The Journal of Neuroscience, March 20, 2013 • 33(12):5195–5207 • 5195

Neurobiology of Disease Target-Derived Neurotrophins Coordinate Transcription and Transport of Bclw to Prevent Axonal Degeneration

Katharina E. Cosker,1,2,3 Maria F. Pazyra-Murphy,1,2,3 Sara J. Fenstermacher,1,2,3 and Rosalind A. Segal1,2,3 1Department of Neurobiology, Harvard Medical School, Boston, Massachusetts 02115, and Departments of 2Cancer Biology and 3Pediatric Oncology, Dana- Farber Cancer Institute, Boston, Massachusetts 02215

Establishment of neuronal circuitry depends on both formation and refinement of neural connections. During this process, target- derived neurotrophins regulate both transcription and translation to enable selective axon survival or elimination. However, it is not known whether retrograde signaling pathways that control transcription are coordinated with neurotrophin-regulated actions that transpire in the axon. Here we report that target-derived neurotrophins coordinate transcription of the antiapoptotic gene bclw with transport of bclw mRNA to the axon, and thereby prevent axonal degeneration in rat and mouse sensory neurons. We show that neurotrophin stimulation of nerve terminals elicits new bclw transcripts that are immediately transported to the axons and translated into protein. Bclw interacts with Bax and suppresses the caspase6 apoptotic cascade that fosters axonal degeneration. The scope of bclw regulation at the levels of transcription, transport, and translation provides a mechanism whereby sustained neurotrophin stimulation can be integrated over time, so that axonal survival is restricted to neurons connected within a stable circuit.

Introduction mRNA, which is both targeted to axons and locally translated Formation of a working sensory nervous system relies on axonal there in response to neurotrophins to facilitate growth cone mo- guidance for innervation of appropriate targets and on the selec- tility and neurotrophin-dependent axon guidance (Zhang et al., tive survival of neurons that are integrated into functional cir- 1999; Zhang et al., 2001; Willis et al., 2005; Yao et al., 2006; Willis cuits. These critical events are regulated by neurotrophins both et al., 2007). It has been proposed that local protein synthesis of during development and into adulthood (Segal, 2003; Skaper, ␤-actin allows axonal turning responses to occur rapidly and 2012). Target-derived neurotrophins initiate retrograde signal- independently of the remote cell body. ing cascades that induce transcriptional changes enabling neuro- More recently it has been reported that mRNA localization nal survival (Cosker et al., 2008; Pazyra-Murphy et al., 2009; and local translation may also play a role in neurotrophin- Chowdary et al., 2012), whereas lack of neurotrophin support dependent axonal survival. One such mRNA is Impa1, which is prevents outgrowth, triggers local axonal degeneration, and targeted to sympathetic neuron axons and locally translated in eventually causes neuronal apoptosis (Luo and O’Leary, 2005). It response to nerve growth factor (NGF) stimulation of distal ax- is currently not known whether neurons are able to coordinate ons (Andreassi et al., 2010). The Impa1 gene product is critical for transcriptional events in the cell body with localized mechanisms synthesizing membrane lipids and thereby promotes axonal that function within the axons to promote axon outgrowth and maintenance. Similarly, local synthesis of Lamin B2 is critical for survival pathways. axon maintenance in Xenopus retinal ganglion cell axons (Yoon During axonal outgrowth, neurotrophins regulate subcellular et al., 2012). It is currently unknown whether local protein syn- localization and translation of specific mRNAs (Yoon et al., thesis enables axonal survival to be regulated independently of ␤ 2009). The most extensively characterized of these is -actin the cell body or whether neurotrophins coordinate survival path- ways in the cell body and axons. Received Aug. 13, 2012; revised Jan. 22, 2013; accepted Feb. 6, 2013. Bcl2 family members are critical determinants of neurotro- Authorcontributions:K.E.C.andR.A.S.designedresearch;K.E.C.,M.F.P.-M.,andS.J.F.performedresearch;K.E.C., phin survival responses. In sensory neurons, Bclw (Bcl2l2) is the M.F.P.-M., S.J.F., and R.A.S. analyzed data; K.E.C. and R.A.S. wrote the paper. only antiapoptotic Bcl2 family member selectively regulated by This work was supported by National Institutes of Health Grant R01 NS050674 to R.A.S. and Grant F31NS077620 toS.J.F.,K.E.C.isaDavidMahoneyFellowatHarvardMedicalSchoolandarecipientofaNeurodegenerativeDisease target-derived neurotrophins (Pazyra-Murphy et al., 2009; Pilot Study grant from Massachusetts General Hospital Neurology Clinical Trials Unit and Harvard NeuroDiscovery Courchesne et al., 2011). Furthermore, Bclw is the Bcl2 family Center.S.J.F.isaVictoriaQuanFellowatHarvardMedicalSchool.Confocalmicroscopyimagingwasperformedatthe member that exhibits substantial protein expression in axons and Harvard NeuroDiscovery Center Optical Imaging Program. We thank Stephanie Courchesne for help in generating in Ϫ Ϫ prevents axonal degeneration in vivo (Courchesne et al., 2011). vivo samples, Jose Alfaro and Emily Chadwick for assistance with bclw / mice, Eugene Vaios for assistance with designing probes for ISH, and the members of the R.A.A. laboratory and the Qiufu Ma laboratory for helpful advice. Here we show that mRNA encoding bclw is present in peripheral The authors declare no competing financial interests. axons as well as in cell bodies of sensory neurons, and neurotro- Correspondence should be addressed to Dr. Rosalind A. Segal, Departments of Cancer Biology and phin stimulation of distal axons increases levels of bclw mRNAs in Pediatric Oncology, Dana-Farber Cancer Institute, 450 Brookline Avenue, Boston, MA 02215. E-mail: both locations. Our studies indicate that a retrograde neurotro- [email protected]. DOI:10.1523/JNEUROSCI.3862-12.2013 phin signaling cascade leads to transcription of bclw mRNA, Copyright © 2013 the authors 0270-6474/13/335195-13$15.00/0 which is immediately transported back to the stimulated axons. 5196 • J. Neurosci., March 20, 2013 • 33(12):5195–5207 Cosker et al. • Target-Derived Neurotrophins

