DOCSLIB.ORG

Comparison of Gene Expression Profiling in Pressure and Volume

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

1029 Hypertens Res Vol.29 (2006) No.12 p.1029-1045 Original Article Comparison of Gene Expression Profiling in Pressure and Volume Overload–Induced Myocardial Hypertrophies in Rats Hiroshi MIYAZAKI1), Naoki OKA1), Akimasa KOGA1), Haruya OHMURA1), Tamenobu UEDA1), and Tsutomu IMAIZUMI1),2) Gene expression profiling has been conducted in rat hearts subjected to pressure overload (PO). However, pressure and volume overload produce morphologically and functionally distinct forms of cardiac hypertro- phy. Surprisingly, gene expression profiling has not been reported for in an animal model of volume over- load (VO). We therefore compared the gene expression profiles in the hypertrophied myocardium of rats subjected to PO and VO using DNA chip technology (Affymetrix U34A). Constriction of the abdominal aorta and abdominal aortocaval shunting were used to induce PO and VO, respectively. The gene expression pro- files of the left ventricle (LV) 4 weeks after the procedure were analyzed by DNA chips. There were compa- rable increases in the left ventricular weight/body weight ratio in rats subjected to PO and VO. Echocardiography revealed concentric hypertrophy in the PO animals, but eccentric hypertrophy in the rats subjected to VO. The expressions of many genes were altered in VO, PO, or both. Among the genes that were upregulated in both forms of hypertrophy, greatly increased expressions of B-type natriuretic peptide, lysyl oxidase–like protein 1 and metallothionein-1 (MT) were confirmed by real-time reverse transcription– polymerase chain reaction (RT-PCR). Because free radicals are increased in the hypertrophied heart and may contribute to apoptosis, we examined the role of MT, a free radical scavenger, in apoptosis. The over- expression of MT in H9c2 cells inhibited norepinephrine-induced apoptosis, suggesting that MT may act as an anti-apoptotic molecule in cardiac hypertrophy. In conclusion, we found that many genes were regulated in VO, PO, or both. In addition, a novel role of MT in the hypertrophied myocardium was suggested. (Hyper- tens Res 2006; 29: 1029–1045) Key Words: gene expression, hypertrophy, DNA chip, metallothionein-1, apoptosis phy whereas VO produces eccentric hypertrophy. At the cel- Introduction lular level, cardiomyocytes grow vertically in PO and longitudinally in VO. The molecular mechanisms of these Pressure and volume overload (PO and VO, respectively) differences have been unknown. Changes of some specific produce morphologically and functionally distinct forms of genes have been reported in the hearts of PO and VO, i.e., the cardiac hypertrophy (1–4); PO produces concentric hypertro- expressions of collagen isoforms (5, 6) and matrix metallo- From the 1)Department of Medicine, Division of Cardio-Vascular Medicine and 2)Cardiovascular Research Institute, Kurume University School of Med- icine, Kurume, Japan. This study was supported in part by a grant from the Kimura Memorial Heart Foundation/Pfizer Grant for Research on Autonomic Nervous System and Hypertension (to N.O.), and a grant for Science Frontier Research Promotion Centers and a Grant-in-Aid for the Encouragement of Young Scientists (to H.M. and N.O.) from the Ministry of Education, Culture, Sports, Science and Technology, Japan. Address for Reprints: Naoki Oka, M.D., Ph.D., Department of Medicine, Division of Cardio-Vascular Medicine, Kurume University School of Medi- cine, 67 Asahi-machi, Kurume 830–0011, Japan. E-mail: [email protected] Received February 27, 2006; Accepted in revised form September 4, 2006. 1030 Hypertens Res Vol. 29, No. 12 (2006) A ** ** B ** ** 10 2.5 8 ) 2 m m 6 ( 1.5 T 4 S 1 V I LVDd (mm) 2 0.5 0 0 Sham VO PO Sham VO PO C D ** 60 6 ** 50 ) 5 m 40 m 4 ( 30 D 3 A L Shortening 20 2 % Fractional 10 1 0 0 Sham VO PO SOham V PO Fig. 1. Echocardiographic measurements of the hypertrophied rat heart. Echocardiography was performed 28 days after hemo- dynamic overload as described in Methods. VO, volume overload group; PO, pressure overload group; LVDd, end-diastolic diameter of the left ventricle; IVST, interventricular septal wall thickness; %FS, percent fractional shortening; LAD, left atrial diameter. Values are the mean±SD. **p<0.01 vs. the sham group. proteinases (7), the expression of β myosin heavy chain (8), pentobarbital, then examined by echocardiography with an the transcriptional regulation of adrenomedullin (9), and the SSD 5500 and a 7.5 MHz probe (Aloka, Tokyo, Japan). expressions of growth factors (10, 11) and β-tubulin (12). Based on these previous reports, it is anticipated that some DNA Chip Analysis specific genes are regulated similarly or differentially in PO and VO, but the regulation of genes other than those listed DNA chips (GeneChip Rat Genome