DOCSLIB.ORG

Traffic Jam at the Synapse Age and Density of the Cortical Cultures

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Traffic Jam at the Synapse Age and Density of the Cortical Cultures RESEARCH HIGHLIGHTS DOI: VESICULAR TRAFFICKING endocytic traffic. Furthermore, these 10.1038/nrn2166 structures became more numerous and elaborate with increasing Traffic jam at the synapse age and density of the cortical cultures. Extracellular tracers during stimulation showed that although the synaptic vesicle formation, the formation of vesicles was not efficient authors were surprised to find that and recovery after stimulation took dynamin-1-knockout mice had an longer, vesicle formation did occur in apparently normal prenatal develop- dynamin-1-knockout mice. ment. However, these mice die within The researchers measured the net two weeks after birth which indicates rate of endo/exocytosis with the help that, postnatally, dynamin 1 is indis- of synapto-pHluorin, a chimaera pensable. of a synaptic vesicle protein and a The authors investigated synaptic fluorophore that is quenched at low transmission in primary cortical cul- pH, which is relevant as the lumen tures derived from knockout mice and of synaptic vesicles is acidified. showed that in electrophysiological Stimulation of neurotransmitter recordings, although synaptic events release at increasingly high frequen- occurred, the peak amplitude of single cies will reach a threshold at which evoked miniature inhibitory postsy- endocytosis can no longer keep naptic currents (mIPSCs) was greatly up with exocytosis, and therefore reduced in the absence of dynamin 1. the net rate of endo/exocytosis will Furthermore, sustained stimulation decline. Comparing cortical cultures led to a faster depression of mIPSCs, derived from wild-type and knockout with slower recovery. These findings mice, the authors observed that the suggest that synaptic transmission was threshold of this decline was reached less effective in the knockout mice, but at a lower stimulation frequency in unexpectedly was not abolished. the knockout cultures, consistent Investigating tissue sections and with impaired vesicle recovery. This cultured neurons by electron micros- impairment of endocytosis could Electron micrograph of a Neurotransmission involves a tightly copy, the authors noticed that synaptic be rescued by transfection with synapse from a cultured cortical neuron of a controlled balancing act between vesicles were often heterogeneous in dynamin 1 and also by overexpres- dynamin-1-knockout mouse. synaptic vesicle exocytosis and endo- size and on average slightly larger in sion of dynamin 3, but only partially Note the presence of abnormally large vesicles cytosis. One of the key players in knockout samples, yet the number of by overexpression of dynamin 2. sparsely distributed among endocytosis is the GTPase dynamin, vesicles was only moderately reduced These results suggest overlapping, synaptic vesicles, and numerous clathrin coated which assembles at the neck of at most synapses. This indicates that but also different, functions of the profiles with tubular necks. clathrin-coated pits and regulates dynamin 1 is not required for the three isoforms. Tomographic analysis of similar synapses indicated the fission of endocytic vesicles. In a biogenesis of synaptic vesicles. Ferguson et al. showed that that the most of these recent Science paper, Ferguson et al. Imaging studies using extracellular dynamin 1 has a key role during profiles are connected to the plasma membrane by showed that dynamin 1 is not tracers demonstrated the presence of endocytosis at synaptic sites under branched tubular networks. required for embryonal development intracellular, unusual, interconnected conditions of high synaptic activity. Image courtesy of S. Ferguson, S. Paradise and P. and is essential for endocytosis and and branched clathrin-coated vesicu- Further studies are required to shed De Camilli, Department of synaptic transmission only during lar structures that were continuous light on the mechanisms that these Cell Biology, Howard high synaptic activity. with the plasma membrane of cul- mice use to compensate for the loss Hughes Medical Institute, Yale University School of There are three mammalian tured dynamin-1-knockout neurons. of dynamin 1 during development Medicine, New Haven, isoforms, dynamin 1–3, of which This is in stark contrast to the very and low-level synaptic stimulation. Connecticut, USA. dynamin 1 is by far the most few clathrin-coated profiles observed Claudia Wiedemann abundant in the nervous system. in wild-type neurons, generally single Clustering of synaptic vesicles at pits or single vesicles. This suggests ORIGINAL RESEARCH PAPER synaptic sites is a defining event in that the final stages of endocytosis Ferguson S. M. et al. A selective activity- dependent requirement for dynamin 1 in synaptic synapse formation. So, as dynamin 1 were impaired in dynamin-1-knock- vesicle endocytosis. Science 316, 570–574 (2007) was believed to be essential for out mice, resulting in a backup of NATURE REVIEWS | NEUROSCIENCE VOLUME 8 | JUNE 2007 © 2007 Nature Publishing Group .