There, bclw is translated in response to continuous neurotrophin 5, neurotrophins were removed from the cell body compartment and exposure and thereby suppresses axon degeneration mediated by reduced to 1 ng/ml in axon compartments for 3–7 d. For each experi- Bax and caspase6. Thus, target-derived neurotrophins coordi- ment, neurons were starved for2hinserum and neurotrophin-free nate transcription, mRNA transport, and translation in space and media, and then vehicle control (100 ng/ml BSA in PBS) or neurotro- ϩ time to promote neuronal survival of cell bodies and axons. phins (100 ng/ml BDNF NGF) were applied to distal axons or cell body compartments for the indicated time. Mass cultures consisting of 3 ϫ 10 5 DRG neurons were grown on laminin-coated p35 cultures dishes (Nunc) Materials and Methods in neurotrophin-enriched (100 ng/ml NGF ϩ BDNF) media with 0.3 Microfluidic chambers. Cover glass (Fisherband Microscope Cover Glass; ␮g/ml AraC. 24 ϫ 40–1) was coated with 0.25 mg/ml poly-M-lysine in HBSS overnight qRT-PCR. RNA was extracted from DRG neurons in compartmented chamber cultures using Trizol (Invitrogen) according to the manufac- at room temperature. After washing with ddH2O, the microfluidic cham- ber (Xona Microfluidics) was attached to the cover glass. Laminin (10 turer’s protocol. Reverse transcription was performed using the cDNA ␮g/ml) was added to each channel at 37°C for 3 h. Dorsal root ganglia archive kit (Applied Biosystems) according to the manufacturer’s (DRG) from embryonic day 15 (E15) rats of either sex were dissected, specifications. Quantitative real-time RT-PCR was performed using trypsinized, and plated directly into the channel at 100,000 cells/micro- TaqMan gene expression assays (Applied Biosystems) to assess the fluidic chamber in 5 ␮l of media (DMEM with 5% horse serum, 1% expression of c-fos (Rn02105452_s1), bclw (Rn00821025_g1), ␤-actin ␥ penicillin-streptomycin, and 0.3 ␮M cytosine arabinoside [AraC], and 50 (Rn00667869_m1), and -actin (Rn01470738_g1). For each sample, ng/ml NGF ϩ BDNF; PeproTech). After allowing cells to attach for 10 data were normalized to the expression level of gapdh (Applied min, 100 ␮l of media with 50 ng/ml NGF ϩ BDNF was added to cell body Biosystems). wells, and 100 ␮l of media with 100 ng/ml NGF ϩ BDNF to axonal wells. Western blotting. For analysis of Bclw protein in DRG cell bodies and Media was changed daily, removing AraC, and cells were fixed after4din distal axons, E15 rat DRGs were grown in compartmented chamber cul- culture with ice-cold MeOH for 2 min and 4% PFA for 20 min. tures as described above. Cells and axons were lysed in nonionic deter- FISH. DRGs from E15 rats of either sex were cultured in microfluidic gent, and protein lysates were separated by 4–12% SDS-PAGE and chambers as described above. Cells were permeabilized in 0.5% Triton blotted with the following antibodies: anti-pTrk (1:1000; pY-490) (Segal X-100 for 10 min and refixed in 4% PFA for 5 min. Cells were acetylated et al., 1996), anti-phospho Erk1/2 (1:1000; Cell Signaling Technology), in 0.25% acetic anhydride in 0.1 M triethanolamine for 10 min and anti-pan-actin (1:1000; Cell Signaling Technology), anti-Bclw (1:200; washed in PBS. Neurons were prehybridized for 1 h, before being incu- Stressgen), anti-His (1:1000; Novagen), anti-Bax (1:1000; Cell Signaling bated in 1 ␮g/ml probe at a final concentration of 4% dextran sulfate Technology), and anti-GAPDH (1:1000; Cell Signaling Technology). overnight at 65°C. Cultures were washed in 0.2ϫ saline-sodium citrate at Bands were visualized with secondary antibodies conjugated to HRP 65°C, cooled down, and equilibrated in TNT buffer (100 mM Tris, pH 7.5, (1:10,000; Bio-Rad) and SuperSignal chemiluminescent substrate kit. 150 mM NaCl, 0.05% Tween) for 5 min. Cells were incubated in blocking Using National Institutes of Health ImageJ software, protein levels were buffer (100 mM Tris, pH 7.5, 150 mM NaCl, 0.5% blocking reagent) for quantified and levels of protein were normalized to GAPDH. 1 h and anti-digoxigenin-POD (1:500) and mouse anti-Tuj1 (1:400; Co- mRNA stability. E15 rat DRG neurons were grown in mass cultures as vance) in blocking buffer overnight at 4°C. Cultures were washed with described. After2dinculture, 4-thiouridine nucleoside (20 ␮M; Sigma) TNT buffer and incubated in biotin-tyramide (1:50; PerkinElmer) in was added to cultures for 24 h for mRNA labeling. Total RNA was ex- amplification plus solution for 8 min. After washing in TNT, cells were tracted at 0, 4, and 8 h after 4-thiouridine removal. Total RNA (10 ␮l) was incubated with 546-Strepdavidin and goat anti-mouse 488 in blocking biotinylated with EZ-Link HPDP-Biotin (Pierce) for3hatroom tem- buffer for1hatroom temperature. Cells were washed with TNT and perature in the dark. Labeled RNA was precipitated and washed with mounted. Images were obtained using NIS Imaging software and a 60ϫ 75% EtOH. Biotinylated mRNA was purified using Dynabeads MyOne oil objective. Streptavidin C1 (Invitrogen), blocked with 10 mg/ml yeast tRNA for 1 h In situ hybridization. Probes for bclw, ␤-actin, and ␥-actin were ampli- at room temperature. Biotinylated RNA was added to the beads (10 ␮l fied with gene-specific sets of PCR primers and cDNA templates pre- RNA to 100 ␮l beads) and incubated for 15 min at room temperature. pared from P0 rat brain. Digoxigenin-labeled riboprobes were generated Beads were collected, washed 3 times with buffer (1 M NaCl, 10 mM EDTA, with digoxigenin-RNA labeling mixture (Roche) and T7 RNA polymer- and 100 mM Tris-HCl, pH 7.4, in RNase-free H20), and bound RNA was ase. Whole DRG with central and peripheral nerves were dissected from eluted by addition of 5% 2-mercaptoethanol. The eluted thiolated RNA was P0 rats of either sex and fixed overnight in 4% PFA in DEPC PBS. After precipitated with 2-propanol, spun, washed with 75% EtOH, spun, and ␮ fixation, embryos were dehydrated stepwise into 100% MeOH. Before resuspended in 20 l RNase-free H2O. Reverse transcription was performed hybridization, DRGs were rehydrated, refixed, and prehybridized in hy- using the cDNA archive kit (Applied Biosystems), according to manufactur- bridization buffer for1hat65°C. Prehybridization buffer was replaced er’s specifications for analysis by qRT-PCR. with hybridization buffer containing 1.5 ␮g/ml probe and hybridized Drug treatment. Distal axons and cell bodies of DRG neurons grown in overnight at 65°C. After washes, DRGs were blocked in TBST ϩ 10% compartmented chamber cultures were treated either with 200 nM lamb serum for2hatroom temperature, then incubated in TBST ϩ 10% K252A (Calbiochem), 10 ␮M U0126 (Calbiochem), 20 ␮M actinomycin lamb serum containing 1/2000 dilution of alkaline phosphatase- D (actD), 10 ␮g/ml cycloheximide (Calbiochem), 10 ␮M anisomycin conjugated sheep anti-digoxigenin Fab fragments overnight at 4°C. After (Sigma), 500 nM ABT-263 (Selleck Chemicals) or DMSO vehicle control. washing in TBST, and alkaline phosphatase buffer, DRGs were incubated Drugs were applied 10 min before neurotrophin stimulation or through- in BM Purple (BMB/Roche) until signal was detected. The reaction was out the duration of neurotrophin deprivation. stopped by washing in PBST/5 mM EDTA, DRGs were postfixed in 4% 4-Thiouridine labeling. E15 rat DRGs were grown in compart- PFA for 24 h, washed and mounted. mented chamber cultures as described. For pulse-labeling experiments, Cell cultures. Compartmented chamber cultures (Campenot cultures) 4-thiouridine nucleoside (20 ␮M; Sigma) was added to cell body com- were prepared as previously described (Heerssen et al., 2004; Pazyra- partments during2hofdistal axon neurotrophin (NT) stimulation, and Murphy and Segal, 2008). Briefly, DRGs from embryonic day 15 (E15) then removed for an additional2hofNTstimulation. For control ex- rats or E13 bclw ϩ/ϩ and bclw Ϫ/Ϫ mice of either sex were dissected, periments, 4-thiouridine nucleoside was added to cell body compart- trypsinized, and plated in the center compartment of a Teflon divider ments 24 h before NT stimulation, during which time it was removed. (Camp10; Tyler Research) (Campenot, 1982). Cultures were maintained After NT stimulation, total RNA was extracted from cell bodies and distal in media consisting of DMEM with 5% horse serum, 1% penicillin- axons using Trizol (Invitrogen). Total RNA (10 ␮l) was biotinylated and ␮ ϩ ␮ streptomycin, and 0.3 M AraC at 37°C, 7.5% CO2; BDNF NGF (Pe- precipitated as described. A 3 l RNA sample was removed and reverse proTech) were added to the cell body compartment at a concentration of transcription was performed using the cDNA archive kit (Applied Bio- 10 ng/ml and to the axon compartment at a concentration of 100 ng/ml systems) to check for neurotrophin induction of total-biotinylated for 2 d. On day 3, media was replaced and the AraC was omitted. On day mRNA by qRT-PCR. Total biotinylated mRNA was captured on Dyna- Cosker et al. • Target-Derived Neurotrophins J. Neurosci., March 20, 2013 • 33(12):5195–5207 • 5197

