Virology 487 (2016) 207–214

Contents lists available at ScienceDirect

Virology

journal homepage: www.elsevier.com/locate/yviro

New species of Torque Teno miniviruses infecting gorillas and chimpanzees$

Kristýna Hrazdilová a,b,n, Eva Slaninková a,c, Kristýna Brožová a,c, David Modrý b,c,e, Roman Vodička d, Vladimír Celer a,b a Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,612 42 Brno, Czech Republic b CEITEC – Central European Institute of Technology, University of Veterinary and Pharmaceutical Sciences Brno,612 42 Brno, Czech Republic c Department of Pathology and Parasitology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,612 42 Brno, Czech Republic d The Prague Zoological Garden, Prague 171 00, Czech Republic e Biology Centre, Institute of Parasitology, Czech Academy of Sciences, Branišovská 31, 37005 České Budějovice, Czech Republic article info abstract

Article history: Anelloviridae family is comprised of small, non-enveloped viruses of various genome lengths, high Received 24 June 2015 sequence diversity, sharing the same genome organization. Infections and co-infections by different Returned to author for revisions genotypes in humans are ubiquitous. Related viruses were described in number of mammalian hosts, but 12 October 2015 very limited data are available from the closest human relatives – great apes and non-human primates. Accepted 15 October 2015 Here we report the 100% prevalence determined by semi-nested PCR from fecal samples of 16 captive Available online 4 November 2015 primate species. Only the Mandrillus sphinx, showed the prevalence only 8%. We describe three new Keywords: species of gorillas' and four new species of chimpanzees' Betatorqueviruses and their co-infections in one Anellovirus individual. This study is also first report and analysis of nearly full length TTMV genomes infecting Torque Teno mini virus gorillas. Our attempts to sequence the complete genomes of anelloviruses from host feces invariably Great apes failed. Broader usage of blood /tissue material is necessary to understand the diversity and interspecies Non-human primates Genome sequence transmission of anelloviruses. & 2015 Elsevier Inc. All rights reserved.

Introduction 1999). Subsequently shorter analogs sharing the same genome organization were described in humans - TTV-like mini virus Despite the 18 years from the first description of anellovirus in (TTMV) (Takahashi et al., 2000) with the genome length of about primate species – humans, very little is known about their origin 2.9 kB and lately torque teno midi virus (TTMDV) with genome and limited data are available from the closest human relatives – length of about 3.2 kb (Jones et al., 2005). great apes and non-human primates. First member of new, cur- All anelloviruses share the genomic organization with three over- rently unassigned family Anelloviridae was described in 1997 in lapping open reading frames (ORF1 to 3) and short GC rich sequence fi Japanese patient with acute post transfusion hepatitis and was in the most conserved untranslated region. The expression pro le of anelloviruses is not fully characterized, but the work of Qiu et al. named human TTV (following the TT initials of index case patient, shows that following transfection of human 293 cells at least 6 TTV lately termed Torque Teno virus) (Nishizawa et al., 1997). TTV is a proteins were produced by alternative splicing of three different small, non-enveloped virus carrying negative, single-stranded mRNAs (Qiu et al., 2005). Further molecular characterization of anel- DNA genome of approximate length of 3.8 kb (Mushahwar et al., loviruses as gene expression and protein functions remains poorly understood.

☆The GenBank accession number for the Cpz1cl1 sequence is KT027935, for the In humans, prevalence up to 100% and dual or triple infection Cpz1cl2 sequence is KT027936, for the Cpz2cl1 sequence is KT027937, for the by different species was published (Hussain et al., 2012; Ninomiya Cpz2cl2 sequence is KT027938, for the GorF sequence is KT027939, for the GorMcl3 et al., 2008; Pinho‐Nascimento and Leite, 2011), however so far sequence is KT027940, and for the GorMcl4 sequence is KT027941. without apparent association with any disease. n Corresponding author at: Department of Infectious Diseases and Microbiology, TTV analogues were first detected in farm animals, New World Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sci- ences, Brno 612 42, Czech Republic. Tel.: þ420 604 214 439. monkeys, macaques and chimpanzees (Cong et al., 2000; Leary et al., E-mail address: [email protected] (K. Hrazdilová). 1999; Okamoto et al., 2000a; Verschoor et al., 1999). Later authors http://dx.doi.org/10.1016/j.virol.2015.10.016 0042-6822/& 2015 Elsevier Inc. All rights reserved. 208 K. Hrazdilová et al. / Virology 487 (2016) 207–214

