의의의학학학석석석사사사학학학위위위논논논문문문
Shh induces Motor Neuron differentiation in P19 Embryonic Carcinoma Cells
아아아주주주대대대학학학교교교 대대대학학학원원원
의의의학학학과과과
박박박래래래희희희 Shh induces Motor Neuron Differentiation in P19 Embryonic Carcinoma Cells
by Rae Hee Park
A Dissertation Submitted to The Graduate School of Ajou University in Partial Fulfillment of the Requirements for the Degree of
MASTER OF MEDICAL SCIENCES
Supervised by
Haeyoung Suh-Kim, Ph.D.
Department of Medical Sciences The Graduate School, Ajou University August, 2005 박박박래래래희희희의의의의의의학학학석석석사사사학학학위위위논논논문문문을을을인인인준준준함함함...
심심심사사사위위위원원원장장장 서서서 해해해 영영영 인인인
심심심사사사위위위원원원 이이이 영영영 돈돈돈 인인인
심심심사사사위위위원원원 조조조 은은은 혜혜혜 인인인
아아아주주주대대대학학학교교교 대대대학학학원원원
222000000555년년년666월월월222222일일일 - ABSRACT-
Sonic hedgehog induces Motor Neuron Differentiation in P19 Embryonic Carcinoma Cells
Sonic hedgehog (Shh) is a member of the hedgehog family of signalling molecules and secreted from two signalling centers, the notochord and the floor plate, where it functions as a morphogen to induce early dorso-ventral patterning of the cenral nervous system (CNS). More recently, multiple actions of Shh during CNS development have been discovered in additional sites, where it specifies the fates of oligodendrocytes and motor neurons as well as proliferation of neural precursors and control of axon outgrowth.
To explore the roles of Shh in neuronal differentiation, we utilized embryonal carcinomal P19 cells as an in vitro model system. We overexpressed
Shh in P19 cells and investigated it’s effects on proliferation and differentiation of
P19 cells., P19/Shh, P19 cells overexpressing Shh, proliferated at higher rates than normal P19 cells even when normal P19 cells stopped growth and underwent differentiation. Ironically, P19/Shh also differentiated into neurons at higher rates than normal P19 cells. Upregulation of both proliferation and neuronal differentiation P19/Shh suggests that Shh may induce neuronal fates from uncommitted P19 cells and concomitantly promote the proliferation of the resulting neuronal precursor cells. As expected motor neuron markers (Hb9,
i ChAT) as well as a dopaminergic neuron marker (TH) were upregulated in neuronal cells derived from P19/Shh. Collectively, these results suggest that Shh may have multiple functions in neural induction of uncommitted stem cells, proliferation of neural precursors, and dorso-ventral patterning of the CNS.
Key words : Sonic hedgehog, Proliferation, Differentiation, Motor neuron, P19 cells
ii TABLE OF CONTENTS
ABSTACT ------i
TABLE OF CONTENTS ------ii
LIST OF FIGURES ------vi
LIST OF TABLE ------viii
LIST OF ABBREVIATIONS ------ix
I. INTRODUCTION ------1
A. Sonic hedgehog ------1
B. Transcriptional regulation of development by Shh ------4
1. Midbrain dopaminergic neuron ------4
2. Spinal cord motor neuron ------5
C. P19 embryonic carcinoma cells ------6
II. MATERIALS AND METHODS ------8
A. Materials ------8
B. Mathods ------9
1. P19 cell culture ------9
2. Purification & titeration of 5E1 antibody ------9
2.1 Affinity chromatography ------9
2.2 Enzyme-Linked Immunosorbent (ELISA) Assay ------10
3. Preparation of Shh conditioned medium ------10
4. Concentration of secreted ShhN ------11
iii 5. Growth kinetics ------11
6. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
(MTT) assay ------12
7. Differentiation of P19 cell ------12
7.1 Conventional neuronal differentiation ------12
7.2 Current neuronal differentiation ------13
8. Reverse Transriptase-Polymerase Chain Reaction (RT-PCR) ------14
9. Western blotting ------15
10. Immunocytochemistry ------16
III. RESULTS ------17
1. Expression of hShhN in P19 cells ------17
2. Preparation of 5E1, a neutralizing antibody against Shh ------19
3. The concentration of secreted Shh ------19
4. Shh induces proliferation of P19 cells ------22
5. Shh induces neuronal differentiation of P19 cells ------25