beads MyOne Streptavidin C1 (Invitrogen), and purified 4-thiouridine Animal use. Timed pregnant rats were purchased from Charles River. biotinylated RNA was eluted as described. The eluted thiolated RNA was bclwϪ/Ϫ mice were a generous gift from Grant MacGregor (University of precipitated with 2-propanol, spun, washed with 75% EtOH, spun, and California, Irvine, CA) (Ross et al., 1998). Genotyping for the wild-type bclw ␮ resuspended in 20 l RNase-free H2O. Reverse transcription was per- gene and/or lacZ gene were performed by Transnetyx using the Bclw target- formed using the cDNA archive kit (Applied Biosystems), according to ingsequenceGCTCTGAACCTCCCCATGACTTAAATCCGTTGCTCTTT manufacturer’s specifications for analysis by qRT-PCR. CT-TGGCCCTGCCCAGTGCCTCTGAGCATTTCACCTATCTCAGGA His pulldown of recombinant Bclw protein. E15 rat DRGs were grown in GCandthelacZsequenceCGATCGTAATCACCCGAGTGTGATCATCTG mass cultures as described. After2dinculture, recombinant His-tagged GTCGCTGGGGAATGAGTCAGGCCACG-G. All experimental procedures Bclw protein was introduced using Chariot reagent. Cells were lysed in were done in accordance with the National Institutes of Health guidelines nonionic detergent and transferred onto Dynabeads for His-Tag Isola- and were approved by the Dana-Farber Cancer Institutional Animal Care tion & Pulldown (Invitrogen) according to the manufacturer’s instruc- and Use Committee. tions. Input and pulldown were analyzed by Western blotting. Axonal degeneration assay. E15 rat DRGs were grown in compart- Results mented chamber cultures. After 6 d in culture, the cell body compart- Target-derived neurotrophins regulate axonal levels of ment was maintained in 10 ng/ml NGF ϩ BDNF, and the axonal bclw mRNA compartment was starved in DMEM alone for 10 h before fixation and Bclw promotes neurotrophin-dependent maintenance of sensory staining. Compartmented chamber cultures were fixed in ice-cold nerve fibers (Courchesne et al., 2011). As Bclw protein is ex- MeOH for 2 min and 4% PFA for 20 min, blocked in 2% BSA and 0.5% Triton X-100 for1hatroom temperature, incubated with mouse anti- pressed in axons, we asked whether bclw mRNA is also localized Tuj1 (1:400, Covance) overnight at 4°C and then with goat anti-mouse to axons of sensory neurons. FISH (Hafezparast et al., 2003)of AlexaFluor-488 (1:1000; Invitrogen) for 1 h at room temperature, and cultured DRG neurons in microfluidic chambers (Fig. 1A) dem- counterstained with DAPI. Images of distal axons were obtained using a onstrates the presence of bclw transcripts in axons as well as cell 40ϫ objective and NIS Elements software. To quantify axonal degener- bodies (Fig. 1B). This pattern is similar to ␤-actin mRNA, which ation, we used the method described by Sasaki et al. (2009). Images were is known to be localized to axons, and in contrast to ␥-actin binarized so that axonal areas were converted to black and background mRNA, which is restricted to cell bodies (Willis et al., 2007)(Fig. areas were converted to white. To detect fragmented (degenerating) ax- 1B). By qRT-PCR from DRG neurons grown in compartmented ons, the particle analyzer function of National Institutes of Health ImageJ chamber cultures, bclw mRNA shows a relative enrichment in software was used to determine the area of the fragments (size, 5–1000 axonal compartments compared with cell body compartments pixels). The degeneration index was then calculated as the ratio of the (Fig. 1C). Similarly, ISH in whole DRG and associated peripheral area of fragmented axons over the total axon area. ␤ Caspase6 immunostaining. For in vitro analysis, compartmented nerves demonstrates the presence of bclw and -actin transcripts chamber cultures were fixed in ice-cold MeOH for 2 min and then in 4% in cell bodies and in peripheral nerves, consistent with expression PFA for 20 min. Cultures were blocked in 5% normal goat serum and of bclw mRNA in axons (Fig. 1D,E). Together, these data indicate 0.1% Triton-X for 1 h. Cultures were incubated overnight at 4°C in that bclw mRNA, like ␤-actin mRNA, is localized to axons of primary antibody (1:100 anti-Active/Cleaved Caspase6; Imogene; and developing sensory neurons. In vivo, the central and peripheral 1:400 anti-Tuj1; Covance) followed by incubation in secondary antibody axons of DRG neurons can be clearly distinguished from one (1:1000 AlexaFluor-546 and AlexaFluor-488; Invitrogen) for1hatroom another. We find that bclw mRNA is clearly evident in cell bodies temperature, and counterstained with DAPI. Active caspase6 was quan- and peripheral nerves but is barely detectable in the central pro- tified using ImageJ software, taking the average of the mean fluorescence jections (Fig. 1F). In contrast, ␤-actin mRNA shows a high level within each axon as defined by Tuj1 staining. of expression in both central and peripheral nerves (Fig. 1F). Protein introduction. Recombinant His-tagged Bclw (R&D Systems) was introduced into E15 DRG sensory neurons using the Chariot protein This suggests that, in vivo, bclw mRNA is primarily localized to transfection system (Active Motif). ␤-Galactosidase protein was used as a peripherally extending axons that encounter target-derived control. Bclw or ␤-galactosidase (1 ␮g/␮l) was introduced into mass neurotrophins. cultures using 6 ␮l of Chariot or into the cell body or into distal axon As a retrograde response gene, bclw transcription is selectively compartments of compartmented chamber cultures by using 2 ␮lof induced in response to distal axon neurotrophin stimulation Chariot reagent. (Pazyra-Murphy et al., 2009; Courchesne et al., 2011). Using ϩ ϩ Ϫ Ϫ Footpad innervation. bclw / and bclw / animals of either sex were compartmented chamber cultures, we find that selective distal killed with isoflurane, and then footpad tissue from hindpaws was re- axon neurotrophin stimulation for 2 h not only increases bclw moved, fixed overnight in Zamboni’s fixative at 4°C, and cyropreserved ␮ levels in the cell bodies but also increases bclw mRNA levels in in 30% sucrose overnight at 4°C. Footpads were frozen, and 30 m axon compartments (Fig. 2A). In contrast, bclw mRNA levels do floating sections were prepared. Tissue sections were blocked in 10% normal goat serum and 0.1% Triton X-100 in PBS for1hatroom not change in either cell bodies or distal axons in response to temperature and then incubated in anti-tuj1 (1:400; Millipore Bioscience neurotrophin stimulation of cell bodies (Fig. 2B). In these exper- Research Reagents) or anti-substance P (1:100; R&D Systems) and anti- iments, the transcription factor c-fos serves as a critical control. Active/Cleaved Caspase6 (1:100; Imgenex) overnight at 4°C. Sections Expression of c-fos is induced in cell bodies in response to neu- were then incubated in goat anti-mouse AlexaFluor-488 (1:200; Invitro- rotrophin stimulation of either cell bodies or distal axons, and so gen) and goat anti-rabbit AlexaFluor-568 (1:200; Invitrogen) and DAPI provides a measure of successful stimulation, whereas c-fos (1:1000) for2hatroom temperature and mounted on gelatin-coated mRNA levels in axons are barely detectable and do not change slides. Confocal images were obtained using a Carl Zeiss LSM 510 META with neurotrophin stimulation (Fig. 2A,B). In these experiments ϫ upright confocal microscope, with a 40 oil objective. Caspase6 staining ␤-actin serves as a positive control, as neurotrophins induce was quantified using ImageJ software, taking the average of the mean transport of ␤-actin mRNA from cell bodies to axons (Willis et fluorescence per pixel within each z-stack of an axon outlined by Tuj1 or al., 2007), and so levels of ␤-actin mRNA in axons increase in substance P staining. Ϯ response to neurotrophin stimulation of distal axons (Fig. 2A). Statistics. Data are expressed as mean SEM. To assess statistical ␤ significance, data were analyzed by unpaired two-tailed Student’s t test or Interestingly, cell body stimulation also increases -actin mRNA by z test for a difference from 1. For multiple comparisons, data were levels in distal axons (Fig. 2B). analyzed by one-way ANOVA with post hoc Bonferroni or Dunnett cor- Neurotrophin-dependent increases in axonal bclw mRNA lev- rection. Significance was placed at p Ͻ 0.05 unless otherwise indicated. els could be the result of transport of mRNA from the cell body or 5198 • J. Neurosci., March 20, 2013 • 33(12):5195–5207 Cosker et al. • Target-Derived Neurotrophins

Figure1. BclwmRNAislocalizedinperipheralaxonsofsensoryneurons.A,Tuj1immunostaining(green)andDAPIstainingofE15DRGneuronsgrowninmicrofluidicchambers.Scalebar,60␮m. B, FISH assay of bclw, ␤-actin, and ␥-actin mRNA (red) in cell body (CB) and distal axon (DA) compartments. Counterstained images show Tuj1 antibody (green) and DAPI. Scale bars, 20 ␮m. C, mRNA from CB and DA of E15 DRG neurons grown in compartmented chamber cultures for bclw, ␤-actin, and ␥-actin analyzed by qRT-PCR. Data are presented as the mean ϩ SEM of DA mRNA/CB mRNA ratio, normalized to gapdh mRNA. Statistical analysis by z test. *p Ͻ 0.05 for a difference from 1. n ϭ 7. D, ISH in P0 DRGs and peripheral nerves with antisense bclw and nonsense control probes.Scalebars,500␮m.E,ISHinP0DRGsandperipheralnervewithantisense␤-actinand␥-actinandnonsensecontrolprobes.Scalebar,500␮m.F,ISHinP0DRGSandassociatedcentral(C) and peripheral (P) nerve with antisense bclw and ␤-actin probes. Scale bar, 500 ␮m. could reflect an increase in mRNA stability within the axon. To (Danckwardt et al., 2011) and the relative decay kinetics of bclw distinguish these possibilities, we removed the cell bodies of sen- mRNA over 8 h are unaffected by neurotrophins (Fig. 2E). We sory neurons grown in compartmented chamber cultures, then compared bclw with ␤-actin mRNA, which shows similar decay stimulated distal axons with neurotrophins for 2 h. In these ex- rates to previous studies (Leclerc et al., 2002), and found no sig- periments, axons are still responsive to neurotrophins in the ab- nificant difference in decay kinetics between ␤-actin and bclw sence of cell bodies for at least 6 h after cell body removal, as mRNA. Half-life measurements for c-fos and gapdh mRNA, shown by activation of Trk and Erk (Fig. 2D). After removal of which are respectively rapidly and very slowly degraded, served as cell bodies, increases in axonal bclw and ␤-actin mRNA are abro- controls (Guhaniyogi and Brewer, 2001). Together, these data gated, indicating that increased axonal mRNA is not simply the indicate a mechanism whereby neurotrophins induce transport result of local events that cause neurotrophin-dependent stabili- of bclw mRNA from cell bodies to axons, with no effect on mRNA zation of bclw mRNA in axons (Fig. 2C). To investigate further stability. whether neurotrophins regulate bclw mRNA stability, we studied We analyzed the temporal relationship between increases in mRNA decay kinetics. We labeled endogenous mRNA with cell body mRNA levels and those seen in the axon after axonal 4-thiouridine for 24 h (Zeiner et al., 2008), then removed neurotrophin stimulation of axons. Increased levels of bclw 4-thiouridine and measured changes in levels of labeled mRNA mRNA are seen in the cell body after 30 min of stimulation (Fig. over time by qRT-PCR. Half-life was quantified by obtaining the 3A). These data are in line with the time course seen for other decay rate constant from the line of best fit of a semilogarithmic early transcriptional changes induced by neurotrophin stimula- plot of mRNA concentration (Chen et al., 2008). The half-life of tion of these cultures (Riccio et al., 1997; Watson et al., 1999). bclw is 5 h, consistent with prior studies in non-neuronal cells Intriguingly, there is no increase in bclw mRNA levels in distal Cosker et al. • Target-Derived Neurotrophins J. Neurosci., March 20, 2013 • 33(12):5195–5207 • 5199

