasuda for sharing their unpublished data; and 26 Hodgkinson, C. eta/. (1993). Mutations at the mouse microphthalmia locus Drs S. Tomarev, P. Zelenka, C. Sax and M. Kantorow for are associated with defects in a gene encoding a novel basic-helix-loop-helix- critical reading of this manuscript. We thank Jeff Aarons and zipper protein. Ce//74,395-404. 27 Hatini, V., Tao, W. and Lai, E. (1994). Expression of winged helix genes, BF-1 Martha Blalock for their help with preparation of figures. and BF-2, define adjacent domains within the developing forebrain and retina. J. Neurobiol. 25, 1239-1309. 28 Wang, S.-2. and Adler, R. (1994). A developmentally regulated basic-leucine zipper-like gene and its expression in embryonic retina and lens. Roc. NatlAcad. References Sci. USA91,1351-1355. 1 Saha, M.S., Servetnick, M. and Grainger, R.M. (1992). Vertebrate eye 29 Dolle, P., Rubeete, E., Leroy, P., Morris-Kay, G. and Chambon, P. (1990). development. Curr. Opin. Genet. Dev. 2, 582-588. Retinoic acid receptors and cellular retinoid binding proteins. I Systematic study of 2 Grainger, R.M. (1992). Embryonic lens induction: shedding light on vertebrate their differential pattern of transcription during mouse organogenesis. tissue determination. Trends Genet. 8, 349-355. Development 110,1133-1 151.

BioEssavs Vol. 18 no. 8 629 Review articles

30 Doh, P., Fraulob, V., Kastner, P. and Chambon, P. (1994). Developmental 53 Cvekl, A., Sax, C.M., Li, X., McDermott, J.B. and Piatigorsky, J. (1995). Pax- expression of murine retinoid X receptor (RXR) genes. Mech. Dev. 45, 91-104. 6 and lens-specifictranscription of the chicken 81 -crystallin gene. Proc. Natl Acad. 31 Kamachi, Y., Sockanathaw, S., Liu, Q., Breitman, M., Lovell-Badge, R. and Scl. USA 92,4681 -4685. Kondoh, H. (1995). Involvement of SOX proteins in lens-specific activation of 54 Richardson, J., Cvekl, A. and Wistow, G. (1995). Pax-6 is essential for lens- crystallin genes. EM60 J. 14,3510-3519. specific expression of (-crystallin. Proc. Natl Acad. Sci. USA 92,4676-4680. 32 Martin, P. eta/. (1992). Characterization of a paired box- and homeobox- 55 Piatigorsky, J. and Zelenka, P.S. (1992). Transcriptional regulation of containing quail gene (Pax-QNR) expressed in the neuroretina. Oncogene 7, crystallin genes: cis elements, trans-factors, and signal transduction systems in 1721-1 728. the lens. Adv. Dev. Eiochem. 1,211-256. 33 Hanson, I. et a/. (1994). Mutations at the PAX6 locuss are found in 56 Piatigorsky, J. (1992). Lens crystallins. Innovation associated with changes in heterogenous anterior segment malformations including Peter's anomaly. Nature gene regulation. J. Efol. Chem. 267, 4277-4280. Genet 6, 168-173. 57 Sax, C.M. and Piatigorsky, J. (1994). Expressionof the a-crystallinlsmall heat 34 Glaser, T., Jepeal, L., Edwards, J.G., Young, S.R., Favor, J. and Maas, R.L. shock proteinlmolecular chaperone genes in the lens and other tissues. Adv. (1994). PAX6 gene dosage effect in a family with congenital cataracts, aniridia, Enzymol. Relat. Areas Mol. Eiol. 69, 155-201. anophthalmia and central nervous system defects. Nature Genet 8,463-471. 58 Tomarev, S.I. and Piatigorsky, J. (1996). Lens crystallins of invertebrates: 35 Grindley, J.C., Davidson, D.R. and Hill, R.E. (1995). The role of Pax-6 in eye recruitment from glutathione S-transferase, aldehyde dehydrogenase and other and nasal development. Development121, 1433-1442. novel proteins. Eur. J. Eiochem. 