University of Ghana College of Basic and Applied Sciences by Shirley Victoria Simpson (10551058) This Thesis Is Submitted To

Home , Fusobacterium, Haemophilus ducreyi, Pathogenic bacteria

UNIVERSITY OF GHANA

COLLEGE OF BASIC AND APPLIED SCIENCES

ISOLATION AND CHARACTERIZATION of Haemophilus ducreyi STRAINS FROM CHILDREN WITH CUTANEOUS LESIONS IN YAWS ENDEMIC REGIONS, GHANA

SHIRLEY VICTORIA SIMPSON

(10551058)

THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE AWARD OF MPHIL MOLECULAR CELL BIOLOGY OF INFECTIOUS DISEASES DEGREE

JULY, 2017

DECLARATION

This is to certify that this thesis is the result of research undertaken by me, Shirley Victoria

Simpson towards the award of Master of Philosophy in Molecular Cell Biology of

Infectious Diseases in the Department of Biochemistry, Cell and Molecular Biology,

School of Biological Sciences, College of Basic And Applied Sciences, University of

Ghana.

Signature------Date------

Shirley Victoria Simpson

(Candidate)

Signature------Date------

Prof. Kennedy Kwasi Addo

(Supervisor)

Signature------Date------

Dr. Lydia Mosi

(Co-Supervisor)

ABSTRACT

Recent discovery of cutaneous H. ducreyi has complicated the epidemiology of Yaws in endemic countries. Yaws and H. ducreyi ulcers are clinically indistinguishable from each other and some other causes of skin ulcerations. The aim of the study was to isolate and characterize H. ducreyi strains from lesions of children in yaws-endemic areas.

Symptomatic patients were first screened with Dual Path Platform (DPP-RDT) Syphilis

Screen & Confirm test kit (Chembio, Medford, New York) for yaws. Lesion exudates were tested by culture for H. ducreyi and real-time multiplex PCR assays were used to identify T.p subsp. pertenue DNA and H. ducreyi DNA. Azithromycin (AZT) resistance markers were screened for in T.p subsp. pertenue PCR positives. Bacterial 16S rRNA gene was amplified and sequenced to detect the presence of other pathogenic bacteria. Patient data showed 84 of 115 more males than females, mean aged 10 years. Eighty-seven percent had a clinically apparent skin lesion with few having skin conditions clinically consistent with yaws. Dual DPP-RDT positives were 64 while dual DPP-RDT negatives were 51. Of 60 bacteria culture positives obtained from symptomatic patients, 7 yielded a definitive diagnosis of H. ducreyi. Isolated cutaneous H. ducreyi strains by their appearance in colony morphology and colour differed compared to genital H. ducreyi strain, HD 35000. Out of 112 samples, 32 were H. ducreyi PCR positive, 11 were T.p subsp. pertenue PCR positive, while 1 had both pathogens. An A2058G point mutation in the 23S rRNA gene of T.p subsp. pertenue indicates resistance to AZT. A total of 69 of

112 samples with unknown aetiology could possibly be any of these bacterial species;

Fusobacterium necrophorum subsp. funduliforme, Catonella morbi and Staphylococcus capitis subsp. capitis amongst others. This study suggest the need to isolate bacterial species associated with cutaneous lesions to screen for other antibiotics to be used as a combination therapy with AZT during mass drug administration (MDA) activities.

DEDICATION

To God Almighty, all Glory to His Holy name and my son, Ashley Drew Dake.

iii

ACKNOWLEDGEMENTS

I wish to express my deep appreciation and indebtedness to my supervisors, Prof. Kennedy

Kwasi Addo and Dr. Lydia Mosi for their valuable guidance, encouragement, and support during this MPhil program.

I wish to express my heartfelt gratitude to Dr. Kingsley Asiedu, from WHO for his immense support and encouragement throughout my MPhil study. I would like to show appreciation and acknowledge Dr. Cheng Chen, Dr. Allan Pillay, Dr. Samantha Katz and

Kai-Hua Chi all of CDC, USA for the technology transfer and donation of laboratory reagents.

I wish to acknowledge WACCBIP (West African Center for Cell Biology of Infectious

Pathogens) for the second year scholarship and the platform to showcase my findings.

I would also like to show appreciation to Dr. Gloria Ivy Mensah, Prof. William Ampofo,

Dr. Cynthia Kwakye-Maclean for their diverse roles they played, not forgetting all members of the Bacteriology and Virology Department of NMIMR. I wish to thank Mr.

Abiola Isawumi and Ms. Adisa Abass for immense laboratory support for this work.

Special thanks to Ms. Ivy Amanor and Ms. Stephanie Clement-Owusu.

Special acknowledgements and appreciation go to my family, Mr. Paul Kow Simpson, Ms.

Grace Felicity Opoku, Mr. Richard Cudjoe, Mr. Francis Willie Laast and my younger siblings for their prayers and support both financially and physically.

TABLE OF CONTENTS

DECLARATION ...... i ABSTRACT ...... ii DEDICATION ...... iii ACKNOWLEDGEMENTS ...... iv TABLE OF CONTENTS ...... v LIST OF TABLES ...... viii LIST OF FIGURES ...... ix

CHAPTER ONE ...... 1 INTRODUCTION ...... 1 1.1 Rationale ...... 4 1.2 Aim of the Study ...... 6 1.3 Specific objectives ...... 7

CHAPTER TWO ...... 8 LITERATURE REVIEW...... 8 2.1 History of Chancroid ...... 8 2.2 The genus Haemophilus ...... 9 2.3 Characteristics of Haemophilus ducreyi ...... 10 2.3.1 Classes of Haemophilus ducreyi ...... 11 2.3.1.1 Subclades of Haemophilus ducreyi strains ...... 12 2.4 Pathogenesis of Chancroid ...... 14 2.5 Clinical presentation of Chancroid ...... 15 2.6 Host immune response to Haemophilus ducreyi infection ...... 18 2.7 Epidemiology of Haemophilus ducreyi infections ...... 20 2.8 Yaws ...... 23 2.8.1 The causative agent ...... 24 2.8.2 Pathogenesis...... 25 2.8.3 Clinical features of Yaws in children ...... 26 2.8.3.1 Primary Yaws ...... 26 2.8.3.2 Secondary Yaws ...... 27 2.8.3.3 Latent Yaws ...... 29 2.8.3.4 Tertiary Yaws ...... 29 2.8.4 Host immune response to Yaws infection ...... 29 2.8.5 Epidemiology ...... 30 2.8.6 Diagnosis ...... 32 2.9 Laboratory methods for diagnosis of Haemophilus ducreyi infections...... 34 2.9.1 Bacteriological diagnostic techniques ...... 35 2.9.2 Mass spectrometric identification method ...... 36 2.9.3 Serological detection...... 37 2.9.4 Molecular-based detection ...... 37 2.10 Treatment ...... 38

2.11 Antimicrobial susceptibility patterns ...... 39

CHAPTER THREE ...... 41 MATERIALS AND METHODS ...... 41 3.1 Study design ...... 41 3.2 Study sites ...... 41 3.3 Subject selection ...... 43 3.3.1 Inclusion and exclusion criteria ...... 43 3.4 Procedures ...... 44 3.4.1 Collection of clinical samples, processing, and transport ...... 44 3.4.2 Growth media for H. ducreyi isolation ...... 45 3.4.3 Storage media for H. ducreyi strains ...... 46 3.4.4 Isolation and identification of H. ducreyi strains ...... 46 3.4.5 Storage of H. ducreyi isolates ...... 47 3.5 Phenotypic characterization of H. ducreyi isolates ...... 47 3.5.1 Gram staining and light microscopy ...... 47 3.5.2 Biochemical testing...... 48 3.5.2.1 Porphyrin test ...... 48 3.5.2.2 Nitrate Reductase test ...... 48 3.5.2.3 β-lactamase test ...... 49 3.5.2.4 Catalase test ...... 49 3.5.2.5 Oxidase test ...... 49 3.6 Molecular analysis ...... 50 3.6.1 DNA extraction ...... 50 3.6.2 DNA quantification...... 51 3.6.3 Multiplex real-time PCR for H. ducreyi detection ...... 51 3.6.4 Multiplex real-time PCR for the detection of Yaws bacterial agents ...... 53 3.6.5 Multiplex real-time PCR for the detection of T.p AZT resistant markers ...... 55 3.6.6 PCR amplification of 16S rRNA gene for bacterial identification ...... 57 3.6.6.1 Gel electrophoresis and U.V visualization of 16S rDNA amplicons ...... 57 3.6.6.2 DNA sequencing ...... 58 3.7 Data analysis ...... 58 3.8 Ethical issues ...... 58

CHAPTER FOUR ...... 60 RESULTS ...... 60 4.1 General characteristics of study participants ...... 60 4.2 Culture analysis ...... 64 4.2.1 Detection of H. ducreyi by PCR and culture methods ...... 64 4.2.2 Phenotypic characteristics of cutaneous H. ducreyi in culture ...... 65 4.3 Molecular analysis ...... 67 4.3.1 Detection of T.p subsp. pertenue DNA and H. ducreyi DNA by respective real- time multiplex PCR ...... 67 4.3.2 Detection of azithromycin resistant markers by real-time multiplex PCR ...... 68

4.3.3 PCR amplification of 16S rRNA gene for bacterial identification ...... 68

CHAPTER FIVE ...... 70 DISCUSSION ...... 70 5.1 Age and gender distribution of study participants ...... 70 5.2 Clinical presentation and serological analysis of active skin ulcers...... 71 5.3 Isolation of cutaneous H. ducreyi strains in culture ...... 73 5.4 Identification of H. ducreyi DNA and T.p subsp. pertenue DNA ...... 74 5.5 Identification of yet unknown organisms as causative agents of cutaneous ulcers ... 77

CHAPTER SIX ...... 78 6.1 Conclusion ...... 78 6.2 Recommendations ...... 78

REFERENCES ...... 79

APPENDIX: NUCLEOTIDE SEQUENCES OF THE IDENTIFIED BACTERIA ...... 98

vii

LIST OF TABLES

Table 1: Phenotypic characteristics of Pasteurellaceae species isolated from humans ..... 10

Table 2: Studies on non-genital ulcerations of the skin caused by Haemophilus ducreyi

from 1988–2014* ...... 23

Table 3: Selected districts and number of reported yaws cases ...... 42

Table 4: Number of reported yaws cases in Bawjiase subdistrict ...... 43

Table 5: MPCR primers and probes for M. ulcerans and H. ducreyi detection ...... 52

Table 6: MasterMix concentrations and volumes for MPCR of H. ducreyi and M. ulcerans

...... 53

Table 7: MPCR primers and probes for T.p subsp. pertenue detection ...... 54

Table 8: MasterMix concentrations and volumes for Treponema MPCR differentiation .. 55

Table 9: MPCR primers and probes for the detection of TP AZT resistant markers...... 56

Table 10: MasterMix concentrations and volumes for MPCR detection of TP AZT

resistant markers...... 56

Table 11: MasterMix concentrations and volumes used for 16S rRNA gene amplification

...... 57

Table 13: Biochemical characteristics of isolated cutaneous versus genital H. ducreyi

strains ...... 66

Table 14: Distribution of T.p subsp. pertenue and H. ducreyi PCR positivity by DPP-RDT

...... 67

Table 15: Blast search results of other potential causative agents of cutaneous lesions..... 69

viii

LIST OF FIGURES

Figure 1: Phylogeny of uncharacterized CU strains to previously-characterized GU and

CU strains...... 14

Figure 2: Penile ulceration due to H. ducreyi Infection...... 16

Figure 3: Ulcers caused by H. ducreyi Infection...... 17

Figure 4: Genital ulcers caused by Haemophilus ducreyi from 1979–2010...... 21

Figure 5: Lesions of Primary Yaws...... 27

Figure 6: Secondary Yaws...... 28

Figure 7: Worldwide Distribution of Yaws, 2008-2015...... 32

Figure 8: Map of Ghana Showing Yaws Endemicity...... 42

Figure 9: Type of skin conditions presented in each District...... 61

Figure 10: Results of Serological testing...... 62

Figure 11: Representative Images of DPP-RDT Positives and PCR Outcomes from Lesion

Exudates...... 63

Figure 12: Representative Images of DPP-RDT Negatives and PCR Outcomes from

Lesion Exudates...... 64

Figure 13: Occurrence of H. ducreyi in Active Skin Ulcers...... 65

Figure 14: Representative C-HgCh Agar Plates of Genital versus Cutaneous H. ducreyi in

Culture...... 66

Figure 15: Representative gel of PCR amplicons of the 16S rRNA gene of bacteria ...... 68

LIST OF ABBREVIATIONS

AP Antimicrobial Peptide

APC Antigen Presenting Cell

AST Antimicrobial Susceptibility Testing

AZT Azithromycin

CDC Centers for Diseases Control and Prevention

CFU Colony Forming Units

C-HgCh Charcoal Agar Plates

CLU Cutaneous Limb Ulcers

CT Cycle Threshold

CU Cutaneous Ulcers

DC Dendritic Cells

DLTA Ducreyi Lectin A

DNA Deoxyribonucleic Acid

DPP Dual Path Platform

DSMB Data and Safety Monitoring Board

DSRA Ducreyi Serum Resistance A

ECM Extracellular Matrix

EIA Enzyme Immunoassay

FBS Fetal Bovine Serum

FGBA Fibrinogen Binder A

GHS Ghana Health Service

GU Genital Ulcer

GUD Genital Ulcerative Disease

HIV Human Immunodeficiency Virus

HLP Haemophilus ducreyi Lipoprotein

HP Human Passage

HSV Herpes Simplex Virus

IFN-γ Interferon Gamma

IL Interleukin

INFB Translation Initiation Factor 2 Gene

KNUST Kwame Nkrumah University of Science and

Technology

LHB Lysed Horse Blood

LOS Lipooligosaccharides

LSHTM London School of Hygiene & Tropical Medicine

LSPA Large Supernatant Proteins A

MDA Mass Drug Administration

MH-HBC Mueller Hinton Agar Base with Chocolate Horse

Blood

MIC Minimum Inhibitory Concentration

MLSA Multi Locus Sequence Analysis

MPCR Multiplex Polymerase Chain Reaction

MYA Million Years Ago

NAAT Nucleic Acid Amplification Test

NAD Nicotinamide Adenine Dinucleotide

NADP Nicotinamide Adenine Dinucleotide Phosphate

NCAA Necessary for Collagen Adhesion A

NK Natural Killer

NMIMR Noguchi Memorial Institute for Medical Research

NT Nucleotide

NYEP National Yaws Eradication Program

OCA Oligomeric Coiled Adhesion

ODC Ornithine Decarboxylase

OMP Outer Membrane Proteins

ORF Open Reading Frame

PCR Polymerase Chain Reaction

PGI Glucose-6-phosphate Isomerase Gene

PMN Polymorphonuclear Leukocyte

PNG Papua New Guinea

POC Point-of-Care

RECA Recombinase A Gene

RNP Ribonucleoprotein

RPR Rapid Plasma Reagin

SNP Single Nucleotide Polymorphism

STI Sexually Transmitted Infection

SUBSP. Subspecies

TAE Tris-acetate Ethylenediaminetetraacetic Acid

TNF-α Tumor Necrosis Factor Alpha

TPHA Treponema pallidum Haemagglutination

TPPA Treponema pallidum Particle Agglutination

VDRL Venereal Disease Research Laboratory

WHO World Health Organization

xii

CHAPTER ONE

INTRODUCTION

A re-emerging infectious endemic neglected tropical treponemal disease, Yaws, is caused by a bacterium known as Treponema pallidum subspecies pertenue (T.p subsp. pertenue)

(Asiedu, 2008; Asiedu et al., 2008; Mitja, Asiedu, & Mabey, 2013). This bacterium is serologically and morphologically indistinguishable from T.p subsp. pallidum which causes venereal syphilis (Antal, Lukehart, & Meheus, 2002; Giacani & Lukehart, 2014;

Stamm, 2015). Yaws is known to spread by skin-to-skin contact leading to skin ulceration and destruction of cartilage, joints, and bones, which result in disability and stigmatization

(Asiedu, 2008; Harper et al., 2008; Rinaldi, 2012). Yaws exhibits two main stages in the infectivity to human host, an early Yaws and late Yaws. Early Yaws comprises primary and secondary lesion stages (active Yaws) and are highly infectious. Late Yaws is non- infectious but results in irreversible disfiguration and disabling complications and develops in 10% of untreated individuals (Harper et al., 2008; Rinaldi, 2008; Walker &

Hay, 2000).

Yaw’s infection is predominant in children less than 15 years and living in rural remote communities in tropical countries. Children are at a higher risk of infection due to factors such as proximity to their daily activities at school, on playgrounds, and in other general activities. The disease is currently endemic in countries in Africa and the Pacific islands with 8 of them reporting more than 46000 in 2015, despite initial successes of control efforts and with an estimated number of approximately 89 million people living in the 13 countries currently endemic for Yaws (Kazadi, Asiedu, Agana, & Mitjà, 2014; WHO,

2017b). In Ghana, the Yaws Control Program has reports of a high prevalence with the most affected regions being the Eastern, Central, Volta and Western, though confirmed

1 cases have also been reported in the six other regions. In 2008, prevalence studies conducted in basic schools in three purposively selected districts in southern Ghana showed a prevalence of 1.92% among children (Agana-Nsiire et al., 2014).

Recent studies in yaws endemic communities provide evidence of Haemophilus ducreyi causing non-genital ulcerative skin lesions in children (Marks et al., 2014). H. ducreyi is a known strict human pathogen and a fastidious Gram-negative coccobacillus which its transmission has long been thought to be mainly through sexual contact (Al-Tawfiq et al.,

1998), and causes a genital ulcerative disease (GUD) known as chancroid. This organism during sexual intercourse usually spread through micro-abrasions, and typically manifests as multiple painful superficial ulcers allied with inguinal lymphadenitis (Bong, Bauer, &

Spinola, 2002; Chen et al., 2000; Lewis, 2003; Trees & Morse, 1995; West et al., 1995).

Case reports and community surveys indicate the detection of H. ducreyi in chronic cutaneous ulcers (CU) on the limbs of children and adults who have recently travelled from or living in the Pacific islands and Africa (Gonzalez-Beiras, Marks, Chen, Roberts,

& Mitjà, 2016). Two of these studies conducted in yaws-endemic areas in Solomon

Islands and Ghana highlighted the importance of H. ducreyi as a cause of chronic limb ulceration in children (Ghinai et al., 2015; Marks et al., 2014). Also, a study conducted in

Papua New Guinea (PNG) was the first major survey where H. ducreyi was observed to be an important and previously unrecognized cause of chronic skin ulceration in children aged 5-15 years from yaws-endemic areas. This therefore suggested the importance to carry out genomic comparisons of H. ducreyi from skin lesions and genital ulcers (Mitja et al., 2014).

Consequently, a group of researchers described the use of whole-genome sequencing and antibiotic susceptibility testing to characterize H. ducreyi isolates from both genital and chronic limb ulcers. The authors showed that the cutaneous strains used were almost identical genetically to the class I genital ulcer (GU)-associated H. ducreyi strains. Their report also showed that the cutaneous H. ducreyi strains were susceptible to penicillin, and majority of GU strains displayed resistance (Gangaiah et al., 2015). Gaston, Roberts, and

Humphreys (2015) used Multi Locus Sequence Analysis (MLSA) approach to assess H. ducreyi strains from chronic limb ulcers in relation to previously described class I and class II GU-associated H. ducreyi strains. The phylogenetic analysis performed using 11 genetic loci suggested that chronic limb ulcer strains had diverged recently from class I

GU H. ducreyi strains. Subsequent similar studies further suggested that CU strains have diverged from class I GU H. ducreyi strains (Gangaiah, Marinov, Roberts, Robson &

Spinola, 2016). More recently, phylogenetic analysis of CU H. ducreyi isolates from

Ghana and Vanuatu (Pillay et al., 2016), rather suggested a divergence from both class I and II GU strains (Gangaiah & Spinola, 2016).

More recently, rapid dual point-of-care (POC) tests originally developed for syphilis have shown its usefulness in the diagnosis of yaws (Yin et al., 2013). The evaluation of this

POC test which provided valuable serological confirmation for yaws infection was carried out in PNG and Solomon Islands (Ayove et al., 2014; Marks et al., 2014). Conventional

Polymerase Chain Reaction (PCR) assays cannot distinguish yaws from venereal syphilis based on either combined PCR and DNA sequencing or multiplex testing (Pillay et al.,

2011). However, PCR assays developed at the Centers for Diseases Control and

Prevention, CDC are now able to differentiate yaws from syphilis (Chi et al., 2015).

The treatment of yaws is based on the chemotherapeutic administration of the drug azithromycin (AZT) which is a macrolide with prolonged tissue half-life. Clinical trials conducted in PNG and Ghana showed that a single dose AZT is non-inferior to benzathine benzyl penicillin g (Kwakye-Maclean et al., 2017; Mitja et al., 2012). AZT is the preferred choice because of the ease to administer and logistical consideration in mass drug administration programmes (MDA) (WHO, 2017b). In resource-poor countries, genital ulcers are treated according to syndromic management algorithms. Single-dose regimens

(ciprofloxacin, azithromycin, and ceftriaxone) or more prolonged therapeutic regimens

(erythromycin and ciprofloxacin) may be used depending on affordability and availability of treatment regimen (Lewis, 2014).

Newer yaws eradication strategies use a single dose of azithromycin and would also be effective against lesions caused by H. ducreyi; however, there should be active surveillance to monitor any development of resistance to this macrolide (Roberts &

Taylor, 2014). A TaqMan based real-time multiplex PCR assay recently published helps in detecting any mutations that might confer resistance to AZT (Chen et al., 2013).