(Kapusinszky et al., 2015; Thom et al., 2003)confirmed the presence confirmed common co-infection by several annellovirus species in of anelloviruses in great apes other than chimpanzees (gorillas and one individual (Supplementary file 1). orangutans) and Old World monkeys (drills, mandrills, mangabeys The DNA extracted from the whole blood/serum samples of andAfricangreenmonkeys).BesidecomplexworkonChlorocebus fourteen NHPs was also used for the detection of anelloviruses by sabaeus (Kapusinszky et al., 2015), only short parts of genome nested PCR. Except one guereza sample, all other tested DNAs (mostly from conserved untranslated region) from sera samples were were anellovirus positive. Using this DNA as template, the entire detected and analyzed. The reported genome sizes in non-primate genomic sequence of anelloviruses from only 4 samples could be animals are in general smaller than for the human variants ranging amplified by PCR with the further described inverted primers. The from 2019 nt in cats to 2878 nt in pigs (Biagini et al., 2007; Inami strongest PCR signal of anellovirus genome was found to be et al., 2000; Ng et al., 2009b; Okamoto et al., 2002, 2001, 2000a, approx. 2.8–2.9 kb in size (in two gorillas’ and two chimpanzees’ 2000b; Van den Brand et al., 2012). Besides humans, chimpanzees samples), weaker signal was also detected in approx. size of 4 kb in are so far the only reported hosts infected by anelloviruses of various some samples. Remaining nine blood/serum samples did not genome lengths (assigned to genera Alphatorquevirus, Betatorquevirus provide any PCR product in whole genome amplification. The 2.8– and Gammatorquevirus). 2.9 kb PCR product for each sample was molecularly cloned and In this study, we examined presence and determined pre- seven TTV clones (GorF; GorM-cl3 and cl4; CPZ1-cl1 and cl2; and valence of TTV-like viruses in fecal samples of 17different African CPZ2-cl1 and cl2) were sequenced over the entire coding part of primate species in Czech and Slovak zoos. We also described the genome. Missing UTR part between primers was amplified and almost full length genomes of two different species of TTMV co- sequenced for both clones of GorM and one clone of GorF samples infecting wild-born, captive living gorilla male and one captive resulting in first almost complete gorilla infecting anellovirus born gorilla female and also coding sequences from two captive genomes. According to the genome length and phylogenetic ana- born chimpanzees. We reported TTV-like virus infection and pre- lysis ( Fig. 2, Supplementary file 2) all newly described anello- valence in all 17 studied African primate species and first char- viruses infecting gorillas and chimpanzees were classified to the acterized gorilla's analogue of TTMV. The elucidation of host range genus Betatorquevirus. and characterization of genome sequences of TTV-like viruses contribute to understanding of origin, evolution, and interspecies Gorilla TTMV transmission potential of anelloviruses. Anelloviruses infecting gorillas share the common genome length and structure including UTR as most conserved region, GC rich region Results and major ORF (so called ORF1 coding putative capsid protein) spanning 1992 nt, 1995 nt and 2025 nt respectively. The nearly full To establish the prevalence of anelloviruses of captive African length gorillas' TTMV genomes were obtained due to difficulties to non-human primate species in 12 Czech and one Slovak zoos, fecal sequence the GC rich part of anellovirus' genomes. The length of samples were collected. In total 153 samples from 17 different obtained sequences was 2851 nt for GorM cl3, 2856 nt for GorM cl4 species were screened using semi-nested PCR for anellovirus and 2568 nt for GorF, which corresponds to the length of anellovirus detection from which 136 samples were positive. The prevalence minigenomeswihoutGCrichdomaininhumansandotherpri- rates range from 75 to 100% in all tested species (Table 1) with the mates. The three genomes displayed overall organization of anello- only exception of Mandrillus sphinx where only single sample from viruses, with main ORFs in the same orientation; nevertheless they 12 was positive (8.3%). Specificity of PCR reaction was confirmed differed in the number of these major ORFs. by sequencing of 35 randomly chosen amplification products from Transcribed region of the genomes encompassed TATA-box representative primate species. Nucleotide sequence analysis (TATAA) which was recognized 100–160 bp before the start showed high variability out of the primer binding sites and codon of the first ORF and ended by polyadenylation signal (ATAAA) detected 110–120 nt following stop codon of ORF3 pro- Table 1 tein. The complete sequence of GC rich region was not obtained for Anellovirus prevalence in NHP species based on semi-nested PCR targeting the technical reasons. Anyway 40 nt long fragment of GC rich stretch conserved UTR; species in which anelloviruses were described for the first time are identified in GorM cl3 genome had the GC content of 84%. in bold. The largest ORF was 1992 nt, 2025 nt and 1995 nt long in GorM +/all % Prevalence at the cl3, GorM cl4 and GorF respectively. Based on the similarity with genus level other known anelloviruses, ORF1 is most likely coding putative nucleocapsid protein. The similarity of ORF1s is ranging from 53 to Gorilla gorilla 10/10 100.0 65% at nucleotide and from 38 to 54% at amino acid level (Table 2). Pan troglodytes 25/25 100.0 Thercopithecus gelada 5/5 100.0 All of them also contained nuclear localization signals detected by Mandrillus sphinx 1/12 8.3 both cNLS Mapper (Kosugi et al., 2009) and NLStradamus (Nguyen et al., 2009). Arginine rich region at the beginning of ORF1 gene Papio anubis 4/4 100.0 100.0 Papio hamadryas 18/18 100.0 was also found ranging from 22 to 25 arginine residues in first 50 amino acids. Chlorocebus sabaeus 13/13 100.0 ORF2 partially overlapped the ORF1 and resulted in 348 nt (GorM Colobus guereza 10/12 83.3 88.9 cl3 and GorF), and 342 nt (GorM cl4) long reading frames. TTV/CAV- Colobus angolensis 6/6 100.0 common motif WX7HX3CXCX5H described previously (Jazaeri Far- Erythrocebus patas 9/10 90.0 sani et al., 2013; Takahashi et al., 2000), was found in the ORF2 of the Lophocebus aterrimus 4/4 100.0 new gorilla TTMV described here (CX7HX3CXCX5H) at the amino Cercopithecus campbelli 4/4 100.0 87.0 acid positions 25–45 of GorM cl4, 19–39 of GorF and degenerated in Cercopithecus diana 8/9 88.9 one position to the sequence CX7HX3RXCX5H in positions 22–42 of Cercopithecus neglectus 6/8 75.0 Cercopithecus mitis 2/2 100.0 GorM cl3. Finally, ORF3 overlapping with 3' terminus of ORF1 was found Miopithecus ogouensis 5/5 100.0 in GorM cl3 (495 nt) and GorF (504 nt) genomes only. In agree- Macaca sylvanus 6/6 100.0 ment with previously described sequences, in both cases the ORF3 K. Hrazdilová et al. / Virology 487 (2016) 207–214 209

