CYP1A1 CYP1A2 CYP1B1 CYP3A4 Qiagen

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Supplemental Table 1 Primer Size PCR PCR Genes Taq used Exons Primers Sequence primer 5'-3' [mM] product program* 2 2F1 cctgacactctagatattggc 0,3 571 TD 60°C 2R2 tccaggtagcaggaggttga 0,3 2F2 agtaatggtcagagcatgtcc 0,3 588 TD 60°C 2R2 aagccccatgcagttcctc 0,3 3-4 3 F aaggaccagacctggatgg 0,3 461 TD 56°C Qiagen 4R acagggacaagatggatgc 0,3 CYP1A1 Hot Star 5-6 5 F agtggctcccttcaaagggg 0,3 496 TD 60°C 6R tataagagcttaagagggtgg 0,3 7 7 F tggagctccactcacttgac 0,6 467 TD 56°C 7R tcagtgtctatgagtttcaggc 0,6 3'UTR P3'F actcaccctgaaccccattc 0,3 405 TD 60°C P3'R taggagtcttgtctcatgcct 0,3 5'UTR P5'F agcgttcatgttgggaatcttg 0,3 336 TD 56°C P5'R tcaaacccttgagcacccag 0,3 2 2F1 tatccagctgggagccaagc 0,3 512 TD 60°C 2R1 tctgtgctgaaggtcaagctc 0,3 2F3 acgtcctgcagatccgcattg 0,3 736 TD 64°C 2R2 aggtgtccagagccttccta 0,3 Qiagen 3 3 F agcaacgttcagcctttgacc 0,3 319 TD 64°C CYP1A2 Hot Star 3R tcccaagccagatctcagtatg 0,3 4-5 4 F tgatggtttccttgtttctgtc 0,6 601 TD 64°C 5R aggaagagaaaacatggcaagc 0,6 6 6 F tggaggtaggagcaacacat 0,6 233 TD 64°C 6R agttcctagcagggacaaac 0,6 7 7 F tgttctcaacagaagtctccc 0,3 467 TD 60°C 7R agaaaggaagagaaacaagggc 0,3 1 1F tgaaagcctgctggtagag 0,6 697 TD 60°C Qiagen 1R aggcgcgtaacggttcctg 0,6 Hot Star 2 2F1 acctctccacccaacggca 0,6 591 TD 60°C + Q 2R1 ggctggcgcgtgaagaagtt 0,6 CYP1B1 solution 2F2 acactcggagcactggaagg 0,6 714 TD 60°C 2R2 actcagcatattctgtctctac 0,6 Qiagen 3 3F1 agtcactgagctagatagcc 0,3 806 TD 56°C Hot Star 3R2 cagcacaaaagaggaactgg 0,3 CYP3A4 Qiagen 1 1F tgtgtgtgattctttgccaac 0,3 429 TD 60°C Hot Star 1R acgcccggcctgaacatct 0,3 2 2F tcttgccttaatgttacctcg 0,6 319 TD 60°C 2R tgtaaaacttcagaccttccc 0,6 3 3F acctcctctgttttctctt 0,6 317 TD 56°C 3R tcatcccaagaggctttgg 0,6 4 4F tccagctgtagaataaggctg 0,3 269 TD 64°C 4R tggacgtggaaccttcctgg 0,3 5/6 5F agcatctagcatagggccca 0,3 705 TD 60°C 6R actggaataacccaacagca 0,3 7 7F atgtgggtttcctgttgcat 0,3 376 TD 60°C 7R tgatggtcacacatatcttc 0,3 8 8F tggcttccagttgagaacc 0,3 393 TD 60°C 8R tgctctaaacatgagcagtc 0,3 9 9F aggaccacgcttgtgatttac 0,3 307 TD 60°C 9R tgcctctagaaagtgcctccaa 0,3 10 10F agggcttcacttagatttctc 0,3 383 TD 60°C 10R agagccttcctacatagagtc 0,3 11 11F tcattagtactgcatggactg 0,3 382 TD 60°C 11R tcctgtagattaagagaggc 0,3 12 12F catagcaggatttcaatgacc 0,3 447 TD 60°C 12R cagatgggcctaattgattct 0,3 13 13F agtgtctcactcactttgatgc 0,3 489 TD 64°C 13R aggaggagttaatggtgctaac 0,3 1 1F tccttctccagcacataaatc 0,3 341 TD 56°C 1R tccaacacttcagctacttc 0,3 2 2F tgaccctctgtgattgagtgc 0,3 653 TD 64°C 2R gtgaaacctcagaactccct 0,3 3 3F agacatctctgaatagcttcc 0,3 363 TD 56°C 3R ctactcccaagtaattatcc 0,3 4 4F tgtaccacccagcttaacg 0,3 573 TD 60°C 4R agattgcaagatgttaccac 0,3 5/6 5F tgtgcaaccatgaagatcacc 0,3 618 TD 64°C 6R gagtaacccaacagtgcgac 0,3 7 7F tagtggaaggacggtaagag 0,3 403 TD 56°C Qiagen 7R gacagctaaagtgtgtgaggg 0,3 CYP3A5 Hot Star 8 8F