U34A arrays) were pur- above has not been clarified. Microarray analysis is a useful chased from Affymetrix (Santa Clara, USA). Poly (A) RNA method to analyze the behavior of many genes. With this was extracted from the left ventricle (LV) by using a FAST method, gene profiling has been conducted in animal hearts track RNA purification kit (Invitrogen, Carlsbad, USA). We subjected to PO (13, 14). Surprisingly, however, gene expres- mixed poly (A) RNAs prepared from the LV of five rats and sion profiling has not been conducted in hearts subjected to the samples were analyzed by three DNA chips in each group. VO. Accordingly, we compared the gene expression profiles DNA chip analysis was performed according to the manufac- in the hypertrophied myocardium of rats subjected to PO and turer’s recommended protocol. Each of the groups was com- VO using the DNA chip technology. pared with each of the other groups, resulting in 27 comparison tests. Average intensity values for each probe set p Methods were obtained from the Affymetrix MicroArray Suite 4.0. A value less than 0.01 was arbitrarily assigned as the level of statistical significance. We considered genes that were ele- Animal Models vated by >2 fold compared with controls as “upregulated,” Male Wistar rats were used for the experiments. PO was pro- genes that were reduced to <0.5 as “downregulated,” and duced in rats by abdominal aortic banding (15), and VO by genes that were altered by 0.8–1.2 fold as showing “no aortocaval shunting (16). The rats were sacrificed 28 days change.” The genes that were expressed at very low levels after the procedure. All animal procedures were conducted (those with a signal intensity less than 100) or genes that were according to the guidelines provided by the Kurume Univer- considered not to be present based on low signal intensity by sity Institutional Animal Care and Use Committee under an the Affymetrix software under all conditions were omitted. approved protocol. For clustering analysis, the CEL files were converted into DCP files using dCHIP analysis software (www.biostat.har vard.edu/compalab/cdhip/), as described previously by Li and Echocardiography Wong (17). Genechips were normalized, and model-based At the day before sacrifice, rats were lightly anesthetized with expression values were generated. We used hierarchical clus- Miyazaki et al: Gene Expression Profiling in Cardiac Hypertrophy 1031 A * B * ** ** 4 7 6 3 5 4 2 3 2 1 HW/BW (mg/g) LVW/ BW (mg/g) 1 0 0 Sham VO PO Sham VO PO Fig. 2. Left ventricular weight and heart weight 28 days after hemodynamic overload. A: LVW/BW. B: HW/BW. VO, volume overload group; PO, pressure overload group; LVW/BW, left ventricular weight normalized to body weight; HW/BW, heart weight normalized to body weight. Values are the mean±SD, *p<0.05, **p<0.01 vs. the sham group. A Genes upregulated D Genes behaved differentially PO 52 33 88 VO PO 80 5 72 VO B Genes downregulated E Genes behaved differentially PO 41 31 46 VO PO 61 11 110 VO C Genes unaltered PO 118 8304 77 VO Fig. 3. Comparisons of differentially regulated genes. Venn diagrams were produced to compare the number of genes altered in the volume overload (VO), pressure overload (PO), and sham groups. A: Genes differentially upregulated between the sham group and the VO group, PO group, or both. B: Genes differentially downregulated between the sham group and the VO group, PO group, or both. C: Genes unaltered between the sham group and the VO group, PO group, or both. D: Genes upregulated in the PO group, downregulated in the VO group, or both. E: Genes upregulated in the VO group, downregulated in the PO group, or both. tering with the average linkage method. The functions of somal RNA (TaqMan ribosomal RNA control reagents; these altered genes were classified by clusters of orthologous Applied Biosystems). The primers and TaqMan probes used groups analysis. in these experiments were as follows: guanosine monophos- phate (GMP) reductase TaqMan probe, CTCTGACGG AAGCTGCACATGTCCA; GMP reductase sense-primer, Real-Time Reverse Transcription–Polymerase GGCCTCAAGGGACACATCA; GMP reductase antisense- Chain Reaction primer, AAAGGCTTTGGCGACATCTC; metallothionein-1 Total RNA was prepared with an RNeasy Midi Kit (MT) TaqMan probe, TGCAAAGGTGCCTCGGACAAG (QIAGEN, Tokyo, Japan) from LV. Real-time reverse tran- TGC; MT sense-primer, GTGGGCTGCTCCAAATGTG; scription–polymerase chain reaction (RT-PCR) was per- MT antisense-primer, GGTCCGGAAATTATTTACACC formed by a GeneAmp 5700 and a TaqMan One-Step RT- TGA; B-type natriuretic peptide (BNP) TaqMan Probe, PCR Master Mix Reagents Kit (Applied Biosystems, Foster CGGCGCAGTCAGTCGCTTGG; BNP sense-primer, TGG City, USA) according to the manufacturer’s instruction. GCAGAAGATAGACCGGA; BNP antisense-primer, ACA Expression values for each gene were
Recommended publications
  • Supplementary Data

