DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 9,683,038 B2 Thuren Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 9,683,038 B2 Thuren Et Al USOO9683 038B2 (12) United States Patent (10) Patent No.: US 9,683,038 B2 Thuren et al. (45) Date of Patent: Jun. 20, 2017 (54) METHODS OF REDUCING THE RISK OF FOREIGN PATENT DOCUMENTS EXPERIENCING A CARDIOVASCULAR (CV) EVENT OR A CEREBROVASCULAREVENT WO O216436 A2 2, 2002 NAPATIENT THAT HAS SUFFERED A WO 2010 136939 12/2010 QUALIFYING CV EVENT OTHER PUBLICATIONS (71) Applicants: Tom Thuren, Succasunna, NJ (US); Portolano et al., J. Immunol. (1993), vol. 150(3):880-887.* Andrew Zalewski, Elkins Park, PA Clackson et al., Nature, (1991), vol. 352: 624–628.* (US); Michael Shetzline, Randolph, NJ Ridker et al., “Interleukin-1 inhibition and the prevention of recur (US) rent cardiovascular events: Rationale and Design of the Canakinumab Ant-inflammatory Thrombosis Outcomes Study (72) Inventors: Tom Thuren, Succasunna, NJ (US); (CANTOS)”, American Heart Journal, Mosby Year Book Inc. US, vol. 162, No. 4, pp. 597-605, Sep. 14, 2011. Andrew Zalewski, Elkins Park, PA Ridker et al., “High-sensitivity C-reactive protein, vascular imag (US); Michael Shetzline, Randolph, NJ ing, and vulnerable plaque: more evidence to Support trials of anti (US) inflammatory therapy for cardiovascular risk reduction'. Circula tion Cardiovasuclar Imaging vol. 4. No. 3, pp. 195-197, May 2011. (73) Assignee: Novartis AG, Basel (CH) Rieke et al., “The human anti-IL limonoclonal antibody ACZ885 is effective in joint inflammation models in mice and in a proof-of (*) Notice: Subject to any disclaimer, the term of this concept study in patients with rheumatoid arthritis'. Arthritis patent is extended or adjusted under 35 Research and Therapy, Biomed Central, London. vol. 10. No. 3, pp. 1-9, Jun. 5, 2008. U.S.C. 154(b) by 0 days. Owyan, et al., “XOMA 052, a potent, high affinity monoclonal antibody for the treatment of IL-1 beta-mediated diseases', MABS, (21) Appl. No.: 14/347,071 vol. 3, No. 1, pp. 49-60, Jan. 2011. Health Canada, "Summary Basis of Decision (SBD) Pr ILARIS', (22) PCT Filed: Sep. 27, 2012 Health Products and Food Branch, pp. 1-21, Jul. 19, 2010. Abbate et al., “C-reactive protein and other inflammatory biomark (86). PCT No.: PCT/US2O12/057444 ers as predictors of outcome following acute coronary syndromes'. Seminars in Vascular Medicine, vol. 3. No. 4, pp. 375-384. Nov. S 371 (c)(1), 2003. (2) Date: Mar. 25, 2014 Hamm and Klootwijk (1999) Lancet 353 (suppl II): 10-15. Cosenty X(R) Product Insert, dated Jan. 2016. (87) PCT Pub. No.: WO2013/049278 TaltZR) Product Insert, dated Mar. 2016. PCT Pub. Date: Apr. 4, 2013 Toss et al. (1997) Circulation 96:4204-10. Lindahl et al. (2000) NEJM 343: 1139-47. (65) Prior Publication Data Pearson et al. (2003) Circulation 107:499-511. Versaci et al. (2000) Am J. Cardio. 85 92-94. US 2014/0356356 A1 Dec. 4, 2014 Pflieger et al. (2011) Am. Fam Physician 83:819-828. McMurray et al. (2009) Circulation 120:2188-96. Ridker (2005) NEJM 352 :20-8. Related U.S. Application Data Ridker et al. (2008) NEJM 359:2195-207. Thygesen et al (2007) Circulation; 116:2634-2653. (60) Provisional application No. 61/541.341, filed on Sep. Fournier et al., “The High-Sensitivity C-Reactive Protein Level One 30, 2011. Month After Bare-Metal Coronary Stenting May Predict Late Adverse Events'. Rev. Esp. Cardiol., vol. 61, No. 3, pp. 313-316, (51) Int. Cl. 2008. C07K 6/24 (2006.01) A6 IK 39/00 (2006.01) * cited by examiner (52) U.S. Cl. CPC ...... C07K 16/245 (2013.01); A61K 2039/505 Primary Examiner — Christine J Saoud (2013.01); A6 IK 2039/545 (2013.01); C07K Assistant Examiner — Jegatheesan Seharasey on 2317/21 (2013.01) (74) Attorney, Agent, or Firm — Leslie Fischer (58) Field of Classification Search None (57) ABSTRACT See application file for complete search history. The present invention relates to an IL-1B binding antibody or a functional fragment thereof for use in preventing or (56) References Cited reducing risk of experiencing a recurrent cardiovascular U.S. PATENT DOCUMENTS (CV) event or a cerebrovascular event in a patient that has suffered of a qualifying CV event. 