tgggttccagttgagaatca 0,3 390 TD 56°C 8R ctaccaaatggcttctcttgt 0,3 9 9F tcttcaagaagccataggg 0,6 383 TD 56°C 9R tggaacatggctatacctgt 0,6 10 10F tctaagctgtgatgttgtacg 0,6 350 TD 56°C 10R cctacattatgtcagtgaag 0,6 11 11F tgagttattctctggagcttc 0,3 433 TD 56°C 11R tgattgtacaaccacacgat 0,3 12 12F acccctaacatgtaactctg 0,3 362 TD 60°C 12R tcaaagatggatccaagtagg 0,3 13 13F actatccagtatttacccagc 0,3 479 TD 56°C 13R tggtcacctcctttatactac 0,3 COMT Qiagen 1 1 F gctacttgtggctagaagca 0,6 494 TD 56°C Hot Star + Q solution 1R tcacttcacagcggtccgaat 0,6 Qiagen 2 2 F tatctggaccttggtcatcgc 0,3 461 TD 56°C Hot Star 2R3 tggacgctccattttagaaag 0,3 3 3 F gatggtggcactccaagcaaa 0,3 455 TD 60°C 3R acagcttctcctgtaagggctt 0,3 4 4 F accagggaggtgaaatacc 0,3 497 TD 56°C 4R ctggtgatagtgggttttca 0,3 5 5 F tgacaggcgctgttgtatagg 0,3 281 TD 60°C 5R agaggctgaggctgactgaat 0,3 6 6 F tcctttcctgcaggagtcacg 0,3 484 TD 60°C 6R aggtgtgctttgcatttaggac 0,3 1 1F tcttgacttccaccagttgc 0,3 465 TD 56°C 1R aggtccctaatctcttccc 0,3 2/3 2F aggagatggaatgcaataacc 0,3 651 TD 64°C 3R tgcagtaaagtgggtaactg 0,3 Qiagen 4 4F actgtcaagttggctgacc 0,3 712 TD 56°C NQO1 Hot Star 4R aggcttaggatctaattgtgc 0,3 5 5F acagcaaataggacagacttg 0,3 571 TD 60°C 5R aggctcaatgaatgaattccc 0,3 6 6F aggcctccttatcagagtgtc 0,3 487 TD 64°C 6R agtcagggaagccttggaaag 0,3 1 1F1 atccacatgctcagactgttg 0,3 457 TD 60°C 1R1 aaggtctgaccatctcttaatc 0,3 1F2 atcccaacaactcatccgc 0,6 594 TD 56°C 1R2 aagctctgccttcaaagacac 0,6 2 2F acctcacaattctcctactac 0,6 467 TD 60°C 2R tcagtgtaagtcaaacactctg 0,6 Qiagen 3 3F tcttttggtagtgcccgctg 0,3 420 TD 60°C UGT2B7 Hot Star 3R tgtcagcatatttacatagggg 0,3 4 4F tcccttgatctcattcctactc 0,6 334 TD 56°C 4R tctttctcccttaagactgga 0,6 5 5F acactgtcactttcagagcc 0,3 373 TD 56°C 5R actcacactcactattgacaag 0,3 6 6F tccttctttaactcggtgtc 0,6 412 TD 56°C 6R actgaagtagtctcacctatc 0,6 *see PCR conditions at www.cephb.fr/tcf1 Supplemental Table 2 : CYP1B1 allelic frequencies in the groups of patients 55 women with a 98 women with a non Alleles mutated HNF1α mutated benign tumor adenoma * CYP1B1*1 9% 10% CYP1B1*2 25% 31% CYP1B1*3 40% 38% CYP1B1*4 24% 20% CYP1B1*6 1% 1% CYP1B1*7 1% 0% Chi-squared 3.224 P value 0.665 • unvailable data in three cases. Supplemental Figure 1 : : Effect of Y81N on CYP1B1 catalytic activity. Effect of Y81N polymorphism on CYP1B1 catalytic activity. The EROD activity is expressed as picomoles of resorufin per milligram of protein per minute and normalized to the total ß-galactosidase activity measuring the transfection efficiency. Values are means +/- S.D. (n = 4 replicates). EROD activity of the CYP1B1*3 allele was used as reference and fixed to 1. Values of other alleles were expressed according to it. Corresponding immunoblot analysis using an anti-CYP1B1 primary antibody are indicated by an arrow. .
Recommended publications
  • Studies on CYP1A1, CYP1B1 and CYP3A4 Gene Polymorphisms in Breast Cancer Patients

