DOCSLIB.ORG

Genetic Mutations in RNA-Binding Proteins and Their Roles In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Mutations in RNA-Binding Proteins and Their Roles In Hum Genet DOI 10.1007/s00439-017-1830-7 REVIEW Genetic mutations in RNA‑binding proteins and their roles in ALS Katannya Kapeli1 · Fernando J. Martinez2 · Gene W. Yeo1,2,3 Received: 1 April 2017 / Accepted: 17 July 2017 © The Author(s) 2017. This article is an open access publication Abstract Mutations in genes that encode RNA-binding revealed that two-thirds of RBPs are expressed in a cell- proteins (RBPs) have emerged as critical determinants of type specifc manner (McKee et al. 2005). This specialized neurological diseases, especially motor neuron disorders expression of RBPs is thought to maintain a diverse gene such as amyotrophic lateral sclerosis (ALS). RBPs are expression profle to support the varied and complex func- involved in all aspects of RNA processing, controlling the tions of neurons. An increasing number of RBPs are being life cycle of RNAs from synthesis to degradation. Hallmark recognized as causal drivers or associated with neurological features of RBPs in neuron dysfunction include misregu- diseases (Polymenidou et al. 2012; Belzil et al. 2013; Nuss- lation of RNA processing, mislocalization of RBPs to the bacher et al. 2015), which reinforces the importance of RBPs cytoplasm, and abnormal aggregation of RBPs. Much pro- in maintaining normal physiology in the nervous system. gress has been made in understanding how ALS-associated Mutations in genes that encode RBPs have been observed mutations in RBPs drive pathogenesis. Here, we focus on in patients with motor neuron disorders such as amyotrophic several key RBPs involved in ALS—TDP-43, HNRNP A2/ lateral sclerosis (ALS), spinal muscular atrophy (SMA), B1, HNRNP A1, FUS, EWSR1, and TAF15—and review multisystem proteinopathy (MSP) and frontotemporal lobar our current understanding of how mutations in these proteins degeneration (FTLD). In adults, ALS is the most common cause disease. motor neuron disorder and is characterized by progressive loss of upper and lower motor neurons, which leads to fatal paralysis (Eykens and Robberecht 2015). The causes of ALS Introduction remain largely unknown, with 90% of cases being sporadic and the remaining 10% having a hereditary component RBPs play a central role in mediating post-transcriptional (Pasinelli and Brown 2016). Model organisms (mouse, yeast, gene expression. They directly bind to RNA and control all and drosophila) and human cells [patient tissue or neurons aspects of RNA processing, including RNA synthesis, matu- generated from patient-derived induced pluripotent stem ration, localization, translation, and decay. A genome-wide cells (iPSCs)] have enabled signifcant progress in dissecting survey of RBPs in the developing mouse nervous system the normal and pathological functions of ALS-linked RBPs. There are more than one hundred genes associated with * Gene W. Yeo ALS, a handful of which encode proteins that control RNA [email protected] processing (Wroe et al. 2008). Here, we focus on several 1 RBPs that are known to be mutated in patients with ALS: Department of Physiology, Yong Loo Lin School TAR DNA-binding protein 43 (TDP-43), heterogeneous of Medicine, National University of Singapore, Singapore 117593, Singapore nuclear ribonucleoprotein A1 (hnRNP A1), heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP A2/B1), fused 2 Department of Cellular and Molecular Medicine, Stem Cell Program and Institute for Genomic Medicine, University in sarcoma/translocated in liposarcoma (FUS/TLS, herein of California, San Diego, La Jolla, CA 92093, USA referred to as