2010/0316651 A1* 12/2010 Scannon .............. CO7K 16.245 424,158.1 14 Claims, 9 Drawing Sheets U.S. Patent Jun. 20, 2017 Sheet 1 of 9 US 9,683,038 B2 g o s 3. hsCRP>2 mg/L. S g es 9. 5 ce 9 is e hsCRP42 mg/L. aY 9 w c E e 5 s 9, S s g s e C, O.S 1. 1.5 2.0 2.5 Follow-Up (years) Fig. 1 U.S. Patent Jun. 20, 2017 Sheet 2 of 9 US 9,683,038 B2 Pro-inflammatory Anti-inflammatory fB IL-1Ra NRP3 cryopyrin inflammasome R Severe alance (inflammasome mutations) CAPS, MWS, NOMED Moderate imbalance Psoriasis, contact hypersensitivity syndrones Gout, inflammatory arthritis, Crohn's, Ulcerative colitis Autoimmune Disorders, thyroidiitis Vidimbalance Atherosclerosis, Diabetes Fig. 2 U.S. Patent Jun. 20, 2017 Sheet 4 of 9 US 9,683,038 B2 State CAE885AE3 s seplacebo First are).03 it grkg Second a t crass0.3 mg/kg Third s as 10 mg/kg Fifth Fourth Fig. 4 U.S. Patent US 9,683,038 B2 U.S. Patent Jun. 20, 2017 Sheet 7 Of 9 US 9,683,038 B2 ATGGAGTTTGGGCGAGCTGGGTTTCCTCGTTGCTCTTAAGAGGGTCCAGGICAG - 19 Ivi E. F. G I, S W W E L V A. L. J. R G V C C C or GGCAGC'GGGGAGCGGGGGAGGCGIGGECCAGCCGGGAGGICCCGAGACCCC W. C. L. W E S G G G W W Q P G R S L R L. S - 2 TGGCAGCGCTGGACACCCAGGTTTATGGCATGAACTGGGCCGCCAGGCCCA C A A S G F T E S W Y G M N W W R O A P - 4 GGCAAGGGGCTGGGTGGGGGCAATTATTTGGTATGATGGAGATAACAATACAGCA (G K G L E W W A W Y D G D E Y Y A. -- as GACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTG S W K G R F S R D N S K N T : Y - 8 CAAATGAACGGCCTGAGAGCCGAGGACACGGCTGGTATTATTGTGCGAGAGACTAGG Q M N G L R A E D T A W Y Y C A R D L. R. - C ACGGGCCTGACTACGGGGCCAGGGAACCCTGGTCACCGTCTCCTC T. G. E. F. Y W G C G T I, W T W S S. a 1.8 Italics: Leader sequence (not in mature antibody) Bold and underlined : CDR's Fig. 7 U.S. Patent Jun. 20, 2017 Sheet 8 of 9 US 9,683,038 B2 ATGTTGCCAT CACAACTCAGGGTTCIGCT'GCTCGGGTTCCAGCCTCCAGGGGIGAA - 19 M L P S C L T G F L L I, W W P A S R G. E. - ATTGTGCTGACTCAGTCTCCAGACT CAGICTGTGACTCCAAAGGAGAAAGTCACCATC W L T Q S P D F C S W T P K E K W T Y - 2. ACCGCCGGGCCAGICAGASCATGGASAGCTTACACTGGTACCACAGAAACCAGA T C R A S C S I C S S , H. W. Y O C K P D - 4. CAGTCCCAAAGCTCCTCATCAAGAGCTCCCAGCCTCTCAGGGGCCCCTCGAGG O S P K L L T K Y AS Q S F. S. G V P S R - 6. TCAGTGGCAGTGGATCGGGACAGATTCACCCTCACCACAATAGCCGGAAGCGAA E. S. G. S. G. S G T D F : , T , N. S. L. E. A. E. - 8 GATGCGCAGCGTATTACTGTCATCAGAGTAGTAGACCACACTTCGGCCCTGGG D A A A Y Y C H C S S S P. F. T. F. G P G ... O ACCAAAGGGATACAAA. a. Of K W K Italics: Leader sequence (not in mature antibody) Bold and underlined: CDR's Fig. 8 U.S. Patent Jun. 20, 2017 Sheet 9 Of 9 US 9,683,038 B2 Screen Double-Blind Treatment Stable Post- M. F/U period " Approx. 36 to 60 months (event driven) with hisCRP2 canakinumab 50 mg s.c. + standard of care Active Tx for therapy aornoglycemic canakinumab 150 mg s.c. + standard of care and T2DM Standard of care therapy OR canakinumab 300 mg s.c. t + standard of care Wash ot therapy phase for pre Screen O. O.S 1.5 3 6 9 12 8 24, 30 36 +6 (~4 weeks) BL Time in months relative to Baseline/EOS Fig. 9 US 9,683,038 B2 1. 