    Studies on CYP1A1, CYP1B1 and CYP3A4 Gene Polymorphisms in Breast Cancer Patients

    Ginekol Pol. 2009, 80, 819-823 PRACE ORYGINALNE ginekologia Studies on CYP1A1, CYP1B1 and CYP3A4 gene polymorphisms in breast cancer patients Badania polimorfizmów genów CYP1A1, CYP1B1 i CYP3A4 u chorych z rakiem piersi Ociepa-Zawal Marta1, Rubiś Błażej2, Filas Violetta3, Bręborowicz Jan3, Trzeciak Wiesław H1. 1 Department of Biochemistry and Molecular Biology, Poznan University of Medical Sciences 2 Department of Clinical Chemistry and Molecular Diagnostics, 3Department of Tumor Pathology, Poznan University of Medical Sciences Abstract Background: The role of CYP1A1, CYP1B1 and CYP3A4 polymorphism in pathogenesis of breast cancer has not been fully elucidated. From three CYP1A1 polymorphisms *2A (3801T>C), *2C (2455A>G), and *2B variant, which harbors both polymorphisms, the *2A variant is potentially carcinogenic in African Americans and the Taiwanese, but not in Caucasians, and the CYP1B1*2 (355G>T) and CYP1B1*3 (4326C>G) variants might increase breast cancer risk. Although no association of any CYP3A4 polymorphisms and breast cancer has been documented, the CYP3A4*1B (392A>G) variant, correlates with earlier menarche and endometrial cancer secondary to tamoxifen therapy. Objective: The present study was designed to investigate the frequency of CYP1A1, CYP1B1 and CYP3A4 po- lymorphisms in a sample of breast cancer patients from the Polish population and to correlate the results with the clinical and laboratory findings. Material and methods: The frequencies of CYP1A1*2A; CYP1A1*2C; CYP1B1*3; CYP3A4*1B CYP3A4*2 polymorphisms were determined in 71 patients aged 36-87, with primary breast cancer and 100 healthy indi- viduals. Genomic DNA was extracted from the tumor, and individual gene fragments were PCR-amplified.
  • New Perspectives of CYP1B1 Inhibitors in the Light of Molecular Studies

    New Perspectives of CYP1B1 Inhibitors in the Light of Molecular Studies

    processes Review New Perspectives of CYP1B1 Inhibitors in the Light of Molecular Studies Renata Mikstacka 1,* and Zbigniew Dutkiewicz 2,* 1 Department of Inorganic and Analytical Chemistry, Collegium Medicum, Nicolaus Copernicus University in Toru´n,Dr A. Jurasza 2, 85-089 Bydgoszcz, Poland 2 Department of Chemical Technology of Drugs, Pozna´nUniversity of Medical Sciences, Grunwaldzka 6, 60-780 Pozna´n,Poland * Correspondence: [email protected] (R.M.); [email protected] (Z.D.); Tel.: +48-52-585-3912 (R.M.); +48-61-854-6619 (Z.D.) Abstract: Human cytochrome P450 1B1 (CYP1B1) is an extrahepatic heme-containing monooxy- genase. CYP1B1 contributes to the oxidative metabolism of xenobiotics, drugs, and endogenous substrates like melatonin, fatty acids, steroid hormones, and retinoids, which are involved in diverse critical cellular functions. CYP1B1 plays an important role in the pathogenesis of cardiovascular diseases, hormone-related cancers and is responsible for anti-cancer drug resistance. Inhibition of CYP1B1 activity is considered as an approach in cancer chemoprevention and cancer chemotherapy. CYP1B1 can activate anti-cancer prodrugs in tumor cells which display overexpression of CYP1B1 in comparison to normal cells. CYP1B1 involvement in carcinogenesis and cancer progression encourages investigation of CYP1B1 interactions with its ligands: substrates and inhibitors. Compu- tational methods, with a simulation of molecular dynamics (MD), allow the observation of molecular interactions at the binding site of CYP1B1, which are essential in relation to the enzyme’s functions. Keywords: cytochrome P450 1B1; CYP1B1 inhibitors; cancer chemoprevention and therapy; molecu- Citation: Mikstacka, R.; Dutkiewicz, lar docking; molecular dynamics simulations Z. New Perspectives of CYP1B1 Inhibitors in the Light of Molecular Studies.
  • Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid

    Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid

    Comprehensive Summaries of Uppsala Dissertations from the Faculty of Pharmacy 231 _____________________________ _____________________________ Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid Cloning, Expression and Catalytic Properties of CYP4F8 and CYP4F21 BY JOHAN BYLUND ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2000 Dissertation for the Degree of Doctor of Philosophy (Faculty of Pharmacy) in Pharmaceutical Pharmacology presented at Uppsala University in 2000 ABSTRACT Bylund, J. 2000. Cytochrome P450 Enzymes in Oxygenation of Prostaglandin Endoperoxides and Arachidonic Acid: Cloning, Expression and Catalytic Properties of CYP4F8 and CYP4F21. Acta Universitatis Upsaliensis. Comprehensive Summaries of Uppsala Dissertations from Faculty of Pharmacy 231 50 pp. Uppsala. ISBN 91-554-4784-8. Cytochrome P450 (P450 or CYP) is an enzyme system involved in the oxygenation of a wide range of endogenous compounds as well as foreign chemicals and drugs. This thesis describes investigations of P450-catalyzed oxygenation of prostaglandins, linoleic and arachidonic acids. The formation of bisallylic hydroxy metabolites of linoleic and arachidonic acids was studied with human recombinant P450s and with human liver microsomes. Several P450 enzymes catalyzed the formation of bisallylic hydroxy metabolites. Inhibition studies and stereochemical analysis of metabolites suggest that the enzyme CYP1A2 may contribute to the biosynthesis of bisallylic hydroxy fatty acid metabolites in adult human liver microsomes. 19R-Hydroxy-PGE and 20-hydroxy-PGE are major components of human and ovine semen, respectively. They are formed in the seminal vesicles, but the mechanism of their biosynthesis is unknown. Reverse transcription-polymerase chain reaction using degenerate primers for mammalian CYP4 family genes, revealed expression of two novel P450 genes in human and ovine seminal vesicles.
  • Cytochrome P450

    COVID-19 is an emerging, rapidly evolving situation. Get the latest public health information from CDC: https://www.coronavirus.gov . Get the latest research from NIH: https://www.nih.gov/coronavirus. Share This Page Search Health Conditions Genes Chromosomes & mtDNA Classroom Help Me Understand Genetics Cytochrome p450 Enzymes produced from the cytochrome P450 genes are involved in the formation (synthesis) and breakdown (metabolism) of various molecules and chemicals within cells. Cytochrome P450 enzymes Learn more about the cytochrome play a role in the synthesis of many molecules including steroid hormones, certain fats (cholesterol p450 gene group: and other fatty acids), and acids used to digest fats (bile acids). Additional cytochrome P450 enzymes metabolize external substances, such as medications that are ingested, and internal substances, such Biochemistry (Ofth edition, 2002): The as toxins that are formed within cells. There are approximately 60 cytochrome P450 genes in humans. Cytochrome P450 System is Widespread Cytochrome P450 enzymes are primarily found in liver cells but are also located in cells throughout the and Performs a Protective Function body. Within cells, cytochrome P450 enzymes are located in a structure involved in protein processing Biochemistry (fth edition, 2002): and transport (endoplasmic reticulum) and the energy-producing centers of cells (mitochondria). The Cytochrome P450 Mechanism (Figure) enzymes found in mitochondria are generally involved in the synthesis and metabolism of internal substances, while enzymes in the endoplasmic reticulum usually metabolize external substances, Indiana University: Cytochrome P450 primarily medications and environmental pollutants. Drug-Interaction Table Common variations (polymorphisms) in cytochrome P450 genes can affect the function of the Human Cytochrome P450 (CYP) Allele enzymes.
  • At the X-Roads of Sex and Genetics in Pulmonary Arterial Hypertension