FUS), Ewing’s sarcoma breakpoint region 1 3 Molecular Engineering Laboratory, A*STAR, (EWSR1), and TAF15 (TATA-box binding protein asso- Singapore 138673, Singapore ciated factor 15) (Fig. 1). There are many commonalities Vol.:(0123456789)1 3 Hum Genet between these proteins. TDP-43, hnRNP A1, and hnRNP by transportin to control nuclear–cytoplasmic shuttling (Lee A2/B1 are structurally similar in that they contain two et al. 2006) (Fig. 1). They are predominantly nuclear, multi- RNA recognition motifs (RRMs) and a Gly-rich C-terminal functional proteins that are widely expressed in most cell and domain (Fig. 1) (He and Smith 2009). FUS, EWSR1 and tissue types and are implicated in a broad range of cellular TAF15, which form the FET family, also share a similar processes. The importance of these proteins is exemplifed structure: a zinc fnger domain and RRM that facilitates by the observations that compete loss of TDP-43 or hnRNP DNA and RNA binding, respectively, an N-terminal low A1 in mice is embryonic lethal (Kraemer et al. 2010; Liu complexity, prion-like domain that mediates protein inter- et al. 2017) while complete loss of FUS or EWSR1 in mice actions and self-assembly (Han et al. 2012; Kato et al. 2012; is postnatal lethal (Hicks et al. 2000; Li et al. 2007). Disease- Kwon et al. 2013; Schwartz et al. 2012), multiple C-terminal related mutations in these RBP have been reported to alter Arg-Gly-Gly (RGG) domains that facilitate non-specifc the normal functions of the protein in various steps of RNA RNA binding and protein interactions, and an atypical Pro- processing (Fig. 2). In this review, we discuss their normal Tyr nuclear localization signal (PY-NLS) that is recognized functions in RNA processing, their connection to ALS, and 1106 176191 262414 A90V G298S N345K G376D N378D/S RRM1 RRM2 Gly-rich D169G M311V G348C/V/R TDP-43 K263E A315T/E N352S/T S379P/C Mutations N267S A321V/G G357S/R A382P/T RNA G287S Q331K M359V I383T/V G290A/V S332N R361S/T G384R S292N G335D P363A W385G G294A/V M337V G368S N390D/S G295R/S/C Q343R Y374X S393L 11497105 184195 317320 HNRNP RRM1 RRM2 Gly-rich D262V/N A1 Mutations N267S RNA P288S P18S G228-G229insG R502WfsX15 S57del G230delG G503WfsX12 N63S G230C G504WfsX12 19 92 100179 190337 341 S96del R234C/L G507D RRM1 RRM2 Gly-rich S115N R244C G509D HNRNP S142N G245V K510WfsX517 A2/B1 Mutations D290V G144-Y149del M254V K510E/R RNA G156E R383C S513P N159Y G399V R514G/S G173-G174del S462F G515C G174-G175del M464I E516V G187S G466VfsX14 H517D/P/Q G191S G472VfsX57 R518G/K/del 1165 267285 371422 453501 526 G206S R487C Q519X Q210H R491C R521S/G/C/H/L FUS QGSY-richGly-rich RRM RGG Zn RGG R216C G492EfsX527 R522G G222-G223insG R495X R524R/S/T/W Mutations G223del R495EfsX527 P525L RNA G225V R495QfsX527 X527YextX G226S G497AfsX527 1250 283348 360 446454 517548 655 EWSR1 QGSY-rich Gly-rich RRM RGG Zn RGG Mutations P552L G511A RNA 1150 171219 234320 325 354386 572592 QGSY-rich Gly-rich RRM RGGZn RGG A31T R395Q TAF15 M368T R408C Mutations R385H G452E G391E G473E RNA ALS mutations RNA recognition motif zinc finger motif (Zn) RNA interactions glycine-rich domain nuclear localization signal (Gly-rich) QGSY-rich domain arginine-glycine-glycine nuclear export signal rich domain (RGG) Fig. 1 Mutation and RNA interaction maps for ALS-associated protein sequence—missense mutations, frame shifts, and deletions— RNA-binding proteins (RBPs). The locations of mutations identi- are reported. Points of contact between RBPs and mRNA are shown fed in familial and sporadic ALS patients are mapped against the (TDP-43, Buratti and Baralle 2001; all others, Castello et al. 2016) domain structure of the RBP. Mutations that cause a change in the 1 3 Hum Genet Fig. 2 