1.1 Rationale

Yaws affects children in rural communities with no mortalities but silently leads to the destruction of cartilage, joints and bones. The epidemiology of yaws in endemic countries has further been complicated by the discovery of H. ducreyi as an etiologic agent of cutaneous ulcers, although reports show that out of 256343 cases reported to WHO from

2010 to 2013, 215308 (84%) were from Solomon Islands, Ghana, and PNG (Mitja et al.,

2015). In addition to that, recent results from Knauf et al. (2016) raise the possibility that flies play a role in yaws transmission and subsequently Houinei et al. (2017) identified H.

4 ducreyi DNA and T.p subsp. pertenue DNA in flies. Such findings could 1) present difficulties in differential clinical case identification of yaws and H. ducreyi infections 2) warrants further research in understanding the transmission of H. ducreyi and yaws for appropriate control strategies and eradication. The ability to clinically differentiate other bacterial causes of skin ulcers also has very important implications for case diagnosis, reporting, management and prevention of yaws causing ulcerations (Marks et al., 2015).

More recently, PCR assays have been used to detect H. ducreyi in skin lesions of children in yaws-endemic areas of Solomon Islands, PNG, Vanuatu, and Ghana (Ghinai et al.,

2015). There is currently no POC test for H. ducreyi confirmation and culture is the primary diagnostic test for most laboratories which requires expertise. Although the use of

PCR will be able to detect this bacterium, susceptibility test of the bacterium will not be possible (Trees & Morse, 1995). Scientists then suggested the need to culture H. ducreyi in addition to detection by PCR (Roberts & Taylor, 2014). There is currently no published data on cutaneous H. ducreyi characterization and also no recent data on genital ulcers caused by H. ducreyi in Ghana. Thus, this study seeks to characterize cutaneous H. ducreyi strains to provide the much-needed information and also help to develop appropriate strategies to refine data collected by the yaws campaign and plans towards its’ eradication.

Azithromycin is an expensive macrolide and its administration currently depends on research projects. Although AZT has proven its effectiveness for treatment of skin ulcerations, the possibility of the development of resistance should not be overlooked.

Some studies have shown evidence of the prevalence of AZT resistance in syphilis, and resistance is due to single point mutations in the 23S rRNA gene (either A2058G or

A2059G) (Lukehart et al., 2004; Mitchell et al., 2006). There are also reports of persistence of H. ducreyi in communities where there has been MDA of AZT for yaws and trachoma (Ghinai et al., 2015; Marks et al., 2015; Mitja, Lukehart, & Bassat, 2015), although, a single dose of AZT has been proven to be efficacious against H. ducreyi CU strains in yaws-endemic areas (González-Beiras et al., 2017). Reports from a randomized controlled clinical trial conducted in PNG and Ghana shows that 20 mg/kg AZT is probably effective against yaws although further data is needed (Marks et al., 2018)..

Also, CU in the tropics have traditionally been treated with penicillin (Thornton et al.,

1998), and the fact that some CU H. ducreyi strains have acquired antimicrobial resistance genes in their genomes (Gangaiah & Spinola, 2016), makes it important to attempt and isolate CU H. ducreyi strains from skin lesions to provide insights on the best therapeutic approach for H. ducreyi infections. This study will provide a collection of strains for any future studies on yaws and H. ducreyi. Chi et al. (2015) found no evidence of T.p subsp. pertenue infection in ~59% of cases either by PCR or serology, indicating other causes of yaws-like lesions in endemic areas. Similar findings have been reported by other researchers (Ghinai et al., 2015; González-Beiras et al., 2017). In view of these, the study further seeks to identify other bacteria associated with cutaneous lesions since there is currently no available data.

1.2 Aim of the Study

To isolate and characterize cutaneous H. ducreyi strains from skin lesions of children in yaws-endemic communities.

1.3 Specific objectives

1. To identify dual infections of Yaws and H. ducreyi in active skin lesions.

2. To screen for azithromycin resistant markers in samples that test positive for T.

pallidum pertenue DNA.

3. To compare the morphological and biochemical characteristics CU H. ducreyi

strains to that of GU H. ducreyi strain.

4. To determine the presence of other bacteria associated with cutaneous lesions.

CHAPTER TWO

LITERATURE REVIEW

2.1 History of Chancroid

Chancroid, also known as “soft chancre” or “ulcus molle” was first recognized by a French dermatologist Leon Bassereau in 1852. Bassereau to whom credit is given was able to clinically distinguish a soft chancre from a similar chancre seen in syphilis or hard chancre. Although the causative agent (s) was not identified by Bassereau, according to

Schulte, Martich, and Schmid (1992), many chancroid cases were either misdiagnosed or improperly reported or both as other GUD’s like genital herpes or syphilis. Subsequently, a French scientist, Auguste Ducrey in 1889, did repeated autoinoculation on the forearm of patients with exudates from the patients’ own genital ulcers.

Ducrey successfully isolated the specific agent: a “streptobacillary rod with a clumping or chaining morphology” after several passages. However, Ducrey was unsuccessful with the isolation of the organism on artificial media or in animal models. It was Benzacon and his co-workers who identiﬁed the causative organism and fulfilled Koch’s postulates by isolating the organism from a chancroid lesion, obtained a pure culture on a blood agar plate, inoculated healthy subjects with the pure culture and re-isolated the organism from the lesion (Albritton, 1989; Hammond, 1996). Several investigators at the time also contributed original observations which lead to the classification of Ducrey’s bacillus in the genus Haemophilus (Albritton, 1989).

2.2 The genus Haemophilus

The bacterial family of Pasteurellaceae consists of genera Haemophilus, Pasteurella and

Actinobacillus. Classification of species into the genus Haemophilus, is based on their dependency on specific growth factors X (heme) and V (Nicotinamide adenine dinucleotide (NAD) or NAD phosphate (NADP)) found in blood, whereas species independent of the X and V growth factors were classified under the genera Actinobacillus or Pasteurella. The genus Haemophilus included all bacterial species isolated from various animals and humans and transpired into a heterogeneous group with the rapid development of molecular tools (Nørskov-Lauritsen, 2014).

All 9 species so far described demonstrate host specificity for humans. Based on certain phenotypic traits, the species may be grouped into 3: the H. parainfluenzae group, which is made up of 5 species that are independent of the X-factor, H. paraphrohaemolyticus, H. parainfluenzae, H. sputorum, H. parahaemolyticus and H. pittmaniae; the H. influenzae group is also made up of 3 species that are dependent on the X-factor, H. haemolyticus, H. aegyptius, and H. influenzae and a group for H. ducreyi only (Nørskov-Lauritsen, 2014).

Table 1 shows the differential phenotypic characteristics of the genus Haemophilus from other Pasteurellaceae species.

Table 1: Phenotypic characteristics of Pasteurellaceae species isolated from humans

Phenotype

Haemophilus sp. Aggregatibacter Actinobacillus Pasteurella sp. sp. sp.

Character Infl Aeg Hae Pinf Phae ppha sput pitt ducr act aphr seg homi ureae bett mult y m e i n NadV synthesis 0 0 0 0 0 0 0 0 + + d 0 + + + + (V factor not required)

Porphyrin 0 0 0 + + + + + 0 + + + + + + + synthesis (X factor not required) Catalase + + + d d d d d 0 + 0 d + d 0 + ODC d 0 0 d 0 0 0 0 0 0 0 0 0 0 0 + β-Galactosidase 0 0 0 d 0 + + + 0 0 + d + 0 0 0 Urease d + + d + + + 0 0 0 0 0 + + 0 0 Hemolysis 0 0 + d + + + + d 0b 0 0 0 0 0 0 Tryptophanase d 0 d d 0 0 0 0 0 0 0 0 0 0 + + Acid from: IgA1 protease + + 0 0 + 0 0 0 0 0 0 0 0 0 0 0 Mannose 0 0 0 + 0 0 0 + 0 d + w d d d + Lactose 0 0 0 0 0 0 0 0 0 0 + 0 + 0 0 0 Sucrose 0 0 0 + + + + + 0 0 + w + + 0 +

aInterpretations: 0, negative; +, positive; d, variable; w, weak or delayed reaction. Abbreviations: sput, H. sputorum; aegy, H. aegyptius; ducr, H. ducreyi; pinf, infl, H. influenzae; H.parainfluenzae; phae, H. parahaemolyticus; pphae, H. paraphrohaemolyticus; haem, H. haemolyticus; pitt, H. pittmaniae; segn, A. segnis; acti, A. actinomycetemcomitans; aphr, A.aphrophilus; homi, A. hominis; ureae, A. ureae; mult, P. multocida; bett, P. bettyae; ODC, ornithine decarboxylase; IgA1, immunoglobulin A1. bIsolates with overexpression of leukotoxin may exhibit a zone of hemolysis. Source: (Nørskov-Lauritsen, 2014)

2.3 Characteristics of Haemophilus ducreyi

The causative agent of Chancroid, H. ducreyi, is a fastidious slow-growing anaerobic

Gram-negative obligate coccobacillus bacterium (Albritton, 1989; Morse, 1989). This

bacterium is not similar to any of the Haemophilus species (Olsen et al., 2015) by 16S

rRNA and fragments of 3 housekeeping gene sequences (translation initiation factor 2

10 gene (infB, 453 nucleotide (nt)), the recombinase A gene (recA, 447 nt) and the glucose-6- phosphate isomerase gene (pgi, 393 nt)) (Nørskov-Lauritsen, 2014). The optimum temperature for growth under microaerophilic conditions is 33ºC (Sturm & Zanen, 1984;

Trees & Morse, 1995). When cultured directly from infections, the bacteria show small yellow-grey colonies and remain cohesive when pushed across the agar (Hammond,

1996). Gram-stained cultures from artificial media displays a characteristic “schools of fish” appearance (Albritton, 1989; Lewis, 2000).

The species is independent on V factor but dependent on X factor, as the nadV gene located on a plasmid confers this independence (Nørskov-Lauritsen, 2014). H. ducreyi reduces nitrates, oxidase and alkaline phosphatase positive and is catalase and porphyrin negative (Albritton, 1989). Genital H. ducreyi strain 35000 and its human-passaged derivative, strain 35000HP have been studied extensively (Post & Gibson, 2007). The full- genome-sequence of H. ducreyi strain 35000HP shows that, the bacterium carries both tandem plasmid copies and extrachromosomal plasmid in its’ genome (Nørskov-Lauritsen,

2014). According to Spinola, Bauer, and Munson (2002), the genome is a 1.7-Mb chromosome and has a total of 1,693 putative open reading frames (ORFs).

2.3.1 Classes of Haemophilus ducreyi

Genital H. ducreyi strains is grouped into classes I and II on the basis of genetic variation of a few key genes encoding OMPs (outer membrane proteins) which is associated with virulence (White et al., 2005); a division supported by proteomic studies (Post & Gibson,

2007). Genital strains express two Oca (oligomeric coiled adhesion) proteins, namely,

NcaA (necessary for collagen adhesion A) and DsrA (for ducreyi serum resistance A)

(Leduc et al., 2008). Generally, Oca proteins are found on the surfaces bacteria as

11 homotrimers involved in binding to ECM (extracellular matrix) proteins and various eukaryotic cells, mediates invasion of cells and resists killing by serum complement (El

Tahir & Skurnik, 2001).

White et al. (2005) detected that some H. ducreyi strains express different immunotypes of

DsrA protein (DsrAII) than the 35000HP (Human passage) strain (DsrAI) which is well- characterized. Strains expressing DsrAII proteins showed a 100% identity to each other however only 48% identical to 35000HP. H. ducreyi strains that expressed DsrAI were grouped into Class I and strains expressing DsrAII were grouped into Class II. Class II strains in addition to DsrAII also expressed variant forms of OMPs including Hlp (H. ducreyi lipoprotein), NcaA, major OMP/OmpA2 (for OMP A2), DltA (ducreyi lectin A) and synthesized a distinct, faster-migrating LOS (lipooligosaccharide) than Class I strains

(White et al., 2005).

Studies of sequence diversity at 11 H. ducreyi loci, including housekeeping and virulence genes, showed that genital strains form 2 genetically distinct classes, differ in susceptibilities to vancomycin and have evolutionary diverged from each other about 1.95 million years ago (mya) and may possibly represent distinct species (Gangaiah et al.,

2015; Post & Gibson, 2007; Post et al., 2007; Ricotta, Wang, Cutler, Lawrence, &

Humphreys, 2011; Scheffler et al., 2003).

2.3.1.1 Subclades of Haemophilus ducreyi strains

The new infection patterns of H. ducreyi prompted a re-examination of its population structure. Consequently, using whole-genome phylogenetic analysis and multilocus sequence-based phylogenetic analysis, it was evident that within class I GU strains is a sub

12 cluster of cutaneous ulcer (CU) H. ducreyi strains and that class II strains form a distinct cluster from that of class I and sub cluster CU strains. The CU strains had diverged from the class I GU strains (Gangaiah et al., 2016; Gangaiah et al., 2015; Gaston et al., 2015).

Reports also show that CU strains that form a subclone of 35000HP branch are genetically nearly identical to 35000HP, differs by about 400 single nucleotide polymorphisms

(SNPs), most of which are synonymous, and expresses genes required for pustule formation for strain 35000HP (Gangaiah et al., 2015). This raises the probability that GU strains have the potency to cause CU and vice versa (Gangaiah & Spinola, 2016).

The phylogenetic analysis also showed that CU strains have rather diverged from both classes I and II GU strains. Class I GU strains form two subclades with subclade 1 containing 35000HP and HD183 and subclade 2 containing the remainder of class I strains

(Figure 1A) (Gangaiah & Spinola, 2016). The 6 previously-characterized CU strains and the recent 6 uncharacterized CU strains from Ghana and Vanuatu formed a sub clone which diverged from the class I 35000HP subclade; all the Vanuatu and Samoan strains formed separate groups within this subclone (Gangaiah & Spinola, 2016). Two Ghanaian strains diverged from the other class I subclade. Interestingly, 3 strains from Ghana and

Vanuatu formed a subclone under the class II strains. Multilocus sequence typing analysis based on dsrA, hgbA and ncaA of GU and CU strains of H. ducreyi generated a tree similar to that of the whole genome sequenced phylogenetic tree (Figure 1B) (Gangaiah &

Spinola, 2016).

Figure 1: Phylogeny of uncharacterized CU strains to previously-characterized GU and CU strains. A) Phylogenetic tree based on whole-genome sequenced H. ducreyi CU and GU strains. B) Phylogenetic tree based on dsrA-hgbA-ncaA sequenced H. ducreyi CU and GU strains. Source: (Gangaiah & Spinola, 2016)

2.4 Pathogenesis of Chancroid

H. ducreyi occupies no known animal or environmental reservoir and naturally infects mucosal surfaces, nongenital and genital skin, and regional lymph nodes (Morse, 1989).

The incubation period is normally from 4 to 7 days and hardly persists more than 10 days or less than 3 days (Morse, 1989). Human studies of experimental H. ducreyi infection showed that, delivering a dose of about 30 colony forming units (CFU) of the bacteria resulted in a 69% pustule formation rate and a 95% papule formation rate (Al-Tawfiq et al., 1998). Meanwhile, as few as 1 CFU of 35000HP experimentally inoculated into the upper arm of adults was highly infectious (Janowicz, Ofner, Katz, & Spinola, 2009).

The bacteria are known to penetrate a new host through minor abrasions in the epithelium that occur during sexual intercourse (Morse, 1989). The host responds to H. ducreyi infection with a high infiltrate of polymorphonuclear leukocytes (PMNs) and macrophages which leads to the development of lesions that progress from papules to pustules to ulcers

(Janowicz, Li, & Bauer, 2010). In experimental and natural disease, PMNs and macrophages surround the bacteria and remain extracellular, and co-localize with phagocytes, collagen, and fibrin (Janowicz et al., 2010). Several studies have identified that antigens of H. ducreyi that could be essential for disease pathogenesis (White et al.,

2005).

2.5 Clinical presentation of Chancroid

The first pathological changes manifest within 4–7 days as tender erythematous papules after initiation of H. ducreyi infection at the sites of micro-abrasions (Morse, 1989).

Papules may subsequently develop into pustules which often rupture within a period of 2 to 3 days to form painful shallow ulcers with granulomatous bases and purulent exudates

(Lewis, 2003). The base of the ulcer is characteristically scruffy and undermined, and covered by grey or yellow necrotic purulent exudate which often bleeds when scraped

(Lagergård, 1995; Lewis, 2003). Chancroid typically appears on the prepuce (Figure 2) and penile frenulum in men.

Figure 2: Penile ulceration due to H. ducreyi Infection. A typical ulcer on the prepuce of a patient’s penis. Source: (Lewis, 2003)

Severe infection may possibly result in phimosis and phagedenic ulceration. Perianal chancroid might occur in gay men although rare, and in women usually presents as vulva ulceration, though internal cervical ulcers may also occur (Lewis, 2003; Morse, 1989).

Without effective antimicrobial therapy, ulcers might persist for 1–3 months in both males and females. The phenomenon of auto-inoculation has been well-described for H. ducreyi infections and could result in extra-genital lesions on breasts and inner thighs. Gonzalez-

Beiras et al. (2016) document pictorially genital and non-genital skin ulcerations (Figure

3). These characteristics of non-genital skin ulcers were mostly found in children aged between 5 to 17 years with the majority being males (Ghinai et al., 2015; Marks et al.,

2014; Mitja et al., 2014). Ulcers are characteristically painful, pus-filled, and deep with scruffy, undermined edges. However, because the appearance of these ulcers is similar to ulcers caused by other pathogenic bacteria, clinical diagnosis can be insensitive or nonspecific and often requires laboratory confirmation (Gonzalez-Beiras et al., 2016). In

Solomon Islands, lesions containing H. ducreyi DNA were similar in tenderness, location,

16 and duration of lesions in which H ducreyi was not found (Marks et al., 2014). Similar observations have been reported from studies conducted in PNG (Mitja et al., 2014).

Co-existent with genital ulcers is painful, tender inguinal lymphadenitis which usually occurs in up to 50% of cases and the lymph nodes may also develop into buboes (Lewis,

2003; Morse, 1989). Lymphadenopathy is usually unilateral and more prevalent in men

(Lewis, 2003). Studies in Human Immunodeficiency Virus (HIV)-positive patients show a greater number of ulcers at initial presentation and longer duration of ulceration than that in HIV-seronegative patients (Kimani et al., 1995). Genital ulceration has been shown to facilitate the acquisition and transmission of HIV-1 infection (Fleming & Wasserheit,

1999; Galvin & Cohen, 2004; Korenromp, de Vlas, Nagelkerke, & Habbema, 2001;

Plummer et al., 1991; Wasserheit, 1992).

Figure 3: Ulcers caused by H. ducreyi Infection. (A, B) Images of genital ulcers in adults from Ghana. (C, D) Images of skin ulcerations in children from PNG. Source: (Gonzalez-Beiras et al., 2016)

2.6 Host immune response to Haemophilus ducreyi infection

Upon infection with the bacterium adaptive and innate immune cells are rapidly aggregate at the site of infection (Banks et al., 2007; Li, Janowicz, Fortney, Katz, & Spinola, 2009;

Spinola et al., 2002). PMNs coalesce to form an epidermal abscess, while macrophages form a collar at the base of the abscess. Below the collar is a dermal infiltrates of natural killer (NK) cells, myeloid dendritic cells (DC), memory/effector CD (cluster of differentiation) 4 and CD8 T cells, macrophages and few B cells (Janowicz et al., 2010).

There is an increased buildup of Langerhans cells in the hair follicles, epidermis, and eccrine ducts (Palmer et al., 1998) and a 2.8-fold increase in the ratio of CD123+ pDC to

CD11c+ myeloid DC (Banks et al., 2007). Pro-inflammatory cytokines are secreted by

DC’s upon exposure to the organism, such as interleukin (IL) -8, IL-1β, IL-12, IL-6, TNF-

α (Tumor necrosis factor alpha) and IL-10 (Banks et al., 2007).

PBMC’s from uninfected surrogate subjects showed that NK cells were indirectly activated by the bacteria via antigen presenting cells (APC’s) such as DC’s, macrophages and monocytes (Janowicz et al., 2010). H. ducreyi-infected macrophages and monocytes produce IL-18 and unknown contact-dependent signals for NK cell activation, while DC activates NK cells through IL-12. Also, to activate NK cells; macrophages/monocytes must phagocytose H. ducreyi. Hence, at H. ducreyi-infected sites NK cells secrete IFN-γ when stimulated with IL-12 and IL-18. The function of NK cells in differential host responses to H. ducreyi is being studied (Janowicz et al., 2010).

H. ducreyi is known to express certain key virulence mechanisms that resist host defense mechanisms as reviewed by Janowicz et al. (2010) and summarized here. Resistance to phagocytosis in experimental infection is mediated by two homologous large supernatant

18 proteins, LspA1 and LspA2 (Vakevainen, Greenberg, & Hansen, 2003). These LspA proteins after Fcγ receptor-mediated activation prevent phagocytosis by inhibiting signal- transducing phosphorylation events by Src family tyrosine kinases in phagocytes

(Janowicz et al., 2010). According to a review by Janowicz et al. (2010), how LspA proteins enter the host cells is unknown. A study by Deng, Mock, Greenberg, van Oers, and Hansen (2008) demonstrates that during macrophage-H. ducreyi co-incubations, LspA proteins are tyrosine-phosphorylated by macrophage kinases. This makes it intriguing for

Janowicz et al. (2010) to consider that, macrophage-encoded enzymes may possibly activate H. ducreyi-encoded proteins which then can block the cascade of signaling events to shut down phagocytosis (Janowicz et al., 2010).