71 160 | CVOS | TTV TATA box 5’TRCACWKMCGAATGGCTGAGTTT 3’ Human-1 GGGTCTACGTCCTC ATATAA GTAAG TACACTTCCGAATGGCTGAGTTT -TCCACGCCCGTCCGCAGCGGTGAAG------CCACGGAGGGA--GATCAC Human-2 ...... A....A ...... C .G...... -...... G...AGA.CA------...... G--AG..CG Human-3 T...... G..G ...... AGCG. .G...... -.T...... AGATC.------.G...C...AG--CGATCG Human-4 T.TC..C.CA.TGA ...... C..C AG.GG.GA...... TA...... -.TTC...... AG..C.------CGAG..C..C..G-CGG.CG Human-5 T...T...A...... C...C .G...... -...... G.A.AG..G------...... CA.CG--....CG CPZ-1 ..A...T.CCGGC...... C..GC .G...... -ATGC...... AC.GAG------GAGG..CT.CCGC-CGA.CG CPZ-3 T...T..T.AAACT ...... C.G.C .G...... -ATGC...... GAGC.T----TGA.GG.A.CCC.A-CGG.CG Macaque ...AAA.G.G-.CA ...... CCG. AG...... -.T.C.C.GA.-A.....GC.A.G.CG--AACCG.G.A.CCT.GTGAG.G.. TTMDV Human .A.A..TTTA.ACT ...... C.... .GT...GA...... -A..C...TA.-A..GT..A.A..CCGGATCGAG.G.A.C.--.GGAGGTCT Human .A..TAC.AAA.CT ...... C ...... GA...... -A..C...TA.-A..GT..A.G..CCGGATCGAG.G.A.C.--.GGAGGTC. CPZ .A..T.CAC.TTCT ...... C...C AG...... T..GC...TT.-A..GT....A.C.C--AACGAG...A.C.--.GGAGAG.. TTMV Human .A.A.ACAC.A-CT ...A.. C...... GA...... -AT...... A.-A..G..AC------GG..ACACCAC.G-TGG..G Human .TTCTACACAA-GT .....G C...... -ATGC....A.-A..A..GA------AG..TCACTTT.G-TGA.TG CPZ .A.C.A.TCAT-CT .....T TC..C .G...... -ATGC...TA.-A..G..A.------AAG.TA.TC.C.G-AC.A.. GorillaM3 T..CT.TTACTTCT ...... C...C ...... GA...... -ATGC....A.-A..G...T.AA..C--AACTAG.G.A.C.T-.GGCGGACT GorillaM4 CAAC.A.ACC--CT ...... C...C ...... A...... -ATGC...TA.-A..G..A.------AA...A.CA.C.G--C.GCG 161 254 | CVIA CVOA | TTV 3’CCCGCCCWCGGCYTCCAC-TC 5’ 3’TCAGWTCCCCGTTAAGCCCGA 5’ Human-1 CGCG---TCCCGA GGGCGGGTGCCGAAGGTG-AG TTTACACACCGA- AGTCAAGGGGCAATTCGGGCT CGGGACTGGCCGG-GCTATGGGCAAGGCTCTG Human-2 ....---.....T ...... -...... - ...... A ...... T..-...... T Human-3 A...---...... G.....-...... C- ...... -...... T Human-4 A...---A....T ...... A...... -...... C- ...... -...... A....T Human-5 AA..---...T...... G.....-...... - ...... A...... -...T...... T CPZ-1 ....TCG...... A..CG.....-...... - G..T...... -...... T CPZ-3 AC..-CG...... A..CG.....-...... - G..T...... -...... T Macaque .T..GCCG....T ...... CG.G.. G..TAC.C...CG ...... A A.-.G.G.T.TC.G.GACC...... TTMDV Human .CG.-CTG...AT ...... A...CG.....-.. .GA.AC...... - G...T...... A.-.G.A.T.TA.C.GA.C...... AAA..T Human .CG.-CTG...A...... A...CG.....-.. .GA.AC...... - G...T...... A.-.G.A.T.TA.C.GA.C...... AAA..T CPZ TC..-CAG.AGCT ...... A....G.....-.. .GA.AC.....T- ....T...... G GC-TG.A.T.TA.C.GA.C...... AAA..T TTMV Human .CG.-CTGAT.TT ...... A...... -.. .GA.AC...... - ....T...... A.-AT.A.T.T..C.GACC...... AAA..T Human .AGA-CTGAT.TT ...... A...... -.. .GA.AC.....T- ....T...... A.-AT.A.T.T..C.GA.C...... AAA..T CPZ TT..-CTGT..CT ...... -.. .GA.AC...... - ...... G.-...A.T.TA.C.GA.C...... AAA..T GorillaM3 TCA.-CTGAG.CT ...... T.T.....-.. .GA.AC...... - ....T...... G.-CGAA.T.T..A.GA.C...... AAA..T GorillaM4 TT..-CTG..AC...... A...-.....-.. .GA.AC.....-- ...... GA-.G.A.T.TA.C.GA.C...... AAA..T

Fig. 1. Sequence alignment showing highly conserved UTR region of anelloviruses of humans (TTVs: AF351132, AF261761, AY823988, AB064599, AJ620228, TTMDVs: AB303561, AB303555; TTMVs: AB038628, AB038629) and nonhuman primates (TTV chimpanzee: AB041957, AB049607, macaque: AB041959; TTMDV chimpanzee: AB449064; TTMV chimpanzee AB041963). Conserved regions and primers locations are indicated in boxes. Dot: sequence identity with prototype TTV sequence; dash: gap introduced. starts by alternative start codon GTG coding valine instead of The arginine rich region was also recognized in three of four iso- standard ATG coding methionine. The carboxy-terminus of this lates in expected extent (22–25R/50 amino acids), CPZ1 cl2 lacks putative protein contains a serine-rich tract (15, respective 14 Ser the first 79 codons (237 nt) compared to cl1 isolated from the from last 18 amino acids) preceded by a cluster of basic amino same animal. acids (R and K) capable of generating different phosphorylation ORF2, partially overlapping 5'end of the ORF1, was detected in all sites (Asabe et al., 2001; Takahashi et al., 2000). Corresponding four isolates in length ranging from 309 to 345 nt. The conserved coding region in GorM cl4 sequence spans only 180 nucleotides motif WX7HX3CXCX5H was found in three isolates (missing in CPZ1 coding for 60 aminoacids. cl2) also in conserved position from 19 to 39 amino acid. ORF3 in chimpanzee isolates is in general shorter (ranging from Chimpanzee TTMV 321 to 393 nt) than in above described gorillas' anelloviruses. Alternative start codon GTG is found in the only isolate CPZ1 cl1, Coding part of the chimpanzee anellovirus genomes was other uses the standard ATG. Serine-rich region preceded by basic sequenced in total of four strains originating from two animals. amino acids is coded in three chimpanzee isolates, its absence in The length of sequenced regions was 2487–2577 nt and three the CPZ2 cl1 might be caused by shortening of ORF1 of this clone. major open reading frames were identified in all of them. The longest ORF, designated as ORF1, corresponds by the length (1773–2007 nt) and relative position to putative nucleocapsid Discussion protein gene identified in anelloviruses with the only exception of CPZ2 cl2 sample where the premature stop codon forms the The anelloviruses in Old World primates (incl. man) are further 1350 nt long ORF thus lacking the C-terminus of coded protein. divided into 3 well defined monophyletic genera (Alphatorquevirus, The similarity of chimpanzees' ORF1s is ranging from 53 to 68% at Betatorquevirus and Gammatorquevirus, Fig. 2) clearly separated from nucleotide level and from 39 to 60% at amino acid level (Table 2). the anelloviruses from other host species; our newly described 210 K. Hrazdilová et al. / Virology 487 (2016) 207–214