2 METHODS OF REDUCING THE RISK OF markers such as hsCRP have increased vascular risk. The EXPERIENCING A CARDIOVASCULAR (CV) present disclosure relates, in part, to the finding that direct EVENT OR A CEREBROVASCULAREVENT inhibition of inflammation by administration of IL-1B bind NAPATIENT THAT HAS SUFFERED A ing antibodies will reduce cardiovascular event rates. QUALIFYING CV EVENT Accordingly, the present disclosure is directed to a RELATED APPLICATIONS method of preventing or reducing risk of experiencing a recurrent cardiovascular (CV) event or a cerebrovascular The present disclosure claims priority to U.S. Provisional event in a patient that has suffered of a qualifying CV event, Patent Application No. 61/541,341, filed Sep. 30, 2011, the comprising administering about 25 mg to about 300 mg of disclosure of which is incorporated by reference herein in its 10 an IL-1B binding antibody or functional fragment thereof, entirety. wherein said patient has a level of hsCRP of about a 1 mg/L before administration of said antibody or functional frag TECHNICAL FIELD ment thereof. The present disclosure relates to novel uses and regimens 15 Further features and advantages of the disclosure will for preventing or reducing risk of experiencing a recurrent become apparent from the following detailed description of cardiovascular (CV) event or a cerebrovascular event in a the invention. patient that has suffered of a qualifying CV event, which employ an IL-1B binding antibody or functional fragments BRIEF DESCRIPTION OF THE DRAWINGS thereof, e.g., canakinumab. FIG. 1: Risk of recurrent cardiovascular events in the BACKGROUND OF THE DISCLOSURE PROVE IT TIMI 22 trial of acute coronary syndrome patients after initiation of Statin therapy, according to on Atherosclerosis is a disease characterized by chronically treatment levels of hsCRP.
Load more

Recommended publications
  • Xử Trí Quá Liều Thuốc Chống Đông
    XỬ TRÍ QUÁ LIỀU THUỐC CHỐNG ĐÔNG TS. Trần thị Kiều My Bộ môn Huyết học Đại học Y Hà nội Khoa Huyết học Bệnh viện Bạch mai TS. Trần thị Kiều My Coagulation cascade TIÊU SỢI HUYẾT THUỐC CHỐNG ĐÔNG VÀ CHỐNG HUYẾT KHỐI • Thuốc chống ngưng tập tiểu cầu • Thuốc chống các yếu tố đông máu huyết tương • Thuốc tiêu sợi huyết và huyết khối Thuốc chống ngưng tập tiểu cầu Đường sử Xét nghiệm theo dõi dụng Nhóm thuốc ức chế Glycoprotein IIb/IIIa: TM VerifyNow Abciximab, ROTEM Tirofiban SLTC, Hb, Hct, APTT, Clotting time Eptifibatide, ACT, aPTT, TT, and PT Nhóm ức chế receptor ADP /P2Y12 Uống NTTC, phân tích chức +thienopyridines năng TC bằng PFA, Clopidogrel ROTEM Prasugrel VerifyNow Ticlopidine +nucleotide/nucleoside analogs Cangrelor Elinogrel, TM Ticagrelor TM+uống ƯC ADP Uống Nhóm Prostaglandin analogue (PGI2): Uống NTTC, phân tích chức Beraprost, năng TC bằng PFA, ROTEM Iloprost (Illomedin), Xịt hoặc truyền VerifyNow TM Prostacyclin,Treprostinil Nhóm ức chế COX: Uống NTTC, phân tích Acetylsalicylicacid/Aspirin#Aloxiprin,Carbasalate, chức năng TC bằng calcium, Indobufen, Triflusal PFA, ROTEM VerifyNow Nhóm ức chế Thromboxane: Uống NTTC, phân tích chức +thromboxane synthase inhibitors năng TC bằng PFA, Dipyridamole (+Aspirin), Picotamide ROTEM +receptor antagonist : Terutroban† VerifyNow Nhóm ức chế Phosphodiesterase: Uống NTTC, phân tích chức Cilostazol, Dipyridamole, Triflusal năng TC bằng PFA, ROTEM VerifyNow Nhóm khác: Uống NTTC, phân tích chức Cloricromen, Ditazole, Vorapaxar năng TC bằng PFA, ROTEM VerifyNow Dược động học một số thuốc
    [Show full text]
  • Effect of Garlic in Comparison with Misoprostol and Omeprazole on Aspirin Induced Peptic Ulcer in Male Albino Rats