    Supplementary Data

    Supplementary Data for Quantitative Changes in the Mitochondrial Proteome from Subjects with Mild Cognitive Impairment, Early Stage and Late Stage Alzheimer’s disease Table 1 - 112 unique, non-redundant proteins identified and quantified in at least two of the three analytical replicates for all three disease stages. Table 2 - MCI mitochondrial samples, Protein Summary Table 3 - MCI mitochondrial samples, Experiment 1 Table 4 - MCI mitochondrial samples, Experiment 2 Table 5 - MCI mitochondrial samples, Experiment 3 Table 6 - EAD Mitochondrial Study, Protein Summary Table 7 - EAD Mitochondrial Study, Experiment 1 Table 8 - EAD Mitochondrial Study, Experiment 2 Table 9 - EAD Mitochondrial Study, Experiment 3 Table 10 - LAD Mitochondrial Study, Protein Summary Table 11 - LAD Mitochondrial Study, Experiment 1 Table 12 - LAD Mitochondrial Study, Experiment 2 Table 13 - LAD Mitochondrial Study, Experiment 3 Supplemental Table 1. 112 unique, non-redundant proteins identified and quantified in at least two of the three analytical replicates for all three disease stages. Description Data MCI EAD LAD AATM_HUMAN (P00505) Aspartate aminotransferase, mitochondrial precursor (EC Mean 1.43 1.70 1.31 2.6.1.1) (Transaminase A) (Glutamate oxaloacetate transaminase 2) [MASS=47475] SEM 0.07 0.09 0.09 Count 3.00 3.00 3.00 ACON_HUMAN (Q99798) Aconitate hydratase, mitochondrial precursor (EC 4.2.1.3) Mean 1.24 1.61 1.19 (Citrate hydro-lyase) (Aconitase) [MASS=85425] SEM 0.05 0.17 0.18 Count 3.00 2.00 3.00 ACPM_HUMAN (O14561) Acyl carrier protein, mitochondrial
  • Transcriptomic Analysis of Human Brain Microvascular Endothelial