Fig. 2. Phylogenetic tree constructed by maximum likelihood method, based on nucleotide sequence of ORF1 coding region. Left part displays overall topologyofAnello- viridae family, human gyrovirus sequences were used as an outgroup; full tree view is included in Supplementary file 2. Right part shows detail of Betatorquevirus genus clade; sequences are labeled by their ncbi accession numbers; those of non-human origin are marked by prefix (CPZ–Pan troglodytes). Newly described TTMVs of gorilla and chimpanzee origin are highlighted in red. Proportion of bootstrap values from 1000 replicates is shown.

Table 2 ORF1 sequence similarities (reverse p-distance) on nucleotide (bold) and amino acid level of newly described gorilla and chimpanzee species and their closest relatives (human TTMVs: AB038629, AB038630; chimpanzee TTMV: AB041963).

GorM cl3 GorM cl4 GorF CPZ1 cl1 CPZ1 cl2 CPZ2 cl1 CPZ2 cl2 AB038629 AB038630 AB041963

GorM cl3 38.1 54.1 32.4 32.8 36.0 37.4 34.5 38.2 35.6 GorM cl4 52.9 38.8 43.5 39.6 48.9 47.0 43.4 42.8 42.4 GorF 64.7 55.6 34.7 35.4 36.8 35.9 35.6 36.8 35.6 CPZ1 cl1 51.1 60.2 53.5 59.6 41.2 42.7 37.6 38.0 42.5 CPZ1 cl2 53.8 60.3 52.2 60.0 38.7 39.0 38.6 35.0 39.3 CPZ2 cl1 51.4 55.8 53.4 55.8 55.3 48.5 42.5 42.1 41.3 CPZ2 cl2 49.6 56.1 53.0 53.7 52.9 67.6 39.2 40.2 47.2 AB038629 52.3 57.9 53.2 54.7 54.1 55.0 53.7 42.9 38.6 AB038630 52.0 58.8 55.0 59.5 56.8 53.5 54.9 59.9 37.7 AB041963 51.4 56.9 50.2 58.3 59.7 58.0 53.7 54.7 56.1

anelloviruses infecting gorillas and chimpanzees were classified to almost 100%, reflecting close contacts between captive animals the genus Betatorquevirus. TTVs have been detected from a broad combined with supposed oro-fecal route of virus transmission range of biological materials (serum or blood, feces, urine, saliva, (Okamoto et al., 1998). The vertical transmission of anelloviruses semen, tears, and milk (Catroxo et al., 2008; Goto et al., 2000; Chan among primates is improbable, given the negative results of et al., 2001; Inami et al., 2000; Osiowy and Sauder, 2000; Saback Ninomiya et al. (2008). Interestingly, low (8%) prevalence was et al., 1999), but invasive sampling of primates represents a challenge recorded in M. sphinx. Almost ubiquitous occurrence of studied for safety and ethical reasons. In most cases, the feces are the only viruses in blood/sera of captive primates examined in our study is samples available. We collected 153 fecal samples from different comparable to published data reaching 80% in chimpanzees, 100% simian species kept in Czech and Slovak zoos. Further 14 blood/ in orangutans, 63% in gibbons, 100% in mandrills and 100% in serum samples were obtained in the course of anesthesia for differ- mangabeys (Thom et al., 2003). ent reasons (transportation, routine health check, wound treatment We identified TT viruses in fecal samples based on amplifica- etc.) of several animals nonrelated with sampling for virus detection. tion of highly conserved UTR part of the virus genome and con- Our data represent the first report about prevalence of anello- firmed the results by sequencing. Several negative samples were viruses in 13 primate species (Table 1) and short sequences of UTR re-assigned as positive after repeated DNA isolation/virus detec- from 11 of these species (Supplementary file 1). The prevalence of tion suggesting the 100% prevalence in all examined primate anelloviruses in feces in most examined primate species reached species with the exception of mandrills. Our attempts to classify K. Hrazdilová et al. / Virology 487 (2016) 207–214 211