Figure 2. Neurotrophins regulate bclw mRNA in cell bodies and distal axons. A, Compartmented chamber cultures were stimulated with neurotrophins (NT; 100 ng/ml NGF ϩBDNF) at distal axons (DA) for 2 h. Bclw and ␤-actin mRNA is upregulated in cell bodies (CB) and distal axons (DA). Expres- sion is compared with neurons treated with vehicle (100 ng/ml BSA). Fold induction of c-fos mRNA is a control. All results represent the mean ϩ SEM. *p Ͻ 0.05, difference from 1 (z test); n ϭ 8. B, Expressionofc-fos,bclw,and␤-actinmRNAinCBandDAinresponseto2hNTstimulationofCB.*pϽ 0.05,differencefrom1(ztest);nϭ8.C,SeveringofcellbodiesduringNTstimulationofDAprevents increasesinbclwand␤-actinmRNAinDA.D,CellbodieswereseveredfromaxonsandDAlysateswere blotted with pTrk and pErk1/2. After 6 h, axons still respond to NT stimulation. Pan-actin was used as a loading control. E, Decay kinetics of bclw and ␤-actin mRNA and control mRNAs c-fos and gapdh in the absence (0) or presence (10) of NT. Data are presented as amount of 4-thio-labeled mRNA, nor- Figure 3. Bclw mRNA increases in cell bodies before distal axons. Compartmented chamber cul- malized to no thiol control; nϭ5. tureswerestimulatedwithneurotrophins(NT)atdistalaxons(DA)for30min,1h,2h,and4h.A,After 30 min NTs induce bclw mRNA expression increases only in cell bodies (CB). All data show mean ϩ SEM.*pϽ0.05,30minversus1h(Student’sttest);nϭ10.At1,2,and4h,bclwmRNAincreasesin axons until 1 h after stimulation (Fig. 3A). This temporal pattern both CB and DA. *p Ͻ 0.05, difference from 1 (z test); n ϭ 10. B, Expression of ␤-actin mRNA suggests that a retrograde signal must first reach the cell body and increasesat30min,1h,2h,and4hbothinCBandDA.*pϽ0.05,differencefrom1(ztest);nϭ10. increase transcription of bclw mRNA, before bclw mRNA in the C, Expression of c-fos mRNA is induced only in CB. *pϽ0.05, difference from 1 (ztest); nϭ10. distal axon can be affected. This is strikingly different from 5200 • J. Neurosci., March 20, 2013 • 33(12):5195–5207 Cosker et al. • Target-Derived Neurotrophins

␤-actin mRNA, where there is a concom- itant increase in mRNA levels in both cell bodies and distal axons by 30 min (Fig. 3B). At each time point, c-fos induction serves as a control for successful stimula- tion (Fig. 3C). Induction of bclw mRNA in cell bodies by neurotrophin stimulation of distal axons depends on a retrograde Trk-Erk5 pathway culminating in Mef2D-dependent tran- scription of bclw (Pazyra-Murphy et al., 2009). Because bclw mRNA levels are in- creased in axons after cell bodies, we asked whether axonal levels of bclw mRNA are also regulated through retrograde Trk-Erk sig- naling or through a distinct regulatory mechanism. Previous studies indicate that Trk kinase and Erk kinase activity is needed in both compartments for induction of bclw transcription (Watson et al., 1999; Watson et al., 2001). This reflects the role of trans- ported signaling endosomes containing ac- tivated Trks in these long-range responses (Ginty and Segal, 2002). Addition of the Trk Figure4. InhibitionofaTrk-ErkretrogradesignalblocksinductionofaxonalbclwmRNA.A,AdditionofTrkinhibitorK252a(K2; inhibitor K252a or the Erk inhibitor UO126 200nM)tocellbodies(CB)ordistalaxons(DA)blocksneurotrophin(NT)inductionofbclwmRNAinCBandDA.AlldatashowmeanϩSEM. at either location completely abrogates gene B, c-fos induction is blocked by addition of K2 to CB or DA. C, Western blot of NT-induced pTrk activation in DA. D, Addition of Erk induction of bclw in cell bodies (Fig. 4A,D). inhibitor U0126 (U0; 10 ␮M) to CB or DA blocks NT induction of bclw mRNA in CB and DA. E, c-fos induction is blocked by addition Similarly, c-fos induction is blocked in cell ofU0toCBorDA.F,WesternblotofNT-inducedpErk1/2activationinDA.*pϽ0.05(one-wayANOVAwithBonferronicorrection); bodies by this intervention (Fig. 4B,E). In- n ϭ 7. †p Ͻ 0.1 (one-way ANOVA with Bonferroni correction); n ϭ 7. terestingly, the increase in bclw mRNA in distal axons is also abrogated when K252a or transcribed thiouridine-labeled mRNA was isolated from each UO126 is applied to cell bodies (Fig. 4A,D), despite robust activa- compartment by biotin-streptavidin pull-down, and the tion of Trk and Erk in distal axons (Fig. 4C,F). This suggests that a neurotrophin-induced changes in newly transcribed mRNA were Trk-Erk signal from the distal axon must reach the cell body to assessed by qRT-PCR. As expected, neurotrophin stimulation increase axonal bclw mRNA. induces increases in labeled c-fos, bclw, and ␤-actin mRNA in cell bodies (Fig. 5D). We then analyzed newly transcribed mRNA in Newly transcribed bclw mRNA is targeted to axons after distal distal axons. Neurotrophin stimulation dramatically increases la- axon neurotrophin stimulation beled bclw mRNA in axons, indicating that newly made bclw To determine whether transport of bclw mRNA from cell bodies mRNA is rapidly transported to axons (Fig. 5E). In contrast, to distal axons requires transcription of bclw, distal axons were neurotrophin stimulation does not increase labeled, newly tran- stimulated with neurotrophins while the transcription inhibitor scribed ␤-actin mRNA in axons, supporting previous studies actD was added to the cell body compartment. Addition of actD showing transport of ␤-actin mRNA from preexisting cytoplas- to cell bodies prevents neurotrophin-dependent increases of bclw mic pools (Fig. 5E). No labeled c-fos mRNA is detected in axons. mRNA in axons. In contrast, neurotrophin-dependent increases In control experiments, distal axons were stimulated for 4 h with in axonal ␤-actin mRNA are unaffected by actD (Fig. 5B). Con- no 4-thiouridine during the period of stimulation, after 24 h trol experiments showed that actD blocks the increased expres- incubation with 4-thiouridine to label transcripts generated be- sion of c-fos, bclw, and ␤-actin in cell bodies, indicating successful fore neurotrophin stimulation (Fig. 5C). In these control exper- inhibition of transcription (Fig. 5A). Together with the time iments, where neurotrophin-induced mRNA is not labeled with course studies, these data indicate that bclw mRNA is regulated 4-thiouridine, there is no increase in labeled mRNA for c-fos, differently from ␤-actin mRNA and that changes in axonal bclw bclw,or␤-actin in cell bodies, and there is no increase in labeled mRNA levels depend on neurotrophin-induced transcription, mRNA for bclw in the axons, verifying the specificity of our assay whereas ␤-actin mRNA does not. (Fig. 5D). Thus bclw mRNA represents a new “class” of axonal Previous studies show ␤-actin mRNA can be transported to ax- mRNAs that are transcribed and immediately targeted to axons ons from preexisting pools of mRNA in cell bodies without new in response to target-derived neurotrophin stimulation. transcription (Willis et al., 2007). It is possible that transcription of bclw mRNA replenishes cytoplasmic mRNA pools available for ax- Axonal Bclw suppresses the caspase6 apoptotic pathway to onal transport. Alternatively, neurotrophins could regulate tran- prevent axon degeneration scription of bclw mRNA, such that the new bclw transcripts are To address the functional significance of neurotrophin regula- immediately targeted to axons. To follow newly made mRNA from tion of bclw mRNA in axons, we asked whether neurotrophins the cell bodies to the distal axons, we pulse-labeled mRNA with also regulate axonal Bclw protein. In response to8hofneurotro- 4-thiouridine (Zeiner et al., 2008) during2hofdistal axon neurotro- phin stimulation, Bclw protein levels are increased in both cell phin stimulation and followed the labeled mRNA for an additional body and in distal axon compartments (Fig. 6A). To test whether 2 h of distal axon neurotrophin stimulation (Fig. 5C). The newly this is the result of local translation of Bclw in the axon, we selec- Cosker et al. • Target-Derived Neurotrophins J. Neurosci., March 20, 2013 • 33(12):5195–5207 • 5201