ALS-associated mutations in RBPs may disrupt RNA pro- ▸ NormalDisease cessing by several mechanisms. a Wild-type RBPs have roles in transcription. Mutant forms of the proteins may have abnormal inter- actions with transcription factors like TFIID or RNA polymerase II ? that disrupt transcription. b RBPs bind to introns of pre-mRNAs and splicing factors to regulate constitutive and alternative splicing. ALS- WT mutant proteins alter global splicing through events like exon skip- anscription Tr ping. c ALS-associated RBPs predominantly reside in the nucleus. Mutations in the RBPs can cause mislocalization to the cytoplasm ) (a where they bind and regulate diferent sets of RNAs. Some mutant RBPs were found to promote mislocalization of wild-type RBPs to the cytoplasm. d RBPs are involved in RNA trafcking, particularly g to distant axonal and dendritic sites in neurons. Mutations in RBPs, such as FUS and TDP-43, disrupt the protein’s ability to transport WT mRNAs to their proper destinations. e TDP-43, hnRNP A2/B1, and Alt splicin hnRNP A1 are implicated in translation and mutant forms of these ) RBPs may disrupt this function. For example, mutant forms of TDP- (b 43 have a greater propensity to mislocalize to the mitochondria and block translation of specifc mitochondria-transcribed mRNAs (Wang et al. 2016a). f Mutations in ALS-associated RBPs, like FUS and WT TDP-43, cause the protein to be more resistant to proteasome-medi- WT ated degradation. The longer half-lives of mutant proteins results in WT WT their accumulation, which may confer toxicity. g Wild-type RBPs nat- urally form membrane-less organelles through phase transitions into Nuclear export WT liquid droplets. These reversible interactions are mediated by RNA ) and the low-complexity Gly-rich domain of the RBP. The presence of (c ALS-associated mutant RBPs, dipeptide repeats, or RNA repeats alter the biophysical properties of phase transitions and droplet formations. In these cases, droplets may evolve into insoluble structures through WT fbrilization that disrupt membrane-less organelles and kill neurons WT WT Localization ) speculate how ALS-associated mutations in the genes that (d encode these proteins may contribute to pathogenesis. TDP‑43 anslation Tr ) Roles in RNA processing (e Initially described as a transcription factor (Ou et al. 1995), WT TDP-43 is now better known for its role in RNA process- WT t1/2 t ing. Several groups have used crosslinking and immuno- 1/2 precipitation followed by sequencing (CLIP-seq) to identify the global RNA targets of TDP-43 and showed that TDP-43 Protein stability ) binds to thousands of RNAs (Tollervey et al.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • DIPPER, a Spatiotemporal Proteomics Atlas of Human Intervertebral Discs
    TOOLS AND RESOURCES DIPPER, a spatiotemporal proteomics atlas of human intervertebral discs for exploring ageing and degeneration dynamics Vivian Tam1,2†, Peikai Chen1†‡, Anita Yee1, Nestor Solis3, Theo Klein3§, Mateusz Kudelko1, Rakesh Sharma4, Wilson CW Chan1,2,5, Christopher M Overall3, Lisbet Haglund6, Pak C Sham7, Kathryn Song Eng Cheah1, Danny Chan1,2* 1School of Biomedical Sciences, , The University of Hong Kong, Hong Kong; 2The University of Hong Kong Shenzhen of Research Institute and Innovation (HKU-SIRI), Shenzhen, China; 3Centre for Blood Research, Faculty of Dentistry, University of British Columbia, Vancouver, Canada; 4Proteomics and Metabolomics Core Facility, The University of Hong Kong, Hong Kong; 5Department of Orthopaedics Surgery and Traumatology, HKU-Shenzhen Hospital, Shenzhen, China; 6Department of Surgery, McGill University, Montreal, Canada; 7Centre for PanorOmic Sciences (CPOS), The University of Hong