6. Shh promotes neuronal precursor cell/ motor neurons survival
or proliferation ------28
7. Shh induces motor neuron differentiation in P19 cells ------30
8. Shh induces dopaminergic and motor neuron differentiation in P19
cells ------34
9. Shh promotes neuronal differentiation in P19 cells without treatment
of RA or aggregation culture ------37
iv IV. DISCUSSION ------39
V. CONCLUSIONS ------43
REFERENCES ------44
국문요약 ------54
v LIST OF FIGURES
Fig. 1. Phylogentic relationship of numbers of the Hh protein family ------2 Fig. 2. The Shh signaling pathway ------3
Fig. 3. Shh-activated transcriptional pathway of spinal motor neuron
generation------6
Fig. 4. The method for neural induction of P19 cells ------13
Fig. 5. Generation of ShhN-Producing P19 Cell Lines ------18
Fig. 6. Preparation of 5E1, a neutralizing antibody against Shh ------20
Fig. 7. Soluble Shh activity is inhibited by Shh neutralizing antibody, 5E1 --- 21
Fig. 8. Shh induces proliferation of P19 cells ------23
Fig. 9. Cell viability of P19, P19/hShhN cells was measured by MTT
(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay
------24
Fig. 10. Neuronal differentiation of P19, P19/hShhN cells ------27
Fig. 11. eGFP-labeled neuronal precursors in P19/pNPEeGFP ------29
Fig. 12. RT-PCR of the expression of HD, bHLH and motor neuron specific
markers, Nkx6.1, Olig2, Ngn2, NeuroD, Hb9 and ChAT in P19
and P19/hShhN ------31
Fig. 13. Shh expression induces motor neuron differentiation of P19 cells (1) -- 32
Fig. 14. Shh expression induces motor neuron differentiation of P19 cells (2) -- 33
Fig. 15. Motor neurons and Dopamine neurons of differentiation in P19 cells
vi ------35
Fig. 16. Shh expression induces dopamine neurons and motor neurons
differentiation of P19 cells ------36
Fig. 17. Shh promotes neuronal differentiation in P19 cells without treatment
RA or aggregation culture ------38
vii LIST OF TABLES
Table 1. Primer sequence for RT-PCR ------14
viii LIST OF ABBREVIATION
bHLH b helix-loop-helix bp base pair
ChAT Choline acetyltransferase
CNPase 2', 3'-cyclic nucleotide 3'-phosphodiesterase
CNS Central nerve system
DA Dopaminergic neuron
Dhh Desert hedgehog
DMEM Dulbecco's modified Eagle's medium
ECL Enhanced chemiluminescence
ELISA Enzyme-Linked Immunosorbent Assay
FBS Fetal bovine serum
FGF8 Fibroblast growth factor 8
FITC Fluorescein isothiocyanate
Fsk Forskolin
GFAP Glial fibrillary acidic protein
GFP Green fluorescent protein
HAT Hypoxanthine-Aminopterin Thymidine
Hb9 Homeobox gene 9
HBSS Hank's balanced salt solution
HD Homeodomain
ix Hh Hedgehog
HRP Horseradish peroxidase
IgG Immuonglobulin G
Ihh Indian hedgehog
MN Motor neuron
NCAM Neuronal cell adhesion molecule
NF-M Neurofilament-160 kDa
Ngn2 Neurogenin 2
OD Optical density
Olig2 Oligodendrocyte transcription factor 2
OPD o-phenylenediamine dihydrochloride
P19 cell Mouse embryonic carcinoma cell
PAGE Polyacrylamide gel electrophoresis
PBS Phosphate buffered saline pMN Motor neuron presursor
Ptc Patched
RIPA Radioimmunoprecipitation
RT-PCR Revese transcriptase - polymerase chain reaction
SDS Sodium dodecyl sulfate
Shh Sonic hedgehog
Smo Smoothened
x TBS Tris buffered saline
TH Tyrosine hydroxylase
Tuj1 beta III-tubulin
xi I. INTRODUCTION
A. Shh (Sonic hedgehog)
In vertebrates, three members of the Hedgehog (hh) gene family have been identified : Desert hedgehog (Dhh), Indian hedgehog (Ihh), and Sonic hedgehog
(Shh). The most-studied member is Shh, which is initially expressed in the notochord and then in the floor plate (Echelard et al. 1999; Chiang et al. 1996; for a review, see
Ingham and McMahon 2001). The signaling properties of the notochord and floor plate are associated with several developmental processes, among them the induction or self-induction of the floor plate, the specification of neuronal identity, and the induction of sclerotome development in ventral somite.