Fig. 3. Conserved motif WX7HX3CXCX5H in (A) anellovirus ORF2 sequences (for accession numbers see the Fig. 1 legend); (B) Chicken anemia virus and human gyroviruses; (C) herpesviruses of primate origin (ncbi accession numbers: human HV5 AY446894, panine HV2 AF480884, macacine HV3 NC_006150, macaque cytomegalovirus JN227533, cercopithecine HV5 NC_012783); residues of described conserved motif are shadowed and mark by star, additional conserved residues are in red. 212 K. Hrazdilová et al. / Virology 487 (2016) 207–214 detected viruses based on obtained UTRs failed, as the Blast ana- shows a different degree of conservation especially of the first lysis revealed range of hits with low scores, apparently caused by tryptophan residue in humans' anelloviruses regardless their limited length of sequences and their high variability. genome length. In chimpanzees and gorillas isolates we found Inconclusive results from UTRs sequence analysis and difficul- several other conserved positions in and around the described ties to amplify the whole virus genomes from fecal samples motif (Fig. 3A), but due to limited number of available sequences apparently prohibit further investigation of anelloviruses in fecal we can specify only one more residue in a motif to WX7H(A/D) material. To amplify the whole virus genomes in blood/serum X2CXCX5H for human and great apes anelloviruses. The short- samples from gorillas and chimpanzees we used primers com- ening of ORF3 in one of the gorillas TT virus genomes and the plementary to those for diagnostic purposes and obtained nearly absence of standard ATG start codon was already observed in full virus genomes excluding GC rich region. Similar strategy was several human TTMV isolates and indicate that this virus gene used by Okamoto et al. also on non-human primate samples might be nonfunctional (Biagini et al., 2001). (Okamoto et al., 2000a). Blast analysis, ORF arrangement pattern Our attempts to sequence the complete genomes of anello- and phylogenetic analysis proved that the identified sequences viruses from host feces invariably failed. On the contrary, the belong to anelloviruses and in fact are the first identified in gor- examination of limited set of blood/sera from captive great apes illas. Estimated full size of these genomes (2700–3000 nt for gor- revealed the presence of 7 new TTMV species. Eighteen years after illas' and 2500–2600 nt for chimpanzees' isolates) and phyloge- the description of first human anellovirus, our knowledge on netic analysis suggest their classification to Betatorquevirus genus, diversity of these viruses in primates is extremely limited, which among so called TT mini viruses (Biagini et al., 2001; Takahashi contrasts with almost ubiquitous presence as revealed by detec- et al., 2000). Following the International Committee on Taxonomy tion in feces. Blood samples are routinely collected (and stored) of Viruses (ICTV) guidelines (ICTV, 2013), setting up the para- from captive primates as part of health monitoring and disease meters of new species to be 20–55% divergence in nucleotide diagnostics and also the free ranging primates are occassionally sequence of ORF1, we assign all seven described viruses from sampled. Broader usage of available blood or tissue material offers gorillas and chimpanzees as new species (Table 2). a unique opportunity to study the diversity and interspecies In humans, co-infection of one individual by several different transmission of anelloviruses, as well as their zoonotic potential. species of anelloviruses was described (Ninomiya et al., 2008; Pinho‐Nascimento and Leite, 2011) and seems to be common. Co- infection with at least two species was described also in pigs Materials and methods (Jarosova et al., 2011). Similarly, the co-infection seems to be common in great apes as we describe co-infections with two dif- Samples ferent species of anellovirus in gorillas and chimpanzees based on sequencing separate clones. For GorM individual four clones of A total of 153 fecal samples from 17 different species (Table 1) long range PCR products were sequenced and two different spe- of African primates from Czech and Slovak zoos were collected cies were detected (each twice) suggesting their equal presence in during 2012 and stored in RNAlaters at 20 °C. Two samples of the sample. Analogous situation was with both chimpanzee sam- whole, frozen blood of Cercopithecus campbelli and one sample of ples tested. whole, frozen blood of G. gorilla from Czech zoos were available. The longest ORF identified in gorillas and chimpanzees TTMV Stated gorilla individual is a male, wild born in 1972 in Cameroon genomes share general characteristics of nucleoproteins of many living from approx. the age of one year in captivity in different ssDNA viruses, like size, nuclear localization signal and basic – zoos in Europe, mainly in Czech Republic (Sample GorM). Eleven arginine-rich region present at the N-terminal part of the protein. samples of frozen serum samples obtained during routine exam- Our results support the data of Okamoto et al. (Okamoto et al., ination of animals from different ZOOs were available from three 2000a) describing the shorter arginine-rich region of ORF1 in different gorillas (including sample GorF), two chimpanzees shorter anelloviruses. In TTVs this region span is about 100 amino (samples labeled CPZ1 