Kong, Hong Kong Abstract The spatiotemporal proteome of the intervertebral disc (IVD) underpins its integrity *For correspondence: and function. We present DIPPER, a deep and comprehensive IVD proteomic resource comprising [email protected] 94 genome-wide profiles from 17 individuals. To begin with, protein modules defining key †These authors contributed directional trends spanning the lateral and anteroposterior axes were derived from high-resolution equally to this work spatial proteomes of intact young cadaveric lumbar IVDs. They revealed novel region-specific Present address: ‡Department profiles of regulatory activities
    [Show full text]
  • Characterization of HNRNPA1 Mutations Defines Diversity in Pathogenic Mechanisms and Clinical Presentation
    Characterization of HNRNPA1 mutations defines diversity in pathogenic mechanisms and clinical presentation Danique Beijer, … , J. Paul Taylor, Jonathan Baets JCI Insight. 2021;6(14):e148363. https://doi.org/10.1172/jci.insight.148363. Research Article Genetics Neuroscience Mutations in HNRNPA1 encoding heterogeneous nuclear ribonucleoprotein (hnRNP) A1 are a rare cause of amyotrophic lateral sclerosis (ALS) and multisystem proteinopathy (MSP). hnRNPA1 is part of the group of RNA-binding proteins (RBPs) that assemble with RNA to form RNPs. hnRNPs are concentrated in the nucleus and function in pre-mRNA splicing, mRNA stability, and the regulation of transcription and translation. During stress, hnRNPs, mRNA, and other RBPs condense in the cytoplasm to form stress granules (SGs). SGs are implicated in the pathogenesis of (neuro- )degenerative diseases, including ALS and inclusion body myopathy (IBM). Mutations in RBPs that affect SG biology, including FUS, TDP-43, hnRNPA1, hnRNPA2B1, and TIA1, underlie ALS, IBM, and other neurodegenerative diseases. Here, we characterize 4 potentially novel HNRNPA1 mutations (yielding 3 protein variants: *321Eext*6, *321Qext*6, and G304Nfs*3) and 2 known HNRNPA1 mutations (P288A and D262V), previously connected to ALS and MSP, in a broad spectrum of patients with hereditary motor neuropathy, ALS, and myopathy. We establish that the mutations can have different effects on hnRNPA1 fibrillization, liquid-liquid phase separation, and SG dynamics. P288A accelerated fibrillization and decelerated SG disassembly, whereas *321Eext*6 had no effect on fibrillization but decelerated SG disassembly. By contrast, G304Nfs*3 decelerated fibrillization and impaired liquid phase separation. Our findings suggest different underlying pathomechanisms for HNRNPA1 mutations with a possible link to clinical phenotypes.
    [Show full text]
  • Analysis of Hnrnpa1, A2/B1, and A3 Genes in Patients with Amyotrophic Lateral Sclerosis
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Neurobiol Manuscript Author Aging. Author Manuscript Author manuscript; available in PMC 2019 June 25. Published in final edited form as: Neurobiol Aging. 2013 November ; 34(11): 2695.e11–2695.e12. doi:10.1016/j.neurobiolaging. 2013.05.025. Analysis of hnRNPA1, A2/B1, and A3 genes in patients with amyotrophic lateral sclerosis Daniela Calinia, Lucia Corradob, Roberto Del Boc,d, Stella Gagliardie, Viviana Pensatof, Federico Verdea,c, Stefania Cortic,d, Letizia Mazzinig, Pamela Milanie, Barbara Castellottif, Cinzia Bertolinh, Gianni Sorarùi, Cristina Ceredae, Giacomo P. Comic,d, Sandra D’Alfonsob, Cinzia Gelleraf, Nicola Ticozzia,c, John E. Landersj, Antonia Rattia,c,*, Vincenzo Silania,c, and The SLAGEN Consortium aDepartment of Neurology and Laboratory of Neuroscience, IRCCS Istituto Auxologico Italiano, Via Zucchi 18, 20095 Cusano Milanino, Milan, Italy bDepartment of Health Sciences, Interdisciplinary Research Center of Autoimmune Diseases, “A. Avogadro” University, Via Solaroli 17, 28100 Novara, Italy cDipartimento di Fisiopatologia Medico-Chirurgica e dei Trapianti, “Dino Ferrari” Centre, Università degli Studi di Milano, Via Sforza 35, 20122 Milan, Italy dIRCCS Foundation Ca’Granda Ospedale Maggiore Policlinico, Via Sforza 35, 20122 Milan, Italy eLaboratory of Experimental Neurobiology, IRCCS National Neurological Institute “C. Mondino”, Via Mondino 2, 27100 Pavia, Italy fUnit of Genetics of Neurodegenerative and Metabolic Diseases, Fondazione IRCCS Istituto