DsrA expressed by H. ducreyi mediates resistance to serum bactericidal activity (Elkins,

Morrow, & Olsen, 2000). DsrA forms homomeric trimers on bacterial surfaces to provide protection from serum complement and adherence to host tissues. This protein also binds to two extracellular matrix components, fibronectin, and vitronectin (Cole, Kawula,

Toffer, & Elkins, 2002; Leduc et al., 2008). In a human model infection, DsrA mutants of

H. ducreyi were fully attenuated (Bong et al., 2001). DrsA-mediated serum resistance seem to protect the bacteria from the classical complement cascade by blocking complement components and surface deposition of IgM (Abdullah et al., 2005). A structure-function analysis showed that, independently, serum resistance and matrix binding activities are mediated by separate domains of DsrA. This results refuted an earlier hypothesis of adherence to matrix proteins been responsible for the DsrA- dependent protection against serum bactericidal activity (Leduc, Olsen, & Elkins, 2009).

An extracellular matrix binding protein expressed during infection known as fibrinogen binder A (FgbA), recently described, binds fibrinogen in vitro and is required in vivo for full virulence of H. ducreyi (Bauer et al., 2009). H. ducreyi is often surrounded by fibrin during infection, although this mechanism of action of FgbA action is unknown in vivo

(Janowicz et al., 2010). However, it is known that fibrin surface deposition protects other extracellular pathogens from phagocytes, antibodies, and complement; thus, FgbA may perhaps initiate fibrin deposition to protect the bacterial surface from host-mediated attack

(Janowicz et al., 2010).

Also, host innate immune system produces cationic antimicrobial peptides (APs) such as cathelicidin and defensins (Jenssen, Hamill, & Hancock, 2006). During H. ducreyi infection, several AP-secreting cells are presented including PMNs, macrophages, and keratinocytes. Mount, Townsend, and Bauer (2007) were the first authors to show H. ducreyi’s ability to resist killing by most of the human APs including cathelicidin LL37,

β-defensins and α-defensins. H. ducreyi is also known to express sensitivity to antimicrobial peptides (Sap) influx transporter; which confers resistance to APs and contributes to virulence (Mount et al., 2010).

2.7 Epidemiology of Haemophilus ducreyi infections

Two major findings confirmed by a systematic review by Gonzalez-Beiras et al. (2016) is, firstly, a decrease in the proportions of H. ducreyi-causing genital ulcers which has been sustained for about 10 and half years. Secondly, a growing evidence of H. ducreyi being a common and previously unrecognized cause of chronic ulcerations of the skin in children.

The syndromic management of GUD’s, the difficulties in confirming a microbiological diagnosis, and the lack of surveillance programs has hindered the knowledge about the

20 exact worldwide occurrence of chancroid in previously endemic areas (Lewis, 2014). The worldwide chancroid estimation in the 1990s was 7 million (Steen, 2001). Analyses of incidence of chancroid by Gonzalez-Beiras et al. (2016) shows a clear reduction in the prevalence of chancroid cases from 1979 to 2010 (Figure 4). From the year 1979 to 1999, chancroid cases in published studies ranged from 0.0% to 68.9%. Eleven studies from

African countries (Swaziland, Kenya, Senegal, Côte d’Ivoire, Lesotho, Gambia and South

Africa) reported high percentages (>40% cases) of infections with H. ducreyi. Slightly lower percentages (20%–40% cases) were recorded in 15 studies conducted in Africa

(Botswana, Kenya, Madagascar, Tanzania, Malawi, Rwanda, South Africa and

Zimbabwe), the United States during localized outbreaks, India, Dominican Republic and

Jamaica. Countries that reported low proportions (<10%) of cases were Pakistan,

Singapore, Uganda, Mozambique, France, Peru, Greece, the Netherlands, United States and Saudi Arabia. The only studies that reported zero cases of genital H. ducreyi infections were in Thailand in 1996 and China in 1999.

Figure 4: Genital ulcers caused by Haemophilus ducreyi from 1979–2010. Reported cases of chancroid worldwide (Source: Gonzalez-Beiras et al., 2016)

From 2000–2014, studies in patients with GUD’s from 5 countries (Namibia, Kenya,

Australia, Zambia, and Brazil) reported no case of H. ducreyi infection (Gonzalez-Beiras et al., 2016). However, a study in Malawi reported a total of 60 patients out of 398 patients with GUD with H. ducreyi infection using data from 2004 to 2006 (Phiri et al., 2013).

Also in North India, Hassan et al reported 13 chancroid cases out of 54 patients with GUD

(Hassan et al., 2015). Reports from studies in Mozambique, Botswana, Uganda, South

Africa, France, and Pakistan also described few cases of H. ducreyi infection as a cause of

GUD (Gonzalez-Beiras et al., 2016). Fouéré, Lassau, Rousseau, Bagot, and Janier (2015) reported the first case of chancroid in 14 years in a largest Sexually Transmitted Infection

(STI) clinic in Paris. Presently in Europe, chancroid is limited to rare periodic cases

(Barnes & Chauhan, 2014; Fouéré et al., 2015). Globally, from 1988-2010, 5 case reports were described in patients with CU H. ducreyi infections (Table 2). The first ulcer case was recorded on the left foot of a 22-year-old man who had visited the Fiji islands.

Clinical reports showed that the man neither had any clinical history nor sign of primary genital infection (Marckmann, Højbjerg, von Eyben, & Christensen, 1989). There were no reports until 2007, where 3 children who had separately visited Samoa were confirmed to have cutaneous limb ulcers (CLU) with H. ducreyi being the etiological agent (Ussher,

Wilson, Campanella, Taylor, & Roberts, 2007). Similar cases were reported in Vanuatu

(McBride, Hannah, Le Cornec, & Bletchly, 2008), PNG (Peel, Bhatti, De Boer, Stratov, &

Spelman, 2010) and from Sudan; a 5 year old refugee, which indicated that H. ducreyi associated limb ulceration could be more widespread than previously suspected

(Humphrey, Romney, & Au, 2007) .

Table 2: Studies on non-genital ulcerations of the skin caused by Haemophilus ducreyi from 1988–2014* No. No. patients Year of Diagnostic cases H. % (95% Reference Country with skin study method ducreyi CI) ulcers infection Marckmann et al. (7) Fiji islands 1988 Culture 1 man 1 NA

Ussher et al. (8) Samoa 2005 PCR 3 girls <10y 3 NA of age

McBride et al. (9) Vanuatu 2007 PCR 1 woman 1 NA

Peel et al. (10) Vanuatu and Papua 2010 PCR 2 men 2 NA New Guinea

Humphery et al. (11) Sudan 2007 PCR 1 boy 1 NA

Mitjà et al. (3) Papua New Guinea 2013 PCR 90 54 60.0(49.6- 69.5)

Mitjà et al. (6) Papua New Guinea 2014 PCR 114 60 60.1(54.3- 65.5)

Marks et al. (4) Solomon Islands 2013 PCR 41 13 31.7(19.5- 46.9)

Chen et al.† Vanuatu 2013 PCR 176 68 38.6(31.7- 46.0)

Chen et al.† Ghana 2013 PCR 179 49 27.3(21.3- 34.3)

Ghinai et al. (5) Ghana 2014 PCR 90 8 8.8(4.5- 16.5)

*NA, not applicable. †Pers. Communication (Source: Gonzalez-Beiras et al., 2016)

2.8 Yaws

The term yaws is from either the African word for berry ‘yaw’, or the Carib word for

lesion or sore ‘yaya’; which was commonly used in the 17th century when a Dutch

physician Willem Piso clinically described the disease to provide one of the earliest

records. Yaws is also called Framboesia tropica because the lesions resemble raspberries;

‘framboise’: the French word for raspberry. The disease is one of the agents of endemic,

non-venereal treponematoses with the others being bejel (endemic syphilis) and pinta

(Mitja et al., 2013). In 1679, Thomas Sydenham’s epistle on venereal disease clearly described yaws; believed it to be common among African slaves and also thought it was same as venereal syphilis. Later in 1905, Aldo Castellani, a physician and an expert in neglected tropical diseases (NTD’s), discovered the etiological agent of yaws when he observed spiral-shaped bacteria in lesion material from yaws patients in Sri Lanka.

Castellani’s findings were later confirmed by Wellman’s report, who had also observed spirochetes in the lesions of an African yaws patient (Stamm, 2015).

2.8.1 The causative agent

Yaws is an infectious disease caused by Treponema pallidum subsp. pertenue which affects humans and is recognized by WHO as an NTD (Marks, 2016; WHO, 2011). The etiological agent is a Gram-negative bacteria belonging to the order Spirochaetales, the family Spirochaetaceae, and the genus Treponema. Yaws, bejel and syphilis spirochetes are now classified into subspecies of Treponema pallidum as T. pallidum subsp. pertenue,

T. pallidum subsp. endemicum and T. pallidum subsp. pallidum respectively on the basis of DNA hybridization evident of their remarkably high genetic relatedness and differences in clinical manifestations of their respective diseases (Centurion-Lara et al., 2006;

Mikalová et al., 2010). Pinta retains its separate name as T. carateum due to unavailability of an isolate for genetic analysis (Giacani & Lukehart, 2014).

Treponemes are uncultivatable in vitro and require expensive and difficult to handle laboratory animals for successful propagation. Currently, rabbits serve as the major laboratory animal model used in the propagation of isolates (Giacani & Lukehart, 2014).

T.p subsp. pertenue has a diameter of 0.2μm and a length ranging from 10 to 15μm, which makes it invisible by light microscopy except under dark-field illumination. The

24 spirochetes divide slowly (every 30 h), have a corkscrew-like motility and able to move through gel-like environments e. g. connective tissues. They can be rapidly killed by drying, heating or oxygen exposure, and cannot survive outside the mammalian host

(Mitja et al., 2013). The spirochetes are morphologically and serologically indistinguishable; whole-genome sequencing demonstrates that the genome of T. p subsp. pertenue differs by only 0.2% from that of T. p subsp. pallidum (Cejková et al., 2012).

The differences are restricted to few genes including tpr and TP0136. These genes though implicated in pathogenesis, their role are uncertain (Mikalová et al., 2010). The phylogenetic relationship between the subspecies remains unclear (Giacani & Lukehart,

2014).

2.8.2 Pathogenesis

Studies in hamster and rabbit models have provided insights into the pathogenesis of yaws

(Giacani & Lukehart, 2014) as summarized here. T.p subsp. pertenue presumably enters the human host through a breach in the skin and infection is spread by skin to skin contact.

In hamster models, the minimum infective dose is 103–104 bacteria and the rate at which cutaneous lesions appear and resolve varies with the size of the inoculum. The treponemes move via epithelial cells through tight junctions and on the ECM of host cells invasively attach to fibronectin-coated surfaces.

Treponemes appear in lymph nodes within minutes, disseminate widely within hours and multiply rapidly. Early lesions of yaws consist of epidermal hyperplasia and papillomatosis, most often with intraepidermal collections of neutrophils and focal spongiosis. However, skin biopsy from individuals with yaws infection showed many

25 plasma cells in the dermis, but few B and T cells. Yaw’s treponemes are mostly in extracellular clusters in the upper regions of the epidermis (Mitja et al., 2013).

2.8.3 Clinical features of Yaws in children

Clinical manifestations of yaws are diverse or may be totally unspecific (Mitja et al.,

2011). Early clinical manifestations are mostly seen in children below 15 years of age

(peaks between 6 and 10 years) and living in rural communities, particularly those with low standards of hygiene, poor economic circumstances and scarce water supply, with incidence declining as economic and status rise. Studies have shown that majority of clinical cases occur in children between 2 and 15 years of age, who are also considered as the reservoir for infections with a suggestive preponderance of cases in males than females. The justification is that boys are more active than girls and therefore suffer more traumas (Kazadi et al., 2014). A report from Ghana by Kwakye-Maclean et al. (2017) shows a study population of 70% more males with clinical manifestations and a mean age of 9.5 years (SD: 3.1, range: 1 to 15 years) of participants. Generally, the peak age is between 2 to 15 years and male to female ratio of 1.5: 1 (Mitja et al., 2017). The clinical features may be conveniently divided into early (primary and secondary) and late (tertiary) disease (Marks, Lebari, Solomon, & Higgins, 2015; Mitja et al., 2013). Although this classification is clinically useful, patients may possibly present with a mixture of clinical signs (Marks et al., 2015).

2.8.3.1 Primary Yaws

The primary lesion is a localized papule or ‘Mother Yaw’ which appears at the site of inoculation after a variable incubation period of 10-90 days (mean 21 days). This may either evolve into an exudative papilloma which measures about 2-5cm in size or

26 degenerate to form a solitary, crusted, non-tender ulcer with a red moist base (Figure 5

A&B). Primary lesions are commonly found on the ankles and legs (65–85% of cases) but may occur on the face, arms, hands, and buttocks (Mitja et al., 2011). Split-papules’ may also occur at the angle of the mouth. Groups of small dry papules as the initial manifestation instead of a mother yaw.

The mother yaw is highly infectious and can persist for weeks to 6 months before healing spontaneously, often leaving a pigmented scar. Primary lesion heals spontaneously for a majority of the cases before the onset of secondary manifestations. Only a few patients (9 to 15%) have the mother yaw still present when the ‘daughter yaws’ appear (Marks et al.,

2015). Primary yaws are commonly confused with cutaneous leishmaniasis, anaerobic fusobacteria-related ulcer, mycobacterial disease, Corynebacterium diphtheriae , or

Arcanobacterium haemolyticum skin infection (Mitja et al., 2011).

Figure 5: Lesions of Primary Yaws. A) Typical ulcer of primary yaws. B) Papilloma of primary yaws. Source: (Marks et al., 2015)

2.8.3.2 Secondary Yaws

Untreated individuals with primary lesions may progress to develop secondary yaws, which mostly affects the skin and bones. Secondary lesions result from the lymphatic and

27 haematogenous spread of treponemes from a few weeks to 2 years after primary lesions

(Mitja et al., 2011; Mitja et al., 2011). Arthralgia and regional lymphadenopathy may also be common (Mitja et al., 2011). Secondary skin lesions often consist of many smaller excrescences, which resemble an initial papilloma, or scaly macular lesions which are irregular or discoid in shape. Hyperkeratotic lesions can form on the soles and palms which results in pain and a crab-like gait. Secondary yaws also causes osteoperiostitis of multiple bones. When it involves the proximal phalanges of the finger it manifests as polydactylitis or of long bones (ie, forearm, fibula, or tibia) may cause nocturnal bone pain and swelling (Figure 6 A-D) (Giacani & Lukehart, 2014; Marks et al., 2015; Marks, Mitja,

Solomon,Asiedu, & Mabey, 2015; Mitja et al., 2011).

Figure 6: Secondary Yaws. A) Crusted maculopapular lesions B) Multiple ulcers C) Dactylitis Source: (Marks et al., 2015) D) Discoloration and cracks of the soles of the feet Source: (Mitja et al., 2013)

2.8.3.3 Latent Yaws

Patients with primary and secondary yaws lesions may pass into a period of latency after resolution of clinical signs. Untreated individuals may develop a latent infection, with reactive serological tests but with no clinical signs. Latent cases can relapse most often in the first 5 years (rarely 10 years) after infection. Relapsing lesions usually occur around the mouth, axillae, and anus (Marks et al., 2015).

2.8.3.4 Tertiary Yaws

Destructive lesions of tertiary yaws were formerly reported to occur in about 10% of untreated individuals, but are now rarely seen. The skin is most commonly affected. The disease may manifest as gummatous nodules near joints, and ulcerate, resulting in tissue necrosis; as a destructive osteitis which causes bowing of the shins (sabre shin) or hypertrophic periostitis resulting in exostosis of the maxillary bones (Goundou) or a destructive osteitis of the nasopharynx and palate which results in mutilating facial ulceration (Gangosa). There is no evidence of neurological or cardiovascular manifestations of yaws (Marks et al., 2015).

2.8.4 Host immune response to Yaws infection

The host response is mediated by both humoral and cellular immune responses.

Macrophage phagocytosis of treponemes is increased by opsonization with the immune serum which plays a key role in the immune response (Steiner, Schell, & Harris, 1986). In a hostile host environment, bacteria adapt several survival mechanisms. The organism can induce depression of mitogenic response of normal lymphoid cells or may stimulate the trafficking of T cells out of peripheral blood circulation (Lukekart, Baker-Zander, & Sell,

1980); maintain infection with very few viable cells in order to exploit its low metabolic

29 rate, and thereby evade immune response stimulation during latent disease; and antigenic variation in candidate OMP antigenic targets (eg, TprK) could have a key role in immune evasion (Giacani et al., 2012). T pallidum infection in a rabbit model showed that, untreated rabbits with latent infection could not be superinfected with the same strain.

Studies in guinea pigs observed that T. pallidum subsp. pertenue does not cross the placenta. Also, offspring born to mothers who were yaws-infected did not produce immunoglobulin (IG) M antibodies (Wicher, Wicher, Abbruscato, & Baughn, 2000).

2.8.5 Epidemiology

A review of current and historical literature from the year 1950 to 2013 shows that at least

90 countries have ever reported yaws in South America, Africa, Asia, the Caribbean, and the Pacific. Globally, estimates were between 50 and 150 million active yaws cases in the early 1950’s (Kazadi et al., 2014). In South America, the disease was prevalent in Bolivia,

Ecuador, Colombia, Venezuela, and Brazil. Passing to Africa, the disease was highly prevalent in Mozambique, Uganda, and Madagascar as well as most countries of the west coast, with the heaviest burden in Haiti and other Carribean Islands. A review by Kazadi et al. (2014) shows that in the 1950s, Cameroon, Côte d’Ivoire, Ghana, and the Belgian

Congo reported more than 100,000 cases each per annum, and about 20 African countries reported more than 10,000 cases per annum.

In Asia, yaws was very common in Laos, Cambodia, Malaysia and Thailand, and in some districts of China and India. The disease was present in the South Pacific, including northern parts of Australia, and was highest in Papua New Guinea and the Solomon

Islands. A major eradication effort based on mass screening and treatment with injectable penicillin reduced the global burden of yaws significantly to about 2.5 million cases

(Asiedu et al., 2008). Following this initial success, yaws dropped down the public health agenda both internationally and domestically in many countries. In the 1970s and 1980s, there was a resurgence in some countries in Central and West Africa which led to a renewal of control efforts, which though reduced the burden of the disease, did not eradicate it (Asiedu et al., 2008; Marks, Solomon, & Mabey, 2014).

Over the past 20 years, the resurgence has occurred in previously endemic countries and is now thought to be endemic in at least 13 countries in the Pacific, Southeast Asia and West

Africa. Furthermore, 76 countries that previously reported yaws, throughout Asia, the

Americas, Africa and the Pacific, has no evidence of adequate up-to-date surveillance data available (Figure 7) (Kazadi et al., 2014). Currently, most of the reported yaws cases are concentrated in just three countries: Papua New Guinea, the Solomon Islands and

Ghana, each reporting >15 000 cases annually within the past 3 years. In eight other countries, transmission occurs in focal communities. India and Ecuador have reported eliminating yaws with prolonged campaigns on a strategy based on active case identification, contact tracing and treatment with injectable penicillin, (Anselmi, Moreira,

Caicedo, Guderian, & Tognoni, 2003; Narain, Jain, Bora, & Venkatesh, 2015) which demonstrates that sustained efforts can be successful.

A cohort study conducted in five yaws-endemic villages in PNG showed that 54 cases out of 90 patients with skin ulcers were infected with H. ducreyi. Coinfection with both yaws and H. ducreyi infection was found in 12 out of the 54 confirmed cases of H. ducreyi infection (Mitja et al., 2014). Also, a longitudinal study conducted showed 60 cases out of

114 patients infected with H. ducreyi (Mitja et al., 2015). A study in Solomon Islands also identified 13 children out of 41 children with H. ducreyi infection during a survey of yaws

31 prevalence (Marks et al., 2014). Similar observations were made in Vanuatu and Ghana according to Gonzalez-Beiras et al. (2016), and in Ghana specifically in the northern parts of the country, Ghinai et al. (2015) saw no evidence of ongoing transmission of yaws but rather found H. ducreyi in a proportion of skin ulcers while the majority of lesions remained unexplained. Pathogens such as Fusobacterium fusiforme, Streptococcus pyogenes, and Staphylococcus aureus have been reported from Gram staining of lesion exudates collected from tropical ulcers as causative agents (Gonzalez-Beiras et al., 2016).

Figure 7: Worldwide Distribution of Yaws, 2008-2015. Worldwide map showing countries which were previously Yaws endemic, and is currently endemic and where transmission has been interrupted. Source: (WHO, 2017a)

2.8.6 Diagnosis

In known yaws endemic communities, clinical diagnosis is generally straightforward although yaws can be confused with several diseases common in the tropics (eg, scabies, fungal infections, tropical ulcers or cutaneous leishmaniasis). Health-care workers unfamiliar with the diseases are likely to under-report or over-report yaws unless the

32 diagnosis is confirmed by laboratory techniques (Mitja et al., 2013). Dark field microscopy allows for direct visualization of spirochetes in wet preparation of specimen from early lesions, however, the equipment and skills required are not available even in relatively high-income settings. Instead, the diagnosis has rested on serological assays and recently, nucleic acid amplification tests (NAATs) (Marks et al., 2015). The same serological tests can be performed to diagnose both yaws and syphilis which requires detecting two distinct antibodies: one against a non-treponemal antigen and one against a treponemal antigen.