and CPZ2), three samples of Colobus guer- acids from N-terminus while in TTMVs just about half of this size. eza, one sample of Macaca sylvanus and two samples from Two smaller ORFs (ORF2 and ORF3) are partially overlapping orangutans. ORF1. In six of seven genomes of great apes' anellovirus described in this work, ORF2 coding sequence contains a previously descri- Nucleic acid extraction bed conserved motif WX7HX3CXCX5H (Andreoli et al., 2006; Takahashi et al., 2000). Using ScanProsite online search (De Castro DNA from feces samples was extracted from solid fraction of et al., 2006) the same motif was recognized in all known types of 1.5 ml feces suspension in RNAlaters by PSPs Spin Stool DNA Kit anelloviruses (TTVs, TTMDVs and TTMVs) from all known host (Stratec Molecular, Germany) according to manufacturer's species (humans, pigs, cats, dogs, tamarins, douroucoulis, pine instructions, eluted by total volume of 150 ml of elution buffer. DNA marten, tupaias, seals etc.) and also in recently described, distantly from blood/serum samples was extracted from 100 ml of blood/ related sea turtle tornovirus ORF2 (Ng et al., 2009a)(Fig. 3A). serum diluted by 100 ml of PBS buffer using NucleoSpins Blood kit Besides anelloviruses, this motif was already described in VP2 (Macherey-Nagel, Germany) following manufacturer's instruc- proteins of chicken anemia virus and human gyrovirus (Gia Phan tions, eluted by 2 50 ml of elution buffer. et al., 2013; Phan et al., 2012)(Fig. 3B). The same motif was also recognized in two copies in proteins coded by genes US1, US31 and Anellovirus DNA detection US32 of human herpesvirus 5, macacine herpesvirus 3cynomolgus macaque cytomegalovirus, panine herpesvirus 2 and cercopithe- Primers (CVOS, CVOA, CVIA) as well as PCR conditions for semi- cine herpesvirus 5 (Fig. 3C). In non-viral sequences the motif was nested PCR co-amplifying 95 nt long fragments from UTR of TTVs recognized in two PAS domain containing bacterial proteins and in and/or TTMVs (Fig. 1) were adopted from study of distribution of Drosophila TIL domain containing protein (Marchler-Bauer et al., these viruses in humans and nonhuman primates (Thom et al., 2014). None of these findings give us a clue about possible func- 2003). The universality of primers was tested based on currently tion of the motif because it does not overlap with functional available sequences of primate TTVs, TTMDVs and TTMVs in residues/parts of above mentioned proteins or their function is not database as shown in Fig. 1. Amplification was done by Combi PPP known so far. Detailed analysis of the motif in different ORFs Master Mix (Top-Bio, Czech Republic). PCR products were K. Hrazdilová et al. / Virology 487 (2016) 207–214 213 visualized on a 2% agarose gel stained with GelRedTM (Biotium, Czech Republic [Grant numbers CZ.1.07/2.3.00/20.0300 and Hayward, CA). In order to confirm specificity of PCR reaction, CZ.1.07/2.3.00/30.0014]. randomly chosen amplification products from representative host species were sequenced. Acknowledgments Whole genome amplification This work could not arise without kind cooperation of all 12 To determine the full-length nucleotide sequence of anellovirus Czech and one Slovak ZOOs, namely ZOO Brno, Děčín, Dvůr Krá- genomes, inverted primers to those used for detection were designed. lové, Hodonín, Jihlava, Košice, Lešná, Liberec, Olomouc, Ostrava, Amplification was done using LA DNA polymerases mix (Top-Bio, Plzeň, Praha, and Ústí nad Labem graciously coordinated by CzechRepublic).Inthefirst round of the PCR (in total volume of 25 ml), Dr. Klára J. Petrželková. 1 ml of blood extracted DNA was amplified using primers CVOSrc and CVIArc (CVOSrc 5ʹ-AAACTCAGCCATTCGKMWGTGYA-3ʹ,CVIArc5ʹ- ʹ GGGCGGGWGCCGRAGGTGAG-3 ). One microliter of this reaction was Appendix A. Supplementary material carried over to a second round and amplified using primers CVOSrc ʹ ʹ fi and CVOArc (CVOArc 5 -AGTCWAGGGGCAATTCGGGCT-3 ). Ampli ca- Supplementary data associated with this article can be found in ° ° ° tion conditions were 94 C/20 s, 52 C/30 s, and 68 C/5 min for 30 the online version at http://dx.doi.org/10.1016/j.virol.2015.10.016. cycles, with an additional 10 min extension at 68 °C. To amplify missing sequence in between CVOSrc and CVOArc, specific primers for each isolate were designed, and used for the first round of the PCR, the References second round was performed using CVOS and CVOA primers. Ampli- fication was done by Combi PPP Master Mix (Top-Bio, Czech Republic) ° ° ° Andreoli, E., Maggi, F., Pistello, M., Meschi, S., Vatteroni, M., Nelli, L.C., Bendinelli, M., under conditions 95 C/30 s, 50 C/20, 72 C/45 s for 30 cycles, with 2006. Small Anellovirus in hepatitis C patients and healthy controls. Emerg. additional 5 min extension at 72 °C. PCR products were visualized on a Infect. Dis. 12, 1175–1176. http://dx.doi.org/10.3201/eid1207.060234. 1% agarose gel stained by GelRedTM. Asabe, S., Nishizawa, T., Iwanari, H., Okamoto, H., 2001. Phosphorylation of serine- rich protein encoded by open reading frame 3 of the TT virus genome. Biochem. Biophys. Res. Commun. 286, 298–304. http://dx.doi.org/10.1006/ Molecular cloning and sequencing of TTV and TTMV DNA bbrc.2001.5385. Biagini, P., Gallian, P., Attoui, H., Touinssi, M., Cantaloube, J., de Micco, P., de Lam- ballerie, X., 2001. Genetic analysis of full-length genomes and subgenomic PCR products chosen for sequencing were cut out of the gel, – fi sequences of TT virus-like mini virus human isolates. J. Gen. Virol. 