    [Show full text]
  • Multiple Sclerosis-Associated Hnrnpa1 Mutations Alter Hnrnpa1 Dynamics and Influence Stress Granule Formation
    International Journal of Molecular Sciences Article Multiple Sclerosis-Associated hnRNPA1 Mutations Alter hnRNPA1 Dynamics and Influence Stress Granule Formation Joseph-Patrick W. E. Clarke 1,2,* , Patricia A. Thibault 2,3, Hannah E. Salapa 2,3 , David E. Kim 4, Catherine Hutchinson 2,3 and Michael C. Levin 1,2,3,4,* 1 Department of Health Sciences, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada 2 Office of the Saskatchewan Multiple Sclerosis Clinical Research Chair, University of Saskatchewan, Saskatoon, SK S7K 0M7, Canada; [email protected] (P.A.T.); [email protected] (H.E.S.); [email protected] (C.H.) 3 Department of Medicine, Neurology Division, University of Saskatchewan, Saskatoon, SK S7N 0X8, Canada 4 Department of Anatomy, Physiology and Pharmacology, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] * Correspondence: [email protected] (J.-P.W.E.C.); [email protected] (M.C.L.); Tel.: +1-306-6558 (M.C.L.) Abstract: Evidence indicates that dysfunctional heterogeneous ribonucleoprotein A1 (hnRNPA1; A1) contributes to the pathogenesis of neurodegeneration in multiple sclerosis. Understanding molecular mechanisms of neurodegeneration in multiple sclerosis may result in novel therapies that attenuate neurodegeneration, thereby improving the lives of MS patients with multiple sclerosis. Using an in vitro, blue light induced, optogenetic protein expression system containing the optogene Citation: Clarke, J.-P.W.E.; Thibault, Cryptochrome 2 and a fluorescent mCherry reporter, we examined the effects of multiple sclerosis- P.A.; Salapa, H.E.; Kim, D.E.; associated somatic A1 mutations (P275S and F281L) in A1 localization, cluster kinetics and stress Hutchinson, C.; Levin, M.C.
    [Show full text]
  • Solution Structure of the Two RNA Recognition Motifs of Hnrnp A1
    Solution structure of the two RNA recognition motifs of hnRNP A1 using segmental isotope labeling: how the relative orientation between RRMs influences the nucleic acid binding topology. Pierre Barraud, Frédéric H-T Allain To cite this version: Pierre Barraud, Frédéric H-T Allain. Solution structure of the two RNA recognition motifs of hnRNP A1 using segmental isotope labeling: how the relative orientation between RRMs influences the nucleic acid binding topology.. Journal of Biomolecular NMR, Springer Verlag, 2013, 55 (1), pp.119-38. 10.1007/s10858-012-9696-4. hal-00782205 HAL Id: hal-00782205 https://hal.archives-ouvertes.fr/hal-00782205 Submitted on 29 Jan 2013 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Solution structure of the two RNA recognition motifs of hnRNP A1 using segmental isotope labeling: how the relative orientation between RRMs influences the nucleic acid binding topology Pierre Barraud & Frédéric H.-T. Allain† Institute of Molecular Biology and Biophysics, ETH Zurich, CH-8093 Zürich, Switzerland † Corresponding author: FH-T Allain, Institute of Molecular Biology and Biophysics, ETH Zurich, Schafmattstrasse 20, CH-8093 Zürich, Switzerland. Tel.: +41 44 633 3940, Fax: +41 44 633 1294.