Load more

Recommended publications
  • Variable Priming of a Docked Synaptic Vesicle PNAS PLUS
    Variable priming of a docked synaptic vesicle PNAS PLUS Jae Hoon Junga,b,c, Joseph A. Szulea,c, Robert M. Marshalla,c, and Uel J. McMahana,c,1 aDepartment of Neurobiology, Stanford University School of Medicine, Stanford, CA 94305; bDepartment of Physics, Stanford University School of Humanities and Sciences, Stanford, CA 94305; and cDepartment of Biology, Texas A&M University, College Station, TX 77845 Edited by Thomas S. Reese, National Institutes of Health, Bethesda, MD, and approved January 12, 2016 (received for review November 30, 2015) The priming of a docked synaptic vesicle determines the proba- transition. Biochemical and electrophysiological approaches have bility of its membrane (VM) fusing with the presynaptic membrane provided evidence that priming is mediated by interactions be- (PM) when a nerve impulse arrives. To gain insight into the nature tween the SNARE proteins and their regulators (7, 12–14, 24) and of priming, we searched by electron tomography for structural can involve differences in positioning of docked SVs relative to + relationships correlated with fusion probability at active zones of Ca2 channels (25). Biochemistry has also led to the suggestion axon terminals at frog neuromuscular junctions. For terminals that primed SVs may become deprimed (26). fixed at rest, the contact area between the VM of docked vesicles We have previously shown by electron tomography on frog and PM varied >10-fold with a normal distribution. There was no neuromuscular junctions (NMJs) fixed at rest that there are, for merging of the membranes. For terminals fixed during repetitive docked SVs, variations in the extent of the VM–PM contact area evoked synaptic transmission, the normal distribution of contact and in the length of the several AZM macromolecules linking areas was shifted to the left, due in part to a decreased number of the VM to the PM, the so-called ribs, pegs, and pins (2, 27).
    [Show full text]
  • Mechanisms of Synaptic Plasticity Mediated by Clathrin Adaptor-Protein Complexes 1 and 2 in Mice
    Mechanisms of synaptic plasticity mediated by Clathrin Adaptor-protein complexes 1 and 2 in mice Dissertation for the award of the degree “Doctor rerum naturalium” at the Georg-August-University Göttingen within the doctoral program “Molecular Biology of Cells” of the Georg-August University School of Science (GAUSS) Submitted by Ratnakar Mishra Born in Birpur, Bihar, India Göttingen, Germany 2019 1 Members of the Thesis Committee Prof. Dr. Peter Schu Institute for Cellular Biochemistry, (Supervisor and first referee) University Medical Center Göttingen, Germany Dr. Hans Dieter Schmitt Neurobiology, Max Planck Institute (Second referee) for Biophysical Chemistry, Göttingen, Germany Prof. Dr. med. Thomas A. Bayer Division of Molecular Psychiatry, University Medical Center, Göttingen, Germany Additional Members of the Examination Board Prof. Dr. Silvio O. Rizzoli Department of Neuro-and Sensory Physiology, University Medical Center Göttingen, Germany Dr. Roland Dosch Institute of Developmental Biochemistry, University Medical Center Göttingen, Germany Prof. Dr. med. Martin Oppermann Institute of Cellular and Molecular Immunology, University Medical Center, Göttingen, Germany Date of oral examination: 14th may 2019 2 Table of Contents List of abbreviations ................................................................................. 5 Abstract ................................................................................................... 7 Chapter 1: Introduction ............................................................................