The non-treponemal tests include the venereal disease research laboratory (VDRL) and rapid plasma reagin (RPR) tests which use an antigen of lecithin, cardiolipin and cholesterol. Antibodies produced in patients’ serum against lipid on the cell surface of T. pallidum react with an antigen to give a visible flocculation. VDRL is read microscopically whereas RPR is read with the naked eye. Although non-specific,

VDRL/RPR titres more accurately reflect active disease. The treponemal tests include the

T. pallidum particle agglutination (TPPA) and T. pallidum haemagglutination (TPHA) assays which are used to detect Treponema-specific antibodies. These treponemal tests are more specific and usually remain positive for life (Marks et al., 2015; Mitja et al., 2013).

A rapid diagnostic test (RDT) (Chembio Diagnostic System, Inc., New York, NY, USA) has proved its effectiveness in the diagnosis of syphilis (Yin et al., 2013), and a number of evaluations of its performance in diagnosing yaws have been undertaken. This RDT detects both non-treponemal and treponemal antibodies in clinically suspected yaws patients when used during community surveillance and mapping. This can be used in remote communities where Yaws is endemic and may help to improve reporting of yaws cases worldwide (Ayove et al., 2014; Marks et al., 2014). T. pallidum subspecies

33 differentiation currently relies on combined real-time PCR and sequencing (Pillay et al.,

2011) since previously developed PCR protocols could not distinguish between the subspecies (Mitja et al., 2011; Orle, Gates, Martin, Body, & Weiss, 1996). However, Chi et al recently developed a real-time multiplex PCR assay which can differentiate between the T. pallidum subspecies in skin lesions clinically suspected as yaws (Chi et al., 2015;

Kositz, Butcher, & Marks, 2017).

In a recent study, nested PCR and/or real-time PCR failed to detect the yaws bacterium in blood specimens of patients, however, in syphilis, similar techniques were successful in identifying T. pallidum subspecies pallidum DNA in the blood of patients with latent disease (Marks et al., 2015). For routine purposes, diagnosis of yaws should depend on clinical manifestations and rapid serological tests, taking into accounts epidemiological and demographic characteristics of yaws. The possibility that there are alternative causes of skin ulcers in the Pacific region could have implications for WHO’s targeted yaws eradication strategy, which is based on detection of suspected clinical cases (Marks et al.,

2014).

2.9 Laboratory methods for diagnosis of Haemophilus ducreyi infections

Scientists have suggested the possibility that, the difficulty of collecting samples for molecular analysis, the lack of facilities to enable collection of samples for culture in affected communities, and the precise culture requirements of H. ducreyi have notably delayed recognition of associating genital H. ducreyi as the cause of some non-genital ulcers in recent surveys (Marks et al., 2014).

2.9.1 Bacteriological diagnostic techniques

From the original observations of Ducrey, according to Albritton (1989), the morphology and Gram staining characteristics of H. ducreyi have been the most important structural features of the organism. The direct examination of clinical material by Gram’s stain might be misleading most genital ulcers may have polymicrobial flora composition

(Lewis, 2000). Therefore, direct microscopy should not be used for routine diagnosis.

Microscopically, some morphological forms have been described as “railroad tracks,”

“schools of fish,” and “fingerprints”. The average Gram-negative bacillus length is from

1.2 to 1.5 µm and is about 0.5 µm in width with rounded ends.

Traditionally, the laboratory confirmation has relied on the culture of the organism and for many years, it has been the ‘gold standard’ for diagnosing H. ducreyi infection (Lewis,

2014). Gonzalez-Beiras et al. (2016) considered the following diagnostic methods as methods that provide acceptable evidence of H. ducreyi infection: 1) isolation and identification by culture; or 2) PCR/real-time PCR. The main advantage is that bacterial cultures provide isolates for antimicrobial sensitivity testing which can provide useful information in any advent of treatment failure (Lewis, 2000). The most widely used media require either Mueller-Hinton agar or Gonococcal agar or Columbia agar as the base to which a nutritional supplement (e.g., IsoVitaleXTM enrichment) and either 5% chocolatized blood or 1% hemoglobin with 5% fetal calf serum is added (Gaston et al.,

2015; Ghinai et al., 2015; Houinei et al., 2017; Pillay et al., 2016).

In some resource-poor settings, an activated charcoal-containing medium has been used with success. To reduce overgrowth of commensal Gram-positive bacteria, vancomycin (3 mg/ml) is added; however, some clinical H. ducreyi strains are inhibited at this

35 concentration and additional unsupplemented media may be considered to ensure recovery of the pathogen (Alfa, 2005). To isolate class II H. ducreyi strains, the incubation period of primary cultures may have to be extended beyond the standard 48 hours. Once inoculated on freshly-made media, agar plates should be incubated specifically at a temperature of

33-35°C at high humidity, ideally in a strict anaerobic or microaerophilic environment.

Identification of presumptive H. ducreyi colonies relies upon colony morphology and the fact that colonies can be pushed intact across agar surfaces due to bacterial adherence

(‘clumping’) (Alfa, 2005).

Starch aggregation of H. ducreyi strains has been shown and also reported (Sturm &

Zanen, 1984). Usually, area of heavy bacterial growth showed colonies that had a smooth, glistening surface and were pyramidal in shape with an average diameter of +0.5 mm.

Colonies in an area of less heavy growth had a diameter of ±1.0 to 1.5 mm, a brown- yellow colour and a flat granular surface. Small, nonmucoid, yellow-grey, semiopaque, adherent colonies with occasional translucent colonies have also been observed (Albritton,

1989). Presumptive identification can be assisted with biochemical tests: a positive oxidase reaction, a negative catalase reaction, X-factor nutritional requirement (evaluated by the porphyrin test), alkaline phosphatase production and a nitrate reduction (Lewis,

2000).

2.9.2 Mass spectrometric identification method

Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI/

TOF-MS) enabled the rapid identification and speciation of bacteria within a shorter time compared to conventional culture method. The mass spectral ‘fingerprints’ which were obtained permitted the rapid speciation of pathogenic forms of Haemophilus; those

36 bacteria usually regarded as non-pathogenic and also members of the normal flora.

The identification of Haemophilus species is made within 24 hrs rather than the 48 hrs or more needed for bacterial culture and the mass spectra are generated within 10 min.

(Haag, Taylor, Johnston, & Cole, 1998).

2.9.3 Serological detection

Techniques used to detect serological responses include enzyme immunoassays (EIA)

(using ultrasonicated whole cell antigen, OMPs49 or purified H ducreyi LOS49 as antigens (Alfa et al., 1993), dot immunobinding, complement fixation, agglutination, and precipitation have been evaluated. However, due to their low sensitivity compared with

PCR assays, they may only be useful for sero-epidemiological studies for past infection

(Lewis, 2000). Lesions associated with H. ducreyi infections have been found in patients with negative and positive serologic test results for T.p subsp. pertenue. It is likely that patients with positive serologic test results represent latent yaws infections with an alternative etiologic agent causing the current lesion (Marks et al., 2014).

2.9.4 Molecular-based detection

In order to improve the sensitivity of H. ducreyi diagnosis, several PCR assays have been developed. Primers have been designed to amplify sequences from either the rrs (16S)-rrl

(23S) ribosomal intergenic spacer region (Gu et al., 1998), the H ducreyi 16S ribosomal

RNA gene (Orle et al., 1996), the groEL gene encoding the H ducreyi GroEL heat shock protein (Parsons, Waring, Otido, & Shayegani, 1995) or an anonymous fragment of cloned

H ducreyi DNA (Johnson, Martin, Cammarata & Morse, 1994). The first multiplex PCR

(M-PCR) assay developed for the simultaneous amplification of DNA targets from HSV

(Herpes Simplex Virus) types 1 and 2, H ducreyi and T pallidum, appears more sensitive

37 for the detection of these etiological agents than standard diagnostic tests in genital ulcer specimens (Orle et al., 1996). Mackay and his colleagues also developed a novel in-house

GUD M-PCR assay, with an internal control to additionally detect Klebsiella (or

Calymmatobacterium) granulomatis, the causative agent of donovanosis (Mackay et al.,

2006). Subsequently, Suntoke et al. (2009) developed and evaluated a real-time PCR assay that was similar to that developed by Orle et al. (1996). Recently, commercially produced

Seeplex M-PCR panels which include the STD4 ACE Detection test (T. pallidum, HSV-

1/2, H. ducreyi, and Candida albicans) and the STI Master Panel 5 test (T. pallidum,

Chlamydia trachomatis L1-L3, H. ducreyi, Streptococcus agalactiae and cytomegalovirus) by Seegene Technologies, Seoul, South Korea have become available.

However, its performance characteristic for H. ducreyi diagnosis is yet to be evaluated

(Lewis, 2014). Other groups have recently developed a duplex real-time PCR for M. ulcerans and H. ducreyi using previously validated targets (Marks et al., 2014).

2.10 Treatment

Studies conducted in Papua New Guinea and Ghana showed that a single oral dose of azithromycin of 30mg/kg (max 2g) was equivalent to treatment with injectable benzathine penicillin-G (Kwakye-Maclean et al., 2017; Mitja et al., 2012). The ease of AZT administration and favorable safety profile has led to a renewed interest in yaws eradication, therefore in 2012, WHO outlined the Morges strategy to be adopted worldwide. Although AZT had been widely and successfully used in MDA programmes for control and elimination of trachoma, the possibility of resistance is one major area of concern. There is evidence of resistance of azithromycin in sexually transmitted strains of

T. pallidum which is now widespread (Chen et al., 2013; Lukehart et al., 2004; Stamm,

2014) The recent development of an assay to monitor the development of any resistance in

T.p subsp. pertenue is possible (Chen et al., 2013)

Genital ulcers (commonly chancroid, syphilis, and herpes), as advocated by WHO, are treated according to syndromic management algorithms in most resource-poor countries.

Single-dose regimens (ciprofloxacin, azithromycin, and ceftriaxone) or more prolonged therapeutic regimens (ciprofloxacin and erythromycin) may be used to treat patients dependent on regimen availability and affordability (Lewis, 2014). Results from experimental infection of human volunteers using a single dose of AZT (1 g) or ciprofloxacin (500 mg) proved efficacious (Thornton et al., 1998) and that from MDA of

AZT for yaws (and possibly trachoma) could also be effective in treating ulcers infected with H. ducreyi (Ghinai et al., 2015). Recent reports show AZT efficacious for treatment of CU H. ducreyi in PNG (González-Beiras et al., 2017).

2.11 Antimicrobial susceptibility patterns

The fastidious nature of H. ducreyi and its tendency to clump makes it a technical challenge to perform antimicrobial susceptibility testing and till now there is no standardized protocol for this activity. Minimum inhibitory concentrations (MICs) of antimicrobials may be determined by agar dilution or Etest methods, although this is rarely performed (Lagergård, Frisk, & Trollfors, 1996). The list of drugs to be tested should include those locally recommended for treatment, those for epidemiological studies, newly developed drugs requiring microbiological assessment as well as alternative therapeutic agents. Commonly tested antimicrobials include tetracycline, chloramphenicol, erythromycin, sulfamethoxazole and trimethoprim (used alone and in combination), ciprofloxacin (or fleroxacin), kanamycin (or streptomycin), and ceftriaxone (or cefotaxime)(Lewis, 2000).

Although historically H. ducreyi is susceptible to a wide range of antimicrobial agents, the organism has acquired and expresses a variety of resistance mechanisms over time.

Plasmid-mediated resistance has been described for penicillin, tetracycline, chloramphenicol, sulfonamides, and aminoglycosides. Chromosomally-mediated resistance has also been described for penicillin, trimethoprim and fluoroquinolones among plasmid-free H. ducreyi isolates (Lewis, 2000). It has previously been shown that

CU isolates are generally β-lactamase negative with penicillin MICs of 0.25 mg/l and contained no acquired antimicrobial resistance genes (Gangaiah et al., 2015; Marckmann et al., 1989; Ussher et al., 2007) except for AUSPNG1, which expressed β-lactamase

(Gangaiah et al., 2016). CU isolates were found to be susceptible to ceftriaxone, amoxicillin, ciprofloxacin, doxycycline, and azithromycin (Gangaiah et al., 2015).

Recently reported Ghanaian uncharacterized CU strains showed that 2 of the (GHA1 and

GHA2) strains contained catS, which confers resistance to chloramphenicol and 4 strains

(GHA3, GHA5, GHA8 and GHA9) contained tet(B), which confers resistance to tetracycline (Gangaiah & Spinola, 2016); both of these resistance determinants have been reported in GU isolates (Dangor, Ballard, Miller, & Koornhof, 1990). In addition, none of the strains examined contained bla determinants (Gangaiah & Spinola, 2016).

CHAPTER THREE

MATERIALS AND METHODS

3.1 Study design

This study is part of a clinical trial which was a randomized, controlled open-label non- inferiority phase III, multi-center trial, with two parallel groups. The trial was aimed at assessing the efficacy of a single dose of treatment of Yaws with 20mg/kg versus 30mg/kg of AZT and was registered under ClinicalTrials.gov identifier (NCT02344628).

Subsequently, samples taken from sites other than the trial study sites were undertaken as a follow-up to the second round recruitment of participants for the clinical trial. A convenience sample of 112 samples was obtained from 115 participants within the time frame of this study.

3.2 Study sites

The data according to WHO shows that Ghana from 2009 to 2013 (Figure 8A) is a highly endemic country with more than 5000 cases within a 4-year reporting period; where the regions most affected are Ashanti, Eastern, Volta, Central, Western and Brong-Ahafo

(NYEP, 2014). Three (3) districts in the Eastern region and one (1) district in the Volta region were initially targeted as circled in red (Figure 8B). The districts namely

Ayensuanor, West Akyem Municipality and Upper West Akyem and Nkwanta North

Districts were selected based on the trend of reported yaws cases from 2011 to 2013 annually (Table 3). Secondly, there have been successful pilot studies for the mass treatment of yaws in those areas using AZT in 2013 (Kwakye-Maclean et al., 2017).

Figure 8: Map of Ghana Showing Yaws Endemicity. (A) Total number of reported cases by region in Ghana, 2009-2013 (B) Reported cases of Yaws by District, Ghana, 2013. Source (NYEP, 2014)

Table 3: Selected districts and number of reported yaws cases District/Region 2011 2012 2013 Total

Ayensuanor District (Eastern region) 134 110 64 308 West Akyem Municipality (Eastern region) 124 354 194 672

Upper West Akyem (Eastern region) 34 262 229 525

Nkwanta North District (Volta region) 920 173 2341 3434

The Awutu Senya and Ga South Districts were also selected and included in the study after the randomized clinical control screening. This was done to collect more samples and isolate H. ducreyi strains. The West Akyem District extended to its neighboring district,

Awutu Senya District, to recruit yaws cases during the second round recruitment phase to add up to the expected numbers for the clinical trial. Though the Awutu Senya District is

42 known to be Yaws endemic, the total number of endemic communities is currently unknown. Ga South district formerly used to report yaws cases, but at the time of this study, there were no records of yaws cases. Table 4 shows the number of yaws cases reported from February 2015 to December 2016 in the Bawjiase Sub district which is one of the five sub-districts under the Awutu Senya District. Cases reported here were all treated with injectable benzathine penicillin G suspension (Table 4).

Table 4: Number of reported yaws cases in Bawjiase subdistrict Year Jan Feb Mar Apr May Jun Jul Aug Sept Oct Nov Dec Total

2015 - 3 7 4 5 3 7 4 3 6 9 - 51

2016 7 9 5 4 3 1 8 5 1 5 3 1 52

3.3 Subject selection

3.3.1 Inclusion and exclusion criteria

Each participant was clinically assessed using a combination of clinical experience and

WHO picture booklet for yaws. All 115 participants meeting initial inclusion criteria had their data and study samples collected.

Inclusion criteria for enrollment were:

 Aged 6 to 16 years

 Clinical lesion consistent with primary or secondary yaws

o Primary ulcer or papilloma

 Dually-Positive Chembio Dual Path Platform (DPP) Syphilis Screen & Confirm

test

 Negative result for Chembio DPP Syphilis Screen & Confirm test

 Clinical lesion that were ‘yaws-like’

 Informed Consent and Assent (for children 12-16 years)

Exclusion criteria were:

Participants were excluded from the study if any one or more of the following applied:

 Known allergy to azithromycin or macrolides

 Treatment with long-acting penicillin or alternative antibiotic with activity against

T. pallidum within the last 3 months (ceftriaxone, azithromycin or doxycycline,

amoxicillin)

 Patients with current treatment with any drugs likely to interact with the study

medication

 Patients who were unable to take oral medication or having gastrointestinal disease

likely to interfere with drug absorption

 Patients who were not willing to give informed consent (participant and/or

parent/legal representative), or who withdrew consent.

3.4 Procedures

3.4.1 Collection of clinical samples, processing, and transport

A rapid test was performed with a drop of blood from a thumb finger prick for serological analysis using a dual rapid test kit, Dual Path Platform (DPP) Syphilis Screen & Confirm

Assay (Chembio, Medford, NY, USA). All participants had their history of previous skin lesions along with socio-demographic details taken. Photographic data of lesions per participants was also taken (S120 Canon, INC., Japan). Dry sterile cotton swabs were used to collect exudates from the bases of the skin lesions. Specimens were placed in an assay assure transport medium and also inoculated directly on two agar plates: Charcoal (C-

HgCh) plates containing Columbia Agar base (Difco, BD) containing bovine haemoglobin

(BBL, BD), activated charcoal (Sigma-Aldrich), Isovitalex (BBL, BD), Fetal bovine serum (FBS) (Gibco) and vancomycin (Sigma-Aldrich); the Chocolatized (MH-HBC) plates containing Mueller-Hinton Agar base (BBL, BD) chocolatize horse blood, isovitalex and vancomycin. The agar plates were placed in a clean metal paint can, a small candle placed on top of the plates was lit and the container was tightly sealed to create anaerobic conditions. The plates were transported to the laboratories of Noguchi Memorial

Institute for Medical Research (NMIMR) within 4-6 hours (hrs.) in a mobile incubator

(Darwin Chambers Company, Washington, USA) at a temperature of 33ºC together with specimens in assay assure kept on ice for further analysis. All study participants were given a standard regimen of Azithromycin (30mg/kg, maximum 2g) single oral dose and a simple dressing to keep the ulcerated lesions clean.

3.4.2 Growth media for H. ducreyi isolation

C-HgCh and MH-HBC agar plates were prepared and used for the primary isolation of H. ducreyi. Briefly, for 1litre (L) of C-HgCh media, component one placed in an Erlenmeyer flask contained 26.4g of Columbia Agar Base and 525millilitre (mL) of distilled water while component two also in an Erlenmeyer flask contained 10g Bovine Hemoglobin, 2g activated charcoal and 400mL of distilled water. Components one and two were autoclaved separately at 121oC for 15 minutes (min.), mixed and allowed to cool to 55oC in a water bath. A volume of 10mL IsoVitaleX, 50mL of heat inactivated FBS and 1mL vancomycin concentration (conc.) of 3µg/mL) was added. A volume of 25mL of the final medium was dispensed into sterile plastic Petri dishes and allowed to set. Vancomycin was not added to media for growing H. ducreyi laboratory strains. A 5mL stock of vancomycin was previously prepared with 15mg of vancomycin and mixed with 5mL sterile distilled water. The solution was filter-sterilized using a syringe and 0.45μm filter.

One ml aliquots were aseptically dispensed into sterile 1.5mL microfuge tubes and kept at

-20 °C until needed.

A volume of 1L of MH-HBC media was prepared by using 38g of Mueller-Hinton agar base and 940 mL distilled water, autoclaved at 121oC for 15min. and allowed to cool to

70oC in a water bath. A volume of 50mL of chocolatized horse blood was added and the medium was cooled to 55oC in a water bath. A quantity of 10mL of IsoVitaleX and 1mL vancomycin (conc. of 3µg/mL) was added. Twenty-five mL of the medium was dispensed into sterile plastic Petri dishes and allowed to set. The growth of HD 35000 on both media indicated that the medium could support the growth of H. ducreyi strains.

3.4.3 Storage media for H. ducreyi strains

Glycerol-peptone storage medium was prepared and used for storage of H. ducreyi isolates. Briefly, for 200mL of the storage medium, 10g of Proteose peptone No. 3 (Difco,

BD), 80mL Glycerol (BDH) and 200mL of distilled water were mixed well until the solution was clear. Twenty mL was aliquoted into 50mL sterile glass bottles and autoclaved at 121oC for 15min. Three hundred µL of the medium was aliquoted into 2mL cryotubes containing glass beads (previously autoclaved at 121oC for 15 min.) and kept in the refrigerator at 4°C until use.

3.4.4 Isolation and identification of H. ducreyi strains

At NMIMR, the plates were transferred from the paint can to BD GasPak EZ Campy

Container System with a gas generating sachet (BBL, BD, USA) and incubated at 33oC for

48hrs. The plates were examined after the 48hrs incubation. Any primary isolation plate which showed poor growth or none was re-incubated for another day and re-examined daily (up to 72 hrs from initial inoculation). For plates that were contaminated or a

46 contaminant bacterium was streaked instead of H. ducreyi; another colony was picked from the primary isolation plate and streaked onto fresh C-HgCh and chocolatized medium. H. ducreyi was presumptively identified on the basis that the colonies could be pushed intact across the agar surface using a sterile loop. Single colonies were picked up with a sterile disposable loop and streaked on fresh C-HgCh plates that have been pre- warmed at 33oC for 20min.