    [Show full text]
  • Use of IBM Watson to Identify Additional RNA-Binding Proteins
    Acta Neuropathol DOI 10.1007/s00401-017-1785-8 ORIGINAL PAPER Artifcial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA‑binding proteins altered in amyotrophic lateral sclerosis Nadine Bakkar1 · Tina Kovalik1 · Ileana Lorenzini1 · Scott Spangler2 · Alix Lacoste3 · Kyle Sponaugle1 · Philip Ferrante1 · Elenee Argentinis3 · Rita Sattler1 · Robert Bowser1 Received: 29 September 2017 / Revised: 4 November 2017 / Accepted: 4 November 2017 © The Author(s) 2017. This article is an open access publication Abstract Amyotrophic lateral sclerosis (ALS) is a dev- to controls. Overall, we successfully used IBM Watson to astating neurodegenerative disease with no efective treat- help identify additional RBPs altered in ALS, highlighting ments. Numerous RNA-binding proteins (RBPs) have been the use of artifcial intelligence tools to accelerate scientifc shown to be altered in ALS, with mutations in 11 RBPs discovery in ALS and possibly other complex neurological causing familial forms of the disease, and 6 more RBPs disorders. showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely Keywords Amyotrophic lateral sclerosis · RNA-binding accepted as a contributing factor in ALS pathobiology. There protein · Artifcial intelligence · Protein aggregation · are at least 1542 RBPs in the human genome; therefore, Motor neuron other unidentifed RBPs may also be linked to the patho- genesis of ALS. We used IBM ­Watson® to sieve through all RBPs in the genome and identify new RBPs linked to ALS Introduction (ALS-RBPs). IBM Watson extracted features from pub- lished literature to create semantic similarities and identify Amyotrophic lateral sclerosis (ALS) is characterized by new connections between entities of interest.
    [Show full text]
  • Hnrnp A/B Proteins: an Encyclopedic Assessment of Their Roles in Homeostasis and Disease
    biology Review hnRNP A/B Proteins: An Encyclopedic Assessment of Their Roles in Homeostasis and Disease Patricia A. Thibault 1,2 , Aravindhan Ganesan 3, Subha Kalyaanamoorthy 4, Joseph-Patrick W. E. Clarke 1,5,6 , Hannah E. Salapa 1,2 and Michael C. Levin 1,2,5,6,* 1 Office of the Saskatchewan Multiple Sclerosis Clinical Research Chair, University of Saskatchewan, Saskatoon, SK S7K 0M7, Canada; [email protected] (P.A.T.); [email protected] (J.-P.W.E.C.); [email protected] (H.E.S.) 2 Department of Medicine, Neurology Division, University of Saskatchewan, Saskatoon, SK S7N 0X8, Canada 3 ArGan’s Lab, School of Pharmacy, Faculty of Science, University of Waterloo, Waterloo, ON N2L 3G1, Canada; [email protected] 4 Department of Chemistry, Faculty of Science, University of Waterloo, Waterloo, ON N2L 3G1, Canada; [email protected] 5 Department of Health Sciences, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada 6 Department of Anatomy, Physiology and Pharmacology, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada * Correspondence: [email protected] Simple Summary: The hnRNP A/B family of proteins (comprised of A1, A2/B1, A3, and A0) contributes to the regulation of the majority of cellular RNAs. Here, we provide a comprehensive overview of what is known of each protein’s functions, highlighting important differences between them. While there is extensive information about A1 and A2/B1, we found that even the basic Citation: Thibault, P.A.; Ganesan, A.; functions of the A0 and A3 proteins have not been well-studied.