Sonic Hedgehog (Shh) is a potent morphogen involved in the development of limbs and muscles as well as the anterior/posterior organization of the neural tube in vertebrates (Goodrich and Scott, 1998). The 19 kDa amino terminal fragment of Shh
(also called Shh-N) is released by autocatalytic proteolysis and induces graded signaling of neighbor target cells (Marti et al ., 1995; Briscoe and Ericson, 1999;
McMahon, 2000). Covalent linkage of cholesterol to the C terminus of Shh may result in tethering of Shh to the cell membrane, which plays an important role in long range signaling during patterning of chick limb and mouse digits (Zeng et al., 2001;
Lewis et al., 2001). On target cells, Shh binds Patched (Ptc) a 12 transmembrane which causes releases of Ptc-inhibition of Smoothened. (Smo), Smo is a 7
1 transmembrane domain G protein coupled receptor and triggers a signaling cascade that finally leads to expression of Shh target genes in the nucleus (Goodrich and
Scott, 1998; McMahon, 2000).
Human Shh Rat Shh Mouse Shh Chick Shh Cynops Shh Pleurodel Shh X.laevis Shh D.rerio twhh D.rerio Shh Human Ihh Mouse Ihh Chick Ihh X. laevis bhh D. Rerio qhh D.Rerio ehh Human Dhh Mouse Dhh X.laevis hh4 X.Laevis chh Fugu hh B.floridae hh L.variegatus hh Drosophila hh
Fig. 1. Phylogentic relationship of numbers of the Hh protein family
2
Shh Shh
Ptc Smo
PKA Fu Cos2 CK1 Su(Fu) GSK3 Cholesterol Slimb Ras23
Gli1, Gli2, Gli3 Shh Zic2
Target genes
Signaling cell Responding cell
Fig. 2. The Shh signaling pathway. Patched (Ptc), Smoothened (Smo), Protein kinase A (PKA), Costal-2 (Cos-2), Suppressor of fused (Su(Fu)), Fused (Fu), Casein kinase 1 (CK1) and Glycogen synthesis kinase 3 (GSK3).
3 B. Transcriptional regulation of development by Shh
The embryonic expression pattern of Shh has been shown to be closely linked to the development and differentiation of the entire ventral neuraxis (Marti et al.,
1995a). Using naive neural tube explants derived from the appropriate levels of the rostro-caudal axis, it has been demonstrated that the induction of spinal motor neurons (Roelink et al., 1994; Tanabe et al., 1995), midbrain dopaminergic neurons
(Hynes et al., 1995; Wang et al., 1995), and basal forebrain cholinergic neurons
(Ericson et al., 1995) are dependent on exposure to Shh. This molecule appears to be crucial for such patterning and phenotype specification in vivo , because mouse embryos deficient in the expression of functional Shh gene product manifest a lack of normal ventral patterning in the CNS as well as gross atrophy of the entire cranium
(Chiang et al., 1996).