235, 449-465. 36 Li, H.-S., Yang, J.-M., Jacobson, R.D., Pasko, D. and Sundin, 0. (1994). 59 Haynes, J.I., II, Duncan, M.K. and Piatigorsky, J. (1996). Spatial and Pax-6 is first expressed in a region of ectoderm anterior to the early neural plate: temporal activity of the aB-crystallinlsmall heat shock protein gene promoter in implications for stepwise determination of the lens. Dev. Eiol. 162, 181-194. transgenic mice. Dev. Dynam. (in press). 37 Fujiwara, M., Uchida, T., Osumi-Yamashita, N. and Eto, K. (1994). Uchida 60 Goring, D.R.. Bryce, D.M., Tsui, L.-C., Breitman, M.L. and Liu, Q. (1993). rat (rSey): a new mutant rat with craniofocal abnormalities resemblingthose of the Developmental regulation and cell type-specific expression of the murine mouse Small eye mutant. Differentiation57,31-38. 7- 38 Quinn, J.C., West, J.D. and Hill, R.E. (1996). Multiple functions for Pax6 in crystallin gene is mediated through a lens-specific element containing the yF-1 mouse eye and nasal development. Genes Dev. 10,435-446. binding site. Dev. Dynam. 196, 143-152. 39 Kastner, P. eta/. (1994). Genetic analysis of RXRa developmental function: 61 Duncan, M.K., Li, X., Ogino, H., Yasuda, K. and Piatigorsky, J. (1996) convergence of RXR and RAR signalling pathways in heart and eye Developmental regulation of the chicken pel -crystallin promoter in transgenic morphogenesis. Cell78,987-1003. mice. Mech. Dev. (in press). 40 Lohnes, D. et ar. (1994). Function of the retinoic acid receptors (RARs) during 62 McDermott, J.B., Cvekl, A. and Piatigorsky, J. (1996). Lens-specific development. (1) Craniofacial and skeletal abnormalities in RAR double mutants. expression of a chicken aA3/A1 -crystallin promoter fragment in transgenic mice. Development120,2723-2748. Eiochem. Eiophys. Res. Commun. 221,559-564. 41 Plaza, S.,Dozier, C. and Saule, S. (1993). Quail PAX-6 (PAX-QNR) encodes 63 Dirks, R.P.H., Klok, E.J., van Genesen, S.T., Schoenmakers, J.G.G. and a transcription factor able to bind and transactivate its own promoter. Cell Growth Lubsen, N.H. (1996). The sequence of regulatory events controlling the Differ. 4, 1041-1050. expression of the $-crystallin gene during fibroblast growth factor-mediated rat 42 Treisman, J., Harris, E and Desplan, C. (1991). The paired box encodes a lens fiber differentiation. Dev. BIOl. 173, 14-25. second DNA-bindingdomain in the Paired homeo domain protein. Genes Dev. 5, 64 Sax, C,M. et a/. (1995). Lens-specific activity of the mouse aA-crystallin 594-604. promoter in the absence of TATA box: functional and protein binding analysis of 43 Treisman, J., Gonczy, P., Vashishtha, M., Harris, E. and Desplan, C. the mouse aA-crystallin PEI region. NucleicAcids Res. 23,442-451. (1989). A single amino acid can determine the DNA binding specificity of 65 Gopal-Srivastava, R., Haynes, J.I., II, and Piatigorsky, J. (1995). Regulation homeodomain proteins. Cell59, 553-562. of the murine aB-crystallinlsmali heat shock protein gene in cardiac muscle. Mol. 44 Xu, W.. Rould, M.A., Jun, S., Desplan, C. and Pabo, C. (1995). Crystal Cell. Biol. 15,7081-7090. structure of a paired domain-DNA complex at 2.5A resolution reveals structural 66 Sekido, R. eta/. (1994). The S-crystallin enhancer-binding protein 6EF1 is a basis for Pax developmental mutations. Ce//80,639-650. repressor of E2-box-mediatedgene activation. Mo/. Cell. Biol. 14, 5692-5700. 