    Available online at www.derpharmachemica.com ISSN 0975-413X Der Pharma Chemica, 2017, 9(6):68-74 CODEN (USA): PCHHAX (http://www.derpharmachemica.com/archive.html) Effect of Garlic in Comparison with Misoprostol and Omeprazole on Aspirin Induced Peptic Ulcer in Male Albino Rats Ghada E Elgarawany¹, Fatma E Ahmed², Safaa I Tayel³, Shimaa E Soliman³ 1Departments of Physiology, Faculty of Medicine, Menoufia University, Egypt 2Pharmacology, Faculty of Medicine, Menoufia University, Egypt 3Medical Biochemistry, Faculty of Medicine, Menoufia University, Egypt ABSTRACT Aiming to evaluate the protective effect of garlic on aspirin induced peptic ulcer in comparison with misoprostol and omeprazole drugs and its possible mechanisms. Forty white male albino rats were used. Total acid content, ulcer area/mm2, histological study, mucosal & serum Total Antioxidant Capacity (TAC) by calorimetry and mucosal & serum PGE2 and serum TNF-α by ELISA were assayed. Titrable acidity and total acid output decreased in garlic, misoprostol and omeprazole treated groups. Garlic, misoprostol and omeprazole improved gastric mucosa and 2 decreased ulcer formation and ulcer area/mm . Aspirin decreased PGE2 in gastric mucosa and serum. Co-administration of garlic to aspirin significantly increased PGE2 near to normal in gastric mucosa. Aspirin significantly increased serum TNF-α than control and other groups. Garlic is suggested to protect the stomach against ulcer formation induced by aspirin by reducing gastric acidity, ulcer area, improve gastric mucosa, increasing PGE2 and decreasing TNF-α. Keywords: Aspirin, Garlic, Misoprostol, Omeprazole, Peptic ulcer INTRODUCTION Peptic ulcer is a worldwide problem, that present in around 4% of the population [1]. About 10% of people develop a peptic ulcer in their life [2].
    [Show full text]
  • Effects of Beraprost Sodium on Renal Function and Inflammatory Factors of Rats with Diabetic Nephropathy
    Effects of beraprost sodium on renal function and inflammatory factors of rats with diabetic nephropathy J. Guan1,2, L. Long1, Y.-Q. Chen1, Y. Yin1, L. Li1, C.-X. Zhang1, L. Deng1 and L.-H. Tian1 1Affiliated Hospital of North Sichuan Medical College, Nanchong, Sichuan, China 2Nursing School of North Sichuan Medical College, Nanchong, Sichuan, China Corresponding author: J. Guan E-mail: [email protected] / [email protected] Genet. Mol. Res. 13 (2): 4154-4158 (2014) Received November 19, 2012 Accepted November 13, 2013 Published June 9, 2014 DOI http://dx.doi.org/10.4238/2014.June.9.1 ABSTRACT. Beraprost sodium (BPS) is a prostaglandin analogue. We investigated its effects on rats with diabetic nephropathy. There were 20 rats each in the normal control group (NC), the diabetic nephropathy group (DN), and the BPS treatment group. The rats in DN and BPS groups were given a high-fat diet combined with low-dose streptozotocin intraperitoneal injections. The rats in the BPS group were given daily 0.6 mg/kg intraperitoneal injections of this drug. After 8 weeks, blood glucose, 24-h UAlb, Cr, BUN, hs-CRP, and IL-6 levels increased significantly in the DN group compared with the NC group; however, the body mass was significantly reduced in the DN group compared with the NC group. Blood glucose, urine output, 24-h UAlb, Cr, hs-CRP, and IL-6 levels were significantly lower in the BPS group than in the DN group; the body mass was significantly greater in the DN group. Therefore, we concluded that BPS can improve renal function and protect the kidneys of DN rats by reducing oxidative stress and generation of inflammatory cytokines; it also decreases urinary protein Genetics and Molecular Research 13 (2): 4154-4158 (2014) ©FUNPEC-RP www.funpecrp.com.br Beraprost sodium and diabetic nephropathy 4155 excretion of rats with diabetic nephropathy.