1. Midbrain dopaminergic neuron
Midbrain dopaminergic neurons are the main source of dopamine in the mammalian central nervous system and are associated with one of the most prominent human neurological disorders, Parkinson’s disease. During development, they are induced in the ventral midbrain by an interaction between two diffusible factors, Shh and FGF8. The local identity of this part of the midbrain is probably determined by the combinatorial expression of three transcription factors, Otx2, Pax2, and Pax5. After the last cell division, the neurons start to express transcription factors that control further differentiation and the manifestation of cellular properties
4 characteristic for adult dopaminergic neurons of the substantia nigra compacta and the ventral tegmentum. The first to appear is the LIM-homeodomain transcription factor, Lmx1b. It is essential for the survival of these neurons, and it regulates the expression of another transcription factor, Pitx3, an activator of tyrosine hydroxylase
(TH). Lmx1b is followed by the orphan steroid receptor Nurr1. It is essential for the expression of dopaminergic phenotype. A day after Nurr1, two homeodomain transcription factors, engrailed-1 and -2, are expressed.
2. Spinal cord motor neuron
In the embryonic nervous system, many different subtypes of neurons are generated with distinct cellular and physiological properties. Neurons for controlling locomotion, located within the ventral spinal cord, are generated through the coordinate actions of Shh and delta, which influence the subtype identity, timing of differentiation, numbers, and relative position of the cells (Bertrand et al., 2002;
Briscoe and Ericson, 2001; Jessell, 2000; Tanabe and Jessell, 1996). The dividing progenitor cells for motor neurons express a unique combination of transcription factors in response to Shh, including Pax6, Nkx6.1, Olig2, and Mnr2 (Briscoe et al.,
2000; Lee and Pfaff, 2001). These proteins have several roles in motor neuron development: repressing transcriptional programs for other cell fates (Briscoe et al.,
2000), activating neurogenesis via proneural bHLH factors (Mizuguchi et al., 2001;
Novitch et al., 2001; Scardigli et al., 2001), and promoting expression of the LIM homeodomain (LIM-HD) proteins Isl1 and Lhx3, required for motor neuron
5 specification (Thaler et al.,2002). Thus, single factors such as Olig2 coordinately switch on both bHLH and HD proteins (Mizuguchi et al., 2001; Novitch et al., 2001).
Irx3
Pax6 Lhx3 Shh Olig2 Hb9 Nkx6.1 Isl1 Nkx2.2
Fig. 3. Shh-activated transcriptional pathway of spinal motor neuron generation.
C. P19 embryonic carcinoma cell
Very little is known about the determination events that commit unspecialized cells to differentiate into the more specialized cell types that appear later during embryonic development. Mouse embryonic carcinoma cells, the pluripotent stem cells of malignant teratocarcinomas, may provide a culture system with which to study these events. Lines of embryonic carcinoma cells can be isolated from teratocarcinomas and maintained in an undifferentiated state when kept in exponential growth phase in tissue culture. If left undisturbed at high density, they differentiate in vitro into a variety of cell types including epithelium, neurons, muscle, and cartilage.
6 The P19 mouse embryonic carcinoma cell line is an established model of cell differentiation. Developmentally, pluripotent P19 cells give rise to the formation of cell derivatives of all three germ layers and appear to differentiate by the same mechanisms as normal embryonic stem cells. When cultured in the presence of 10 -6
M retinoic acid, a physiologically relevant morphogen, P19 cells differentiate into neuroectodermal cell lineage, such as neurons and glial cells neurons. However, we showed the overexpression of Shh could direct P19 cells to differentiate into neuronal cells in the absence of RA possibly through the Shh signaling pathway.
In this report, we show that P19/hShhN cells, when replated as the single cells suspension, could differentiate only into neurons in the absence of RA.
7 II. MATERIRALS AND METHODS
A. MATERIRALS
FITC conjugated secondary antibodies from Vector Laboratory (Burlingame,
CA, U.S.A); βIII-tubulin (Tuj-1) specific antibody from Berkeley antibody company
(Richmond, CA, U.S.A); neurofilament-160kDa (NF-M) specific antibody from
Zymed Laboratory (South San Francisco, CA, U.S.A); 2', 3'-cyclic nucleotide 3'- phosphodiesterase (CNPase) specific antibody, Choline acetyltransferase (ChAT) and
Hb9 specific antibody from Chemicon (Temecula, CA, U.S.A); DMEM and N2- supplement from GibcoBRL (Grand Island NY, U.S.A); FBS from Hyclone Inc.