    Transcriptomic Analysis of Human Brain Microvascular Endothelial

    www.nature.com/scientificreports OPEN Transcriptomic analysis of human brain microvascular endothelial cells exposed to laminin binding protein (adhesion lipoprotein) and Streptococcus pneumoniae Irene Jiménez‑Munguía1, Zuzana Tomečková1, Evelína Mochnáčová1, Katarína Bhide1, Petra Majerová2 & Mangesh Bhide1,2* Streptococcus pneumoniae invades the CNS and triggers a strong cellular response. To date, signaling events that occur in the human brain microvascular endothelial cells (hBMECs), in response to pneumococci or its surface adhesins are not mapped comprehensively. We evaluated the response of hBMECs to the adhesion lipoprotein (a laminin binding protein—Lbp) or live pneumococci. Lbp is a surface adhesin recently identifed as a potential ligand, which binds to the hBMECs. Transcriptomic analysis was performed by RNA‑seq of three independent biological replicates and validated with qRT‑PCR using 11 genes. In total 350 diferentially expressed genes (DEGs) were identifed after infection with S. pneumoniae, whereas 443 DEGs when challenged with Lbp. Total 231 DEGs were common in both treatments. Integrative functional analysis revealed participation of DEGs in cytokine, chemokine, TNF signaling pathways and phagosome formation. Moreover, Lbp induced cell senescence and breakdown, and remodeling of ECM. This is the frst report which maps complete picture of cell signaling events in the hBMECs triggered against S. pneumoniae and Lbp. The data obtained here could contribute in a better understanding of the invasion of pneumococci across BBB and underscores role of Lbp adhesin in evoking the gene expression in neurovascular unit. Streptococcus pneumoniae (also known as pneumococcus) is a life-threatening pathogen responsible for high morbidity and mortality rates worldwide1. It can cross the blood–brain barrier (BBB) and cause meningitis, commonly known as pneumococcal meningitis, a rare but life-threatening medical emergency.
  • The Rise and Fall of the Bovine Corpus Luteum

    The Rise and Fall of the Bovine Corpus Luteum

    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
  • The Airway Epithelium Undergoes Metabolic Reprogramming in Individuals at High Risk for Lung Cancer

    The Airway Epithelium Undergoes Metabolic Reprogramming in Individuals at High Risk for Lung Cancer

    The airway epithelium undergoes metabolic reprogramming in individuals at high risk for lung cancer S.M. Jamshedur Rahman, … , Jamey D. Young, Pierre P. Massion JCI Insight. 2016;1(19):e88814. https://doi.org/10.1172/jci.insight.88814. Research Article Metabolism Oncology The molecular determinants of lung cancer risk remain largely unknown. Airway epithelial cells are prone to assault by risk factors and are considered to be the primary cell type involved in the field of cancerization. To investigate risk- associated changes in the bronchial epithelium proteome that may offer new insights into the molecular pathogenesis of lung cancer, proteins were identified in the airway epithelial cells of bronchial brushing specimens from risk-stratified individuals by shotgun proteomics. Differential expression of selected proteins was validated by parallel reaction monitoring mass spectrometry in an independent set of individual bronchial brushings. We identified 2,869 proteins, of which 312 proteins demonstrated a trend in expression. Pathway analysis revealed enrichment of carbohydrate metabolic enzymes in high-risk individuals. Glucose consumption and lactate production were increased in human bronchial epithelial BEAS2B cells treated with cigarette smoke condensate for 7 months. Increased lipid biosynthetic capacity and 13 net reductive carboxylation were revealed by metabolic flux analyses of [U- C5] glutamine in this in vitro model, suggesting profound metabolic reprogramming in the airway epithelium of high-risk individuals. These results provide a rationale for the development of potentially new chemopreventive strategies and selection of patients for surveillance programs. Find the latest version: https://jci.me/88814/pdf RESEARCH ARTICLE The airway epithelium undergoes metabolic reprogramming in individuals at high risk for lung cancer S.M.
  • Primary Antibodies Flyer