    [Show full text]
  • Dynamic Expression of Mrnas and Proteins for Matrix Metalloproteinases and Their Tissue Inhibitors in the Primate Corpus Luteum During the Menstrual Cycle
    Molecular Human Reproduction Vol.8, No.9 pp. 833–840, 2002 Dynamic expression of mRNAs and proteins for matrix metalloproteinases and their tissue inhibitors in the primate corpus luteum during the menstrual cycle K.A.Young1,3, J.D.Hennebold1 and R.L.Stouffer1,2 1Division of Reproductive Sciences, Oregon National Primate Research Center, Oregon Health and Science University, 505 NW 185th Ave, Beaverton, Oregon 97006 and 2Department of Physiology and Pharmacology, Oregon Health and Science University, Portland, OR 97201, USA 3To whom correspondence should be addressed. E-mail: [email protected] Matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMPs) may be involved in tissue remodelling in the primate corpus luteum (CL). MMP/TIMP mRNA and protein patterns were examined using real-time PCR and immunohistochemistry in the early, mid-, mid-late, late and very late CL of rhesus monkeys. MMP-1 (interstitial collagenase) mRNA expression peaked (by >7-fold) in the early CL. MMP-9 (gelatinase B) mRNA expression was low in the early CL, but increased 41-fold by the very late stage. MMP-2 (gelatinase A) mRNA expression tended to increase in late CL. TIMP-1 mRNA was highly expressed in the CL, until declining 21-fold by the very late stage. TIMP-2 mRNA expression was high through the mid-luteal phase. MMP-1 protein was detected by immunocytochemistry in early steroidogenic cells. MMP-2 protein was prominent in late, but not early CL microvasculature. MMP-9 protein was noted in early CL and labelling increased in later stage steroidogenic cells. TIMP-1 and -2 proteins were detected in steroidogenic cells at all stages.
    [Show full text]
  • Study Protocol
    Protocol 3-001 Confidential 28APRIL2017 Version 4.1 Asahi Kasei Pharma America Corporation Synopsis Title of Study: A Randomized, Double-Blind, Placebo-Controlled, Phase 3 Study to Assess the Safety and Efficacy of ART-123 in Subjects with Severe Sepsis and Coagulopathy Name of Sponsor/Company: Asahi Kasei Pharma America Corporation Name of Investigational Product: ART-123 Name of Active Ingredient: thrombomodulin alpha Objectives Primary: x To evaluate whether ART-123, when administered to subjects with bacterial infection complicated by at least one organ dysfunction and coagulopathy, can reduce mortality. x To evaluate the safety of ART-123 in this population. Secondary: x Assessment of the efficacy of ART-123 in resolution of organ dysfunction in this population. x Assessment of anti-drug antibody development in subjects with coagulopathy due to bacterial infection treated with ART-123. Study Center(s): Phase of Development: Global study, up to 350 study centers Phase 3 Study Period: Estimated time of first subject enrollment: 3Q 2012 Estimated time of last subject enrollment: 3Q 2018 Number of Subjects (planned): Approximately 800 randomized subjects. Page 2 of 116 Protocol 3-001 Confidential 28APRIL2017 Version 4.1 Asahi Kasei Pharma America Corporation Diagnosis and Main Criteria for Inclusion of Study Subjects: This study targets critically ill subjects with severe sepsis requiring the level of care that is normally associated with treatment in an intensive care unit (ICU) setting. The inclusion criteria for organ dysfunction and coagulopathy must be met within a 24 hour period. 1. Subjects must be receiving treatment in an ICU or in an acute care setting (e.g., Emergency Room, Recovery Room).