(Logan, UT, U.S.A); 5E1 hybrydoma cell from DSHB (IA, U.S.A); Protein G sepharose TM 4 Fast Flow from Amersham Bioscience (Buckinghamshire, U.K);
Mouse IgG , glial fibrillary acidic protein (GFAP) specific antibody, neuronal cell adhesion molecule (NCAM) specific antibody, All-trans-retinoic acid(RA) , Tyrosine
Hydroxylase (TH) specific antibody, 2-mercaptoethanol, o-phenylenediamine dihydrochloride (OPD), Forskolin, Tris, Glycine, sodium dodecyl sulfate(SDS), polyacrylamide, bis-acrylamide, and TEMED from Sigma (St. Louis, MO, U.S.A);
Enhanced chemiluminescence (ECL) kit from Pierce (Rockford, IL, U.S.A); Westran
PVDF membranes from Schleicher & Schuell (Dassel, Germany); RNAzol TM B regents from TEL-TEST Inc. (Frendwood, TX, U.S.A); Frist strand cDNA synthesis kit from Roche (Indianapolis, U.S.A); Super Taq DNA polymerase from Korea B&G
8 (Suwon, Korea).
All other chemicals were obtained from Sigma-Aldrich (St. Louis, MO, U.S.A).
B. METHODS
1. P19 cell culture
P19 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS), 100unit/ml penicillin, 100 ㎍/ml streptomycin in a standard humidified atmosphere at 37 ℃. After the cultures reached 80-90% confluence, the cells were harvested with 0.25% trypsin and 1mM EDTA for 2-3min at 37 ℃, re-plated after 1:10 dilution on 100mm culture dish.
2. Purification & Titration of 5E1 antibody
2.1 Affinity chromatography
Ascitic fluid containing an anti-Shh monoclonal antibody, 5E1 was mixed with on Protein G sepharose 4 Fast Flow beads. prebound gel matrix was packed in a glass column of 1x10cm. The column was equilibrated with binding buffer (20mM sodium phosphate buffer pH 7.0). Then 10ml of binding buffer was applied to the column at a flow rate of 0.4ml/min. The 5E1 antibody was eluted with 20ml of 0.1M
Glycine-HCl pH 2.8 at a flow rate of 0.8/min. Each fraction was monitored by
Bradford assay and the peak fractions were neutralized with 0.05ml of 1M Tris-HCI pH 9.
9 2.2 ELISA (Enzyme-Linked Immunosorbent Assay)
Screening for the presence of an anti-Shh mAb (5E1) in the purified 5E1 and
Ascitic fluid was performed with lab-made ELISA. High binding capacity 96-well flatbottomed microtiter plates were coated with Proleukin. To each well was added
100µl of culture supernatants at 100µg/ml in 0.1% Tween-20 containing PBS (PBS-
T) and then they were incubated overnight at 4 ℃. After washing five times with
PBS-T, potential binding sites were blocked with 200µl of 5% bovine serum albumin in PBS-T and incubated for 1hr at 4 ℃. The purified 5E1(1:10000) and Asctic fluid
(1:1000, 1:5000, 1:100 and 1:10), 100µl per well, were incubated overnight at 4 ℃.
After washing five times with 0.1% Tween-20 containing PBS (PBS-T), to each well was added 100µl of horse radish peroxidase (HRP)-conjugated goat anti-mouse IgG, diluted to 1:5000 in PBS-T, and then incubated for 2 hr at 37 ℃. After washing five times, to each well was added 100µl of OPD (o-phenylenediamine dihydrochloride) substrate and then they were incubated for 10 minutes at room temperature. The
4 reaction was stopped by adding 50µl of 2.5M H 2SO per well and then optical density (OD) was evaluated with an ELISA reader using either a 490nm filter.