    At the X-Roads of Sex and Genetics in Pulmonary Arterial Hypertension

    G C A T T A C G G C A T genes Review At the X-Roads of Sex and Genetics in Pulmonary Arterial Hypertension Meghan M. Cirulis 1,2,* , Mark W. Dodson 1,2, Lynn M. Brown 1,2, Samuel M. Brown 1,2, Tim Lahm 3,4,5 and Greg Elliott 1,2 1 Division of Pulmonary, Critical Care and Occupational Medicine, University of Utah, Salt Lake City, UT 84132, USA; [email protected] (M.W.D.); [email protected] (L.M.B.); [email protected] (S.M.B.); [email protected] (G.E.) 2 Division of Pulmonary and Critical Care Medicine, Intermountain Medical Center, Salt Lake City, UT 84107, USA 3 Division of Pulmonary, Critical Care, Sleep and Occupational Medicine, Department of Medicine, Indiana University School of Medicine, Indianapolis, IN 46202, USA; [email protected] 4 Richard L. Roudebush Veterans Affairs Medical Center, Indianapolis, IN 46202, USA 5 Department of Anatomy, Cell Biology & Physiology, Indiana University School of Medicine, Indianapolis, IN 46202, USA * Correspondence: [email protected]; Tel.: +1-801-581-7806 Received: 29 September 2020; Accepted: 17 November 2020; Published: 20 November 2020 Abstract: Group 1 pulmonary hypertension (pulmonary arterial hypertension; PAH) is a rare disease characterized by remodeling of the small pulmonary arteries leading to progressive elevation of pulmonary vascular resistance, ultimately leading to right ventricular failure and death. Deleterious mutations in the serine-threonine receptor bone morphogenetic protein receptor 2 (BMPR2; a central mediator of bone morphogenetic protein (BMP) signaling) and female sex are known risk factors for the development of PAH in humans.
  • 2D3 and 1,25(OH)2D3 on Gene Expression in Human Epidermal Keratinocytes: Identification of Ahr As an Alternative Receptor for 20,23(OH)2D3

    2D3 and 1,25(OH)2D3 on Gene Expression in Human Epidermal Keratinocytes: Identification of Ahr As an Alternative Receptor for 20,23(OH)2D3

    International Journal of Molecular Sciences Article Differential and Overlapping Effects of 20,23(OH)2D3 and 1,25(OH)2D3 on Gene Expression in Human Epidermal Keratinocytes: Identification of AhR as an Alternative Receptor for 20,23(OH)2D3 Andrzej T. Slominski 1,2,3,* , Tae-Kang Kim 1 , Zorica Janjetovic 1, Anna A. Brozyna˙ 4,5, Michal A. Zmijewski˙ 6 , Hui Xu 1 , Thomas R. Sutter 7, Robert C. Tuckey 8, Anton M. Jetten 9 and David K. Crossman 10 1 Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL 35294, USA; [email protected] (T.-K.K.); [email protected] (Z.J.); [email protected] (H.X.) 2 Comprehensive Cancer Center, Cancer Chemoprevention Program, University of Alabama at Birmingham, Birmingham, AL 35294, USA 3 Veteran Administration Medical Center, Birmingham, AL 35294, USA 4 Department of Medical Biology, Faculty of Biology and Environment Protection, Nicolaus Copernicus University, 87-100 Toru´n,Poland; [email protected] 5 Department of Tumor Pathology and Pathomorphology, Oncology Centre-Prof. Franciszek Łukaszczyk Memorial Hospital, 85-796 Bydgoszcz, Poland 6 Department of Histology, Medical University of Gda´nsk,80-211 Gda´nsk,Poland; [email protected] 7 Feinstone Center for Genomic Research, University of Memphis, Memphis, TN 38152 USA; [email protected] 8 School of Molecular Sciences, The University of Western Australia, Perth, WA 6009, Australia; [email protected] 9 Immunity, Inflammation, and Disease Laboratory/Cell Biology Group, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC 27709, USA; [email protected] 10 Howell and Elizabeth Heflin Center for Human Genetics, Genomic Core Facility, University of Alabama at Birmingham, Birmingham, AL 35294, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-205-934-5245; Fax: +1-205-996-0302 Received: 30 August 2018; Accepted: 3 October 2018; Published: 8 October 2018 Abstract: A novel pathway of vitamin D activation by CYP11A has previously been elucidated.
  • Recent Advances in P450 Research