    [Show full text]
  • Uveitis and Cystoid Macular Oedema Secondary to Topical Prostaglandin
    Review Br J Ophthalmol: first published as 10.1136/bjophthalmol-2019-315280 on 12 June 2020. Downloaded from Uveitis and cystoid macular oedema secondary to topical prostaglandin analogue use in ocular hypertension and open angle glaucoma Jason Hu,1 James Thinh Vu ,1 Brian Hong,1 Chloe Gottlieb1,2,3 ► Additional material is ABSTRact complications and PGAs became popular due to published online only. To view, Background Of the side effects of prostaglandin having once- daily administration and few side please visit the journal online (http:// dx. doi. org/ 10. 1136/ analogues (PGAs), uveitis and cystoid macular oedema effects. PGAs have emerged as the most potent bjophthalmol- 2019- 315280). (CME) have significant potential for vision loss based IOP- lowering topical medication with bimatoprost on postmarket reports. Caution has been advised due reported as the most effective and unoprostone as 1 University of Ottawa, Faculty to concerns of macular oedema and uveitis. In this the least effective.3 of Medicine, Ottawa, Ontario, report, we researched and summarised the original data Canada The specific mechanism of action of PGAs is 2University of Ottawa Eye suggesting these effects and determined their incidence. not completely understood. It is known that they Institute, Ottawa, Ontario, Methods Preferred Reporting Items for Systematic increase uveoscleral outflow and there is growing Canada review and Meta- Analyses guidelines were followed. 3 evidence that they also increase conventional Ottawa Hospital Research Studies evaluating topical PGAs in patients with ocular 4 Institute, Ottawa, Ontario, outflow through Schlemm’s canal. The proposed Canada hypertension or open angle glaucoma were included. mechanism is that PGAs bind to E- type prostanoid MEDLINE, PubMed, EMBASE, CINAHL, Web of Science, receptors and prostaglandin F receptors in ‘the Cochrane Library, LILACS and ClinicalTrials.
    [Show full text]
  • 3720-3726-Domiciliary Treatment with Intravenous Iloprost
    European Review for Medical and Pharmacological Sciences 2016; 20: 3720-3726 Efficacy, safety and feasibility of intravenous iloprost in the domiciliary treatment of patients with ischemic disease of the lower limbs R. POLIGNANO1, C. BAGGIORE1, F. FALCIANI2, U. RESTELLI3, N. TROISI4, S. MICHELAGNOLI4, G. PANIGADA5, S. TATINI1, A. FARINA6, G. LANDINI1 1Medical Department, USL Centro Toscana, Florence, Italy 2Skin Lesions Observatory, USL Centro Toscana, Florence, Italy 3School of Public Health, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, South Africa; Centre for Research on Health Economics, Social and Health Care Management, Carlo Cattaneo University – LIUC, Castellanza (Varese), Italy 4Department of Surgery, Vascular and Endovascular Surgery Unit, San Giovanni di Dio Hospital, Florence, Italy 5Internal Medicine Unit, Santi Cosma e Damiano Hospital, Pescia, Italy 6Medical Affairs Department, Italfarmaco S.p.A., Cinisello Balsamo, Milan, Italy Abstract. – OBJECTIVE: Intravenous iloprost Introduction is an important option in the treatment of isch- emic disease of the lower limbs; however, the administration of therapy is frequently compro- The term ischemic disease of the lower limbs mised because of the need for long cycles of in- defines a wide number of pathological conditions fusion in a hospital setting. The aim of the study of both large and small peripheral arteries and is to evaluate the efficacy, safety, feasibility, and veins, including peripheral artery disease (PAD), the economic impact of infusion therapy in the diabetic microangiopathy, thromboangiitis oblite- outpatient setting. PATIENTS AND METHODS: rans or Buerger’s disease, and other inflammatory Twenty-four con- 1 secutive patients were treated with iloprost at vasculitis . Although these conditions are cha- their homes where they were administered a slow racterized by different pathogenetic mechanisms, rate of infusion for 24 hours a day, during 9.9 ± 2.3 similar clinical manifestations may occur due to days, with a portable syringe pump (Infonde®).