3. Preparation of ShhN-Conditioned medium
After P19 and P19/hShhN cells had been plated in tissue culture dish at a density of 1 x 10 5 cells/ml in 10% fetal bovine serum (FBS)/DMEM (Gibco) for 1 day, culture medium was switched to serum-free medium supplemented with N2 supplement and to fresh 10% fetal bovine serum (FBS)/DMEM. Two days later, the
10 medium was collected as P19 (PCM) and P19/hShhN (SCM)-conditioned medium.
The medium filtered through a 0.2 ㎛ pore-size filter. The PCM and SCM is stored at 4℃ for use.
4. Concentration of secreted ShhN
The concentration of Shh in cultured P19/hShh and P19/hShhN conditioned media was determined using a Shh ELISA kit protocol (R&D). Using known concentrations of Shh (0-1000 pg/ml) a standard curve was calculated during each assay using the same 96-well, flat bottom, high binding, EIA/RIA. The concentration of Shh in the conditioned media fell with linear range of the standard curve and thus the Shh concentration in the media was determined from standard curve by interpolation.
5. Growth kinetics
P19, P19/hShhN cells were plated at a density of 5 x 10 3 cells per well of 96- well plate. Following overnight attachment, cells were maintained for 4 days with culture media, serum free media and conditioned media. Anti-Shh, 5E1 and control mIgG added into the medium to a final concentration of 10 ㎍/ml for the 4 days.
Conditioned media was collected 48 hr during P19 and P19/hShhN cells culture and filtered through a 0.2㎛ filter. Cell proliferation was measured in culture using
Trypan-Blue exclusion method. Briefly, the cells were harvested with trypsin, and mixed with 0.4% Trypan-Blue solution. After 1min incubation, living cells were
11 counted.
6. MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay
The proliferation activity of cells was assessed using the MTT assay. This method is based on the ability of mitochondrial dehydrogenases in living cells to reduce soluble tetrazolium salts to a blue formazan product whose amount is directly proportional to the number of living cells. P19, P19/hShhN cells in suspension
(500 l) were added to each well of a 4-well culture plate for a final concentration of
5x10 3 cells/well with 5E1 (10 g/ml) or IgG (10 g/ml) and incubated for 24h, 48h,
72h and 96h at 37°C in a CO2 incubator. At appropriate time points, 300 l of 0.5 mg/ml MTT solution were added to each well, and the cultures further incubated for
2h. Subsequently, the medium with MTT was replaced with 0.2 ml dimethyl sulphoxide. Sample (100 l) were added to each well of a 96-well culture plate. A microplate reader was used to measure absorbance at 570 nm for each well.
7. Differentiation of P19 cells
7.1 Conventional neuronal differentiation
P19 cells were allowed to aggregate in bacterial Petri dishes at a seeding density of 1 x 10 5 cells/ml in the presence of 0.5 µM all-trans -retinoic acid in 10% fetal bovine serum (FBS)/DMEM. After 4 days of aggregation, cells were dissociated into single cells by 0.05 % trypsin-EDTA , and were replated in tissue culture dish at a density of 1 x 10 5 cells/ml in a N2 serum-free medium [DMEM/F12 supplemented
12 with 5 ㎍/ml insulin, 50 ㎍/ml human transferring, 20 mM progesterone, 60 µM putresine, and 30 nM sodium selenite] supplemented with or without final concentration 10 µM forskolin. The cells were then allowed to adhere and cultured for 4 days with replacement of the medium every 48h.
7.2 Current neuronal differentiation
P19 cells were plated in tissue culture dish at a density of 2 x 10 5 cells/ml in
10% fetal bovine serum (FBS)/DMEM. To induce neuronal differentiation, the media were removed, and the cells were washed with HBSS and was replaced with N2 serum-free medium with or without final concentration 10 µM forskolin. The cells maintained for 4 days. The same protocol was used for P19/hShhN cells.