3.4.5 Storage of H. ducreyi isolates

Using a sterile plastic loop, H. ducreyi colonies were carefully scraped off from the C-

HgCh plates and transferred into 2 sterile cryotubes containing 300µL of storage solution.

The tubes were immediately transferred to a -70oC freezer.

3.5 Phenotypic characterization of H. ducreyi isolates

H .ducreyi isolates were examined by typical colony morphology, colour, size and appearance in Gram-stained smears. The sizes of the colonies were measured with a digital Vernier caliper (Mitutoyo, Japan).

3.5.1 Gram staining and light microscopy

Gram stain technique was used for phenotypic characterization of H. ducreyi isolates as described by Monica Cheesbrough (Cheesbrough, 1991) using Gram stain reagents (BBL,

BD). Briefly, fixed smears were flooded with crystal violet for 1min and gently washed off with tap water. The smear was covered with Lugol’s iodine for a further 1min and washed off gently with tap water. The decolorizer was used to remove excess stain and washed immediately with tap water. After decolorization, the smear was flooded with a counterstain for approximately 1 minute and the stain was washed off with tap water. The

47 back of the slides was wiped with a clean paper towel and placed in a draining rack and allowed to air-dry. The stained smears were examined microscopically using a light microscope (Olympus Optical Co. LTD., Philippines), the 40X objective was first used to check the staining and distribution of the material and then with the oil immersion 100X objective.

3.5.2 Biochemical testing

The biochemical tests used to identify H. ducreyi were porphyrin test, nitrate reductase test, β-lactamase test, catalase test and oxidase test. These tests were performed at CDC using CDC in-house reagents. H. ducreyi isolates used were those that were cultured on C-

HgCh medium lacking vancomycin.

3.5.2.1 Porphyrin test

Heavy growth of cells of each of the H. ducreyi isolates was each inoculated into 0.5mL porphyrin medium. The cells were incubated for 24hrs at 33°C under microaerophilic conditions. Tubes were placed underneath a long wave UV light and the colour observed.

A volume of 0.5mL Kovacs reagent was added. Tubes were inverted 5-10 times and incubated on the bench for 5mins and the colour was observed. The results were interpreted as positive when a red fluorescence was observed under UV light and negative when no fluorescence was observed under UV light.

3.5.2.2 Nitrate Reductase test

Several single colonies of each of the H. ducreyi isolates were each scraped from C-HgCh plates and transferred to Durham tubes containing 5mL nitrate broth. Tubes were gently mixed and incubated at 33°C for 24hrs under microaerophilic conditions. Five drops each

48 of reagent A and reagent B were added and observed for color change and effervescence.

The results were interpreted as positive when a red colour for nitrate reductase was observed and negative when there was no color change.

3.5.2.3 β-lactamase test

Several single colonies of each of the H. ducreyi isolates were each swabbed evenly on C-

HgCh plates. Penicillin antibiotic, 10units (BBL, BD, USA) was placed on each plate and incubated at 33°C for 24hrs under microaerophilic conditions. The results were interpreted as positive when there was no zone of inhibition observed around the antibiotic and negative when a zone of inhibition was observed around the antibiotic.

3.5.2.4 Catalase test

Several single colonies of each of the H. ducreyi isolates were each scraped from C-HgCh plates and transferred into micro centrifuge tubes containing 100µL sterile distilled water.

The cells were mixed well and spanned down at 8,000rpm for 2min to pellet the cells. The supernatant was aspirated; 100µL of 3% hydrogen peroxide solution was added, the tubes were gently inverted and observed for bubbles. Results were interpreted as positive when effervescence was observed and negative when no bubble was observed.

3.5.2.5 Oxidase test

Filter paper was saturated with oxidase reagent and placed inside a petri dish. Single colonies of the H. ducreyi isolates were each picked with sterile plastic loops and rubbed onto the filter paper. Colour change was observed and the results interpreted. A purple colour indicated a positive test while no colour changed indicated a negative result.

3.6 Molecular analysis

The molecular analysis was performed in the laboratories of NMIMR using exudates in assay assure medium. A total number of 112 ulcerative lesion samples were used for this analysis. Real-time PCR analysis for both T.p subsp. pertenue and H. ducreyi were performed (Kositz et al., 2017). The 23S rRNA TaqMan real-time multiplex PCR assay for detection of T. pallidum AZT resistance was also performed for samples that tested positive for yaws (Chen et al., 2013). The universal primers for the amplification of the

16S rRNA gene in bacteria as described by Greisen et al were used to detect the occurrence of other bacteria in skin ulcers (Greisen, Loeffelholz, Purohit, & Leong, 1994).

3.6.1 DNA extraction

Genomic DNA was extracted from the lesion exudates using the QIAamp DNA mini kit

(Qiagen Hilden, Germany) according to the manufacturer’s instructions with slight modifications. Briefly, centrifuge tubes with flip-top were pre-labelled and 20µL of proteinase K solution, 200µL of sample and 200µL of Lysis (AL) buffer was aliquoted into each of the centrifuge tubes. The mixture was vortexed for 15-20sec to completely mix the contents. The tubes were incubated at 56ºC for 10min on a water bath for total cell lysis. After 10min, the tubes were removed from the water bath and allowed to cool at room temperature for 5min. The tubes were short spanned and 200µL of absolute ethanol of molecular grade was added to the resulting solution, vortexed for 15-20sec. to mix the contents well and short span. The contents in the centrifuge tubes were transferred into filter columns and centrifuged at 8000rpms for 1min. The collection tubes were discarded and the filter columns were placed into new collection tubes.

A volume of 500µL of AW1 buffer was pipetted into the filter columns and centrifuged at

8000rpms for 1mins. This washing step was repeated with 500µL of AW2 buffer and centrifuged at 14000rpms for 3mins. The collection tubes were replaced and spanned for

2mins at 14000rpms. The filter columns were placed into new collection tubes and 100uL of elution (AE) buffer was added to each. The tubes were allowed to stand for 3mins at room temperature and then centrifuged at 14000rpms for 2mins. Eluted DNA was transferred into pre-labelled clean sterile screw-cap Eppendorf tubes and stored at -20°C until use for downstream analysis.

3.6.2 DNA quantification

The NanoDrop Micro-UV/Vis spectrophotometer (ThermoScientific, U.S.A) was used to quantify the amount of DNA extracted from the samples according to manufacturer’s instructions. Briefly, 1µL of a blanking solution was first used to blank the instrument.

Subsequently, 1µL each of the extracted DNA was measured and the reported values were entered in Microsoft Excel.

3.6.3 Multiplex real-time PCR for H. ducreyi detection

A duplex real-time PCR was performed using specific sequences (hemolysin gene, HdhA) and IS2404 respectively for H. ducreyi and M. ulcerans on all samples. Briefly, the multiplex assay was set up using a set of primers and probes (Table 5). A 25µL of amplification reaction mixture for the H. ducreyi and M. ulcerans multiplex PCR contained 10µL of template DNA (sample), 12.5µL of PerfeCTa Multiplex qPCR

SuperMix (Quanta Biosciences, Gaithersburg, MD), 0.7µL of water (Ambion, USA) and a total volume of 1.8µL of a mixture of primers and probes for H. ducreyi, M. ulcerans and

Ribonucleoprotein (RNase P). RNase P included in the assay served as an internal control

to confirm sample adequacy and monitor PCR inhibition. The PCR targets, primer and

probe sequences with their final concentrations and the fluorescent dyes used for each

specific probe (Table 5 and Table 6). The amplification assay was performed on a real-

time PCR instrument Rotor-Gene Q (Qiagen Hilden, Germany) using the following

thermocycling conditions: 95°C for 4 min, followed by 50 cycles of 95°C for 20sec, and

60°C for 1min. Positive and no-template controls (NTC) were included in the assay to

standardize the threshold cutoff in each run.

Table 5: MPCR primers and probes for M. ulcerans and H. ducreyi detection Primer No. Description Sequence (5’----> 3’)

FP-MU-0010 IS2404FP2 ATTGGTGCCGATCGCGTTG

RP-MU-0011 IS2404RP2 TCGCTTTGGCGCGTAAA

Probe:CalRed- IS2404CalRed CalRed610CACCACGCAGCATCTTGCCGTBHQ2 MU-0012

FP- HD-003 HHDA3257F AAT CGTTAACTGCGGGATTAGG

RP- HD-004 HHDA3349R CAATAGACACATTATCGCCCTTTAAA

Probe:HEX- HHDA3284PHEX TETATGGCCATGGTAGTGAGGTAAATCAGGCTGTBHQ1 HD-002

FP-CONTROL- RNASEP 3F CCAAGTGTGAGGGCTGAAAAG 036

RP-CONTROL- RNASEP 3R TGTTGTGGCTGATGA ACTATAAAAGG 024 probe: Quas670- RNSEP3-Q670 Quas670CCCCAGTCTCT GTCAGCACTCCCTTCBHQ3 CONTROL-032

Table 6: MasterMix concentrations and volumes for MPCR of H. ducreyi and M. ulcerans Volume (µl) Stock (µM) MMix (µl) CMMix (nM)

MU:FP 0.2 37.5 0.2 300

RP 0.2 37.5 0.2 300

CalRed610 Probe 0.2 12.5 0.2 100

HD:FP 0.2 25 0.2 200

RP 0.2 37.5 0.2 300

HEX Probe 0.2 25 0.2 200

RNP: FP 0.2 10 0.2 80

RP 0.2 10 0.2 80

Q670 Probe 0.2 10 0.2 80

2x PerfecTa Multiplex qPCR 12.5 12.5 supermix

PCR Water 0.7

Sample (DNA) 10

Total reaction volume 25

3.6.4 Multiplex real-time PCR for the detection of Yaws bacterial agents

The molecular differentiation of T.p subsp. pertenue from T.p subsp. endemicum and T.p subsp. pallidum was achieved using a real-time triplex PCR. The PCR targets, primer and probe sequences and fluorescent dyes used for each specific probe are listed (Table 7).

Briefly, the quadruplex PCR was performed with a 10μL sample of DNA in a 25μL reaction volume containing 12.5μL of PerfecTa Multiplex qPCR SuperMix (Quanta

Biosciences, Gaithersburg, MD) and the appropriate volume of each primer and probe

(Table 8). The assay was performed on a real-time PCR instrument Rotor-Gene Q (Qiagen

Hilden, Germany) using the following thermocycling conditions: 95°C for 4 min, followed by 50 cycles of 95°C for 20sec, and 65°C for 60 sec. Both positive and NTC were included in the multiplex assay to standardize the threshold cutoff in each run.

Table 7: MPCR primers and probes for T.p subsp. pertenue detection Primer No. Description Sequence (5’----> 3’)

Tpr I gene for T. pallidum

FP- TP-339 TP-tprI-FP CACTCCTGTGGGGAGTAGGA

RP- TP-340 Tp-tprI-RP3 GAGCTCCCCGTTGCCA

TP-tprI-RP- Probe:Cy5- TP-341 Cy5CGATTACCTGCATCGGCAGGGTCBHQ3 CY5

Tpr I gene for T.

endemicum

FP- TP-250 Tp-tprI-FP2 TTATTAACCCCGCGTACACC

RP- TP-252 Tp-tprI-RP2 GCCAAAGTAACGCTCAGACC

Probe:CalRed- TP- Tp-tprI-R- ROX-NATGCCCATGTAGGGAACATCGGAGBHQ2 321 CalRed610

Tp-858 gene for T.

pertenue

Pertenue- FP- TP-333 AGTCCTGCTGCAACGGTAGTAC TP858-FP

RP- TP-252 Tp-tprI-RP2 GCCAAAGTAACGCTCAGACC

Probe: CalRed610- Pertenue- FAMTGCTGCACGAAGAAGTGCGAAGGBHQ1 TP-321 TP858-FAM

Table 8: MasterMix concentrations and volumes for Treponema MPCR differentiation Volume (µl) Stock (µM) MMix (µl) CMMix (nM)

Pallidum : FP 0.2 37.5 0.2 300

RP 0.2 37.5 0.2 300

Cy5 Probe 0.2 37.5 0.2 300

Endemicum : FP 0.2 25 0.2 200

RP 0.2 25 0.2 200

CalRed610 Probe 0.2 25 0.2 200

Pertenue : FP 0.2 25 0.2 200

RP 0.2 25 0.2 200

FAM Probe 0.2 25 0.2 200

2x PerfecTa Multiplex qPCR supermix 12.5 12.5

PCR Water 0.7

Sample (DNA) 10

Total reaction volume 25

3.6.5 Multiplex real-time PCR for the detection of T.p AZT resistant markers

All samples that tested positive for T. pallidum pertenue DNA using the triplex PCR were further tested with a TaqMan real-time multiplex PCR assay to detect the A2058G and

A2059G point mutations in the 23S rRNA gene associated with azithromycin resistance in

T.p subsp. pallidum. The PCR targets, primer and probe sequences with fluorescent dyes used for each specific probe is listed (Table 9). Briefly, the multiplex PCR was performed with a 10μL sample of DNA in a 25μL reaction volume containing 12.5μL of PerfecTa

Multiplex qPCR SuperMix (Quanta Biosciences, Gaithersburg, MD) and the appropriate volume of each primer and probe (Table 10). The assay was performed on a real-time PCR instrument Rotor-Gene Q (Qiagen Hilden, Germany) using the following thermocycling conditions: initial hold at 95°C for 4 min, followed by 50 cycles of 95°C for 20sec and

65°C for 60sec. Positive and NTC were included to standardize the threshold cutoff for each run.

Table 9: MPCR primers and probes for the detection of TP AZT resistant markers Primer No. Description Sequence (5’----> 3’)

FP- TP-085 TPrrnaA23S-SF-FP GACTCTGGACACTGTCTCG

RP- TP-042 TPrrnaA23S-RP1 TTGACTCCGCCTAACCTGACG

WT-TPrrnaA23S-R- FAM- TP-076 FAMTGAAGGTTCACGGGGTCTTTCCGTBHQ1 FAM

CalRed610- A2058G - TPrrnaA23S-R- CalRed610TGAAGGTTCACGGGGTCTTCCCGTBHQ2 TP-077 CalRed

Quas670- A2059G -TPA2059G QUAS670AAGGTTCACGGGGTCTCTCCGTCTBHQ3 TP-177 R-Q670

Table 10: MasterMix concentrations and volumes for MPCR detection of TP AZT resistant markers Volume (µl) Stock (µM) MMix (µl) CMMix (nM)

FP 0.2 25 0.2 200

RP 0.2 25 0.2 200

WT : Probe 0.2 25 0.2 200

A2058G : Probe 0.2 25 0.2 200

A2059G : Probe 0.2 25 0.2 200

2x PerfecTa Multiplex qPCR supermix 12.5 2x 12.5

PCR Water 1.5 1.5

Sample (DNA) 10

Total reaction volume 25

3.6.6 PCR amplification of 16S rRNA gene for bacterial identification

PCR for bacterial identification was performed using PCR amplification procedures described by Greisen et al. (1994) with slight modifications. Briefly, DNA from lesion exudates was amplified in a 25µL reaction containing PCR buffer with MgCl2, deoxy ribonucleotides, forward and reverse primers, Taq polymerase, water and 2.5µL of template DNA (Table 11). The assay was performed on a PCR instrument Gene Amp PCR

System 2720 (Applied Biosystems, Singapore) using cycling conditions were set at 95ºC for 5min., followed by 35 cycles of denaturation at 94ºC for 45sec, annealing at 56ºC for

45 sec, extension at 72ºC for 45sec, a final extension at 72ºC for 10min and the reaction held at 4ºC.

Table 11: MasterMix concentrations and volumes used for 16S rRNA gene amplification Reagents in reaction mix Concentration Volume/µL Sterilized double distilled water 15.87

PCR Buffer with MgCl2 10x 5 dNTPs 10mM 0.5 Forward Primer 10µM 0.5 Reverse Primer 10µM 0.5 Taq Polymerase 5µ/µl 0.13 Template DNA 2.5

3.6.6.1 Gel electrophoresis and U.V visualization of 16S rDNA amplicons

Agarose gel electrophoresis was performed using 7µL of PCR amplicons from the 16s rRNA assay. The amplicons were run on 1% agarose (Sigma-Aldrich, Darmstadt,

Germany) gel stained with 2µL ethidium bromide (Sigma-Aldrich, Darmstadt, Germany) dissolved in 100mL 1X Tris Acetate-Ethylenediaminetetraacetic acid (TAE) Buffer

(Thermo Scientific, Waltham, U.S.A). Each run had 1kb DNA ladder loaded. The gel was run at 100V (Biometra, Gottingen, Germany) using 1X TAE buffer as running buffer for

50min. Visualization of the resolved DNA was done under a U.V trans illuminator (UVP

57 benchtop, Cambridge, U.K). The band sizes were scored and the gel pictures were taken

(Kodak, New York, USA).

3.6.6.2 DNA sequencing

The 16S PCR amplicons obtained were submitted for standard single PCR sequencing at

Macrogen Europe Laboratory (Amsterdam, The Netherlands). Sequence similarity search was done using the NCBI BLAST website at (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

(Johnson et al., 2008).

3.7 Data analysis

Data was entered into Microsoft Excel. The morphological, microscopic and biochemical characteristics of the cutaneous H. ducreyi strains were compared to that of the genital H. ducreyi strain. The cycle threshold (CT) values of tests and controls from amplification plots of the real-time PCR run were analyzed to confirm the presence of T.p subsp. pertenue and H. ducreyi in the skin lesions. The PCR-positivity outcome for T.p subsp. pertenue and H. ducreyi in symptomatic participants were tabulated. Odds ratios with 95%

CIs from univariate logistic regression analysis was reported for single and co-infections of either T.p subsp. pertenue or H. ducreyi. The ID and Accession numbers of the BLAST sequences were noted. The sequences were aligned using MEGA 7 bioinformatics software (Kumar, Stecher, & Tamura, 2016).

3.8 Ethical issues

This study was conducted according to Good Clinical Practice (Declaration of Helsinki and ICH Guidelines) and was approved by the ethical review committees of the Ghana

Health Service (GHS) (GHS 13/11/14), London School of Hygiene and Tropical Medicine

(LSHTM) (LSHTM 8832), and a final approval given by the WHO Ethical Review

Committee (RPC 720). The trial was monitored by an independent Data and Safety

Monitoring Board (DSMB).

CHAPTER FOUR

RESULTS

4.1 General characteristics of study participants

The study involved a total of 115 individuals with clinically suspected yaws-like skin

ulcerations from 3 districts in the Eastern region (Ayensuanor, West Akyem and Upper

West Akyem), 1 district in the Volta region (Nkwanta), 1 district in Greater Accra region

(Ga South) and 1 district in the Central region (Awutu Senya). In each study site, a

majority of the participants were males, representing 73% of the study population whereas

27% were found to be females (Table 12). More cases were seen in Upper West Akyem

district than the remaining districts.

Table 12: Characteristics of participants across study sites Districts Upper Ayensuanor West Nkwanta Ga South Awutu West Overall Akyem Senya Akyem n=115 n=19 n=18 n=16 n=17 n=17 n=28 (16.5%) (15.7%) (13.9%) (14.8%) (14.8%) (24.3%) Male 84 (73.0%) 14 (73.7%) 11 (61.1%) 19 (67.9%) 13 (81.3%) 13 (76.5%) 14 (82.4%) Age (years) 4-7 19 (16.5%) 2 (10.5%) 1 (5.6%) 4 (14.3%) 5 (31.2%) 4 (23.5%) 3 (17.6%) 8-11 39 (33.9%) 6 (31.6%) 6 (33.3%) 10 (35.7%) 6 (37.5%) 5 (29.4%) 6 (35.3%) 12-15 25 (21.7%) 6 (31.6%) 3 (16.7%) 5 (17.9%) 2 (12.5%) 4 (23.5%) 5 (29.4%) ≥16 1 (0.9%) 0 1 (5.6%) 0 0 0 0

The age range of participants was 4 to 16 years with a calculated mean age of about 10 ± 3

(mean ± SD) years. The highest number of clinically suspected yaws-like skin ulcerations

was seen in males between the ages of 8 to 11 years (Table 12). In general, more males

were seen to be ≤ 14 years of age, representing about 71.3% of the study population with

females being 24.3%.

A hundred children (87%) had a clinically apparent skin lesion. Fifteen children (13%) had skin conditions clinically consistent with yaws (Figure 9). Lesions were more common in the Upper West Akyem district with very few recorded in Awutu Senya district. Of the 6 districts, 11 papillomas were found in Awutu Senya district and 1 in Ga

South district. Two children with hyperkeratotic feet were found in the Ayensuanor district, where 1 of these 2 children had an additional macular lesion. Of the 2 macular lesions found in the Awutu Senya district, only 1 child had a lesion on the leg with the other child having no additional skin condition.

30 28 26 24 22 20 18 16 14 12

number number of participants 10 8 6 4 2 0 Papillomas Ulcers Macules Hyperkeratosis skin conditions Ayensuanor West Akyem Upper West Akyem Nkwanta Ga South Awutu Senya

Figure 9: Type of skin conditions presented in each District. A clustered column graph showing different skin conditions presented in each study site.

Treponemal testing for all participants included in the study showed that 64 participants

(55.7%) were confirmed to be DPP-RDT positive, with 51 participants (44.3%) being

61 negative. Of the 64 positives, the majority 53 participants all had lesions on their legs; with 8 participants having papillomas at different parts of the body (neck, buttocks, and back of knee); 2 participants with typical hyperkeratotic feet and 1 participant with a macular lesion on the hand. Of the 51 DPP-RDT negatives, 48 participants had lesions on their legs, with 3 participants having papillomas on their heads (Figure 10).