45 Epstein, J.A., Glaser, T., Cai, L., Jepeal, L., Walton, D.S. and Maas, R.L. 67 Liu, Q., Shalaby, F., Puri, M.C., Tang, S. and Breitman, M.L. (1994). Novel (1994). Two independent and interactive DNA-binding subdomains of the Pax6 zinc finger proteins that interact with the mouse yF-crystallin promoter and are paired domain are regulated by alternative splicing. Genes Dev. 8,2022-2034. expressed in the sclerotome during early somitogenesis. Dev. Biol. 165, 165- 46 Epstein, J., Cai, J., Glaser, T., Jepeal, L. and Maas, R.L. (1994). 177. Identificationof a Pax paired domain recognition sequence and evidence for DNA- 68 Tini, M., Fraser, R.A. and Giguere, V. (1995). Functional interactionsbetween dependent conformationalchange. J. Biol. Chem. 269,8355-8361. retinoic acid receptor-related orphan nuclear receptor (RORo.) and the retinoic 47 Czerny, T., Schaffner, G. and Busslinger, M. (1993). DNA sequence acid receptors in the regulation of the yF-crystallin gene. J. Biol. Chem. 270, recognition structure of the paired domain and its binding site. Genes Dev. 7, 20156-20161. 2048-2061. 69 Matsuo, I. and Yasuda, K. (1992). The cooperative interaction between two 48 Czerny, T. and Busslinger, M. (1995). DNA-binding and transactivation motifs of an enhancer element of the chicken aA-crystallin gene, aCEl and aCE2, properties of Pax-6:three amino acids in the paired domain are responsible for the confers lens-specificexpression. Nucleic Acids Res. 20,3701-3712. different sequence recognition of Pax-6 and BSAP (Pax-5). Mol. Cell. Biol. 15, 2858-2871. 70 Frederikse, P.F. and Piatigorsky, J. (1 994). Normal and heat-inducible 49 Carriere, C. ef a/. (1995). Nuclear localization signals, DNA binding, and binding of HSF proteins to a-crystallin regulatory sequences. lnvest. Ophthalmol. transactivation properties of quail Pax-6 (Pax-QNR) isoforms. Cell Growth Diff. 6, Visual. Sci. 35 (Suppl.), 2073. 1531-1540. 71 Pituello, F., Yamada, G. and Gruss, P. (1995). Activin A inhibits Pax-6 50 Carriere, C.S. ef a/. (1993). Characterization of quail Pax-6 (Pax-QNR) expression and perturbs cell differentiation in the developing spinal cord in vitro. proteins expressed in the neuroretina. Mol. Cell. Biol. 13, 7257-7266. Proc. NatlAcad. Sci. USA 92,6952-6956. 51 Cvekl, A., Sax, C.M., Bresnick, E.H. and Piatigorsky, J. (1994). Complex 72 Ekker, S.C. eta/.(1 995). Patterning activities of vertebrate hedgehog proteins array of positive and negative elements regulates the chicken aA-crystallin gene: in the developing eye and brain. Curr. Biol. 5,944-955. involvement of Pax-6. USF, CREB and/or CREM, and AP-1 proteins. Mol. Cell. EIol. 14.7363-7367. Ale6 Cvekl and Joram Piatigorsky are at the Laboratory of 52 Cvekl, A., Kashanchi, F., Sax, C.M.,Brady, J. and Piatigorsky, J. (1995). Molecular and Developmental Biology, National Eye Institute, Transcriptional regulation of the mouse aA-crystallin gene: activation dependent National Institutes of Health, Bethesda, MD 20892-2730, USA. on a cyclic AMP-responsive element (DEllCRE) and a Pax-6-binding site. Mol. E-mail: JoramQ helix.nih.gov and [email protected]

Cell. Biol. 15,653-660...... ~~~

630 Vol. 18 no. 8 BioEssavs