- Conventional method
N2 10% FBS
RA +2d/-2d 4-8d
P19 cells Embryoid body Neuronal cells
- Current method
ShhN, N2
4d
P19 cells Neuronal cells
Fig. 4. The method for neural induction of P19 cells.
13 8. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)
Total RNA was isolated using a RNAzol TM B and cDNA was synthesized using First-strand cDNA synthesis kit and 1 ㎍ of total RNA following the manufacture’s instructions. The PCR reactions were carried out according to standard protocols. Primer sequences (forward and reverse) and product sizes (base pairs) were as follows (Table 1). The PCR products were analyzed on a 1.5% agarose gel.
Table 1. Primer sequence for RT-PCR
Gene Forward Reverse Size (bp)
GAPDH TCCATGACAACTTTGGCATCGTGG GTTGCTGTTGAAGTCACAGGAGAC 395 Smo GGAACTCSAATCGCTACCC GCTGGCWGCCTTCTCACT 560 Ptc ACCTTTGGACTGCTTCTGGG GAGTCATTAACTGGAACATGG 416 Gli ATGCTGTCTCCGGCCCCTCC TCCTCCCGCCCATCCAGCATC 620 Nestin GCGGGGCGGTGCGTGACTAC CAAGAGAAGCCTGGGAACCT 395 NF-M GCCGCTACGCCAAGCTCACCG CTGTCGGTGTGTGTACAGAGG 423 TH GTTCTCAACCTGCTCTTCTCC GCATAGAGGCCCTTCAGCGTG 490 Nurr1 TTAAAAGGCCGGAGAGGTCG CTCTCTTGGGTTCCTTGAGCC 557 Ptx3 GCGCACGCACTTCACCAGCC GCCAGGCTCGAGTTACACGG 600 Olig2 CAGCGAGCACCTCAAATCTA CACCAGTCGCTTCATCTGCT 601 Nkx6.1 CACCCCACACGGCATCAAA GGGCGAAGATTTGCTGTCC 476 Ngn2 CACGCACGAGAACGACAACA CGGTTGTTGGCCTTGAGC 579 NeuroD CTCCGGGGTTATGAGATCGTCAC GCTCTAGATCTCTGACAGAGCCCAAATG 390 Hb9 ACAGGCGGCTCTCTATGGACAC TTCCCCAAGAGGTTCGACTGC 258 ChAT GGCCATTGTGAAGCGGTTTG TGACATGCTCGGGCTCAGGC 425
14 9. Western blotting
Whole cell lysates were prepared as follows; Cells were washed with cold phosphate buffered saline (PBS) twice and drained. Cells were resuspended in RIPA buffer [150mM Sodium chloride, 1% NP-40, 0.1% SDS, 50mM Tris-HCl (pH8.0),
0.5% sodium deoxycholate] and kept on ice for 5 min. After centrifugation at 12000 rpm for 20min, the supernatant was collected and protein content was assayed by
Bradford method. Each 60 ㎍ proteins were separated on 8% or 12% SDS polyacrylamide gel electrophoresis and transferred to PVDF membranes. Membranes were incubated in blocking solution [5% nonfat dry milk in 10mM Tris-HCl (ph7.4),
100mM NaCl, and 0.1% Tween 20] for 1 hour at room temperature and with mouse anti- ShhN (1:100), mouse anti-βIII -tubulin (Tuj-1, 1:1,000), mouse anti-neuronal cell adhesion molecule (NCAM, 1:1,000), mouse anti-neurofilament-160kD (NF-M,
1:1,000), mouse anti-glial fibrillary acidic protein (GFAP, 1:1,000), and mouse anti-2', 3'-cyclic nucleotide 3'-phosphodiesterase (CNPase, 1:1,000) antibody in
TTBS [10mM Tris-HCl (ph7.4), 100mM NaCl, and 0.1% Tween 20] solution for overnight at 4°C. The secondary antibody was horseradish-peroxidase (HRP)- conjugated to goat anti-mouse IgG (1:5,000) or anti-goat IgG (1:5000) and the proteins were visualized using an enhanced chemiluminescence (ECL) kit following the manufacture’s recommendation.