60 58 56 54 52 50 48 46 44 42 40 38 36 34 32 30 28 26 24 22 20 18 16 14 number number of participants 12 10 8 6 4 2 0 Papillomas Ulcers Macule Hyperkeratosis skin conditions

DPP Positive DPP Negative

Figure 10: Results of Serological testing. A clustered column graph of serological results of participants recruited from the 6 study sites.

Representative images of lesions from which exudates were obtained and either H. ducreyi

DNA or T.p subsp. pertenue DNA was amplified were similar in location. There was no clear-cut clinical diagnosis of lesions. Serologic outcomes were not indicative of PCR outcomes (Figure 11 and Figure 12). Other lesions had unknown etiology.

Figure 11: Representative Images of DPP-RDT Positives and PCR Outcomes from Lesion Exudates. . A) Unknown etiology B) Only H. ducreyi DNA detected C) Only T.p subsp. pertenue DNA detected D) T.p subsp. pertenue DNA and H. ducreyi DNA detected

Figure 12: Representative Images of DPP-RDT Negatives and PCR Outcomes from Lesion Exudates. A) Unknown etiology B) Only H. ducreyi DNA detected C) Only T.p subsp. pertenue DNA detected

4.2 Culture analysis

4.2.1 Detection of H. ducreyi by PCR and culture methods

Overall, H. ducreyi infections were more detectable by PCR and less retrieved by culture.

Of 60 bacteria cultures from children with active skin ulcers for the isolation of H. ducreyi, 42 (70%) yielded no growth for H. ducreyi, 11 (18%) were lost during passaging and 7 (12%) were confirmed as H. ducreyi strains. Of the 32 PCR-confirmed H. ducreyi positives from the study, Nkwanta district was seen to be highly endemic with 12 PCR- confirmed cases of which 5 isolates were successfully retrieved by culture, followed by

West Akyem with 8 PCR-confirmed cases with no isolates retrieved (Figure 13).

Ayensuanor and Upper West Akyem districts had 6 PCR-confirmed cases each with 2 isolates retrieved from Ayensuanor district. Ga South and Awutu Senya districts had zero cases of H. ducreyi infections.

Figure 13: Occurrence of H. ducreyi in Active Skin Ulcers. Pie charts showing the number of isolates retrieved and PCR positivity across the 6 study sites.

4.2.2 Phenotypic characteristics of cutaneous H. ducreyi in culture

Visible growth was seen on C-HgCh agar plates incubated for 48 hours at 33ºC in BD

GasPak EZ Campy Container System with a gas generating sachet. Cutaneous H. ducreyi colonies had smooth surfaces, could be pushed intact across the agar surface, were pale greyish in colour and measured averagely 0.52 ±0.02 mm and 0.84 ±0.01 mm in diameter in dense and less dense areas respectively (Figure 14). The isolates by microscopic examination of Gram-stained smears were Gram-negative short chained coccobacilli characteristic of a “schools of fish”. Genital H. ducreyi strain differed slightly by the smooth, could be pushed intact across the agar surface, yellowish grey in colour and measured averagely 0.66 ±0.02mm and 0.95 ± 0.05 mm in diameter in dense and less dense areas respectively.

Figure 14: Representative C-HgCh Agar Plates of Genital versus Cutaneous H. ducreyi in Culture. A - genital H. ducreyi strain (HD 35000), B – cutaneous H. ducreyi strain (GHA 6).

All isolates were positive for oxidase, nitrate reductase and alkaline phosphatase, and negative for catalase and porphyrin tests. All except one cutaneous strain (GHA 6) tested positive for β-lactamase (Table 13).

Table 123: Biochemical characteristics of isolated cutaneous versus genital H. ducreyi strains β- Alkaline Nitrate Strain source lactamase phosphatase Catalase reduction Oxidase Porphyrin HD 35000 genital (-) (+) (-) (+) (+) (-) GHA3 cutaneous (-) (+) (-) (+) (+) (-) GHA4 cutaneous (-) (+) (-) (+) (+) (-) GHA5 cutaneous (-) (+) (-) (+) (+) (-) GHA6 cutaneous (+) (+) (-) (+) (+) (-) GHA7 cutaneous (-) (+) (-) (+) (+) (-) GHA8 cutaneous (-) (+) (-) (+) (+) (-) GHA9 cutaneous (-) (+) (-) (+) (+) (-) Positive test result, (+), Negative test result, (-).

4.3 Molecular analysis

4.3.1 Detection of T.p subsp. pertenue DNA and H. ducreyi DNA by respective real- time multiplex PCR

The DNA from the 112 AssayAssure samples was tested by the respective real-time multiplex PCR. Overall, T.p subsp. pertenue DNA was detected in skin lesions and papillomas from 11 of 112 (9.8%) of children (Table 14). Thirty-two of 112 (28.6%) was detected as H. ducreyi with 69 of 112 (61.6%) of unknown etiology. Neither T.p subsp. pallidum nor T.p endemicum and Mycobacterium ulcerans were detected in the samples.

One participant with positive DPP-RDT was PCR-confirmed positive for both T.p subsp. pertenue and H. ducreyi (OR H. ducreyi co-infection 21.33, 95% CI 2.73-166.87, p

=0.0035, OR T.p subsp. pertenue co-infection 13.20, 95% CI 1.65-105.80, p = 0.0151).

The proportion of PCR-confirmed yaws cases that were DPP-RDT positive was significantly lower than those that turned out to be PCR negative (11 of 61 [18%] versus

50/61 [82%], OR 23.46, 95% CI 1.35-408.73). The proportion of PCR-confirmed H. ducreyi positives that were either DPP-RDT positive or negative was 16 of 61 (26.2%) and

16 of 51 (31.4%) respectively, (OR 0.78, 95% CI 0.34-1.77, p =0.55).

Table 134: Distribution of T.p subsp. pertenue and H. ducreyi PCR positivity by DPP-RDT

PCR results DPP + (%) n = 61 DPP – (%) n = 51 T.p subsp. pertenue-PCR pos (%) 11/61 (18) 0/0

T.p subsp. pertenue- PCR neg (%) 50/61 (82) 51/51 (100)

H. ducreyi – PCR pos (%) 16/61 (26.2) 16/51 (31.4)

H. ducreyi – PCR neg (%) 45/61 (73.8) 35/51 (68.6)

T.p subsp . pertenue- PCR pos *H. ducreyi –PCR pos (%) 1/61 (1.6) 0/0 DPP-RDT, Dual Path Platform Rapid Diagnostic Test

4.3.2 Detection of azithromycin resistant markers by real-time multiplex PCR

One of the T.p subsp. pertenue-PCR positive samples tested positive for the A2058G point mutation in the 23S rRNA gene, which has previously been associated with macrolide resistance in T.p subsp. pallidum.

4.3.3 PCR amplification of 16S rRNA gene for bacterial identification

The presence of bacterial DNA was investigated using specific primers for 16S rRNA gene. Amplification was achieved for 29 of 30 samples (Figure 15), and all the positive

16S rRNA gene amplicons were subjected to sequencing. Four samples (2, 4, 7, and 11) of the sequenced 16S rRNA gene were identified using BLAST in the NCBI database (Table

15) and the sequences for each organism identified shown in the appendix. Bacterial species Fusobacterium necrophorum subsp. funduliforme, Catonella morbi and

Staphylococcus capitis subsp. capitis in the NCBI database gave the highest similarity scores.

Figure 15: Representative gel of PCR amplicons of the 16S rRNA gene of bacteria producing band sizes between 350bp to 400bp. Amplicons were visualized under UV on 2% agarose gel. M-Molecular weight marker (100 base pairs), P- Positive control, N- Negative control. Lanes labeled with integers represent amplicons from each participant.

Table 145: Blast search results of other potential causative agents of cutaneous lesions Sample Organism Query E-value % Similarity Accession number ID Cover Search

2 Fusobacterium 62% 3e-110 90% NZ_AJSY01000016.1 necrophorum subsp. funduliforme

4 Catonella morbi 71% 2e-145 96% NZ_KI535369.1

7 Staphylococcus 73% 2e-130 93% NZ CP007601.1 capitis subsp. capitis

11 Catonella morbi 77% 1e-121 96% NZ_KI535369.1

CHAPTER FIVE

DISCUSSION

Yaws remains one of the NTDs that cause chronic bacterial infections which without treatment can lead to disability and disfigurement in children. It has become increasingly evident that the disease is prevalent in all the ten regions of Ghana (Kwakye-Maclean et al., 2017). Skin ulcers caused by H. ducreyi clinically mimic the ulcerative form of yaws and complicates its’ clinical diagnosis (WHO, 2017b). In this study, the phenotypic characteristics of CU H. ducreyi strains from yaws-endemic communities in Ghana were investigated.

5.1 Age and gender distribution of study participants

Kazadi et al. (2014) report that majority of clinical cases of yaws are seen in children living in rural communities and aged between 2 and 15 years; thus serve as the reservoir for infections. Also, more males are seen with clinical manifestations of yaws than females with the justification being that boys are more active than girls and so suffer more traumas. A recent report from Ghana by Kwakye-Maclean et al. (2017) shows a study population of a majority of 70% males than females being 30%, mean aged 9.5 years (SD:

3.1, range:1 to 15 years). Recent reports on NTDs stated peak age for yaws infections in children is from 2 to 15 years and male to female ratio of 1.5: 1 (Mitja et al., 2017).

Cutaneous H. ducreyi infections have also been found in children aged between 5 to 17 years and commonly among males (Ghinai et al., 2015; Marks et al., 2014; Mitja et al.,

2014). It was observed in this study (Table 12) that more males than females had clinically suspected yaws-like skin ulcerations, which could be attributed to boys being more active than girls and possibly suffer more traumas as has been reported by Kazadi et al. (2014).

The highest number of clinically suspected yaws-like skin ulcerations seen in children aged 8 to 11 years does not necessarily imply that the majority of skin ulcerations are seen in children in this age group. However, the ages of participants presented in this study fall within the age ranges of children reported in other studies infected with either H. ducreyi or yaws. So long as children aged below 15years are active, they will continue to serve as reservoirs for bacterial-causing tropical ulcerations; hence the need to explore the possibilities of targeting them for appropriate therapeutic interventions.

5.2 Clinical presentation and serological analysis of active skin ulcers

Clinical manifestations of yaws infections are diverse or may be totally unspecific (Mitja et al., 2011), and patients may present with a mixture of clinical signs (Marks et al., 2015).

In this study, skin conditions that were clinically consistent with yaws (Figure 9) were documented and only two participants had an additional clinical sign. Clinical diagnosis for the majority of the participants who had clinical apparent lesions was unspecific for either Yaws or H. ducreyi and in such cases was confirmed by molecular analysis. This study agrees with the fact that, not being familiar with the disease will likely lead to underreporting or over-reporting yaws unless the diagnosis is confirmed by laboratory techniques (Mitja et al., 2013).

In every district visited, lesions were the majority of skin conditions found. Some of the participants might have been untreated individuals of yaws infections with reactive serological tests but no clinical signs (Marks et al., 2015) and might have generally suffered trauma in their daily active activities at school, playgrounds or homes. The sites of abrasions due to trauma might have been colonized with H. ducreyi DNA and T.p subsp. pertenue DNA from flies. The possibilities that flies could be involved in the

71 transmission of either yaws or H. ducreyi or both would not be ruled out since there is evidence that flies carry H. ducreyi DNA and T.p subsp. pertenue DNA (Houinei et al.,

2017; Knauf et al., 2016), though no such studies have been carried out yet in Ghana.

Serological results from this study (Figure 10), showed a high proportion of 55.7% of the participants being dually reactive for the DPP-RDT test. This is not surprising because similar observations have been found in Solomon Islands that lesions associated with H. ducreyi were found in patients with either negative or positive serologic results for yaws.

It is also probable that participants with positive serological results represent latent yaws infections with a different etiologic agent causing the present lesions (Marks et al., 2014).

The location of primary lesions was consistent with documented characteristics of primary lesions as mostly found on the legs and ankles (65–85% of cases), but may occur on the face, arms, hands, and buttocks (Mitja et al., 2011). Hyperkeratotic cases were found on the soles of the feet of participants as described earlier (Giacani & Lukehart, 2014; Marks et al., 2015; Marks et al., 2015; Mitja et al., 2011). No tertiary yaws cases were found and this is in agreement with a review on yaws that tertiary yaws cases are rarely seen in this modern era (Marks et al., 2015). The location of cutaneous H. ducreyi infections from the first case report to surveys conducted (Gonzalez-Beiras et al., 2016) till date has been similar and in this study were found on the legs of patients. The evidence is shown from the representative images of lesions (Figure 11 and Figure 12) that no clear-cut clinical diagnosis could be made and that serologic outcome was not suggestive of PCR outcomes.

A differential rapid diagnostic test may be required for confirmation of clinical diagnosis of all cutaneous ulcers. This study suggests that for routine purposes, diagnosis of yaws should encompass a cocktail of clinical manifestations, rapid serologic tests, and a

72 molecular analysis which includes AZT resistance markers screen, epidemiological and demographic characteristic of yaws.

5.3 Isolation of cutaneous H. ducreyi strains in culture

The laboratory diagnosis of H. ducreyi infections has relied on culture for many years

(Lewis, 2014). Gonzalez-Beiras et al. (2016) indicate that methods that provide acceptable evidence are 1) isolation and identification by culture; or 2) PCR/real-time PCR. In this study, the attempt to isolate H. ducreyi strains from yaws-endemic areas was made. As shown in Figure 13, the endemicity of H. ducreyi infections in each district is shown by the PCR positivity rates with the number of retrievable isolates by culture. The culture isolates could be used for future drug profiling in case of any treatment failures (Lewis,

2000).

Lesion swabs were plated on both chocolatized and C-HgCh medium supplemented with vancomycin (3 mg/ml) to reduce overgrowth of commensal Gram-positive bacteria. The few isolates that were retrieved could be linked to an earlier observation that some clinical

H. ducreyi strains are inhibited at 3mg/ml concentration of vancomycin (Alfa, 2005), which might have led to the missing out of such strains during culture. To isolate class II

H. ducreyi strains extension of incubation beyond the standard 48 hours is required (Alfa,

2005). It is possible that most of the circulating H. ducreyi strains in those communities in the various districts were class II strains and a limitation of the study was the incubation of primary plates were not extended beyond the standard 48 hours. This is because the aim was to first, be able to isolate H. ducreyi strains from Ghana and then conduct further analysis. Agar plates are to be incubated specifically at 33-35°C ideally in a strict anaerobic or microaerophilic environment (Alfa, 2005). It is possible that even though the

73 agar plates were incubated at 33ºC right from the point of plating into a mobile incubator, the temperature might have fluctuated as a result of long-distance travel before reaching the laboratory for the plates to be transferred into a stable temperature set incubator. More so, constant opening of the mobile incubator during sampling might have led to temperature fluctuations which might have resulted in losing a lot of H. ducreyi isolates.

Presumptive identification of H. ducreyi colonies relies upon colony morphology, all the cutaneous H. ducreyi strains isolated in this study had a characteristic feature of being pushed intact across agar surfaces as documented by (Alfa, 2005). The characteristics of cutaneous H. ducreyi strains used in this study have been described and documented in

Figure 14. All cutaneous H. ducreyi strains had similar biochemical characteristics with the genital H. ducreyi strains as described (Lewis, 2000) and shown in Table 13. Except that one cutaneous strain was β-lactamase positive, of which the implications are that, there could be more than one β-lactamase positive H. ducreyi strains circulating in that district or elsewhere that culture isolates could not be retrieved. This is quite disturbing because penicillin is mostly used for empirical treatment of cutaneous ulcers in the tropics

(Gangaiah et al., 2016). Also, since flies have been implicated in carrying H. ducreyi DNA

(Houinei et al., 2017; Knauf et al., 2016), it is likely that such β-lactamase positive H. ducreyi strains could be picked up and transmitted.

5.4 Identification of H. ducreyi DNA and T.p subsp. pertenue DNA

It was expected that in yaws-endemic communities, chronic cutaneous ulcers would be mainly caused by T.p subsp. pertenue. Conversely, the molecular analysis (Table 14) showed that H. ducreyi is causing a lot of the chronic skin ulcerations detectable by PCR as reported previously in PNG and elsewhere (Lewis & Mitja, 2016; Marks et al., 2014;

Mitja et al., 2015; Mitja et al., 2014). Meanwhile, H. ducreyi has long been known to be

74 cause genital ulcers (Albritton, 1989; Morse, 1989) and studies of sequence diversity at 11

H. ducreyi loci, with housekeeping and virulence genes, showed 2 genetically distinct classes evolutionary diverged from each other about 1.95 mya (Gangaiah et al., 2015).

Thereafter, it has been shown that CU strains which have earlier on been shown to have diverged from the class I GU strain have rather diverged from both class I and II GU strains (Gangaiah & Spinola, 2016) which raises the chances that genital ulcer strains are a potential cause of cutaneous ulcers and vice versa (Gangaiah & Spinola, 2016).

At present there is no published data on the prevalence of genital ulcers in Ghana, which does not imply that there are no such infections. More evidence is shown in this study that there is the persistence of H. ducreyi infections in Ghana and supports earlier reports by

Ghinai et al. (2015). To assess the potency of GU strains causing CU ulcers and CU strains causing GU ulcers, there is the need to attempt to obtain both GU and CU H. ducreyi isolates from Ghana and conduct phenotypic and molecular characterization analysis including antimicrobial susceptibility profiles. Dual infections with H. ducreyi and T.p subsp. pertenue has been reported in earlier studies (Mitja et al., 2015; Mitja et al.,

2014). In this study, one participant who was dually infected does not imply that it is less likely to be co-infected with both diseases. Rather, it is being highlighted here that seropositivity plus dual infection with H. ducreyi and T.p subsp. pertenue suggests the possibility of chronic yaws lesions superinfected by H. ducreyi (Mitja et al., 2014). A much larger sample size could have given more evidence of such dual infection incidences. Individuals with seropositive test results with an apparent clinical lesion are presumably diagnosed with yaws. The negative serological result does not indicate the absence of yaws infection. Primary lesions can persist for days to weeks before seroconversion. Instances where non-reactive serology was proven to be Yaws infection

75 by PCR has been reported (Mitja et al., 2014). This study did not report non-reactive serology with T.p subsp. pertenue-PCR positivity; rather it is shown that seropositivity yielded more monoinfection with H. ducreyi confirmed by PCR and more T.p subsp. pertenue-PCR negatives with reactive serology. It is important to note that reactive serology for Treponemal infection can occur for clinical lesions with H. ducreyi alone as concluded by Mitja et al. (2014). It is less likely to also have coincident false-positive non- treponemal tests and Treponemal tests, the patients maybe latently infected with yaws with ulcers caused by H. ducreyi (Mitja et al., 2014) or latently infected with yaws with trauma infected with other bacterial causing tropical ulcers.

AZT resistance has been associated with syphilis; single point mutations (either A2058G or A2059G) in the 23S rRNA gene (Chen et al., 2013; Lukehart et al., 2004; Mitchell et al., 2006; Stamm, 2014). This study reports here for the first time in Ghana, AZT resistance (A2058G) in yaws. The case might be an imported case from a yaws-endemic community where MDA has been previously implemented. Yaw’s cases are usually found in hamlets with bordering communities (WHO, 2017a) and mostly share community schools. As transmission occurs in children at school, home or at play (WHO, 2017a), it is likely that undetected resistant strains might be circulating. Although, typically in yaws- endemic sites populations are usually not exposed to excessive antibiotic usage (Kwakye-

Maclean et al., 2017), active surveillance to monitor the development of AZT resistance is very critical (Roberts & Taylor, 2014). Routine monitoring of AZT resistance should be conducted until transmission of yaws is interrupted.

5.5 Identification of yet unknown organisms as causative agents of cutaneous ulcers

Several studies have indicated unknown causes of cutaneous ulcers in yaws-endemic areas

(Ghinai et al., 2015; González-Beiras et al., 2017; Marks et al., 2014; Mitja et al., 2015;

Mitja et al., 2014) without identifying which organisms could be associated with these cutaneous ulcers.

Clinical diagnosis of primary Yaws is usually confused with anaerobic fusobacteria- related ulcer, cutaneous leishmaniasis, mycobacterial disease, Corynebacterium diphtheriae, or Arcanobacterium haemolyticum skin infections (Mitja et al., 2011). Gram staining techniques have been used to implicate the presence of pathogens such as

Staphylococcus aureus, Fusobacterium fusiforme and Streptococcus pyogenes in tropical ulcers. However, there has not been any reports on cultures or PCR testing for definitive identification of pathogens (Gonzalez-Beiras et al., 2016). The similarity scores following the sequencing of the 16S rRNA gene from this study suggested that Fusobacterium necrophorum subsp. funduliforme, Catonella morbi and Staphylococcus capitis subsp. capitis could be associated with cutaneous ulcers. A traditional diagnostic method such as isolation and identification by culture could have been used to ascertain the prevalence of causative agents of tropical ulcers hence the limitation of the study was that culture was not conducted to give a definitive identification.

CHAPTER SIX

6.1 Conclusion

The colonial appearance of cutaneous H. ducreyi isolates used in this study on Charcoal agar plates was observed to be different from that of the genital H. ducreyi isolate. This phenotypic characteristic could be helpful for future presumptive bacteriological diagnosis of cutaneous ulcer-causing H. ducreyi infections.

Findings from this study indicate that clinical diagnosis of cutaneous ulcers is complicated and provides additional basis to search for other possible causative agents of cutaneous ulcers. This study also warrants the search for a differential rapid test kit for future surveillance activities of chronic skin ulcers. Towards the WHO targeted yaws eradication by 2020, screening of Azithromycin resistance markers should be part of the routine molecular diagnosis of yaws.