Figure5. NewlytranscribedbclwmRNAisimmediatelytargetedtodistalaxons.A,Addition of actD to cell bodies (CB) inhibits transcription of c-fos, bclw, and ␤-actin mRNA in CB in response to distal axon (DA) neurotrophin (NT) stimulation. All data show mean ϩ SEM. *p Ͻ 0.05(Student’sttest);nϭ6.B,AdditionofactDtoCBblocksbclwmRNAincreaseindistalaxons (DA).*pϽ0.05(Student’sttest);nϭ6.C,TolabelnewmRNA,4-thiouridinewasaddedtoCB during2hofDANTstimulation and removed for a further2hDANTstimulation. In control experiments, 4-thiouridine was added for 24 h and removed before4hDAstimulation. D, Fold Figure 6. Neurotrophins regulate local translation of Bclw in distal axons. A, Western blot increase in newly transcribed c-fos, bclw, and ␤-actin mRNA in cell bodies. Levels of newly analysis and quantification of Bclw in cell body (CB) and distal axon (DA) lysate after8hofDA transcribed gapdh mRNA levels do not change. *p Ͻ 0.05 (Student’s t test); n ϭ 5. E, Fold neurotrophin (NT) stimulation. Results represent the mean ϩ SEM normalized to GAPDH; n ϭ increaseinnewlytranscribedbclwmRNAindistalaxons.*pϽ0.05(Student’sttest);nϭ5.F, 5. B, Western blot analysis and quantification of Bclw in CB and DA lysate after8hofDANT Total mRNA levels of c-fos, bclw, and ␤-actin in CB are upregulated in pulse and control exper- stimulation with cycloheximide (10 mg/ml) added to DA. Results represent the mean ϩ SEM iments. G, Total mRNA levels of c-fos, bclw, and ␤-actin in DA are upregulated in pulse and normalized to GAPDH; n ϭ 3. C, Western blot analysis and quantification of Bclw in CB and DA control experiments. *p Ͻ 0.05 for a difference from 1 (z test); n ϭ 5. lysate after8hofDANTstimulation with cycloheximide added to CB. Results represent the mean ϩ SEM normalized to GAPDH; n ϭ 3. *p Ͻ 0.05 (Student’s t test). tively inhibited protein synthesis in axons only, or in cell bodies is added to cell bodies, neurotrophins still increase axonal Bclw only, and then analyzed Bclw levels. When the translation inhib- (Fig. 6C).Together, these data suggest that neurotrophins regu- itor cycloheximide is added to distal axons, neurotrophins do not late Bclw at multiple steps: transcription, transport and perhaps increase Bclw in axons (Fig. 6B). In contrast, when cycloheximide local translation. 5202 • J. Neurosci., March 20, 2013 • 33(12):5195–5207 Cosker et al. • Target-Derived Neurotrophins

Figure 7. Local translation prevents axon degeneration and caspase6 activation. A,Tuj1-labeled axons in the presence (ϩNT; left) and absence (ϪNT; right) of neurotrophins. Axons were severed from cell bodies (no CB) or treated with anisomycin or cycloheximide as indicated and deprived of NT for 10 h. Binarized images show fragmented axons defined by the Analyze Particle function in National Institutes of Health ImageJ software. Scale bar, 40 ␮m. B, Quantification of axonal degeneration (ratio of area of fragmented axons to total axon area). p Ͻ 0.0001 (one-way ANOVA with Dunnett correction). Results represent the mean ϩ SEM. *p Ͻ 0.05 versus control ϩNT (one-way ANOVA with Dunnett correction); n ϭ 27–36 axonal fields from 5 experiments. Quantification for cycloheximide is not significantly different from anisomycin. C, Axons in the presence (ϩNT; right) and absence (ϪNT; left) of neurotrophins stained for activated caspase6. Caspase6 activation is detected in axons severed from cell bodies (no CB) or treated with anisomycin or cycloheximide. Scale bar, 40 ␮m. D, Quantification of activated caspase6 in DA shown in C. ResultsrepresentthemeanϩSEM.pϭ0.03(one-wayANOVAwithDunnettcorrection).*pϽ0.05versuscontrolϩNT(one-wayANOVAwithDunnettcorrection);nϭ17–24axonalfieldsfrom 3 experiments. Quantification for cycloheximide is not significantly different from anisomycin.

We previously demonstrated that Bclw is critical for haps resulting from local translation (Fig. 7A,B). Indeed, addition of neurotrophin-dependent axonal survival; in cultures from translation inhibitors anisomycin or cycloheximide to axons that bclw Ϫ/Ϫ mice, withdrawal of neurotrophins results in increased ax- remain attached to their cell bodies interrupts the ability of neu- onal degeneration (Courchesne et al., 2011). Therefore, we asked rotrophins to prevent axon degeneration (Fig. 7A,B). Neurotrophin whether manipulations that alter Bclw regulation affect withdrawal can activate an APP/DR6/caspase6 pathway to foster ax- neurotrophin-dependent axonal survival. Withdrawal of neurotro- onal degeneration (Nikolaev et al., 2009; Vohra et al., 2010; Simon et phins from distal axons for 10 h induces selective axonal degenera- al., 2012), and we observed activated caspase6 in degenerating axons tion (Fig. 7A,B). When severed from cell bodies, axonal after neurotrophin withdrawal (Fig. 7C,D), and inhibition of trans- degeneration is increased. This would be expected because many lation in axons by anisomycin or cycloheximide leads to increased survival factors are transported from cell bodies, including the Wal- levels of activated caspase6. Together, these data indicate that pro- lerian degeneration slow component, Nmnat (Gilley and Coleman, teins translated locally in axons prevent activation of caspase6 and 2010). Withdrawal of neurotrophins further increases axonal degen- promote axonal viability. eration in isolated axons severed from cell bodies, suggesting that To determine whether Bclw itself works within the axon to neurotrophins act locally to protect axons from degeneration, per- promote neurotrophin-dependent axon survival, we used a Cosker et al. • Target-Derived Neurotrophins J. Neurosci., March 20, 2013 • 33(12):5195–5207 • 5203