    Primary Antibodies Flyer

    Primary Antibodies Your choice of size and format Format Concentration Size CF® dye conjugates (13 colors) 0.1 mg/mL 100 or 500 uL Biotin, HRP or AP conjugates 0.1 mg/mL 100 or 500 uL R-PE, APC, or Per-CP conjugates 0.1 mg/mL 250 uL Purified, with BSA 0.1 mg/mL 100 or 500 uL Purified, BSA-free (Mix-n-Stain™ Ready) 1 mg/mL 50 uL Advantages Figure 1. IHC staining of human prostate Figure 2. Flow cytometry analysis of U937 • More than 1000 monoclonal antibodies carcinoma with anti-ODC1 clone cells with anti-CD31/PECAM clone C31.7, • Growing selection of monoclonal rabbit ODC1/485. CF647 conjugate (blue) or isotype control (orange). antibodies • Validated in IHC and other applications Your choice of 13 bright and photostable CF® dyes • Choose from 13 bright and stable CF® dyes CF® dye Ex/Em (nm) Features • Also available with R-PE, APC, PerCP, HRP, AP, CF®405S 404/431 • Better fit for the 450/50 flow cytometer channel than Alexa Fluor® 405 or biotin CF®405M 408/452 • More photostable than Pacific Blue®, with less green spill-over • Purified antibodies available BSA-free, 1 mg/mL, • Compatible with super-resolution imaging by SIM ready to use for Mix-n-Stain™ labeling or other CF®488A 490/515 • Less non-specific binding and spill-over than Alexa Fluor® 488 conjugation • Very photostable and pH-insensitive • Compatible with super-resolution imaging by TIRF • Offered in affordable 100 uL size CF®543 541/560 • Brighter than Alexa Fluor® 546 CF®555 555/565 • Brighter than Cy®3 • Validated in multicolor super-resolution imaging by STORM CF®568
  • IMPDH2: a New Gene Associated with Dominant Juvenile-Onset Dystonia-Tremor Disorder

    IMPDH2: a New Gene Associated with Dominant Juvenile-Onset Dystonia-Tremor Disorder

    www.nature.com/ejhg BRIEF COMMUNICATION OPEN IMPDH2: a new gene associated with dominant juvenile-onset dystonia-tremor disorder 1,8 1,8 2 3 1,4 2 5 Anna Kuukasjärvi , Juan✉ C. Landoni , Jyrki Kaukonen , Mika Juhakoski , Mari Auranen , Tommi Torkkeli , Vidya Velagapudi and Anu Suomalainen 1,6,7 © The Author(s) 2021 The aetiology of dystonia disorders is complex, and next-generation sequencing has become a useful tool in elucidating the variable genetic background of these diseases. Here we report a deleterious heterozygous truncating variant in the inosine monophosphate dehydrogenasegene(IMPDH2) by whole-exome sequencing, co-segregating with a dominantly inherited dystonia-tremor disease in a large Finnish family. We show that the defect results in degradation of the gene product, causing IMPDH2 deficiency in patient cells. IMPDH2 is the first and rate-limiting enzyme in the de novo biosynthesis of guanine nucleotides, a dopamine synthetic pathway previously linked to childhood or adolescence-onset dystonia disorders. We report IMPDH2 as a new gene to the dystonia disease entity. The evidence underlines the important link between guanine metabolism, dopamine biosynthesis and dystonia. European Journal of Human Genetics; https://doi.org/10.1038/s41431-021-00939-1 INTRODUCTION The disease-onset was between 9 and 20 years of age. Table 1 Dystonias are rare movement disorders characterised by sustained or summarises the clinical presentations. intermittent muscle contractions causing abnormal, often repetitive, movements and/or postures. Dystonia can manifest as an isolated Case report symptom or combined with e.g. parkinsonism or myoclonus [1]. While Patient II-6 is a 46-year-old woman.
  • An Interactomics Overview of the Human and Bovine Milk Proteome Over Lactation Lina Zhang1, Aalt D

    An Interactomics Overview of the Human and Bovine Milk Proteome Over Lactation Lina Zhang1, Aalt D

    Zhang et al. Proteome Science (2017) 15:1 DOI 10.1186/s12953-016-0110-0 RESEARCH Open Access An interactomics overview of the human and bovine milk proteome over lactation Lina Zhang1, Aalt D. J. van Dijk2,3,4 and Kasper Hettinga1* Abstract Background: Milk is the most important food for growth and development of the neonate, because of its nutrient composition and presence of many bioactive proteins. Differences between human and bovine milk in low abundant proteins have not been extensively studied. To better understand the differences between human and bovine milk, the qualitative and quantitative differences in the milk proteome as well as their changes over lactation were compared using both label-free and labelled proteomics techniques. These datasets were analysed and compared, to better understand the role of milk proteins in development of the newborn. Methods: Human and bovine milk samples were prepared by using filter-aided sample preparation (FASP) combined with dimethyl labelling and analysed by nano LC LTQ-Orbitrap XL mass spectrometry. Results: The human and bovine milk proteome show similarities with regard to the distribution over biological functions, especially the dominant presence of enzymes, transport and immune-related proteins. At a quantitative level, the human and bovine milk proteome differed not only between species but also over lactation within species. Dominant enzymes that differed between species were those assisting in nutrient digestion, with bile salt- activated lipase being abundant in human milk and pancreatic ribonuclease being abundant in bovine milk. As lactation advances, immune-related proteins decreased slower in human milk compared to bovine milk.
  • 1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental

    1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental

    Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN.
  • Calprotectin and Calgranulin C Serum Levels in Bacterial Sepsis

    Calprotectin and Calgranulin C Serum Levels in Bacterial Sepsis

    Diagnostic Microbiology and Infectious Disease 93 (2019) 219–226 Contents lists available at ScienceDirect Diagnostic Microbiology and Infectious Disease journal homepage: www.elsevier.com/locate/diagmicrobio ☆ Calprotectin and calgranulin C serum levels in bacterial sepsis Eva Bartáková a,MarekŠtefan a,Alžběta Stráníková a, Lenka Pospíšilová b, Simona Arientová a,Ondřej Beran a, Marie Blahutová b, Jan Máca a,c,MichalHoluba,⁎ a Department of Infectious Diseases, First Faculty of Medicine, Charles University and Military University Hospital Prague, U Vojenské nemocnice 1200, 169 02 Praha 6, Czech Republic b Department of Clinical Biochemistry, Military University Hospital Prague, U Vojenské nemocnice 1200, 169 02 Praha 6, Czech Republic c Department of Anesthesiology and Intensive Care Medicine, University Hospital of Ostrava, 17. listopadu 1790/5, 708 52 Ostrava-Poruba, Czech Republic article info abstract Article history: The aim of this study was to evaluate the serum levels of calprotectin and calgranulin C and routine biomarkers in Received 26 March 2018 patients with bacterial sepsis (BS). The initial serum concentrations of calprotectin and calgranulin C were signif- Received in revised form 2 October 2018 icantly higher in patients with BS (n = 66) than in those with viral infections (n = 24) and the healthy controls Accepted 10 October 2018 (n = 26); the level of calprotectin was found to be the best predictor of BS, followed by the neutrophil- Available online 17 October 2018 lymphocyte count ratio (NLCR) and the level of procalcitonin (PCT). The white blood cell (WBC) count and the NLCR rapidly returned to normal levels, whereas PCT levels normalized later and the increased levels of Keywords: Sepsis calprotectin, calgranulin C, and C-reactive protein persisted until the end of follow-up.
  • Adaptation to Hif1α Deletion in Hypoxic Cancer Cells by Upregulation of GLUT14 and Creatine Metabolism

    Adaptation to Hif1α Deletion in Hypoxic Cancer Cells by Upregulation of GLUT14 and Creatine Metabolism

    Published OnlineFirst March 18, 2019; DOI: 10.1158/1541-7786.MCR-18-0315 Metabolism Molecular Cancer Research Adaptation to HIF1a Deletion in Hypoxic Cancer Cells by Upregulation of GLUT14 and Creatine Metabolism Alessandro Valli1,2, Matteo Morotti1, Christos E. Zois1, Patrick K. Albers3, Tomoyoshi Soga4, Katharina Feldinger1, Roman Fischer2, Martin Frejno2, Alan McIntyre1, Esther Bridges1, Syed Haider1, Francesca M. Buffa1, Dilair Baban3, Miguel Rodriguez5,6, Oscar Yanes5,6, Hannah J. Whittington7, Hannah A. Lake7, Sevasti Zervou7, Craig A. Lygate7, Benedikt M. Kessler2, and Adrian L. Harris1 Abstract Hypoxia-inducible factor 1a is a key regulator of the than phosphofructokinase. Furthermore, glucose uptake hypoxia response in normal and cancer tissues. It is well could be maintained in hypoxia through upregulation of recognized to regulate glycolysis and is a target for therapy. GLUT14, not previously recognized in this role. Finally, However, how tumor cells adapt to grow in the absence of there was a marked adaptation and change of phospho- HIF1a is poorly understood and an important concept to creatine energy pathways, which made the cells susceptible understand for developing targeted therapies is the flexi- to inhibition of creatine metabolism in hypoxic condi- bility of the metabolic response to hypoxia via alternative tions. Overall, our studies show a complex adaptation to pathways. We analyzed pathways that allow cells to survive hypoxia that can bypass HIF1a, but it is targetable and it hypoxic stress in the absence of HIF1a,usingtheHCT116 provides new insight into the key metabolic pathways colon cancer cell line with deleted HIF1a versus control. involved in cancer growth. Spheroids were used to provide a 3D model of metabolic gradients.
  • Proteomic Analysis of Two Non-Bronchoscopic Methods of Sampling the Lungs of Patients with the Acute Respiratory Distress Syndrome (ARDS)