6.2 Recommendations

1. It is recommended that studies should be conducted in Ghana to know the

prevalence of both chancroid and cutaneous H. ducreyi infections.

2. Studies should be conducted to ascertain the presence of genital H. ducreyi

infections in HIV1 patients.

3. It is recommended that studies should be conducted to investigate the presence of

H. ducreyi DNA in flies in Ghana.

4. Studies to culture for other possible pathogenic bacteria other than H. ducreyi in

yaws-like lesions.

REFERENCES

Abdullah, M., Nepluev, I., Afonina, G., Ram, S., Rice, P., Cade, W., & Elkins, C. (2005).

Killing of dsrA mutants of Haemophilus ducreyi by normal human serum occurs

via the classical complement pathway and is initiated by immunoglobulin M

binding. Infection and Immunity, 73(6), 3431-3439.

Agana-Nsiire, P., Kaitoo, E., Agongo, E. E. A., Bonsu, G., Kyei-Faried, S., Amponsa-

Achiano, K., Amponsa-Achiano, K., Ahmed, K., Appiah-Denkyira, E., Asiedu, K.,

Amankwa, J., Bonsu, F. A. (2014). Yaws Prevalence, Lessons from the Field and

the Way Forward towards Yaws Eradication in Ghana. International Scholarly

Research Notices, 2014(910937), 7.

Al-Tawfiq, J. A., Thornton, A. C., Katz, B. P., Fortney, K. R., Todd, K. D., Hood, A. F., &

Spinola, S. M. (1998). Standardization of the experimental model of Haemophilus

ducreyi infection in human subjects. The Journal of Infectious Diseases, 178(6),

1684-1687.

Albritton, W. L. (1989). Biology of Haemophilus ducreyi. Microbiology and Molecular

Biology Reviews, 53(4), 377-389.

Alfa, M. (2005). The laboratory diagnosis of Haemophilus ducreyi. Canadian Journal of

Infectious Diseases and Medical Microbiology, 16(1), 31-34.

Alfa, M. J., Olson, N., Degagne, P., Plummer, F., Namaara, W., Maclean, I., & Ronald, A.

R. (1993). Humoral immune response of humans to lipooligosaccharide and outer

membrane proteins of Haemophilus ducreyi. The Journal of Infectious Diseases,

167(5), 1206-1210.

Anselmi, M., Moreira, J.-M., Caicedo, C., Guderian, R., & Tognoni, G. (2003).

Community participation eliminates yaws in Ecuador. Tropical Medicine and

International Health, 8(7), 634-638.

Antal, G. M., Lukehart, S. A., & Meheus, A. Z. (2002). The endemic treponematoses.

Microbes and Infection, 4(1), 83-94.

Asiedu, K. (2008). The return of yaws. Bulletin of the World Health Organization, 86,

507-508.

Asiedu, K., Amouzou, B., Dhariwal, A., Karam, M., Lobo, D., Patnaik, S., & Meheus, A.

(2008). Yaws eradication: past efforts and future perspectives. Bulletin of the

World Health Organization, 86(7), 499-499A.

Ayove, T., Houniei, W., Wangnapi, R., Bieb, S. V., Kazadi, W., Luke, L.-N., Manineng,

C., Moses, P., Paru, R., Esfandiari, J., Alonso, P. L., de Lazzari, E., Bassat, Q.,

Mabey, D., & Mitjà, O. (2014). Sensitivity and specificity of a rapid point-of-care

test for active yaws: a comparative study. The Lancet Global health, 2(7), e415-

e421.

Banks, K. E., Humphreys, T. L., Li, W., Katz, B. P., Wilkes, D. S., & Spinola, S. M.

(2007). Haemophilus ducreyi partially activates human myeloid dendritic cells.

Infection and Immunity, 75(12), 5678-5685.

Barnes, P., & Chauhan, M. (2014). Chancroid - desperate patient makes own diagnosis.

International Journal of STD & AIDS, 25(10), 768-770.

Bauer, M. E., Townsend, C. A., Doster, R. S., Fortney, K. R., Zwickl, B. W., Katz, B.

P.,Spinola, S. M., & Janowicz, D. M. (2009). A fibrinogen-binding lipoprotein

contributes to the virulence of Haemophilus ducreyi in humans. The Journal of

Infectious Diseases, 199(5), 684-692.

Bong, C. T., Throm, R. E., Fortney, K. R., Katz, B. P., Hood, A. F., Elkins, C., & Spinola,

S. M. (2001). DsrA-deficient mutant of Haemophilus ducreyi is impaired in its

ability to infect human volunteers. Infection and Immunity, 69(3), 1488-1491.

Bong, C. T. H., Bauer, M. E., & Spinola, S. M. (2002). Haemophilus ducreyi: clinical

features, epidemiology, and prospects for disease control. Microbes and Infection,

4(11), 1141-1148.

Cejková, D., Zobaníková, M., Chen, L., Pospíšilová, P., Strouhal, M., Qin, X., Mikalová,

L., Norris, S. J., Muzny, D. M., Gibbs, R. A., Fulton, L. L., Sodergren, E.,

Weinstock, G. M., & Smajs, D. (2012). Whole genome sequences of three

Treponema pallidum ssp. pertenue strains: yaws and syphilis treponemes differ in

less than 0.2% of the genome sequence. PLoS Neglected Tropical Diseases, 6(1),

e1471.

Centurion-Lara, A., Molini, B. J., Godornes, C., Sun, E., Hevner, K., Van Voorhis, W. C.,

& Lukehart, S. A. (2006). Molecular differentiation of Treponema pallidum

subspecies. Journal of Clinical Microbiology, 44(9), 3377-3380.

Cheesbrough, M. (1991). District Laboratory Practice in Tropical Countries (2nd ed.).

New York, NY: Cambridge University Press.

Chen, C.-Y., Chi, K.-H., Pillay, A., Nachamkin, E., Su, J. R., & Ballard, R. C. (2013).

Detection of the A2058G and A2059G 23S rRNA gene point mutations associated

with azithromycin resistance in Treponema pallidum by use of a TaqMan real-time

multiplex PCR assay. Journal of Clinical Microbiology, 51(3), 908-913.

Chen, C. Y., Ballard, R. C., Beck-Sague, C. M., Dangor, Y., Radebe, F., Schmid, S.,

Weiss, J, B., Tshabalala, V., Fehler, G., Htun, Y., & Morse, S. A. (2000). Human

immunodeficiency virus infection and genital ulcer disease in South Africa: the

herpetic connection. Journal of the American Sexually Transmitted Diseases

Association, 27(1), 21-29.

Chen, X.-S., Yin, Y.-P., Wei, W.-H., Wang, H.-C., Peng, R.-R., Zheng, H.-P., Zhang, J-P.,

Zhu, B-Y., Liu, Q-Z., & Huang, S.-J. (2013). High prevalence of azithromycin

resistance to Treponema pallidum in geographically different areas in China.

Clinical Microbiology and Infection, 19(10), 975-979.

Chi, K.-H., Danavall, D., Taleo, F., Pillay, A., Ye, T., Nachamkin, E., Kool, J. L., Fegan,

D., Asiedu, K., Vestergaard, L. S., Ballard, R. C., & Chen, C.-Y. (2015).

Molecular differentiation of Treponema pallidum subspecies in skin ulceration

clinically suspected as yaws in Vanuatu using real-time multiplex PCR and

serological methods. The American Journal of Tropical Medicine and Hygiene,

92(1), 134-138.

Cole, L. E., Kawula, T. H., Toffer, K. L., & Elkins, C. (2002). The Haemophilus ducreyi

serum resistance antigen DsrA confers attachment to human keratinocytes.

Infection and Immunity, 70(11), 6158-6165.

Dangor, Y., Ballard, R. C., Miller, S. D., & Koornhof, H. J. (1990). Antimicrobial

susceptibility of Haemophilus ducreyi. Antimicrobial Agents Chemotherapy, 34(7),

1303-1307.

Deng, K., Mock, J. R., Greenberg, S., van Oers, N. S. C., & Hansen, E. J. (2008).

Haemophilus ducreyi LspA proteins are tyrosine phosphorylated by macrophage-

encoded protein tyrosine kinases. Infection and Immunity, 76(10), 4692-4702.

El Tahir, Y., & Skurnik, M. (2001). YadA, the multifaceted Yersinia adhesin.

International Journal of Medical Microbiology, 291(3), 209-218.

Elkins, C., Morrow, K. J., & Olsen, B. (2000). Serum resistance in Haemophilus ducreyi

requires outer membrane protein DsrA. Infection and Immunity, 68(3), 1608-1619.

Fleming, D. T., & Wasserheit, J. N. (1999). From epidemiological synergy to public health

policy and practice: the contribution of other sexually transmitted diseases to

sexual transmission of HIV infection. Sexually Transmitted Infections, 75(1), 3-17.

Fouéré, S., Lassau, F., Rousseau, C., Bagot, M., & Janier, M. (2015). First case of

chancroid in 14 years at the largest STI clinic in Paris, France. International

Journal of STD & AIDS, 27 (9), 1-3.

Galvin, S. R., & Cohen, M. S. (2004). The role of sexually transmitted diseases in HIV

transmission. Nature Reviews Microbiology, 2, 33-42.

Gangaiah, D., Marinov, G. K., Roberts, S. A., Robson, J., & Spinola, S. M. (2016). Draft

Whole-Genome Sequence of Haemophilus ducreyi Strain AUSPNG1, Isolated

from a Cutaneous Ulcer of a Child from Papua New Guinea. American Society for

Microbiology, 4(1) e01661-01615.

Gangaiah, D., & Spinola, S. M. (2016). Haemophilus ducreyi Cutaneous Ulcer Strains

Diverged from Both Class I and Class II Genital Ulcer Strains: Implications for

Epidemiological Studies. PLoS Neglected Tropical Diseases, 10(12), e0005259.

Gangaiah, D., Webb, K. M., Humphreys, T. L., Fortney, K. R., Toh, E., Tai, A., Katz, S.

S., Pillay, A., Chen, C-Y., Roberts, S. A., Munson, R. S., &. Spinola, S. M. (2015).

Haemophilus ducreyi Cutaneous Ulcer Strains Are Nearly Identical to Class I

Genital Ulcer Strains. PLoS Neglected Tropical Diseases, 9(7), e0003918.

Gaston, J. R., Roberts, S. A., & Humphreys, T. L. (2015). Molecular phylogenetic analysis

of non-sexually transmitted strains of Haemophilus ducreyi. PLoS Neglected

Tropical Diseases, 10(3), e0118613.

Ghinai, R., El-Duah, P., Chi, K. H., Pillay, A., Solomon, A. W., Bailey, R. L., Agana, N.,

Mabey, D. C. W., Chen, C-Y., Adu-Sarkodie, Y., & Marks, M. (2015). A cross-

sectional study of 'yaws' in districts of Ghana which have previously undertaken

azithromycin mass drug administration for trachoma control. PLoS Neglected

Tropical Diseases, 9(1), e0003496.

Giacani, L., Brandt, S. L., Puray-Chavez, M., Reid, T. B., Godornes, C., Molini, B. J.,

Benzler, M., Hartig, J. S., Lukehart, S. A., & Centurion-Lara, A. (2012).

Comparative investigation of the genomic regions involved in antigenic variation

of the TprK antigen among treponemal species, subspecies, and strains. Journal of

Bacteriology, 194(16), 4208-4225.

Giacani, L., & Lukehart, S. A. (2014). The endemic treponematoses. Clinical

Microbiology Reviews, 27(1), 89-115.

González-Beiras, C., Kapa, A., Vall Mayans, M., Paru, R., Gavilán, S., Houinei, W., Bieb,

S., Sanz, Martíns, R., & Mitjà, O. (2017). Single dose azithromycin for the

treatment of Haemophilus ducreyi skin ulcers in Papua New Guinea. Clinical

Infectious Diseases, 65(4), cis723.

Gonzalez-Beiras, C., Marks, M., Chen, C. Y., Roberts, S., & Mitjà, O. (2016).

Epidemiology of Haemophilus ducreyi Infections. Emergiong Infectious Diseases,

22(1), 1-8.

Greisen, K., Loeffelholz, M., Purohit, A., & Leong, D. (1994). PCR primers and probes

for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria

found in cerebrospinal fluid. Journal of Clinical Microbiology, 32, 335-351.

Gu, X. X., Rossau, R., Jannes, G., Ballard, R., Laga, M., & Van Dyck, E. (1998). The rrs

(16S)-rrl (23S) ribosomal intergenic spacer region as a target for the detection of

Haemophilus ducreyi by a heminested-PCR assay. Microbiology, 144(4), 1013-

1019.

Haag, A. M., Taylor, S. N., Johnston, K. H., & Cole, R. B. (1998). Rapid identification

and speciation of Haemophilus bacteria by matrix-assisted laser

desorption/ionization time-of-flight mass spectrometry. Journal of Mass

Spectrometry, 33(8), 750-756.

Hammond, G. W. (1996). A history of the detection of Haemophilus ducreyi, 1889-1979.

Journal of the American Sexually Transmitted Diseases Association, 23(2), 93-96.

Harper, K. N., Ocampo, P. S., Steiner, B. M., George, R. W., Silverman, M. S., Bolotin,

S., Pillay, A., Saunders, N. J., & Armelagos, G. J. (2008). On the origin of the

treponematoses: a phylogenetic approach. PLoS Neglected Tropical Diseases, 2(1),

e148.

Hassan, I., Anwar, P., Rather, S., Sameem, F., Majid, I., Jabeen, Y., Mubashir, S., Nisa,

N., & Masood, Q. (2015). Pattern of sexually transmitted infections in a Muslim

majority region of North India. Indian Journal of Sexually Transmitted Diseases

and AIDS, 36(1), 30-34.

Houinei, W., Godornes, C., Kapa, A., Knauf, S., Mooring, E. Q., Gonza´lez-Beiras, C.,

Watup, R., Paru, R., Advent, P., Bieb, S., Sanz, S., Bassat, Q., Spinola, S. M.,

Lukehart, S. A., & Mitjà, O. (2017). Haemophilus ducreyi DNA is detectable on

the skin of asymptomatic children, flies and fomites in villages of Papua New

Guinea. PLoS Neglected Tropical Diseases, 11(5), e0004958.

Humphrey, S., Romney, M., & Au, S. (2007). Haemophilus ducreyi leg ulceration in a 5-

year-old boy. Journal of the American Academy of Dermatology, 56(2), AB121.

Janowicz, D. M., Li, W., & Bauer, M. E. (2010). Host-pathogen interplay of Haemophilus

ducreyi. Current Opinion in Infectious Diseases, 23(1), 64-69.

Janowicz, D. M., Ofner, S., Katz, B. P., & Spinola, S. M. (2009). Experimental infection

of human volunteers with Haemophilus ducreyi: fifteen years of clinical data and

experience. The Journal of Infectious Diseases, 199(11), 1671-1679.

Jenssen, H., Hamill, P., & Hancock, R. E. W. (2006). Peptide antimicrobial agents.

Clinical Microbiology Reviews, 19(3), 491-511.

Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., & Madden, T. L.

(2008). NCBI BLAST: a better web interface. Nucleic Acids Research, 36(2), W5-

W9.

Johnson, S. R., Martin, D. H., Cammarata, C., & Morse, S. A. (1994). Development of a

polymerase chain reaction assay for the detection of Haemophilus ducreyi. Journal

of the American Sexually Transmitted Diseases Association, 21(1), 13-23.

Kazadi, W. M., Asiedu, K. B., Agana, N., & Mitjà, O. (2014). Epidemiology of yaws: an

update. Clinical Epidemiology, 6, 119-128.

Kimani, J., Bwayo, J. J., Anzala, A. O., MacLean, I., Mwatha, A., Choudri, S. H.,

Plummer, F. A., & Ronald, A. R. (1995). Low dose erythromycin regimen for the

treatment of chancroid. East African Medical Journal, 72(10), 645-648.

Knauf, S., Raphael, J., Mitjà, O., Lejora, I. A. V., Chuma, I. S., Batamuzi, E. K., Keyyu, J.

D., Fyumagwa, R., Lüert, S., Godornes, C., Liu, H., Schwarz, C., Šmajs, D.,

Grange, P., Zinner, D., Roos, C., & Lukehart, S. A. (2016). Isolation of Treponema

DNA from Necrophagous Flies in a Natural Ecosystem. EBioMedicine, 11, 85-90.

Korenromp, E. L., de Vlas, S. J., Nagelkerke, N. J., & Habbema, J. D. (2001). Estimating

the magnitude of STD cofactor effects on HIV transmission: how well can it be

done? Journal of the American Sexually Transmitted Diseases Association, 28(11),

613-621.

Kositz, C., Butcher, R., & Marks, M. (2017). New Diagnostics for Yaws. The American

Journal of Tropical Medicine and Hygiene, 96(1), 3-4.

Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics

Analysis version 7.0 for bigger datasets. Molecular biology and evolution, 33(7),

1870-1874.

Kwakye-Maclean, C., Agana, N., Gyapong, J., Nortey, P., Adu-Sarkodie, Y., Aryee, E.,

Asiedu, K., Ballard, R., & Binka, F. (2017). A Single Dose Oral Azithromycin

versus Intramuscular Benzathine Penicillin for the Treatment of Yaws-A

Randomized Non Inferiority Trial in Ghana. PLoS Neglected Tropical Diseases,

11(1), e0005154.

Lagergård, T. (1995). Haemophilus ducreyi: pathogenesis and protective immunity.

Trends in Microbiology, 3(3), 87-92.

Lagergård, T., Frisk, A., & Trollfors, B. (1996). Comparison of the Etest with agar

dilution for antimicrobial susceptibility testing of Haemophilus ducreyi. Journal of

Antimicrobial Chemotherapy, 38(5), 849-852.

Leduc, I., Olsen, B., & Elkins, C. (2009). Localization of the Domains of the Haemophilus

ducreyi Trimeric Autotransporter DsrA Involved in Serum Resistance and Binding

to the Extracellular Matrix Proteins Fibronectin and Vitronectin. Infection and

Immunity, 77(2), 657-666.

Leduc, I., White, C. D., Nepluev, I., Throm, R. E., Spinola, S. M., & Elkins, C. (2008).

Outer membrane protein DsrA is the major fibronectin-binding determinant of

Haemophilus ducreyi. Infection and Immunity, 76(4), 1608-1616.

Lewis, D. A. (2000). Diagnostic tests for chancroid. Sexually Transmitted Infections,

76(2), 137-141.

Lewis, D. A. (2003). Chancroid: clinical manifestations, diagnosis, and management.

Sexually Transmitted Infections, 79(1), 68-71.

Lewis, D. A. (2014). Epidemiology, clinical features, diagnosis and treatment of

Haemophilus ducreyi – a disappearing pathogen? Expert Review of Anti-Infective

Therapy, 12(6), 687-696.

Lewis, D. A., & Mitja, O. (2016). Haemophilus ducreyi: from sexually transmitted

infection to skin ulcer pathogen. Current Opinion in Infectious Diseases, 29(1), 52-

57.

Li, W., Janowicz, D. M., Fortney, K. R., Katz, B. P., & Spinola, S. M. (2009). Mechanism

of human natural killer cell activation by Haemophilus ducreyi. The Journal of

Infectious Diseases, 200(4), 590-598.

Lukehart, S. A., Baker-Zander, S. A., & Sell, S. (1980). Characterization of lymphocyte

responsiveness in early experimental syphilis. I. In vitro response to mitogens and

Treponema pallidum antigens. The Journal of Immunology, 124(1), 454-460.

Lukehart, S. A., Godornes, C., Molini, B. J., Sonnett, P., Hopkins, S., Mulcahy, F.,

Engelman, J., Mitchell, S. J., Rompalo, A. M., Marra, C. M., & Klausner, J. D.

(2004). Macrolide resistance in Treponema pallidum in the United States and

Ireland. New England Journal of Medicine, 351, 154-158.

Mackay, I. M., Harnett, G., Jeoffreys, N., Bastian, I., Sriprakash, K. S., Siebert, D., &

Sloots, T. P. (2006). Detection and discrimination of herpes simplex viruses,

Haemophilus ducreyi, Treponema pallidum, and Calymmatobacterium (Klebsiella)

granulomatis from genital ulcers. Clinical Infectious Diseases, 42(10), 1431-1438.

Marckmann, P., Højbjerg, T., von Eyben, F. E., & Christensen, I. (1989). Imported pedal

chancroid: case report. Sexually Transmitted Infections, 65(2), 126-127.

Marks, M. (2016). Yaws: towards the WHO eradication target. Transactions of the Royal

Society of Tropical Medicine and Hygiene, 110(6), 319-320.

Marks, M., Chi, K. H., Vahi, V., Pillay, A., Sokana, O., Pavluck, A., Mabey, D. C., Chen,

C. Y., & Solomon, A. W. (2014). Haemophilus ducreyi associated with skin ulcers

among children, Solomon Islands. Emerging Infectious Diseases, 20(10), 1705-

1707.

Marks, M., Goncalves, A., Vahi, V., Sokana, O., Puiahi, E., Zhang, Z., Dalipanda, T.,

Bottomley, C., Mabey, D., & Solomon, A. W. (2014). Evaluation of a rapid

diagnostic test for yaws infection in a community surveillance setting. PLoS

Neglected Tropical Diseases, 8(9), e3156.