    [Show full text]
  • Part III: Modeling Neurotransmission – a Cholinergic Synapse
    Part III: Modeling Neurotransmission – A Cholinergic Synapse Operation of the nervous system is dependent on the flow of information through chains of neurons functionally connected by synapses. The neuron conducting impulses toward the synapse is the presynaptic neuron, and the neuron transmitting the signal away from the synapse is the postsynaptic neuron. Chemical synapses are specialized for release and reception of chemical neurotransmitters. For the most part, neurotransmitter receptors in the membrane of the postsynaptic cell are either 1.) channel-linked receptors, which mediate fast synaptic transmission, or 2.) G protein-linked receptors, which oversee slow synaptic responses. Channel-linked receptors are ligand-gated ion channels that interact directly with a neurotransmitter and are called ionotropic receptors. Alternatively, metabotropic receptors do not have a channel that opens or closes but rather, are linked to a G-protein. Once the neurotransmitter binds to the metabotropic receptor, the receptor activates the G-protein which, in turn, goes on to activate another molecule. 3a. Model the ionotropic cholinergic synapse shown below. Be sure to label all of the following: voltage-gated sodium channel, voltage-gated potassium channel, neurotransmitter, synaptic vesicle, presynaptic cell, postsynaptic cell, potassium leak channel, sodium-potassium pump, synaptic cleft, acetylcholine receptor, acetylcholinesterase, calcium channel. When a nerve impulse (action potential) reaches the axon terminal, it sets into motion a chain of events that triggers the release of neurotransmitter. You will next model the events of neurotransmission at a cholinergic synapse. Cholinergic synapses utilize acetylcholine as the chemical of neurotransmission. MSOE Center for BioMolecular Modeling Synapse Kit: Section 3-6 | 1 Step 1 - Action potential arrives at the Step 2 - Calcium channels open in the terminal end of the presynaptic cell.
    [Show full text]
  • Molecular Mechanism of Fusion Pore Formation Driven by the Neuronal SNARE Complex
    Molecular mechanism of fusion pore formation driven by the neuronal SNARE complex Satyan Sharmaa,1 and Manfred Lindaua,b aLaboratory for Nanoscale Cell Biology, Max Planck Institute for Biophysical Chemistry, 37077 Göttingen, Germany and bSchool of Applied and Engineering Physics, Cornell University, Ithaca, NY 14850 Edited by Axel T. Brunger, Stanford University, Stanford, CA, and approved November 1, 2018 (received for review October 2, 2018) Release of neurotransmitters from synaptic vesicles begins with a systems in which various copy numbers of syb2 were incorporated narrow fusion pore, the structure of which remains unresolved. To in an ND while the t-SNAREs were present on a liposome have obtain a structural model of the fusion pore, we performed coarse- been used experimentally to study SNARE-mediated mem- grained molecular dynamics simulations of fusion between a brane fusion (13, 17). The small dimensions of the ND compared nanodisc and a planar bilayer bridged by four partially unzipped with a spherical vesicle makes such systems ideally suited for MD SNARE complexes. The simulations revealed that zipping of SNARE simulations without introducing extreme curvature, which is well complexes pulls the polar C-terminal residues of the synaptobrevin known to strongly influence the propensity of fusion (18–20). 2 and syntaxin 1A transmembrane domains to form a hydrophilic MARTINI-based CGMD simulations have been used in several – core between the two distal leaflets, inducing fusion pore forma- studies of membrane fusion (16, 21 23). To elucidate the fusion tion. The estimated conductances of these fusion pores are in good pore structure and the mechanism of its formation, we performed agreement with experimental values.