    [Show full text]
  • Hnrnp A1 (HNRNPA1) (NM 031157) Human Untagged Clone – SC109309 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC109309 hnRNP A1 (HNRNPA1) (NM_031157) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: hnRNP A1 (HNRNPA1) (NM_031157) Human Untagged Clone Tag: Tag Free Symbol: HNRNPA1 Synonyms: ALS19; ALS20; hnRNP-A1; hnRNP A1; HNRPA1; HNRPA1L3; IBMPFD3; UP 1 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene sequence for NM_031157 edited TTCACCCTGCCGTCATGTCTAAGTCAGAGTCTCCTAAAGAGCCCGAACAGCTGAGGAAGC TCTTCATTGGAGGGTTGAGCTTTGAAACAACTGATGAGAGCCTGAGGAGCCATTTTGAGC AATGGGGAACGCTCACGGACTGTGTGGTAATGAGAGATCCAAACACCAAGCGCTCCAGGG GCTTTGGGTTTGTCACATATGCCACTGTGGAGGAGGTGGATGCAGCTATGAATGCAAGGC CACACAAGGTGGATGGAAGAGTTGTGGAACCAAAGAGAGCTGTCTCCAGAGAAGATTCTC AAAGACCAGGTGCCCACTTAACTGTGAAAAAGATATTTGTTGGTGGCATTAAAGAAGACA CTGAAGAACATCACCTAAGAGATTATTTTGAACAGTATGGAAAAATTGAAGTGATTGAAA TCATGACTGACCGAGGCAGTGGCAAGAAAAGGGGCTTTGCCTTTGTAACCTTTGACGACC ATGACTCCGTGGATAAGATTGTCATTCAGAAATACCATACTGTGAATGGCCACAACTGTG AAGTTAGAAAAGCCCTGTCAAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAAAGAGGTC GAAGTGGTTCTGGAAACTTTGGTGGTGGTCGTGGAGGTGGTTTCGGTGGGAATGACAACT TCGGTCGTGGAGGAAACTTCAGTGGTCGTGGTGGCTTTGGTGGCAGCCGTGGTGGTGGTG GATATGGTGGCAGTGGGGATGGCTATAATGGATTTGGTAATGATGGTGGTTATGGAGGAG GCGGCCCTGGTTACTCTGGAGGAAGCAGAGGCTATGGAAGTGGTGGACAGGGTTATGGAA ACCAGGGCAGTGGCTATGGCGGGAGTGGCAGCTATGACAGCTATAACAACGGAGGCGGAG GCGGCTTTGGCGGTGGTAGTGGAAGCAATTTTGGAGGTGGTGGAAGCTACAATGATTTTG
    [Show full text]
  • RNA-Binding Proteins and the Complex Pathophysiology of ALS
    International Journal of Molecular Sciences Review RNA-Binding Proteins and the Complex Pathophysiology of ALS Wanil Kim 1,†, Do-Yeon Kim 2,* and Kyung-Ha Lee 1,* 1 Division of Cosmetic Science and Technology, Daegu Haany University, Hanuidae-ro 1, Gyeongsan, Gyeongbuk 38610, Korea; [email protected] 2 Department of Pharmacology, School of Dentistry, Kyungpook National University, Daegu 41940, Korea * Correspondence: [email protected] (D.-Y.K.); [email protected] (K.-H.L.); Tel.: +82-53-660-6880 (D.-Y.K.); +82-53-819-7743 (K.-H.L.) † Current Address: Department of Biochemistry, College of Medicine, Gyeongsang National University, Jinju 52828, Korea. Abstract: Genetic analyses of patients with amyotrophic lateral sclerosis (ALS) have identified disease- causing mutations and accelerated the unveiling of complex molecular pathogenic mechanisms, which may be important for understanding the disease and developing therapeutic strategies. Many disease-related genes encode RNA-binding proteins, and most of the disease-causing RNA or proteins encoded by these genes form aggregates and disrupt cellular function related to RNA metabolism. Disease-related RNA or proteins interact or sequester other RNA-binding proteins. Eventually, many disease-causing mutations lead to the dysregulation of nucleocytoplasmic shuttling, the dysfunction of stress granules, and the altered dynamic function of the nucleolus as well as other membrane- less organelles. As RNA-binding proteins are usually components of several RNA-binding protein complexes that have other roles, the dysregulation of RNA-binding proteins tends to cause diverse forms of cellular dysfunction. Therefore, understanding the role of RNA-binding proteins will help elucidate the complex pathophysiology of ALS.