Marks, M., Katz, S., Chi, K. H., Vahi, V., Sun, Y., Mabey, D. C., Solomon, A. W., Chen,

C. Y., & Pillay, A. (2015). Failure of PCR to Detect Treponema pallidum ssp.

pertenue DNA in Blood in Latent Yaws. PLoS Neglected Tropical Diseases, 9(6),

e0003905.

Marks, M., Lebari, D., Solomon, A. W., & Higgins, S. P. (2015). Yaws. International

Journal of STD & AIDS, 26(10), 696-703.

Marks, M., Mitjà, O., Bottomley, C., Kwakye, C., Houinei, W., Bauri, M., Adwere, P.,

Abdulai, A. A., Dua, F., Boateng, L., Wangi, J., Ohene, S., Wangnapi*, R.,

Simpson, S. V., Miag, H., Addo, K. K., Basing, L. A., Danavall, D., Chi, K. C.,

Pillay, A., Ballard, R., Solomon, A. W., Chen, C. Y., Bieb, S. V., Sarkodie, Y. A.,

Mabey, D. C. W., &Asiedu, K. (2018). Comparative efficacy of low-dose versus

standard-dose azithromycin for patients with yaws: a randomised non-inferiority

trial in Ghana and Papua New Guinea. Lancet Global Health, 1-10.

Marks, M., Mitja, O., Solomon, A. W., Asiedu, K. B., & Mabey, D. C. (2015). Yaws.

British Medical Bulletin, 113, 91-100.

Marks, M., Solomon, A. W., & Mabey, D. C. (2014). Endemic treponemal diseases.

Transactions of the Royal Society of Tropical Medicine and Hygiene, 108, 601-

607.

Marks, M., Vahi, V., Sokana, O., Chi, K.-H., Puiahi, E., Kilua, G., Pillay, A., Dalipanda,

T., Bottomley, C., Solomon, A. W., & Mabey, D. C. (2015). Impact of Community

Mass Treatment with Azithromycin for Trachoma Elimination on the Prevalence

of Yaws. PLoS Neglected Tropical Diseases, 9(8), e0003988.

Marks, M., Vahi, V., Sokana, O., Puiahi, E., & Pavluck, A. (2015). Mapping the

epidemiology of yaws in the Solomon Islands: a cluster randomized survey. The

American Journal of Tropical Medicine and Hygiene, 92(1), 129-133.

McBride, W. J. H., Hannah, R. C. S., Le Cornec, G. M., & Bletchly, C. (2008). Cutaneous

chancroid in a visitor from Vanuatu. The Australasian Journal of Dermatology,

49(2), 98-99.

Mikalová, L., Strouhal, M., Čejková, D., Zobaníková, M., Pospíšilová, P., Norris, S. J.,

Sodergren, E., Weinstock, G. M., & Šmajs, D. (2010). Genome analysis of

Treponema pallidum subsp. pallidum and subsp. pertenue strains: most of the

genetic differences are localized in six regions. PLoS ONE, 5(12), e15713.

Mitchell, S. J., Engelman, J., Kent, C. K., Lukehart, S. A., Godornes, C., & Klausner, J. D.

(2006). Azithromycin-resistant syphilis infection: San Francisco, California, 2000-

2004. Clinical Infectious Diseases, 42(3), 337-345.

Mitjà, O., Asiedu, K., & Mabey, D. (2013). Yaws. Lancet, 381, 763-773.

Mitjà, O., Hays, R., Ipai, A., Penias, M., Paru, R., Fagaho, D., de Lazzari, E., & Bassat, Q.

(2012). Single-dose azithromycin versus benzathine benzylpenicillin for treatment

of yaws in children in Papua New Guinea: an open-label, non-inferiority,

randomised trial. The Lancet, 379(9813), 342-347.

Mitjà, O., Hays, R., Ipai, A., Wau, B., & Bassat, Q. (2011). Osteoperiostitis in early yaws:

case series and literature review. Clinical Infectious Diseases, 52(6), 771-774.

Mitjà, O., Hays, R., Lelngei, F., Laban, N., Ipai, A., Pakarui, S., & Bassat, Q. (2011).

Challenges in recognition and diagnosis of yaws in children in Papua New Guinea.

The American Journal of Tropical Medicine and Hygiene, 85(1), 113-116.

Mitja, O., Houinei, W., Moses, P., Kapa, A., Paru, R., Hays, R., Lukehart, S., Godornes,

C., Bieb, S. V., Grice, T., Siba, P., Mabey, D., Sanz, S., Alonso, P. L., Asiedu, K.,

& Bassat, Q. (2015). Mass treatment with single-dose azithromycin for yaws. N

Engl J Med, 372(8), 703-710.

Mitja, O., Lukehart, S., & Bassat, Q. (2015). Mass Treatment with Single-Dose

Azithromycin for Yaws. New England Journal of Medicine, 375(11), 1094.

Mitjà, O., Lukehart, S. A., Pokowas, G., Moses, P., Kapa, A., Godornes, C., Robson, J.,

Cherian, S., Houinei, W., Kazadi, W., Siba, P., de Lazzari, E., & Bassat, Q. (2014).

Haemophilus ducreyi as a cause of skin ulcers in children from a yaws-endemic

area of Papua New Guinea: a prospective cohort study. Lancet Global Health, 2(4),

e235-241.

Mitjà, O., Marks, M., Bertran, L., Kollie, K., Argaw, D., Fahal, A. H., Fitzpatrick, C.,

Fuller, L. C., Garcia Izquierdo, B., Hay, R., Ishii, N., Johnson, C., Lazarus, J. V.,

Meka, A., Murdoch, M., Ohene, S-A., Small, P., Steer, A, Tabah, E. N.,

Tiendrebeogo, A., Waller, L., Yotsu, R., Walker, S. L., & Asiedu, K. (2017).

Integrated Control and Management of Neglected Tropical Skin Diseases. PLoS

Neglected Tropical Diseases, 11(1), e0005136.

Mitjà, O., Marks, M., Konan, D. J. P., Ayelo, G., Gonzalez-Beiras, C., Boua, B., Houinei,

W., Kobara, Y., Tabah, E. N., Nsiire, A., Obvala, D., Taleo, F., Djupuri, R.,

Zaixing, Z., Utzinger, J., Vestergaard, L. S., Bassat, Q., & Asiedu, K. (2015).

Global epidemiology of yaws: a systematic review. Lancet Global Health, 3(6),

e324-331.

Morse, S. A. (1989). Chancroid and Haemophilus ducreyi. Clinical Microbiology Reviews,

2(2), 137-157.

Mount, K. L. B., Townsend, C. A., & Bauer, M. E. (2007). Haemophilus ducreyi is

resistant to human antimicrobial peptides. Antimicrobial Agents Chemotherapy,

51(9), 3391-3393.

Mount, K. L. B., Townsend, C. A., Rinker, S. D., Gu, X., Fortney, K. R., Zwickl, B. W.,

Janowicz, D. M., Spinola, S. M., Katz, B. P., & Bauer, M. E. (2010). Haemophilus

ducreyi SapA contributes to cathelicidin resistance and virulence in humans.

Infection and Immunity, 78(3), 1176-1184.

Narain, J. P., Jain, S. K., Bora, D., & Venkatesh, S. (2015). Eradicating successfully yaws

from India: The strategy & global lessons. The Indian Journal of Medical

Research, 141(5), 608-613.

Nørskov-Lauritsen, N. (2014). Classification, identification, and clinical significance of

Haemophilus and Aggregatibacter species with host specificity for humans.

Clinical Microbiology Reviews, 27(2), 214-240.

Orle, K. A., Gates, C. A., Martin, D. H., Body, B. A., & Weiss, J. B. (1996). Simultaneous

PCR detection of Haemophilus ducreyi, Treponema pallidum, and herpes simplex

virus types 1 and 2 from genital ulcers. Journal of Clinical Microbiology, 34(1),

49-54.

Olsen I, Dewhirst F. E., Paster B. J., Busse H-J., 2005. Family I, Pasteurellaceae Pohl

1981, 382VP, p 851-856. In Brenner DJ, Krieg NR, Staley JT, GarrityGM(ed),

Bergey's manual of systematic bacteiology, 2nd ed. volII. The Proteobacteriaceae.

Part B. The Gammaproteobacteria, Springer, New York, NY.

Palmer, K. L., Schnizlein-Bick, C. T., Orazi, A., John, K., Chen, C. Y., Hood, A. F., &

Spinola, S. M. (1998). The immune response to Haemophilus ducreyi resembles a

delayed-type hypersensitivity reaction throughout experimental infection of human

subjects. The Journal of Infectious Diseases, 178(6), 1688-1697.

Parsons, L. M., Waring, A. L., Otido, J., & Shayegani, M. (1995). Laboratory diagnosis of

chancroid using species-specific primers from Haemophilus ducreyi groEL and the

polymerase chain reaction. Diagnostic Microbiology and Infectious Disease, 23(3),

89-98.

Peel, T. N., Bhatti, D., De Boer, J. C., Stratov, I., & Spelman, D. W. (2010). Chronic

cutaneous ulcers secondary to Haemophilus ducreyi infection. The Medical

Journal of Australia, 192(6), 348-350.

Phiri, S., Zadrozny, S., Weiss, H. A., Martinson, F., Nyirenda, N., Chen, C. Y., Miller, W.

C., Cohen, M. S., Mayaud, P., & Hoffman, I. F. (2013). Etiology of genital ulcer

disease and association with HIV infection in Malawi. Journal of the American

Sexually Transmitted Diseases Association, 40(12), 923-928.

Pillay, A., Chen, C.-Y., Reynolds, M. G., Mombouli, J. V., Castro, A. C., Louvouezo, D.,

Steiner, B., & Ballard, R. C. (2011). Laboratory-confirmed case of yaws in a 10-

year-old boy from the Republic of the Congo. Journal of Clinical Microbiology,

49(11), 4013-4015.

Pillay, A., Katz, S. S., Abrams, A. J., Ballard, R. C., Simpson, S. V., Taleo, F., Lahra, M.

M., Batra, D., Rowe, L., Trees, D. L., Asiedu, K., & Chen, C.-Y. (2016). Complete

Genome Sequences of 11 Haemophilus ducreyi Isolates from Children with

Cutaneous Lesions in Vanuatu and Ghana. American Society for Microbiology,

4(4), e00459-00416.

Plummer, F. A., Simonsen, J. N., Cameron, D. W., Ndinya-Achola, J. O., Kreiss, J. K.,

Gakinya, M. N., Waiyaki, P., Cheang, M, Piot, P Ronald, A. R. (1991). Cofactors

in male-female sexual transmission of human immunodeficiency virus type 1. The

Journal of Infectious Diseases, 163(2), 233-239.

Post, D. M. B., & Gibson, B. W. (2007). Proposed second class of Haemophilus ducreyi

strains show altered protein and lipooligosaccharide profiles. Proteomics, 7, 3131-

3142.

Post, D. M. B., Munson, R. S., Baker, B., Zhong, H., Bozue, J. A., & Gibson, B. W.

(2007). Identification of genes involved in the expression of atypical

lipooligosaccharide structures from a second class of Haemophilus ducreyi.

Infection and Immunity, 75(1), 113-121.

Ricotta, E. E., Wang, N., Cutler, R., Lawrence, J. G., & Humphreys, T. L. (2011). Rapid

divergence of two classes of Haemophilus ducreyi. Journal of Bacteriology,

193(12), 2941-2947.

Rinaldi, A. (2008). Yaws: a second (and maybe last?) chance for eradication. PLoS

Neglected Tropical Diseases, 2(8), e275.

Rinaldi, A. (2012). Yaws eradication: facing old problems, raising new hopes. PLoS

Neglected Tropical Diseases, 6(11), e1837.

Roberts, S. A., & Taylor, S. L. (2014). Haemophilus ducreyi: a newly recognised cause of

chronic skin ulceration. Lancet Global Health, 2(4), e187-188.

Roberts, S. A., & Taylor, S. L. (2014). Haemophilus ducreyi: a newly recognised cause of

chronic skin ulceration. Lancet Global Health, 2(4), e187-188.

Scheffler, N. K., Falick, A. M., Hall, S. C., Ray, W. C., Post, D. M., Munson, R. S., &

Gibson, B. W. (2003). Proteome of Haemophilus ducreyi by 2-D SDS-PAGE and

mass spectrometry: strain variation, virulence, and carbohydrate expression.

Journal of Proteome Research, 2(5), 523-533.

Schulte, J. M., Martich, F. A., & Schmid, G. P. (1992). Chancroid in the United States,

1981-1990: evidence for underreporting of cases. Morbidity and Mortality Weekly

Report: Survelliance Summaries, 41(SS-3), 57-61.

Stamm, L. V. (2014). Progress in treatment and diagnosis of yaws: hope for eradication?

Lancet Global Health, 2(7), e369-370.

Stamm, L. V. (2015). Yaws: 110 years after Castellani's discovery of Treponema pallidum

subspecies pertenue. The American Journal of Tropical Medicine and Hygiene,

93(1), 4-6.

Steen, R. (2001). Eradicating chancroid. Bulletin of the World Health Organization, 79(9),

818-826.

Steiner, B. M., Schell, R. F., & Harris, O. N. (1986). The effect of C3 depletion on

resistance of hamsters to infection with the yaws spirochete. Sexually Transmitted

Diseases, 13, 245-250.

Sturm, A. W., & Zanen, H. C. (1984). Characteristics of Haemophilus ducreyi in culture.

Journal of Clinical Microbiology, 19(4), 672-674.

Spinola, S. M., Bauer, M. E., & Munson, R. S. (2002). Immunopathogenesis of

Haemophilus ducreyi infection (Chancroid). Infection and Immunity, 70(4), 1667-

1676.

Suntoke, T. R., Hardick, A., Tobian, A. A. R., Mpoza, B., Laeyendecker, O., Serwadda,

D., Opendi, P., Gaydos, C. A., Gray, R. H., Wawer, M. J., Quinn, T. C., &

Reynolds, S. J. (2009). Evaluation of multiplex real-time PCR for detection of

Haemophilus ducreyi, Treponema pallidum, herpes simplex virus type 1 and 2 in

the diagnosis of genital ulcer disease in the Rakai District, Uganda. Sexually

Transmitted Infections, 85(2), 97-101.

Thornton, A. C., O'Mara, E. M., Sorensen, S. J., Hiltke, T. J., Fortney, K., Katz, B.,

Shoup, R. E., Hood, A. F., & Spinola, S. M. (1998). Prevention of experimental

Haemophilus ducreyi infection: a randomized, controlled clinical trial. The Journal

of Infectious Diseases, 177(6), 1608-1683.

Trees, D. L., & Morse, S. A. (1995). Chancroid and Haemophilus ducreyi: an update.

Clinical Microbiology Reviews, 8(3), 357-375.

Ussher, J. E., Wilson, E., Campanella, S., Taylor, S. L., & Roberts, S. A. (2007).

Haemophilus ducreyi causing chronic skin ulceration in children visiting Samoa.

Clinical Infectious Diseases, 44, e85-87.

Vakevainen, M., Greenberg, S., & Hansen, E. J. (2003). Inhibition of phagocytosis by

Haemophilus ducreyi requires expression of the LspA1 and LspA2 proteins.

Infection and Immunity, 71(10), 5994-6003.

Walker, S. L., & Hay, R. J. (2000). Yaws-a review of the last 50 years. International

Journal of Dermatology, 39, 258-260.

Wasserheit, J. N. (1992). Epidemiological synergy. Interrelationships between human

immunodeficiency virus infection and other sexually transmitted diseases. Journal

of the American Sexually Transmitted Diseases Association, 19, 61-77.

West, B., Wilson, S. M., Changalucha, J., Patel, S., Mayaud, P., Ballard, R. C., & Mabey,

D. (1995). Simplified PCR for detection of Haemophilus ducreyi and diagnosis of

chancroid. Journal of Clinical Microbiology, 33(4), 787-790.

White, C. D., Leduc, I., Olsen, B., Jeter, C., Harris, C., & Elkins, C. (2005). Haemophilus

ducreyi outer membrane determinants, including DsrA, define two clonal

populations. Infection and Immunity, 73(4), 2387-2399.

WHO. (2011). Yaws: A forgotten disease. Retrieved 2017/09/22

http://www.who.int/neglected_diseases/diseases/yaws/en/

WHO. (2017a). Eradication of yaws: a guide for programme managers. Retrieved

2017/10/10 http://apps.who.int/iris

WHO. (2017b). Yaws. Retrieved 22/09/2017

http://www.who.int/mediacentre/factsheets/fs316/en/

Wicher, K., Wicher, V., Abbruscato, F., & Baughn, R. E. (2000). Treponema pallidum

subsp. pertenue displays pathogenic properties different from those of T. pallidum

subsp. pallidum. Infection and Immunity, 68(6), 3219-3225.

Yin, Y.-P., Chen, X.-S., Wei, W.-H., Gong, K.-L., Cao, W.-L., Yong, G., Feng, L., Huang,

S-J., Wang, D-M., Han, Y., Chen, S-C., Mabey, D., & Peeling, R. W. (2013). A

dual point-of-care test shows good performance in simultaneously detecting

nontreponemal and treponemal antibodies in patients with syphilis: a multisite

evaluation study in China. Clinical Infectious Diseases, 56(5), 659-665.

APPENDIX: NUCLEOTIDE SEQUENCES OF THE IDENTIFIED

BACTERIA

1. >170927-049_C01_2_2_16S.ab1 514 (Fusobacterium necrophorum subsp.

funduliforme NZ_AJSY01000016.1)

CCTTTTCCTTTTAGAGTGCGATTCGAACGACTTCCCCCATCACCACCCA

CACCCTCGAAGCCCCTTCCTTACGGTTAGGCCTGCTACTTCAGGTGCAA

CCCACTCTCGGGGGGGGACGGGCGGTGTGTACCACACCCGAGAACGTA

TTCCCCGCAACTTGCTGATTTGCGATTACTAGCGATTCCAACTTCATGT

ACTCGAGTTGCAAAGTACAATCCGAACTAAGAATAGTTTTCTGAGATTT

GCTCCCCCTCGCGGGTTCCCCGCTTTTTGTACCACCCATTGGAGGAGGG

GGGTAGCCCAGGGTATAAGGGGCATGATGACTTGACGCCCCCCCCCCC

TTCCTAAAGTTAAGAGGGGGACCGACCGGATCCCCCCCTTCCTTTTGAT

AGGAGGGGAACCGGCCGCATCCTCCCCTTTCTCCTTATAAAAAGAAAG

GGGGGGGGGAGAGTACCTCTAGGTGGGGGGGAGGGGGGGGGGGGGGG

AGGGTGGGGGATGGCAGAAAAGTATATT

2. >170927-049_G01_4_2_16S.ab1 431 (Catonella morbi NZ_KI535369.1)

TACCGCAGTCACCAGATCTGCCTTCGACGGCTCCTCCCTTGCGCTAGCC

ACTGANTACGGGCATTTCCGACTCCCATGGTGTGACGGGCGGTGTGTAC

AAGACCCGGAAACGTATTCACCGCGACATTCTGATTCGCGATTACTAGC

GATTCCAGCTTCATGTAGTCGAGTTGCAGACTACAATCCGAACTGAGGC

AGCCTTTCTGAGATTTGCTCCGGCTCACGCCTTCGCTTCCCTCTGTAACT

GCCATTGTAGCACGTGTGTAGCCCCGGTCATAAGGGGCATGATGATTTG

ACGTCATCCCCACCTTCCTCCAGTTAGGAGGTGATCCAACCGCATCCCC

CCCTTCCTCCAGTTAGGAGGGGAGGCAACCGCAGGAGTGGATCCCACC

AGAAAGGAGAGAAAGGAAGGAAGGCGGTGGGGGACAGCGC

3. >170927-049_M01_7_2_16S.ab1 443 (Staphylococcus capitis subsp. capitis

NZ CP007601.1)

GGGAATGCAACTGGTATATGACTTCACCGCATCATCTGTCCCACCTTCG

ACGGCTGGCTCCTAAAAGGTACTCCACCGAGTTCGGGTGTTACGAACTC

TCGTGGTGTGACGGGCGGTGTGTACTAGACCCGGGAACGTATTCGCCG

TAGCTTGCTGATCTGGATTACGAGCGATTCCTACTTCATGTAGTCGAGT

TGCAGACTACAATCCGAACTGAGAACAACTTTATGGGATTTGCTTGACC

TCCCGGTCTTACTACCCTTTGTATTGGCCATTGTAGCACGTGTGTAGCC

AAAATCATAAGGGGCATGATGATTTGACGTCATCCCCACCTTCCTCCAG

TAAGGAGGTGGGGATGGGGGGGCTTCACCCCTACAAAAGAGGGGGGG

GGGGGGGTTGGCGGTCTCGTTCTCCCCCCCAAAAAGAAAGAGAGGGTG

GGGGGG

4. >170927-049_E03_11_2_16S.ab1 326 (Catonella morbi NZ_KI535369.1)

GCCGCAGTAACCGCCANTCCTCCCTNNCAAACAAATTAAAANGNGGGN

AGCCACTGACTTCGGTCATTTCAAACANAAATGGTGTGACGGGGGGTG

TGTACAAGACCCGGGAACGTATTCACCGCGACATTCTGATTCGCGATTA

CTAGCGATTCCAGCTTCATGTAGTCGAGTTGCAGACTACAATCCGAACT

GAGGCAGCCTTTCTGAGATTTGCTCCGGCTCACGCCTTCGCTTCCCTCT

GTAACTACCATTGTAGCACGTGTGTAGCCCCAGTCATAAGGGGCATGA

TGATTTGACGTCATCCCCACCTTCCTCCAGTTAAA