    [Show full text]
  • CHAPTER 1 General Introduction
    CHAPTER 1 General Introduction Chapter 1 1.1 General Introduction Drugs are defined as chemical substances that are used to prevent or cure diseases in humans and animals. Drugs can also act as poisons if taken in excess. For example paracetamol overdose causes coma and death. Apart from the curative effect of drugs, most of them have several unwanted biological effects known as side effects. Aspirin which is commonly used as an analgesic to relieve minor aches and pains, as an antipyretic to reduce fever and as an anti-inflammatory medication, may also cause gastric irritation and bleeding. Also many drugs, such as antibiotics, when over used develop resistance to the patients, microorganisms and virus which are intended to control by drug. Resistance occurs when a drug is no longer effective in controlling a medical condition.1 Thus, new drugs are constantly required to surmount drug resistance, for the improvement in the treatment of existing diseases, the treatment of newly identified disease, minimise the adverse side effects of existing drugs etc. Drugs are classified in number of different ways depending upon their mode of action such as antithrombotic drugs, analgesic, antianxiety, diuretics, antidepressant and antibiotics etc.2 Antithrombotic drugs are one of the most important classes of drugs which can be shortly defined as ―drugs that reduce the formation of blood clots‖. The blood coagulation, also known as haemostasis is a physiological process in which body prevents blood loss by forming stable clot at the site of injury. Clot formation is a coordinated interplay of two fundamental processes, aggregation of platelets and formation of fibrin.
    [Show full text]
  • Topical Prostaglandin Analogues with and Without Preservatives on Tear Film Stability in the Long-Term Treatment of Glaucoma
    Jebmh.com Original Research Article Topical Prostaglandin Analogues with and without Preservatives on Tear Film Stability in the Long-Term Treatment of Glaucoma Humayoun Ashraf1, Shamim Ahmad2, Rupankar Sarkar3, Syed Wajahat Ali Rizvi4 1Professor, Institute of Ophthalmology, Jawaharlal Nehru Medical College, Faculty of Medicine, Aligarh Muslim University, Aligarh, Uttar Pradesh, India. 2Professor, Officer In-charge, Microbiology Section, Institute of Ophthalmology, Jawaharlal Nehru Medical College, Faculty of Medicine, Aligarh Muslim University, Aligarh, Uttar Pradesh, India. 3Resident, Institute of Ophthalmology, Jawaharlal Nehru Medical College, Faculty of Medicine, Aligarh Muslim University, Aligarh, Uttar Pradesh, India. 4Assistant Professor, Institute of Ophthalmology, Jawaharlal Nehru Medical College, Faculty of Medicine, Aligarh Muslim University, Aligarh, Uttar Pradesh, India. ABSTRACT BACKGROUND Prostaglandin analogues (PGAs) have proven to be the most potent of the anti- Corresponding Author: glaucoma medications in decreasing IOP, with little systemic side effects and Dr. Rupankar Sarkar, Institute of Ophthalmology, hence are the initial treatment of choice. Many PGAs contain preservatives which Jawaharlal Nehru Medical College, are associated with increased ocular side effects, the most common preservative Faculty of Medicine, Aligarh Muslim being benzalkonium chloride (BAK). BAK is known to cause cell toxicity and cell University (AMU), Aligarh – 202001, death in ocular surface tissues in a dose-dependent and time-dependent manner Uttar Pradesh, India. E-mail: [email protected] and often gives rise to ocular surface diseases, with the consequence of dysfunctional tear film in patients who are on long-term PGA therapy. We wanted DOI: 10.18410/jebmh/2020/178 to evaluate the long-term effects of prostaglandin analogue eye drops with and without preservative on tear film stability in glaucoma patients who are instilling Financial or Other Competing Interests: these medications on a long-term basis.
    [Show full text]
  • International Longitudinal Registry of Patients with Atrial Fibrillation And
    Beyer-Westendorf et al. Thrombosis Journal (2019) 17:7 https://doi.org/10.1186/s12959-019-0195-7 RESEARCH Open Access International longitudinal registry of patients with atrial fibrillation and treated with rivaroxaban: RIVaroxaban Evaluation in Real life setting (RIVER) Jan Beyer-Westendorf1,2*, A. John Camm3, Keith A. A. Fox4, Jean-Yves Le Heuzey5, Sylvia Haas6, Alexander G. G. Turpie7, Saverio Virdone8, Ajay K. Kakkar8,9 and for the RIVER Registry Investigators Abstract Background: Real-world data on non-vitamin K oral anticoagulants (NOACs) are essential in determining whether evidence from randomised controlled clinical trials translate into meaningful clinical benefits for patients in everyday practice. RIVER (RIVaroxaban Evaluation in Real life setting) is an ongoing international, prospective registry of patients with newly diagnosed non-valvular atrial fibrillation (NVAF) and at least one investigator-determined risk factor for stroke who received rivaroxaban as an initial treatment for the prevention of thromboembolic stroke. The aim of this paper is to describe the design of the RIVER registry and baseline characteristics of patients with newly diagnosed NVAF who received rivaroxaban as an initial treatment. Methods and results: Between January 2014 and June 2017, RIVER investigators recruited 5072 patients at 309 centres in 17 countries. The aim was to enroll consecutive patients at sites where rivaroxaban was already routinely prescribed for stroke prevention. Each patient is being followed up prospectively for a minimum of 2-years. The registry will capture data on the rate and nature of all thromboembolic events (stroke / systemic embolism), bleeding complications, all-cause mortality and other major cardiovascular events as they occur.