82, 379 383. puri ed using QIAquick Gel Extraction Kit (Qiagen, Germany), Biagini, P., Uch, R., Belhouchet, M., Attoui, H., Cantaloube, J.-F., Brisbarre, N., de ligated into pGEM-T Easy Vector (Promega Corp., Madison, WI) Micco, P., 2007. Circular genomes related to anelloviruses identified in human and cloned according to manufacturer´s instructions. Plasmid DNA and animal samples by using combined rolling-circle amplification/sequence- – fi ™ independent single primer approach. J. Gen. Virol. 88, 3 4. http://dx.doi.org/ was puri ed by GenElute Plasmid Miniprep Kit (Sigma-Aldrich, 10.1099/vir.0.83071-0. St.Louis, MO). Cloned DNA was sequenced by Macrogen capillary Catroxo, M.H.B., Nishiya, a, Sabino, E., Teixeira, P.S., Petrella, S., Milanelo, L., Vieira, J. sequencing services (Macrogen Europe, The Netherlands) using C., Diaz, R.S., 2008. Research of Torque teno virus (TTV) in serum and total fi blood of Brazilian non-human primates and in chicken plasma (Gallus gallus primers speci c to T7promoter and/or SP6 promoter vector domesticus) by the PCR N22 region. Int. J. Morphol. 26, 377–384. http://dx.doi. sequences. For sequencing of the whole genome of gorilla TTMV, org/10.4067/S0717-95022008000200020. internal primers for sequencing were designed using primer Cong, M.E., Nichols, B., Dou, X.G., Spelbring, J.E., Krawczynski, K., Fields, H. a, Khudyakov, Y.E., 2000. Related TT viruses in chimpanzees. Virology 274, walking approach. 343–355. http://dx.doi.org/10.1006/viro.2000.0471. De Castro, E., Sigrist, C.J. a, Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S., Analysis of nucleotide and amino acid sequences Gasteiger, E., Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins. Nucl. Acids Res. 34, 362–365. http://dx.doi.org/10.1093/nar/gkl124. Sequence analysis was performed by CLC Sequence viewer Felsenstein, J., 1981. Evolutionary trees from DNA sequences: a maximum like- (Qiagen, Germany). Multiple sequence alignment of UTRs was lihood approach. J. Mol. Evol. 17, 368–376. fi performed by Clustal W (Larkin et al., 2007). Multiple sequence Felsenstein, J., 1985. Con dence limits on phylogenies: an approach using the bootstrap. Evolution (N.Y.) 39, 783–791. alignments of ORF1 were generated by Clustal Omega (McWilliam Gia Phan, T., Phung Vo, N., Sdiri-Loulizi, K., Aouni, M., Pothier, P., Ambert-Balay, K., et al., 2013), p-distances were computed using PAUP software Deng, X., Delwart, E., 2013. Divergent gyroviruses in the feces of Tunisian version 4b.10 (Swofford, 2003). Best evolution model was chosen children. Virology 446, 346–348. http://dx.doi.org/10.1016/j.virol.2013.08.020. Goto, K., Sugiyama, K., Ando, T., Mizutani, F., Terabe, K., Tanaka, K., Nishiyama, M., based on Akaike information criterion computed by R software (R Wada, Y., 2000. Detection rates of TT virus DNA in serum of umbilical cord Development Core Team, 2008) and phylogenetic trees were blood, breast milk and saliva. Tohoku J. Exp. Med. 191, 203–207. constructed by the maximum likelihood method (Felsenstein, Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New algorithms and methods to estimate maximum-likelihood phylogenies: 1981) using GTR model considering a fraction of nucleotides to be assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. http://dx.doi. invariable (þI), and assigning each site a probability to belong to org/10.1093/sysbio/syq010. given rate categories (þG) by PhyML 3.0 software (Guindon et al., Hussain, T., Manzoor, S., Waheed, Y., Tariq, H., Hanif, K., 2012. Phylogenetic analysis of Torque Teno virus genome from Pakistani isolate and incidence of co- 2010). The reliability of the phylogenetic results was assessed infection among HBV/HCV infected patients. Virol. J. 9, 1. http://dx.doi.org/ using 1000 bootstrap replicates (Felsenstein, 1985). 10.1186/1743-422X-9-320. Chan, P.K., Tam, W.H., Yeo, W., Cheung, J.L., Zhong, S., Cheng, A.F., 2001. High car- riage rate of TT virus in the cervices of pregnant women. Clin. Infect. Dis. 32, 1376–1377. http://dx.doi.org/10.1097/00006454-200109000-00023. Funding ICTV [WWW Document], 2013. URL 〈http://ictvonline.org/virusTaxonomy.asp〉. Inami, T., Obara, T., Moriyama, M., Arakawa, Y., Abe, K., 2000. Full-length nucleotide This work was supported by project of Internal Grant Agency of sequence of a simian TT virus isolate obtained from a chimpanzee: evidence for a new TT virus-like species. Virology 277, 330–335. http://dx.doi.org/10.1006/ University of Veterinary and Pharmaceutical Sciences Brno [Grant viro.2000.0621. number IGA VFU 42/2013/FVL]; by the project "CEITEC – Central Jarosova, V., Pogranichniy, R., Celer, V., 2011. Prevalence and age distribution of European Institute of Technology" [Grant number CZ.1.05/1.100/ porcine torque teno sus virus (TTSuV) in the Czech Republic. Folia Microbiol. (Praha) 56, 90–94. http://dx.doi.org/10.1007/s12223-011-0030-4. 02.0068] from European Regional Development Fund and further Jazaeri Farsani, S.M., Jebbink, M.F., Deijs, M., Canuti, M., van Dort, K.A., Bakker, M., co-financed from European Social Fund and State Budget of the Grady, B.P.X., Prins, M., van Hemert, F.J., Kootstra, N.A, van der Hoek, L., 2013. 214 K. Hrazdilová et al. / Virology 487 (2016) 207–214