Figure 8. Axonal Bclw binds to Bax and prevents axon degeneration and caspase6 activation. A, Western blot for His after selective introduction of His-tagged Bclw protein into distal axons (DA) of DRG neuronsgrownincompartmentedchambercultures.B,Tuj1-labeledaxonsafterintroductionof␤-galactosidase(␤-gal)proteinorBclwproteintoDAafter24hneurotrophindeprivation(ϪNT).Scalebar,40 ␮m.C,Quantificationofaxonaldegenerationafterintroductionof␤-galorBclwproteintoDAafterremovalofNT.AlldatashowmeanϩSEM.pϭ0.0018(one-wayANOVAwithBonferronicorrection).*pϽ 0.05(one-wayANOVAwithBonferronicorrection);nϭ19–36axonalfieldsfrom4experiments.D,WesternblotforHisafterselectiveintroductionofHis-taggedBclwproteinintocellbodies(CB).E,Tuj1-labeled axons after introduction of ␤-galactosidase (␤-gal) protein or Bclw protein to CB after 24 h neurotrophin deprivation (ϪNT). Scale bar, 40 ␮m. F, Quantification of axonal degeneration after introduction of ␤-galorBclwproteintoCBafterremovalofNT.Statisticalanalysisbyone-wayANOVA.G,H,Quantificationofactivatedcaspase6inDAafterintroductionof␤-galproteinorBclwproteintoDA(G)orCB(H),in the presence (ϩNT) and absence (ϪNT) of neurotrophins. *pϽ0.05 (one-way ANOVA with Bonferroni correction); nϭ29–51 axonal fields from 4 experiments. I, Binding of His-tagged recombinant Bclw toBaxafterHispulldown.J,QuantificationofaxonaldegenerationafteradditionofABT-263toaxonswithBclwproteinintroducedtoaxons.*pϽ0.05(one-wayANOVAwithBonferronicorrection);nϭ10–24 axonalfieldsfrom3experiments.K,Quantificationofactivatedcaspase6inDAafteradditionofABT-263toaxonswithBclwproteinintroducedtoaxons.*pϽ0.05(one-wayANOVAwithBonferronicorrection); nϭ8–17 axonal fields from 3 experiments. protein transfection system to selectively introduce Bclw into ditions (Fig. 8B,C). Importantly, Bclw introduced to cell body axons. We efficiently and selectively transfected recombinant compartments rather than to axons (Fig. 8D) cannot prevent Bclw-His protein in axonal compartments (Fig. 8A). Intro- axonal degeneration in response to neurotrophin deprivation duction of Bclw in axons protects against axonal degeneration (Fig. 8E,F). To determine whether Bclw protection of axon caused by removal of neurotrophins, which is readily observed viability is associated with reduced caspase6 activation, we in control untransfected or ␤-galactosidase-transfected con- measured activated caspase6 in axons after Bclw protein was 5204 • J. Neurosci., March 20, 2013 • 33(12):5195–5207 Cosker et al. • Target-Derived Neurotrophins introduced. Transfection of Bclw into axons dramatically re- Discussion duces levels of activated caspase6 (Fig. 8G), whereas transfec- The retrograde response gene Bclw is transcriptionally upregu- tion of Bclw into cell bodies does not (Fig. 8H). These results lated in response to distal axon neurotrophin stimulation and is indicate that neurotrophin regulation of local, axonal synthe- critical for viability. Our studies have elucidated a mechanism by sis of Bclw is critical for supporting axonal survival and that which neurotrophin stimulation of distal axons induces tran- Bclw functions within the axon to suppress the caspase6 apo- scription of bclw mRNA and subsequent transport of those newly ptotic pathway. made transcripts from the cell body to the axon. Furthermore, It has been shown that Bclw binds to the BH3-binding Bclw protein functions within the axon to inhibit caspase6- protein Bax to prevent caspase activation (Yan et al., 2000a; mediated axonal apoptosis and promote neurotrophin- Kim et al., 2012). We found that recombinant Bclw protein dependent axonal survival. We postulate that the scope of Bclw introduced into DRG sensory neurons binds to Bax (Fig. 8I). regulation, at the level of transcription, transport, and transla- To determine whether Bclw protects axons from degeneration tion, reflects a mechanism by which signaling cascades are inte- through binding and sequestration of Bax, we applied the grated over time, thus promoting axonal maintenance only Bcl2/Bcl-xL/Bclw inhibitor ABT-263 to axons transfected with under conditions of sustained neurotrophin stimulation. recombinant Bclw protein. ABT-263 inhibits binding of Bcl2 Retrograde neurotrophin signaling has traditionally been family members to BH-3 domain proteins, including Bax (Tse thought of as a mechanism by which target-derived neurotro- et al., 2008; Merino et al., 2012), and we see a reduction in phins communicate to a remote cell body to elicit transcriptional recombinant Bclw protein binding to Bax after treatment with and translational changes required for neuronal survival (Cosker 500 nM ABT-263 (data not shown). Addition of ABT-263 to et al., 2008; Chowdary et al., 2012). In this way, only neurons that axons abrogates the ability of recombinant Bclw to prevent correctly reach their targets survive and are incorporated into a axon degeneration and caspase6 activation after neurotrophin functional circuit. Because a functional neural connection de- withdrawal (Fig. 8J,K). Together, these data indicate that pends on the maintenance of the axon as well as the cell body, it Bclw in axons binds to Bax and thereby suppresses the makes sense that an axon-derived neurotrophin signal would caspase6 apoptotic pathway. selectively induce expression of genes required for axonal sur- Previous studies have shown that axons cultured from vival. Our data reveal a bidirectional mechanism wherein retro- bclwϪ/Ϫ mice exhibit increased axon degeneration after neu- grade neurotrophin signaling from the axon activates a specific rotrophin withdrawal (Courchesne et al., 2011)(Fig. 9A). We transcriptional program of retrograde response genes that in turn examined whether recombinant Bclw protein introduced into increases expression of axon-targeted mRNA and protein critical axons deficient for bclw can rescue the axon degeneration pheno- for axonal maintenance. It seems likely that additional retrograde type. Introduction of Bclw protein into axons of sensory neurons response genes may also encode mRNAs that localize to the axon from bclwϪ/Ϫ mice grown in compartmented chamber cultures and generate protein products whose roles are primarily in the protects axons from degeneration after neurotrophin withdrawal axon. Intriguingly, it appears that, in vivo, bclw mRNA is predomi- (Fig. 9A). We then examined caspase6 activation in sensory axons Ϫ Ϫ nantly evident in axons that extend to peripheral, neurotrophin- from bclw / mice and found increased levels of caspase6 activa- ϩ/ϩ expressing targets, rather than in centrally projecting branches. tion after neurotrophin withdrawal compared with bclw ax- Ϫ Ϫ Indeed, in bclw / mice at 6 months of age, there is considerable ons (Fig. 9B,C). The increase in activated caspase6 is rescued Ϫ Ϫ loss of peripheral nerves in the epidermis, whereas nerves that with addition of recombinant Bclw protein to bclw / axons extend centrally into the spinal cord show no deficit (Courchesne (Fig. 9B,C). et al., 2011). Together, these findings suggest that the mecha- In vivo, Bclw is critical for sustained survival of sensory nisms regulating survival and maintenance of centrally and pe- axons (Courchesne et al., 2011). At 6 months of age, bclwϪ/Ϫ ripherally projecting axons differ from one another. There is mice show a progressive nociceptive neuropathy associated evidence in sensory neurons that there are indeed differences with a loss of epidermal innervation and axonal degeneration between the central and peripheral axons; for example, tyrosine- (Courchesne et al., 2011). We examined activated caspase6 hydroxylase appears to be differentially expressed in peripheral staining in axons of nociceptors that innervate the skin in ϩ/ϩ Ϫ/Ϫ and central axons (Brumovsky et al., 2006). Further studies will bclw and bclw mice at 6 months of age. We found sig- be needed to demonstrate whether there is an intrinsic localiza- nificantly elevated levels of activated caspase6 staining in tion element within bclw that targets the mRNA preferentially to Ϫ/Ϫ nerve endings stained with Tuj1 in bclw mice (Fig. 9D,E). peripheral axons or whether selective targeting of bclw depends Nociceptor axons in the epidermis include both peptidergic, on the local NGF stimulus present in the periphery. Loss of Bclw TrkA-expressing and nonpeptidergic, TrkA-independent fi- results in increased activated caspase6 and degeneration of the bers (Silos-Santiago et al., 1995; Molliver and Snider, 1997; peptidergic, NGF-responsive sensory fibers in the epidermis, in- Marmigere and Ernfors, 2007). To determine whether degen- dicating that Bclw functions to support NGF-dependent axon eration and caspase6 activation occur in axons of peptidergic maintenance in vivo. Other trophic factors in target tissues may Ϫ/Ϫ neurons in bclw mice, we examined caspase6 staining in similarly regulate Bclw for maintenance of long axons in neuro- substance P-positive fibers. Activated caspase6 staining is increased nal subtypes that do not express TrkA. Ϫ Ϫ in subtance P positive-nerve endings in bclw / mice (Fig. 9F,G), Regulated transport of mRNA to distal axons in response to demonstrating that in vivo Bclw is critical for maintenance of NGF- neurotrophins requires localization elements often found within responsive, peptidergic axons. Together, these studies suggest that the 3ЈUTR (Andreassi and Riccio, 2009; Donnelly et al., 2010). neurotrophins induce increased axonal Bclw through regulated The best characterized is the 3Ј zipcode element in the 3ЈUTR of transcription, mRNA transport, and translation, resulting in sup- ␤-actin mRNA, which contains a 54-nucleotide sequence (“zip- pression of the Bax-caspase6 apoptotic cascade and thus preventing code”) responsible for axonal localization (Ross et al., 1997). This axonal degeneration. is achieved through binding to the mRNA binding protein ZBP1 Cosker et al. • Target-Derived Neurotrophins J. Neurosci., March 20, 2013 • 33(12):5195–5207 • 5205

Figure 9. Loss of Bclw leads to increased axon degeneration and caspase6 activation in NGF-responsive axons in vitro and in vivo. A, Quantification of axonal degeneration after introductionofBclwproteintoDAofbclwϪ/Ϫ afterremovalofNT.Dataisrepresentedbythemeanϩ SEM.p Ͻ 0.0001(one-wayANOVA).*p Ͻ 0.05(one-wayANOVA).B,Tuj1-labeled axons and activated caspase6 staining from bclwϩ/ϩ, bclwϪ/Ϫ, and bclwϪ/Ϫ axons transfected with recombinant Bclw protein (ϩBclw) in DRG neurons grown in compartmented chamber cultures in absence of NT. Scale bar, 40 ␮m. C, Quantification of activated caspase6 in DA shown in B. p ϭ 0.009 (ANOVA with Bonferroni correction). *p Ͻ 0.05 (ANOVA with Bonferroni correction). †p Ͻ 0.1 (ANOVA with Bonferroni correction); n ϭ 38 axonal fields from 3 bclwϩ/ϩ mice, n ϭ 39 axonal fields from 3 bclwϪ/Ϫ mice, and n ϭ 28 axonal fields from 3 bclwϪ/Ϫ mice transfected with recombinant Bclw protein. D, Six-month-old bclwϪ/Ϫ mice show increased activated caspase6 staining in axons innervating the skin, costained withTuj1.Scalebars,50␮m.E,Quantificationofactivatedcaspase6inaxonsof6-month-oldbclwϪ/Ϫ andbclwϩ/ϩ mice.Alldatashowmeanϩ SEM.*p Ͻ 0.05(Student’st test);n ϭ 3 animals per genotype, 3–5 sections per animal. F, Six-month-old bclwϪ/Ϫ mice show increased caspase6 staining in substance P-positive fibers innervating the skin. Scale bars, 50 ␮m. G, Quantification of activated caspase6 in substance P-positive axons of 6-month-old bclwϪ/Ϫ and bclwϩ/ϩ mice. *p Ͻ 0.05 (Student’s t test); n ϭ 3 animals per genotype, 3–5 sections per animal. 5206 • J. Neurosci., March 20, 2013 • 33(12):5195–5207 Cosker et al. • Target-Derived Neurotrophins