    [Show full text]
  • Autoantibodies Targeting TLR and SMAD Pathways Define New
    Journal of Autoimmunity xxx (2018) 1e12 Contents lists available at ScienceDirect Journal of Autoimmunity journal homepage: www.elsevier.com/locate/jautimm Autoantibodies targeting TLR and SMAD pathways define new subgroups in systemic lupus erythematosus ** Myles J. Lewis a, , Michael B. McAndrew b, Colin Wheeler b, Nicholas Workman b, Pooja Agashe b, Jens Koopmann c, Ezam Uddin b, David L. Morris d, Lu Zou a, * Richard Stark b, John Anson b, Andrew P. Cope e, Timothy J. Vyse d, a Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, London, EC1M 6BQ, UK b Oxford Gene Technology, Unit 15, Oxford Industrial Park, Yarnton, Oxfordshire, OX5 1QU, UK c MedImmune, Aaron Klug Building, Granta Park, Cambridge, CB21 6GH, UK d Department of Medical and Molecular Genetics, King's College London, London, SE1 9RT, UK e Academic Department of Rheumatology, Centre for Molecular and Cellular Biology of Inflammation, King's College London, London, SE1 9RT, UK article info abstract Article history: Objectives: The molecular targets of the vast majority of autoantibodies in systemic lupus erythematosus Received 8 January 2018 (SLE) are unknown. We set out to identify novel autoantibodies in SLE to improve diagnosis and identify Received in revised form subgroups of SLE individuals. 20 February 2018 Methods: A baculovirus-insect cell expression system was used to create an advanced protein microarray Accepted 23 February 2018 with 1543 full-length human proteins expressed with a biotin carboxyl carrier protein (BCCP) folding tag, Available online xxx to enrich for correctly folded proteins.
    [Show full text]
  • Chromosomal Translocations in NK-Cell Lymphomas Originate from Inter-Chromosomal Contacts of Active Rdna Clusters Possessing Hot Spots of Dsbs
    cancers Article Chromosomal Translocations in NK-Cell Lymphomas Originate from Inter-Chromosomal Contacts of Active rDNA Clusters Possessing Hot Spots of DSBs Nickolai A. Tchurikov 1,*, Leonid A. Uroshlev 2, Elena S. Klushevskaya 1 , Ildar R. Alembekov 1, Maria A. Lagarkova 3,4 , Galina I. Kravatskaya 1, Vsevolod Y. Makeev 1,2,5 and Yuri V. Kravatsky 1 1 Engelhardt Institute of Molecular Biology Russian Academy of Sciences, 119334 Moscow, Russia; [email protected] (E.S.K.); [email protected] (I.R.A.); [email protected] (G.I.K.); [email protected] (V.Y.M.); [email protected] (Y.V.K.) 2 Vavilov Institute of General Genetics Russian Academy of Sciences, 119991 Moscow, Russia; [email protected] 3 Federal Research and Clinical Center of Physical-Chemical Medicine, Federal Medical Biological Agency, 119435 Moscow, Russia; [email protected] 4 Center for Precision Genome Editing and Genetic Technologies for Biomedicine, Federal Research and Clinical Center of Physical-Chemical Medicine, Federal Medical Biological Agency, 119435 Moscow, Russia 5 Moscow Institute of Physics and Technology, State University, 141700 Dolgoprudny, Russia * Correspondence: [email protected]; Tel.: +7-499-135-9753 Simple Summary: There are nine DSB hot spots located in the non-transcribed spacer of human Citation: Tchurikov, N.A.; Uroshlev, rDNA units. Circular chromosome conformation capture data indicate that the rDNA clusters often L.A.; Klushevskaya, E.S.; Alembekov, shape contact with a specific set of chromosomal regions containing genes controlling differentiation I.R.; Lagarkova, M.A.; Kravatskaya, and cancer, and often possessing the DSB hot spots. The data suggest a mechanism for rDNA- G.I.; Makeev, V.Y.; Kravatsky, Y.V.
    [Show full text]