    Recent Advances in P450 Research

    The Pharmacogenomics Journal (2001) 1, 178–186 2001 Nature Publishing Group All rights reserved 1470-269X/01 $15.00 www.nature.com/tpj REVIEW Recent advances in P450 research JL Raucy1,2 ABSTRACT SW Allen1,2 P450 enzymes comprise a superfamily of heme-containing proteins that cata- lyze oxidative metabolism of structurally diverse chemicals. Over the past few 1La Jolla Institute for Molecular Medicine, San years, there has been significant progress in P450 research on many fronts Diego, CA 92121, USA; 2Puracyp Inc, San and the information gained is currently being applied to both drug develop- Diego, CA 92121, USA ment and clinical practice. Recently, a major accomplishment occurred when the structure of a mammalian P450 was determined by crystallography. Correspondence: Results from these studies will have a major impact on understanding struc- JL Raucy,La Jolla Institute for Molecular Medicine,4570 Executive Dr,Suite 208, ture-activity relationships of P450 enzymes and promote prediction of drug San Diego,CA 92121,USA interactions. In addition, new technologies have facilitated the identification Tel: +1 858 587 8788 ext 116 of several new P450 alleles. This information will profoundly affect our under- Fax: +1 858 587 6742 E-mail: jraucyȰljimm.org standing of the causes attributed to interindividual variations in drug responses and link these differences to efficacy or toxicity of many thera- peutic agents. Finally, the recent accomplishments towards constructing P450 null animals have afforded determination of the role of these enzymes in toxicity. Moreover, advances have been made towards the construction of humanized transgenic animals and plants. Overall, the outcome of recent developments in the P450 arena will be safer and more efficient drug ther- apies.
  • Consequences of Exchanging Carbohydrates for Proteins in the Cholesterol Metabolism of Mice Fed a High-Fat Diet

    Consequences of Exchanging Carbohydrates for Proteins in the Cholesterol Metabolism of Mice Fed a High-Fat Diet

    Consequences of Exchanging Carbohydrates for Proteins in the Cholesterol Metabolism of Mice Fed a High-fat Diet Fre´de´ ric Raymond1.¤a, Long Wang2., Mireille Moser1, Sylviane Metairon1¤a, Robert Mansourian1, Marie- Camille Zwahlen1, Martin Kussmann3,4,5, Andreas Fuerholz1, Katherine Mace´ 6, Chieh Jason Chou6*¤b 1 Bioanalytical Science Department, Nestle´ Research Center, Lausanne, Switzerland, 2 Department of Nutrition Science and Dietetics, Syracuse University, Syracuse, New York, United States of America, 3 Proteomics and Metabonomics Core, Nestle´ Institute of Health Sciences, Lausanne, Switzerland, 4 Faculty of Science, Aarhus University, Aarhus, Denmark, 5 Faculty of Life Sciences, Federal Institute of Technology, Lausanne, Switzerland, 6 Nutrition and Health Department, Nestle´ Research Center, Lausanne, Switzerland Abstract Consumption of low-carbohydrate, high-protein, high-fat diets lead to rapid weight loss but the cardioprotective effects of these diets have been questioned. We examined the impact of high-protein and high-fat diets on cholesterol metabolism by comparing the plasma cholesterol and the expression of cholesterol biosynthesis genes in the liver of mice fed a high-fat (HF) diet that has a high (H) or a low (L) protein-to-carbohydrate (P/C) ratio. H-P/C-HF feeding, compared with L-P/C-HF feeding, decreased plasma total cholesterol and increased HDL cholesterol concentrations at 4-wk. Interestingly, the expression of genes involved in hepatic steroid biosynthesis responded to an increased dietary P/C ratio by first down- regulation (2-d) followed by later up-regulation at 4-wk, and the temporal gene expression patterns were connected to the putative activity of SREBF1 and 2.
  • Regulation of Cytochrome P450 (CYP) Genes by Nuclear Receptors Paavo HONKAKOSKI*1 and Masahiko NEGISHI† *Department of Pharmaceutics, University of Kuopio, P