(zipcode binding protein). ZBP1 associates with ␤-actin mRNA suggest that axonal degeneration after neurotrophin withdrawal during transcription (Oleynikov and Singer, 2003; Pan et al., is mediated through a distinct apoptotic pathway that requires 2007) and also during transport to the axons. However, ␤-actin activation of Bax and caspase3 and the downstream effector transcription and mRNA transport appear to be separately regu- caspase6 (Nikolaev et al., 2009; Vohra et al., 2010; Simon et al., lated. Thus, bclw and ␤-actin may represent two distinct classes of 2012). Bclw is known to bind to Bax and inhibit its mitochondrial neurotrophin-regulated mRNA: those whose transcription and pore-forming ability (Yan et al., 2000b; Kim et al., 2012). Here we transport into axons are coregulated and those whose transport have shown that Bclw binds to Bax and thereby suppresses acti- into axons is independent of transcriptional regulation. As bclw vation of caspase6 and protects axons from degeneration. Thus, does not contain the same “zipcode” within its 3ЈUTR as ␤-actin, Bclw appears to be the axonal antiapoptotic Bcl2 member critical other cis-localization elements and trans-binding mRNA binding for neurotrophin-dependent axonal survival. Bax is also required proteins are likely to be responsible for targeting bclw mRNA to for axon degeneration after axonal injury, which occurs indepen- axons. The long 2.7 kB 3ЈUTR of bclw transcripts may contain dently of caspase activation (Schoenmann et al., 2010). Thus, several as yet unidentified localization motifs (Andreassi and Bclw can prevent axon degeneration induced by neurotrophin Riccio, 2009; Cosker and Segal, 2010). Identification of such lo- deprivation and could also play a protective role against axon calization elements and mRNA-binding proteins that interact degeneration after injury. with bclw mRNA will give further understanding into how neu- This work provides new understanding of the mechanisms rotrophins regulate axonal bclw mRNA levels. It will be interest- whereby neurotrophins coordinate signals between distal axons ing to investigate whether mRNAs whose transcription and and cell bodies to maintain and preserve connected neurons transport are closely linked might share mRNA-binding proteins within a functioning circuit. Our findings suggest that target- and whether this group of mRNAs shares transport mechanisms. derived neurotrophins induce transcription and transport of Neurotrophin stimulation increases axonal mRNA for both Bclw to regulate axonal levels of bclw mRNA and that the func- bclw and ␤-actin, and abundant evidence indicates that this re- tion of Bclw protein in axons is critical for suppression of the sults, at least in part, from mRNA transport (Willis et al., 2007). caspase6 apopotic cascade and long-term axonal survival. Under- However, it is not known whether neurotrophin-dependent standing how Bclw is regulated in developing neurons provides changes in mRNA stability might also contribute to regulation of insight into axonal viability during normal development of neu- axonal mRNAs. Here we measured the half-life of bclw mRNA ronal circuitry and into axonal degeneration in progressive neu- and showed that it is not regulated by neurotrophins in DRG rodegenerative disorders. neurons. We also measured ␤-actin mRNA stability and found that neurotrophins lead to slight changes in stability. These re- sults cannot exclude the possibility that the stability of mRNAs References within axons is differentially regulated than elsewhere in the cell. Andreassi C, Riccio A (2009) To localize or not to localize: mRNA fate is in Ј Nonetheless, these data strongly suggest that the neurotrophin- 3 UTR ends. Trends Cell Biol 19:465–474. CrossRef Medline ␤ Andreassi C, Zimmermann C, Mitter R, Fusco S, Devita S, Saiardi A, Riccio A dependent increase in axonal bclw and -actin mRNA are pre- (2010) An NGF-responsive element targets myo-inositol monophospha- dominantly the result of regulated mRNA transport. tase-1 mRNA to sympathetic neuron axons. Nat Neurosci 13:291–301. Like other Bcl-2 family members, Bclw is associated with mi- CrossRef Medline tochondria (O’Reilly et al., 2001). A significant proportion of Brumovsky P, Villar MJ, Ho¨kfelt T (2006) Tyrosine hydroxylase is ex- axonally localized mRNAs encode mitochondrial-associated pressed in a subpopulation of small dorsal root ganglion neurons in the components (Zivraj et al., 2010; Gumy et al., 2011), and local adult mouse. Exp Neurol 200:153–165. CrossRef Medline protein synthesis in axons is critical for mitochondrial health Campenot RB (1982) Development of sympathetic neurons in compart- mentalized cultures: II. Local control of neurite survival by nerve growth (Hillefors et al., 2007). Failure to maintain healthy mitochondria factor. Dev Biol 93:13–21. CrossRef Medline in axons is associated with neurodegenerative diseases and Chen CY, Ezzeddine N, Shyu AB (2008) Messenger RNA half-life measure- results in axonal degeneration (Court and Coleman, 2012). ments in mammalian cells. Methods Enzymol 448:335–357. CrossRef Ϫ Ϫ Mitochondria in bclw / axons show increased length and Medline impaired membrane potential (Courchesne et al., 2011). Ab- Chowdary PD, Che DL, Cui B (2012) Neurotrophin signaling via long- normal mitochondrial morphology and impaired energy pro- distance axonal transport. Annu Rev Phys Chem 63:571–594. CrossRef duction in bclwϪ/Ϫ mice may contribute to the selective axonal Medline Cosker KE, Segal RA (2010) The longer U(T)R, the further you go. Nat degeneration observed. Intriguingly, laminB2, another mRNA Neurosci 13:273–275. CrossRef Medline that is locally translated in axons, also associates with the mito- Cosker KE, Courchesne SL, Segal RA (2008) Action in the axon: generation chondria (Yoon et al., 2012), and loss of LaminB2 also leads to and transport of signaling endosomes. Curr Opin Neurobiol 18:270–275. elongated mitochondria and decreased membrane potential. Al- CrossRef Medline though the role for LaminB2, a nuclear-associated intermediate Courchesne SL, Karch C, Pazyra-Murphy MF, Segal RA (2011) Sensory filament protein, at axonal mitochondria is currently unknown, neuropathy attributable to loss of Bcl-w. J Neurosci 31:1624–1634. CrossRef Medline these observations lend further support to the idea that axonal Court FA, Coleman MP (2012) Mitochondria as a central sensor for axonal mitochondria require a local supply of new proteins. Local trans- degenerative stimuli. Trends Neurosci 35:364–372. CrossRef Medline lation of mRNAs, such as bclw or laminB2, may be a mechanism Danckwardt S, Gantzert AS, Macher-Goeppinger S, Probst HC, Gentzel M, by which healthy mitochondria are maintained in long axons to Wilm M, Gro¨ne HJ, Schirmacher P, Hentze MW, Kulozik AE (2011) prevent axonal degeneration. Further work will be needed to de- p38 MAPK controls prothrombin expression by regulated RNA 3Јend finitively demonstrate local translation of Bclw and to show that processing. Mol Cell 41:298–310. CrossRef Medline newly synthesized protein functions to support mitochondrial Donnelly CJ, Fainzilber M, Twiss JL (2010) Subcellular communication through RNA transport and localized protein synthesis. Traffic 11:1498– health in axons. 1505. CrossRef Medline As a Bcl2 family member, Bclw functions to promote cell sur- Gilley J, Coleman MP (2010) Endogenous Nmnat2 is an essential survival vival through inhibition of the apoptotic cascade and so is likely factor for maintenance of healthy axons. PLoS Biol 8:e1000300. CrossRef to play a direct role in regulating axonal survival. Recent studies Medline Cosker et al. • Target-Derived Neurotrophins J. Neurosci., March 20, 2013 • 33(12):5195–5207 • 5207