    Proteomic Analysis of Two Non-Bronchoscopic Methods of Sampling the Lungs of Patients with the Acute Respiratory Distress Syndrome (ARDS)

    Clin Proteom (2007) 3:30–41 DOI 10.1007/s12014-007-9002-8 Proteomic Analysis of Two Non-Bronchoscopic Methods of Sampling the Lungs of Patients with the Acute Respiratory Distress Syndrome (ARDS) Dong W. Chang & Giuseppe Colucci & Tomas Vaisar & Trevor King & Shinichi Hayashi & Gustavo Matute-Bello & Roger Bumgarner & Jay Heinecke & Thomas R. Martin & Guido M. Domenighetti Published online: 5 January 2008 # Humana Press Inc. 2007 Abstract BAL samples, 13.2% were increased in s-Cath compared to Objective The collection of lung fluid using a suction catheter mini-BAL, and 18.4% were decreased in s-Cath compared (s-Cath) and non-bronchoscopic bronchoalveolar lavage to mini-BAL. For each of the seven subjects, overabun- (mini-BAL) are two minimally invasive methods of sampling dance analysis showed that the actual number of differen- the distal airspaces in patients with the acute respiratory tially expressed spots in the mini-BAL and s-Cath sample distress syndrome (ARDS). The objective of this study was to was more than the expected number if the samples were determine the similarity of the lung fluid samples recovered identical. There were nine proteins that were consistently by these methods using proteomic analysis. differentially expressed between the mini-BAL and s-Cath Methods Distal lung fluid samples were collected from samples. Of these nine proteins, five are abundantly found seven mechanically ventilated patients with ARDS using in neutrophils or airway epithelial cells, suggesting that the both s-Cath and mini-BAL in each patient and compared s-Cath may sample the bronchial airways to a greater extent using two-dimensional difference gel electrophoresis.
  • Deamidation of Human Proteins

    Deamidation of Human Proteins

    Deamidation of human proteins N. E. Robinson*† and A. B. Robinson‡ *Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125; and ‡Oregon Institute of Science and Medicine, Cave Junction, OR 97523 Communicated by Frederick Seitz, The Rockefeller University, New York, NY, August 31, 2001 (received for review May 8, 2001) Deamidation of asparaginyl and glutaminyl residues causes time- 3D structure is known (23). This method is more than 95% dependent changes in charge and conformation of peptides and reliable in predicting relative deamidation rates of Asn residues proteins. Quantitative and experimentally verified predictive cal- within a single protein and is also useful for the prediction of culations of the deamidation rates of 1,371 asparaginyl residues in absolute deamidation rates. a representative collection of 126 human proteins have been It is, therefore, now possible to compute the expected deami- performed. These rates suggest that deamidation is a biologically dation rate of any protein for which the primary and 3D relevant phenomenon in a remarkably large percentage of human structures are known, except for very long-lived proteins. These proteins. proteins require measurement of the 400 Gln pentapeptide rates. in vivo deamidation ͉ asparaginyl residues Materials and Methods Calculation Method. The Brookhaven Protein Data Bank (PDB) eamidation of asparaginyl (Asn) and glutaminyl (Gln) was searched to select 126 human proteins of general biochem- Dresidues to produce aspartyl (Asp) and glutamyl (Glu) ical interest and of known 3D structure without bias toward any residues causes structurally and biologically important alter- known data about their deamidation, except for 13 proteins (as ations in peptide and protein structures.