    Regulation of Cytochrome P450 (CYP) Genes by Nuclear Receptors Paavo HONKAKOSKI*1 and Masahiko NEGISHI† *Department of Pharmaceutics, University of Kuopio, P

    Biochem. J. (2000) 347, 321–337 (Printed in Great Britain) 321 REVIEW ARTICLE Regulation of cytochrome P450 (CYP) genes by nuclear receptors Paavo HONKAKOSKI*1 and Masahiko NEGISHI† *Department of Pharmaceutics, University of Kuopio, P. O. Box 1627, FIN-70211 Kuopio, Finland, and †Pharmacogenetics Section, Laboratory of Reproductive and Developmental Toxicology, NIEHS, National Institutes of Health, Research Triangle Park, NC 27709, U.S.A. Members of the nuclear-receptor superfamily mediate crucial homoeostasis. This review summarizes recent findings that in- physiological functions by regulating the synthesis of their target dicate that major classes of CYP genes are selectively regulated genes. Nuclear receptors are usually activated by ligand binding. by certain ligand-activated nuclear receptors, thus creating tightly Cytochrome P450 (CYP) isoforms often catalyse both formation controlled networks. and degradation of these ligands. CYPs also metabolize many exogenous compounds, some of which may act as activators of Key words: endobiotic metabolism, gene expression, gene tran- nuclear receptors and disruptors of endocrine and cellular scription, ligand-activated, xenobiotic metabolism. INTRODUCTION sex-, tissue- and development-specific expression patterns which are controlled by hormones or growth factors [16], suggesting Overview of the cytochrome P450 (CYP) superfamily that these CYPs may have critical roles, not only in elimination CYPs constitute a superfamily of haem-thiolate proteins present of endobiotic signalling molecules, but also in their production in prokaryotes and throughout the eukaryotes. CYPs act as [17]. Data from CYP gene disruptions and natural mutations mono-oxygenases, with functions ranging from the synthesis and support this view (see e.g. [18,19]). degradation of endogenous steroid hormones, vitamins and fatty Other mammalian CYPs have a prominent role in biosynthetic acid derivatives (‘endobiotics’) to the metabolism of foreign pathways.
  • Null Cyp1b1 Activity in Zebrafish Leads to Variable Craniofacial

    Null Cyp1b1 Activity in Zebrafish Leads to Variable Craniofacial

    International Journal of Molecular Sciences Article Null cyp1b1 Activity in Zebrafish Leads to Variable Craniofacial Defects Associated with Altered Expression of Extracellular Matrix and Lipid Metabolism Genes Susana Alexandre-Moreno 1,2 , Juan-Manuel Bonet-Fernández 1,2 , Raquel Atienzar-Aroca 1,2, José-Daniel Aroca-Aguilar 1,2,* and Julio Escribano 1,2,* 1 Área de Genética, Facultad de Medicina de Albacete, Instituto de Investigación en Discapacidades Neurológicas (IDINE), Universidad de Castilla-La Mancha, 02006 Albacete, Spain; [email protected] (S.A.-M.); [email protected] (J.-M.B.-F.); [email protected] (R.A.-A.) 2 Cooperative Research Network on Age-Related Ocular Pathology, Visual and Life Quality (OFTARED), Instituto de Salud Carlos III, 28029 Madrid, Spain * Correspondence: [email protected] (J.-D.A.-A.); [email protected] (J.E.) Simple Summary: CYP1B1 is a cytochrome P450 monooxygenase involved in oxidative metabolism of different endogenous lipids and drugs. The loss of function (LoF) of this gene underlies many cases of recessive primary congenital glaucoma (PCG), an infrequent disease and a common cause of infantile loss of vision in children. To the best of our knowledge, this is the first study to generate a Citation: Alexandre-Moreno, S.; cyp1b1 knockout zebrafish model. The zebrafish line did not exhibit glaucoma-related phenotypes; Bonet-Fernández, J.-M.; however, adult mutant zebrafish presented variable craniofacial alterations, including uni- or bilateral Atienzar-Aroca, R.; Aroca-Aguilar, craniofacial alterations with incomplete penetrance and variable expressivity. Transcriptomic analyses J.-D.; Escribano, J. Null cyp1b1 of seven-dpf cyp1b1-KO zebrafish revealed differentially expressed genes related to extracellular Activity in Zebrafish Leads to matrix and cell adhesion, cell growth and proliferation, lipid metabolism and inflammation.
  • Evaluation of CYP17A1 and CYP1B1 Polymorphisms in Male Breast Cancer Risk