Ginty DD, Segal RA (2002) Retrograde neurotrophin signaling: Trk-ing E, Yaron A (2010) Axonal degeneration is regulated by the apoptotic along the axon. Curr Opin Neurobiol 12:268–274. CrossRef Medline machinery or a NADϩ-sensitive pathway in insects and mammals. J Neu- Guhaniyogi J, Brewer G (2001) Regulation of mRNA stability in mamma- rosci 30:6375–6386. CrossRef Medline lian cells. Gene 265:11–23. CrossRef Medline Segal RA (2003) Selectivity in neurotrophin signaling: theme and variations. Gumy LF, Yeo GS, Tung YC, Zivraj KH, Willis D, Coppola G, Lam BY, Twiss Annu Rev Neurosci 26:299–330. CrossRef Medline JL, Holt CE, Fawcett JQ (2011) Transcriptome analysis of embryonic and Segal RA, Bhattacharyya A, Rua LA, Alberta JA, Stephens RM, Kaplan DR, adult sensory axons reveals changes in mRNA repertoire localization. Stiles CD (1996) Differential utilization of Trk autophosphorylation RNA 17:85–98. CrossRef Medline sites. J Biol Chem 271:20175–20181. CrossRef Medline Hafezparast M, Klocke R, Ruhrberg C, Marquardt A, Ahmad-Annuar A, Silos-Santiago I, Molliver DC, Ozaki S, Smeyne RJ, Fagan AM, Barbacid M, Bowen S, Lalli G, Witherden AS, Hummerich H, Nicholson S, Morgan Snider WD (1995) Non-TrkA-expressing small DRG neurons are lost in PJ, Oozageer R, Priestley JV, Averill S, King VR, Ball S, Peters J, Toda TrkA deficient mice. J Neurosci 15:5929–5942. Medline T, Yamamoto A, Hiraoka Y, et al (2003) Mutations in dynein link Simon DJ, Weimer RM, McLaughlin T, Kallop D, Stanger K, Yang J, O’Leary motor neuron degeneration to defects in retrograde transport. Science DD, Hannoush RN, Tessier-Lavigne M (2012) A caspase cascade regu- 300:808–812. CrossRef Medline lated developmental axon degeneration. J Neurosci 32:17540–17553. Heerssen HM, Pazyra MF, Segal RA (2004) Dynein motors transport acti- CrossRef Medline vated Trks to promote survival of target-dependent neurons. Nat Neuro- Skaper SD (2012) The neurotrophin family of neurotrophic factors: an sci 7:596–604. CrossRef Medline overview. Methods Mol Biol 846:1–12. CrossRef Medline Hillefors M, Gioio AE, Mameza MG, Kaplan BB (2007) Axon viability and Tse C, Shoemaker AR, Adickes J, Anderson MG, Chen J, Jin S, Johnson EF, mitochondrial function are dependent on local protein synthesis in sym- Marsh KC, Mitten MJ, Nimmer P, Roberts L, Tahir SK, Xiao Y, Yang X, pathetic neurons. Cell Mol Neurobiol 27:701–716. CrossRef Medline Zhang H, Fesik S, Rosenberg SH, Elmore SW (2008) ABT-263: a potent Kim EM, Kim J, Park JK, Hwang SG, Kim WJ, Lee WJ, Kang SW, Um HD and orally bioavailable Bcl-2 family inhibitor. Cancer Res 68:3421–3428. (2012) Bcl-w promotes cell invasion by blocking the invasion- CrossRef Medline suppressing action of Bax. Cell Signal 24:1163–1172. CrossRef Medline Vohra BP, Sasaki Y, Miller BR, Chang J, DiAntonio A, Milbrandt J (2010) Leclerc GJ, Leclerc GM, Barredo JC (2002) Real-time RT-PCR analysis of Amyloid precursor protein cleavage-dependent and -independent axonal mRNA decay: half-life of ␤-actin mRNA in human leukemia CCRF-CEM degeneration programs share a common nicotinamide mononucleotide and Nalm-6 cell lines. Cancer Cell Int 2:1. CrossRef Medline adenylyltransferase 1-sensitive pathway. J Neurosci 30:13729–13738. Luo L, O’Leary DD (2005) Axon retraction and degeneration in develop- CrossRef Medline ment and disease. Annu Rev Neurosci 28:127–156. CrossRef Medline Watson FL, Heerssen HM, Moheban DB, Lin MZ, Sauvageot CM, Bhattacha- Marmige`re F, Ernfors P (2007) Specification and connectivity of neuronal ryya A, Pomeroy SL, Segal RA (1999) Rapid nuclear responses to target- subtypes in the sensory lineage. Nat Rev Neurosci 8:114–127. CrossRef derived neurotrophins require retrograde transport of ligand-receptor Medline complex. J Neurosci 19:7889–7900. Medline Me´rino D, Khaw SL, Glaser SP, Anderson DJ, Belmont LD, Wong C, Yue P, Watson FL, Heerssen HM, Bhattacharyya A, Klesse L, Lin MZ, Segal RA Robati M, Phipson B, Fairlie WD, Lee EF, Campbell KJ, Vandenberg CJ, (2001) Neurotrophins use the Erk5 pathway to mediate a retrograde sur- Cory S, Roberts AW, Ludlam MJ, Huang DC, Bouillet P (2012) Bcl-2, vival response. Nat Neurosci 4:981–988. CrossRef Medline Bcl-x(L), and Bcl-w are not equivalent targets of ABT-737 and navitoclax Willis DE, van Niekerk EA, Sasaki Y, Mesngon M, Merianda TT, Williams (ABT-263) in lymphoid and leukemic cells. Blood 119:5807–5816. GG, Kendall M, Smith DS, Bassell GJ, Twiss JL (2007) Extracellular CrossRef Medline stimuli specifically regulate localized levels of individual neuronal mR- Molliver DC, Snider WD (1997) Nerve growth factor receptor TrkA is NAs. J Cell Biol 178:965–980. CrossRef Medline down-regulated during postnatal development by a subset of dorsal root Willis D, Li KW, Zheng JQ, Chang JH, Smit AB, Kelly T, Merianda TT, ganglion neurons. J Comp Neurol 381:428–438. CrossRef Medline Sylvester J, van Minnen J, Twiss JL (2005) Differential transport and Nikolaev A, McLaughlin T, O’Leary DD, Tessier-Lavigne M (2009) APP local translation of cytoskeletal, injury-response, and neurodegeneration binds DR6 to trigger axon pruning and neuron death via distinct caspases. protein mRNAs in axons. J Neurosci 25:778–791. CrossRef Medline Nature 457:981–989. CrossRef Medline Yan C, Chen J, Chen D, Minami M, Pei W, Yin XM, Simon RP (2000) Oleynikov Y, Singer RH (2003) Real-time visualization of ZBP1 association Overexpression of the cell death suppressor Bcl-w in ischemic brain: im- with ␤-actin mRNA during transcription and localization. Curr Biol 13: plications for a neuroprotective role via the mitochondrial pathway. 199–207. CrossRef Medline J Cereb Blood Flow Metab 20:620–630. Medline O’Reilly LA, Print C, Hausmann G, Moriishi K, Cory S, Huang DC, Strasser A Yan W, Samson M, Je´gou B, Toppari J (2000) Bcl-w forms complexes with (2001) Tissue expression and subcellular localization of the pro-survival Bax and Bak, and elevated rations of Bax/Bcl-w and Bak/Bcl-w corre- molecule Bcl-w. Cell Death Differ 8:486–494. CrossRef Medline spond to spermatogonial and spermatocyte apoptosis in the testis. Mol Pan F, Hu¨ttelmaier S, Singer RH, Gu W (2007) ZBP2 facilitates binding Endocrinol 14:682–699. CrossRef Medline of ZBP1 to ␤-actin mRNA during transcription. Mol Cell Biol 27: Yao J, Sasaki Y, Wen Z, Bassell GJ, Zheng JQ (2006) An essential role for 8340–8351. CrossRef Medline ␤-actin mRNA localization and translation in Ca 2ϩ-dependent growth Pazyra-Murphy MF, Segal RA (2008) Preparation and maintenance of dor- cone guidance. Nat Neurosci 9:1265–1273. CrossRef Medline sal root ganglia neurons in compartmented cultures. J Vis Exp 20. Yoon BC, Zivraj KH, Holt CE (2009) Local translation and mRNA traffick- Pazyra-Murphy MF, Hans A, Courchesne SL, Karch C, Cosker KE, Heerssen ing in axon pathfinding. Results Probl Cell Differ 48:269–288. CrossRef HM, Watson FL, Kim T, Greenberg ME, Segal RA (2009) A retrograde Medline neuronal survival response: target-derived neurotrophins regulate Yoon BC, Jung H, Dwivedy A, O’Hare CM, Zivraj KH, Holt CE (2012) Local MEF2D and bcl-w. J Neurosci 29:6700–6709. CrossRef Medline translation of extranuclear lamin B promotes axon maintenance. Cell Riccio A, Pierchala BA, Ciarallo CL, Ginty DD (1997) An NGF-TrkA- 148:752–764. CrossRef Medline mediated retrograde signal to transcription factor CREB in sympathetic Zeiner GM, Cleary MD, Fouts AE, Meiring CD, Mocarski ES, Boothroyd JC neurons. Science 277:1097–1100. CrossRef Medline (2008) RNA analysis by biosynthetic tagging using 4-thiouracil and ura- Ross AF, Oleynikov Y, Kislauskis EH, Taneja KL, Singer RH (1997) Charac- cil phosphoribosyltransferase. Methods Mol Biol 419:135–146. CrossRef terization of a ␤-actin mRNA zipcode-binding protein. Mol Cell Biol Medline 17:2158–2165. Medline Zhang HL, Singer RH, Bassell GJ (1999) Neurotrophin regulation of ␤-actin Ross AJ, Waymire KG, Moss JE, Parlow AF, Skinner MK, Russell LD, mRNA and protein localization within growth cones. J Cell Biol 147:59– MacGregor GR (1998) Testicular degeneration in Bclw-deficient mice. 70. CrossRef Medline Nat Genet 18:251–256. CrossRef Medline Zhang HL, Eom T, Oleynikov Y, Shenoy SM, Liebelt DA, Dictenberg JB, Sasaki Y, Vohra BP, Lund FE, Milbrandt J (2009) Nicotinamide mononucle- Singer RH, Bassell GJ (2001) Neurotrophin-induced transport of a otide adenylyl transferase-mediated axonal protection requires enzymatic ␤-actin mRNP complex increases ␤-actin levels and stimulates growth activity but not increased levels of neuronal nicotinamide adenine dinu- cone motility. Neuron 31:261–275. CrossRef Medline cleotide. J Neurosci 29:5525–5535. CrossRef Medline Zivraj KH, Tung YC, Piper M, Gumy L, Fawcett JW, Yeo GS, Holt CE (2010) Schoenmann Z, Assa-Kunik E, Tiomny S, Minis A, Haklai-Topper L, Arama Subcellular profiling reveals distinct and developmentally regulated rep- 5207a • J. Neurosci., March 20, 2013 • 33(12):5195–5207 Cosker et al. • Target-Derived Neurotrophins

ertoire of growth cone mRNAs. J Neurosci 30:15464–15478. CrossRef Medline