    [Show full text]
  • Living Synaptic Vesicle Marker: Synaptotagmin-GFP
    ©2002Wiley-Liss,Inc. genesis34:142–145(2002) LivingSynapticVesicleMarker: Synaptotagmin-GFP YongQ.Zhang,ChristopherK.Rodesch,andKendalBroadie* DepartmentofBiologicalSciences,VanderbiltUniversity,Nashville,TN37235-1634 Received4June2002;Accepted17July2002 Synapsesarethesiteofchemicalcommunicationbe- tweenneuronsandbetweenneuronsandmuscles.The synapticvesicle(SV)isaprominentpresynapticor- ganellewhichcontainschemicalneurotransmittersand fuseswiththeplasmamembranetomediateneurotrans- mission.Thereareabout50orsosynapticproteins whichareeitherintegralvesiclemembraneproteins FIG.1.Mapofsyt-eGFPandsyb-eGFPfusionconstructs.Syt (e.g.,synaptotagmin,syt;andsynaptobrevin,syb)or (accessionnumberM55048)orsyb(neuronalsynaptobrevin,acces- vesicle-associatedproteins(e.g.,cysteinestringprotein, sionnumberS66686)codingregionwasfusedtotheN-terminalof CSP;Fernandez-ChaconandSudhof,1999).Wehave eGFP(enhancedGFP,catalognumber6084-1fromClonTech,Palo transformedDrosophilawithanovelsyt-eGFP(en- Alto,CA;sequenceaccessionnumberU55763)withEcoRIand XhoI.SytcDNA(encodingaproteinof475aminoacids)wasPCR- hancedGFP)fusionprotein,thefluorescencepatternof amplifiedandsequence-confirmedwithapairofprimerssyt.1: whichcolocalizeswithnativeSVproteinsatsynapses, gggaattcattaggggcaacaacacagc(EcoRI)andsyt.3:ccctcgagc suggestingthatthesyt-eGFPfusionproteiniscorrectly cttcatgttcttcaggatctc(XhoI).n-Syb(encoding180aminoacids) localizedasanintegralSVproteinandthereforeagood wasPCR-amplifiedandsequence-confirmedwithapairofprimers syb1:acagccgaattcgctgaggc(EcoRI)andprimersyb2:tcctc SVmarkerinlivingsynapses.Wedemonstratethatthe
    [Show full text]
  • The Molecular Machinery of Neurotransmitter Release Nobel Lecture, 7 December 2013
    The Molecular Machinery of Neurotransmitter Release Nobel Lecture, 7 December 2013 by Thomas C. Südhof Dept. of Molecular and Cellular Physiology, and Howard Hughes Medical Institute, Stanford University, USA. 1. THE NEUROTRANSMITTER RELEASE ENIGMA Synapses have a long history in science. Synapses were frst functionally demon- strated by Emil duBois-Reymond (1818–1896), were morphologically identifed by classical neuroanatomists such as Rudolf von Kölliker (1817–1905) and San- tiago Ramon y Cajal (1852–1934), and named in 1897 by Michael Foster (1836– 1907). Although the chemical nature of synaptic transmission was already sug- gested by duBois-Reymond, it was long disputed because of its incredible speed. Over time, however, overwhelming evidence established that most synapses use chemical messengers called neurotransmitters, most notably with the pioneer- ing contributions by Otto Loewi (1873–1961), Henry Dale (1875–1968), Ulf von Euler (1905–1983), and Julius Axelrod (1912–2004). In parallel, arguably the most important advance to understanding how synapses work was provided by Bernard Katz (1911–2003), who elucidated the principal mechanism of syn- aptic transmission (Katz, 1969). Most initial studies on synapses were carried out on the neuromuscular junction, and central synapses have only come to the fore in recent decades. Here, major contributions by many scientists, including George Palade, Rodolfo Llinas, Chuck Stevens, Bert Sakmann, Eric Kandel, and Victor Whittaker, to name just a few, not only confrmed the principal results obtained in the neuromuscular junction by Katz, but also revealed that synapses 259 6490_Book.indb 259 11/4/14 2:29 PM 260 The Nobel Prizes exhibit an enormous diversity of properties as well as an unexpected capacity for plasticity.