    Evaluation of CYP17A1 and CYP1B1 Polymorphisms in Male Breast Cancer Risk

    ID: 19-0225 8 8 P Rizzolo, V Silvestri et al. CYP17A1 and CYP1B1 8:8 1224–1229 polymorphisms in MBC risk RESEARCH Evaluation of CYP17A1 and CYP1B1 polymorphisms in male breast cancer risk Piera Rizzolo1,*, Valentina Silvestri1,*, Virginia Valentini1, Veronica Zelli1, Agostino Bucalo1, Ines Zanna2, Simonetta Bianchi3, Maria Grazia Tibiletti4, Antonio Russo5, Liliana Varesco6, Gianluca Tedaldi7, Bernardo Bonanni8, Jacopo Azzollini9, Siranoush Manoukian9, Anna Coppa10, Giuseppe Giannini1, Laura Cortesi11, Alessandra Viel12, Marco Montagna13, Paolo Peterlongo14, Paolo Radice15, Domenico Palli2 and Laura Ottini1 1Department of Molecular Medicine, Sapienza University of Rome, Rome, Italy 2Cancer Risk Factors and Lifestyle Epidemiology Unit, Institute for Cancer Research, Prevention and Clinical Network (ISPRO), Florence, Italy 3Division of Pathological Anatomy, Department of Sciences of Health, University of Florence, Florence, Italy 4Department of Pathology, ASST Settelaghi and Centro di Ricerca per lo Studio dei Tumori Eredo-Familiari, Università dell’Insubria, Varese, Italy 5Section of Medical Oncology, Department of Surgical and Oncological and Oral Sciences, University of Palermo, Palermo, Italy 6IRCCS Ospedale Policlinico San Martino, Genoa, Italy 7Biosciences Laboratory, Istituto Scientifico Romagnolo per lo Studio e la Cura dei Tumori (IRST) IRCCS, Meldola, Italy 8Division of Cancer Prevention and Genetics IEO, European Institute of Oncology IRCCS, Milan, Italy 9Unit of Medical Genetics, Department of Medical Oncology and Hematology,
  • 1,25-Dihydroxyvitamin D3 Inhibits Growth of the Breast Cancer Cell Line MCF-7 and Downregulates Cytochrome P4501B1 Through the COX-2/PGE2 Pathway

    1,25-Dihydroxyvitamin D3 Inhibits Growth of the Breast Cancer Cell Line MCF-7 and Downregulates Cytochrome P4501B1 Through the COX-2/PGE2 Pathway

    ONCOLOGY REPORTS 28: 2131-2137, 2012 1,25-Dihydroxyvitamin D3 inhibits growth of the breast cancer cell line MCF-7 and downregulates cytochrome P4501B1 through the COX-2/PGE2 pathway LEI YUAN1, RONG JIANG2, YINGXUE YANG1, SONGTAO DING1 and HUAYU DENG1 1Department of Pathophysiology, 2Institute of Stem Cell and Tissue Engineering, Chongqing Medical University, Chongqing 400016, P.R. China Received April 13, 2012; Accepted July 3, 2012 DOI: 10.3892/or.2012.2031 Abstract. Cytochrome P4501B1 (CYP1B1) is responsible Introduction for tumor progression in estrogen receptor-positive breast cancer due to its key role in estrogen metabolism, which is Cancer Statistics 2010 indicated that breast cancer incidence upregulated by PGE2, the main product of COX-2 that is is the highest one in female cancer (counts for 23%) and the found to be overexpressed in many breast tumors. Previous main cause of cancer death for women (counts for 14%) (1). studies reported that inhibition of the COX-2/PGE2 pathway, Large number of epidemiological studies (2) have shown that, by 1,25-dihydroxyvitamin D3 in MCF-7 breast cancer cells. breast cancer incidence or mortality was significantly nega- The aim of this study was to investigate if the CYP1B1 tively correlated with sun exposure, suggested that lacking of protein expression shows covariation with the COX-2 and sunlight causes the reduction of vitamin D synthesis which phosphorylated ERα (p-ERα) in human breast cancer. We also in turns closely related with the disease; additionally, there is investigated whether 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] evidence that (3) high levels of plasma vitamin D can reduce the downregulates CYP1B1 via the COX-2/PGE2 pathway in risk of breast cancer.