    [Show full text]
  • Long-Term Clinical Results After Iloprost Treatment for Bone Marrow Edema and Avascular Necrosis
    See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/299549448 Long-term Clinical Results after Iloprost Treatment for Bone Marrow Edema and Avascular Necrosis Article in Orthopedic Reviews · March 2016 DOI: 10.4081/or.2016.6150 CITATIONS READS 5 30 8 authors, including: Tim Classen Stefan Landgraeber University Hospital Essen University Hospital Essen 33 PUBLICATIONS 156 CITATIONS 58 PUBLICATIONS 515 CITATIONS SEE PROFILE SEE PROFILE Xinning Li Christoph Zilkens Boston University Universitätsklinikum Düsseldorf 104 PUBLICATIONS 867 CITATIONS 139 PUBLICATIONS 2,129 CITATIONS SEE PROFILE SEE PROFILE Some of the authors of this publication are also working on these related projects: Patient-specific knee arthroplasty View project Local anaesthetics and opioids View project All content following this page was uploaded by Xinning Li on 01 April 2016. The user has requested enhancement of the downloaded file. Orthopedic Reviews 2016; volume 8:6150 Long-term clinical results after Introduction Correspondence: Tim Claßen, Department of iloprost treatment for bone Orthopedics, University of Duisburg-Essen, marrow edema and avascular Avascular osteonecrosis (AVN) is related to Hufelandstr. 55, D-45147 Essen, Germany. the interruption of blood supply or a disorder of Tel.: +49.201.4089.2138 - Fax: +49.201.723.5910. necrosis E-mail: [email protected] the circulation to the subchondral bone, which Tim Claßen,1 Antonia Becker,1 is a particularly vulnerable location due to the Key words: Avascular osteonecrosis; Iloprost; capillary terminal branches. The detailed Stefan Landgraeber,1 Marcel Haversath,1 bone marrow edema. pathogenesis of AVN and the relationship Xinning Li,2 Christoph Zilkens,3 between the underlying circulatory disorder is Contributions: the authors contributed equally.
    [Show full text]
  • Nsaids in Cats
    ISFM and AAFP Consensus Guidelines Long-term use of NSAIDs in cats Clinical Practice A preprint from the Journal of Feline Medicine and Surgery Volume 12, July 2010 Journal of Feline Medicine and Surgery (2010) 12, 519 doi:10.1016/j.jfms.2010.05.003 EDITORIAL NSAIDs and cats – it’s been a long journey Although the first This issue of JFMS contains the first ever panel have covered much valuable ground: international consensus guidelines ✜ To set the scene they consider how use of NSAIDs on the long-term use of non-steroidal common chronic pain can be in cats, typically was probably anti-inflammatory drugs (NSAIDs) in cats. related to degenerative joint disease, This timely publication, which appears on idiopathic cystitis, trauma and cancer. by Hippocrates, pages 521–538 (doi:10.1016/j.jfms.2010.05.004), ✜ They then explain how and why NSAIDs is a collaborative enterprise by the International can have such positive and, potentially, it has taken until Society of Feline Medicine (ISFM) and negative actions. now for cats to American Association of Feline Practitioners ✜ They consider the best ways of enhancing (AAFP). It has been compiled by a panel of owner and cat compliance, make suggestions gain the benefit of world leaders in the understanding of pain about sensible dosing frequencies, timing of in cats and, without doubt, is essential reading medication and accuracy of dosing, and the long-term use for all small animal veterinary surgeons. emphasize the importance of always using of these drugs. It is interesting to reflect that although the ‘lowest effective dose’.
    [Show full text]