    [Show full text]
  • Synaptic Vesicle Dynamics in Living Cultured Hippocampal Neurons Visualized with CY3-Conjugated Antibodies Directed Against the Lumenal Domain of Synaptotagmin
    The Journal of Neuroscience, June 1995, 1~76): 4328-4342 Synaptic Vesicle Dynamics in Living Cultured Hippocampal Neurons Visualized with CY3-Conjugated Antibodies Directed against the Lumenal Domain of Synaptotagmin Kajetan Kraszewski,’ Olaf Mundigl,’ Laurie DanielI,’ Claudia Verclerio,* Michela Matteoli,2 and Pietro De Camilli’ ‘Department of Cell Biology and Howard Hughes Medical Institute, Yale University School Medicine, New Haven, Connecticut 06510 and XNR Center of Cytopharmacology and Department of Medical Pharmacology, University of Milano, Milano, Italy Antibodies directed against the lumenal domain of synap- which representthe presynaptic elementsof synapses.They un- totagmin I conjugated to CY3 (CYB-Syt,-Abs) and video mi- dergo exocytosis selectively at specialized regions of the pre- croscopy were used to study the dynamics of synaptic ves- synaptic plasmalemmacalled active zones and their rate of exo- icles in cultured hippocampal neurons. When applied to cytosis is dramatically stimulated by depolarization-induced cultures after synapse formation, CY3-Syt,-Abs produced a Ca2+ influx (De Camilli and Jahn, 1990; Jesse1and Kandel, strong labeling of presynaptic vesicle clusters which was 1992; Stidhof et al., 1993; Bennett and Scheller, 1994). markedly increased by membrane depolarization. The in- Until recently, the properties of SVs in situ could only be crease of the rate of CYSSyt,-Ab uptake in a high K+ me- studied by conventional morphological approacheswhich in- dium was maximal during the first few minutes but per- volve cell fixation, or by using electrophysiological techniques sisted for as long as 60 min. In axons developing in iso- which detect effects produced by neurotransmitterrelease. New lation, CYSSyt,-Abs, in combination with electron micros- probes have now been developed which make possibleto mon- copy immunocytochemistry, revealed the presence of itor morphologically, at the light microscopic level, SV dynam- synaptic vesicle clusters which move in bulk in antero- ics in the living cell.
    [Show full text]
  • Differential Regulation of Synaptic AP-2/Clathrin Vesicle Uncoating In
    www.nature.com/scientificreports OPEN Differential regulation of synaptic AP-2/clathrin vesicle uncoating in synaptic plasticity Received: 9 June 2017 Ermes Candiello1, Ratnakar Mishra1, Bernhard Schmidt1, Olaf Jahn2 & Peter Schu1 Accepted: 24 October 2017 AP-1/ 1B-deficiency causes X-linked intellectual disability. AP-1/ 1B / mice have impaired synaptic Published: xx xx xxxx σ σ − − vesicle recycling, fewer synaptic vesicles and enhanced endosome maturation mediated by AP-1/σ1A. Despite defects in synaptic vesicle recycling synapses contain two times more endocytic AP-2 clathrin- coated vesicles. We demonstrate increased formation of two classes of AP-2/clathrin coated vesicles. One which uncoats readily and a second with a stabilised clathrin coat. Coat stabilisation is mediated by three molecular mechanisms: reduced recruitment of Hsc70 and synaptojanin1 and enhanced μ2/ AP-2 phosphorylation and activation. Stabilised AP-2 vesicles are enriched in the structural active zone proteins Git1 and stonin2 and synapses contain more Git1. Endocytosis of the synaptic vesicle exocytosis regulating Munc13 isoforms are differentially effected. Regulation of synaptic protein endocytosis by the differential stability of AP-2/clathrin coats is a novel molecular mechanism of synaptic plasticity. AP-1 and AP-2 clathrin adaptor-protein complexes have essential functions in synaptic vesicle (SV) recycling. AP-2 clathrin-mediated-endocytosis (CME) facilitates SV endocytosis, AP-1 complexes mediate TGN/endosome protein sorting via clathrin-coated-vesicles (CCV). In brain two γ1AP-1 complexes exist, which share β1 and μ1A, but differ in their σ1 adaptins. The ubiquitous AP-1 contains σ1A, the tissue-specific AP-1 contains σ1B. Deficiency of the X-chromosome encoded σ1B causes severe mental retardation1.