Identification of a new genotype of Torque Teno mini virus. Virol. J. 10, 323. Okamoto, H., Akahane, Y., Ukita, M., Fukuda, M., Tsuda, F., Miyakawa, Y., Mayumi, http://dx.doi.org/10.1186/1743-422X-10-323. M., 1998. Fecal excretion of a nonenveloped DNA virus (TTV) associated with Jones, M., Kapoor, A., Lukashov, V.V., Simmonds, P., Hecht, F., Delwart, E., 2005. New posttransfusion non-A-G hepatitis. J. Med. Virol. 56, 128–132. DNA viruses identified in patients with acute viral infection syndrome. J. Virol. Okamoto, H., Fukuda, M., Tawara, a, Nishizawa, T., Itoh, Y., Hayasaka, I., Tsuda, F., 79, 8230–8236. http://dx.doi.org/10.1128/JVI.79.13.8230. Tanaka, T., Miyakawa, Y., Mayumi, M., 2000a. Species-specific TT viruses and Kapusinszky, B., Mulvaney, U., Jasinska, A.J., Deng, X., Freimer, N., Delwart, E., 2015. cross-species infection in nonhuman primates. J. Virol. 74, 1132–1139. Local virus extinctions following a host population bottleneck. J. Virol. 89, Okamoto, H., Nishizawa, T., Takahashi, M., Tawara, A., Peng, Y., Kishimoto, J., Wang, 8152–8161. http://dx.doi.org/10.1128/JVI.00671-15. Y., 2001. Genomic and evolutionary characterization of TT virus (TTV) in tupaias Kosugi, S., Hasebe, M., Tomita, M., Yanagawa, H., 2009. Systematic identification of and comparison with species-specific TTVs in humans and non-human pri- cell cycle-dependent yeast nucleocytoplasmic shuttling proteins by prediction mates. J. Gen. Virol. 82, 2041–2050. of composite motifs. Proc. Natl. Acad. Sci. USA 106, 10171–10176. http://dx.doi. Okamoto, H., Nishizawa, T., Tawara, a, Peng, Y., Takahashi, M., Kishimoto, J., Tanaka, org/10.1073/pnas.0900604106. T., Miyakawa, Y., Mayumi, M., 2000b. Species-specific TT viruses in humans and Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, nonhuman primates and their phylogenetic relatedness. Virology 277, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., 368–378. http://dx.doi.org/10.1006/viro.2000.0588. Higgins, D.G., 2007. Clustal W and clustal X version 2.0. Bioinformatics, 23; , pp. Okamoto, H., Takahashi, M., Nishizawa, T., Tawara, A., Fukai, K., Muramatsu, U., 2947–2948. http://dx.doi.org/10.1093/bioinformatics/btm404. Naito, Y., Yoshikawa, A., 2002. Genomic characterization of TT viruses (TTVs) in Leary, T.P., Erker, J.C., Chalmers, M.L., Desai, S.M., Mushahwar, I.K., 1999. Improved pigs, cats and dogs and their relatedness with species-specific TTVs in primates detection systems for TT virus reveal high prevalence in humans, non-human and tupaias. J. Gen. Virol. 83, 1291–1297. primates and farm animals. J. Gen. Virol. 80 (Pt. 8), 2115–2120. Osiowy, C., Sauder, C., 2000. Detection of TT virus in human hair and skin. Hepatol. Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S., Chitsaz, F., Geer, L.Y., Res. 16, 155–162. Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Marchler, G.H., Phan, T.G., Li, L., O’Ryan, M.G., Cortes, H., Mamani, N., Bonkoungou, I.J.O., Wang, C., Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D., Zheng, C., Bryant, S.H., Leutenegger, C.M., Delwart, E., 2012. A third gyrovirus species in human faeces. 2014. CDD: NCBI’s conserved domain database. Nucl. Acids Res. 43, D222–D226. J. Gen. Virol. 93, 1356–1361. http://dx.doi.org/10.1099/vir.0.041731-0. http://dx.doi.org/10.1093/nar/gku1221. Pinho‐Nascimento, C., Leite, J., 2011. Torque teno virus in fecal samples of patients McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y.M., Buso, N., Cowley, A.P., with gastroenteritis: prevalence, genogroups distribution, and viral load. J. Lopez, R., 2013. Analysis tool web services from the EMBL-EBI. Nucl. Acids Res. Med. Virol. 1111, 1107–1111. http://dx.doi.org/10.1002/jmv. 41, 597–600. http://dx.doi.org/10.1093/nar/gkt376. Qiu, J., Kakkola, L., Cheng, F., 2005. Human circovirus TT virus genotype 6 expresses Mushahwar, I.K., Erker, J.C., Muerhoff, A.S., Leary, T.P., Simons, J.N., Birkenmeyer, L. six proteins following transfection of a full-length clone. J. Virol. 79, 6505–6510. G., Chalmers, M.L., Pilot-Matias, T.J., Dexai, S.M., 1999. Molecular and biophy- http://dx.doi.org/10.1128/JVI.79.10.6505. sical characterization of TT virus: evidence for a new virus family infecting Saback, F.L., Gomes, S. a, De Paula, V.S., Da Silva, R.R.S., Lewis-Ximenez, L.L., Niel, C., humans. Proc. Natl. Acad. Sci. USA 96, 3177–3182. 1999. Age-specific prevalence and transmission of TT virus. J. Med. Virol. 59, Ng, T.F.F., Manire, C., Borrowman, K., Langer, T., Ehrhart, L., Breitbart, M., 2009a. 318–322. http://dx.doi.org/10.1002/(SICI)1096-9071(199911)59:3o318:: Discovery of a novel single-stranded DNA virus from a sea turtle fibropapilloma AID-JMV1043.0.CO;2-Q. by using viral metagenomics. J. Virol. 83, 2500–2509. http://dx.doi.org/10.1128/ Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other JVI.01946-08. Methods) Version 4. Ng, T.F.F., Suedmeyer, W.K., Wheeler, E., Gulland, F., Breitbart, M., 2009b. Novel Takahashi, K., Iwasa, Y., Hijikata, M., Mishiro, S., 2000. Identification of a new anellovirus discovered from a mortality event of captive California sea lions. J. human DNA virus (TTV-like mini virus, TLMV) intermediately related to TT – Gen. Virol. 90, 1256–1261. http://dx.doi.org/10.1099/vir.0.008987-0. virus and chicken anemia virus. Arch. Virol. 145, 979 993. Nguyen Ba, A.N., Pogoutse, A., Provart, N., Moses, A.M., 2009. NLStradamus: a Thom, K., Morrison, C., Lewis, J.C., Simmonds, P., 2003. Distribution of TT virus simple hidden Markov model for nuclear localization signal prediction. BMC (TTV), TTV-like minivirus, and related viruses in humans and nonhuman pri- – Bioinf. 10, 202. http://dx.doi.org/10.1186/1471-2105-10-202. mates. Virology 306, 324 333. http://dx.doi.org/10.1016/S0042-6822(02) Ninomiya, M., Takahashi, M., Nishizawa, T., Shimosegawa, T., Okamoto, H., 2008. 00049-1. Development of PCR assays with nested primers specific for differential Van den Brand, J.M.A., van Leeuwen, M., Schapendonk, C.M., Simon, J.H., Haagmans, detection of three human anelloviruses and early acquisition of dual or triple B.L., Osterhaus, A.D.M.E., Smits, S.L., 2012. Metagenomic analysis of the viral fl – infection during infancy. J. Clin. Microbiol. 46, 507–514. http://dx.doi.org/ ora of pine marten and European badger feces. J. Virol. 86, 2360 2365. http: 10.1128/JCM.01703-07. //dx.doi.org/10.1128/JVI.06373-11. Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y., Mayumi, M., Verschoor, E.J., Langenhuijzen, S., Heeney, J.L., 1999. TT viruses (TTV) of non-human 1997. A novel DNA virus (TTV) associated with elevated transaminase levels in primates and their relationship to the human TTV genotypes. J. Gen. Virol. 80 – posttransfusion hepatitis of unknown etiology. Biochem. Biophys. Res. Com- (Pt. 9), 2491 2499. mun. 241, 92–97. http://dx.doi.org/10.1006/bbrc.1997.7765.