    [Show full text]
  • Rapid Structural Alterations of the Active Zone Lead to Sustained Changes in Neurotransmitter Release
    Rapid structural alterations of the active zone lead to sustained changes in neurotransmitter release Jacob Matza, Andrew Gilyana,b, Annette Kolara,b, Terrence McCarvilla, and Stefan R. Kruegera,b,1 aDepartment of Physiology and Biophysics and bNeuroscience Institute, Dalhousie University, Halifax, NS, Canada B3H 1X5 Edited by Charles F. Stevens, The Salk Institute for Biological Studies, La Jolla, CA, and approved April 6, 2010 (received for review June 2, 2009) The likelihood with which an action potential elicits neurotrans- size and pr, a notion supported by ultrastructural evidence that mitter release, the release probability (pr), is an important compo- the size of the RRP at a synapse is closely correlated with the nent of synaptic strength. Regulatory mechanisms controlling number of SVs docked at its active zone (16). Interestingly, the several steps of synaptic vesicle (SV) exocytosis may affect pr, number of docked SVs is known to correlate well with active yet their relative importance in determining pr and eliciting tem- zone size (17, 18), indicating that, by limiting the number of poral changes in neurotransmitter release at individual synapses is docked SVs, the size of its active zone may be a major de- largely unknown. We have investigated whether the size of the terminant of RRP size. active zone cytomatrix is a major determinant of pr and whether Taken together, this chain of evidence—a strong correlation changes in its size lead to corresponding alterations in neurotrans- between active zone size and the number of docked SVs (17, 18), mitter release. We have used a fluorescent sensor of SV exocyto- similarity of the number of docked SVs and RRP size (16), and sis, synaptophysin-pHluorin, to measure pr at individual synapses a strong correlation between RRP size and pr (7, 13)—suggests fl with high accuracy and employed a uorescently labeled cytoma- that pr may be controlled by active zone size.
    [Show full text]
  • Synaptic Vesicles Undock and Then Transiently Dock After an Action Potential
    bioRxiv preprint doi: https://doi.org/10.1101/509216; this version posted December 31, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Synaptic vesicles undock and then transiently dock after an action potential Grant F Kusick1,2, Morven Chin1º, Kristina Lippmann3*#, Kadidia P Adula3*†, M Wayne Davis4, Erik M Jorgensen3,4 & Shigeki Watanabe1,3,5 1 Department of Cell Biology, Johns Hopkins University, School of Medicine, Baltimore, MD 21205, USA. 2 Biochemistry, Cellular and Molecular Biology Graduate Program, Johns Hopkins University, School of Medicine, Baltimore, MD 21205, USA. 3 Neurobiology Course, The Marine Biological Laboratory, Woods Hole, MA 02543, USA. 4Department of Biology and Howard Hughes Medical Institute, University of Utah, Salt Lake City, UT 84112-0840, USA. 5Solomon H. Snyder Department of Neuroscience, Johns Hopkins University, School of Medicine, Baltimore, MD 21205, USA. º Current address: Program in Neuroscience, Harvard University, Cambridge, MA 02115, USA. # Current address: Carl-Ludwig-Institute for Physiology, University Leipzig, 04103 Leipzig, Germany. † Current address: Department of Molecular, Cell, and Developmental Biology, University of California, Los Angeles, Los Angeles, CA 90095, USA. * These authors contributed equally to this work. Correspondence: Shigeki Watanabe ([email protected]) Keywords Synaptic vesicle exocytosis, neurotransmitter release, multivesicular release, asynchronous release, synaptic vesicle docking, transient docking, flash-and-freeze, zap-and-freeze 1 bioRxiv preprint doi: https://doi.org/10.1101/509216; this version posted December 31, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Dynamin 1- and 3-Mediated Endocytosis Is Essential for the Development of a Large Central Synapse in Vivo
    The Journal of Neuroscience, June 1, 2016 • 36(22):6097–6115 • 6097 Development/Plasticity/Repair Dynamin 1- and 3-Mediated Endocytosis Is Essential for the Development of a Large Central Synapse In Vivo Fan Fan, X Laura Funk, and XXuelin Lou Department of Neuroscience, School of Medicine and Public Health, University of Wisconsin–Madison, Madison, Wisconsin 53706 Dynamin is a large GTPase crucial for endocytosis and sustained neurotransmission, but its role in synapse development in the mam- malian brain has received little attention. We addressed this question using the calyx of Held (CH), a large nerve terminal in the auditory brainstem in mice. Tissue-specific ablation of different dynamin isoforms bypasses the early lethality of conventional knock-outs and allows us to examine CH development in a native brain circuit. Individual gene deletion of dynamin 1, a primary dynamin isoform in neurons, as well as dynamin 2 and 3, did not affect CH development. However, combined tissue-specific knock-out of both dynamin 1 and 3 (cDKO) severely impaired CH formation and growth during the first postnatal week, and the phenotypes were exacerbated by further additiveconditionalknock-outofdynamin2.ThedevelopmentaldefectofCHincDKOfirstbecameevidentonpostnatalday3(P3),atime point when CH forms and grows abruptly. This is followed by a progressive loss of postsynaptic neurons and increased glial infiltration late in development. However, early CH synaptogenesis before protocalyx formation was not altered in cDKO. Functional maturation of synaptic transmission in the medial nucleus of the trapezoid body in cDKO was impeded during development and accompanied by an increase in the membrane excitability of medial nucleus of the trapezoid body neurons.
    [Show full text]
  • SNAP-25 Is a Component of a Ubiquitous SNARE Complex Required for Evoked Neuroexocytosis in Gabaergic Neurons Lawrence C
    University of New Mexico UNM Digital Repository Biomedical Sciences ETDs Electronic Theses and Dissertations 5-1-2011 SNAP-25 is a component of a ubiquitous SNARE complex required for evoked neuroexocytosis in GABAergic neurons Lawrence C. R. Tafoya Follow this and additional works at: https://digitalrepository.unm.edu/biom_etds Recommended Citation Tafoya, Lawrence C. R.. "SNAP-25 is a component of a ubiquitous SNARE complex required for evoked neuroexocytosis in GABAergic neurons." (2011). https://digitalrepository.unm.edu/biom_etds/33 This Dissertation is brought to you for free and open access by the Electronic Theses and Dissertations at UNM Digital Repository. It has been accepted for inclusion in Biomedical Sciences ETDs by an authorized administrator of UNM Digital Repository. For more information, please contact [email protected]. i ii Dedication I dedicate this dissertation to my beautiful wife Charlene and my two precious daughters, Isabella and Gabriella. It is through their unconditional support, undying patience, and infinite understanding that I was able to reach this important milestone. I cannot begin to repay them for the numerous sacrifices they gracefully made over the years. Individually, I would like to thank my oldest daughter, Isabella, for her inquisitive nature, serving as a continual reminder that knowledge belongs to those who seek it and, at any age, one should never stop questioning the world around us. For Gracie, I owe my gratitude for the moments of levity she provides, which extinguish panic, neutralize anxiety, and put into perspective the true priorities in life. Lastly, I pay tribute to my wife, who single-handedly has galvanized my success as a father, husband, physician, researcher, and a man.
    [Show full text]