15 10. Immunocytochemistry
Differentiated P19 and P19/hShhN cells were fixed with 2~4% paraformaldehyde solution or 100% methanol for 10 min at 4 ℃. The fixed was washed with PBS solution, three times and incubated with 10% normal horse serum and goat serum, 0.1% BSA and 0.03% Triton X-100 in PBS (PBS-T) for 1hour. After sufficient washing, the cells were incubated with primary antibodies overnight at 4 ℃.
The following primary antibodies were used at the concentrations given: Rat 401
(1:200), GFP (1:200), Ki-67 (1:200), Tuj1 (1:200), NFM (1:200), TH (1:200), Isl-1
(1:200), ChAT (1:200) and Hb9 (1:200). Following several washing with 0.03%
Triton X-100 containing PBS-T solution, cells were incubated in FITC conjugated anti-mouse IgG (1:500), anti-rabbit IgG (1:500), Alexa 488 anti-mouse IgG (1:500), or Alexa 594 anti-rabbit IgG (1:500) secondary antibody for 1 hour in dark chamber.
After sufficient washing with PBS-T, cells were mounted on acras or cover slips by using Vectashield (mounting medium for fluorescence, Vector) with DAPI or
Hoechst (Molecular probe) and photographed using a fluorescent microscope.
16 III. RESULTS
1. Expression of hShhN in P19 cells
To determine whether Shh could play a role in neuronal differentiation, the expression of components of the Shh signaling pathway in P19 cells was analyzed in western blot. Shh was expressed in P19 cells (Figure 5 A). The N-terminal fragment receives two lipid modifications and, after being secreted, can tether to the membrane of producing cells or diffuse, establishing concentration gradients (Porter et al. 1996; Pepinsky et al. 1998; Lewis et al. 2001; Zeng et al. 2001). Medium conditioned by P19/hShhN cells contained Shh-N (Figure 5 A). The components of the Shh receptor complex, Ptc and Smo, as well as the three Gli transcription factors involved downstream of Shh signaling, have been demonstrated by RT-PCR to be expressed on P19 cells (Figure 5 B).
17 A.
P19 P19/hShhN CCMM
Shh
B.
N hh hS 9 9/ P1 P1
Smo
Ptc
Gli
GAPDH
Fig. 5. Generation of ShhN-Producing P19 Cell Lines. (A) Cells, P19 and
P19/hShhN, were harvested and media collected, separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to PVDF membrane, and probed with antibodies direct against the anti-ShhN. ShhN protein as a 20 kDa was detected both cell extracts and medium in P19/hShhN cell. (B) Expression level of Smo, Ptc and
Gli mRNA was measured by RT-PCR.
18 2. Preparation of 5E1, a neutralizing antibody against Shh
5E1 hybridoma cells were obtained from DSHB (IA, U.S.A). The cells were grown in the presence of HAT (Hypoxanthine-Aminopterin Thymidine). The cells were injected into the peritoneal cavity of BalbC female (6~8 week) to obtain ascitic fluid. The titer of 5E1 ascitic fluid was determined by ELISA using P19/hShhN conditioned medium as an antigen. 5E1 reacted with secreted ShhN in ELISA at dilutions up to >1:1000 (ascitic fluid) (Fig 6 A). IgG fractions were obtained by affinity purification on protein G–sepharose (Fig 6 B). Purified 5E1 were measured the concentration of ShhN by coomassie blue staining and showed neutralizing activity with ShhN in growth kinetics. P19/hShhN were inhibited proliferation at
10~30 ㎍/ml 5E1 (Fig 7).
3. The Concentration of secreted Shh
Shh detected in media conditioned by P19/hShhN using an ELISA. As this concentration of Shh is near the low limit of detection we used the same ELISA protocol to measure Shh in growth media containing 10% FBS, conditioned media form P19/hShhN and differentiation media containing N2 supplement in DMEM:F12 from P19/hShh. The concentration of secreted Shh has 0.7ng/ml in differentiation media and 0.85 ng/ml in conditioned media.
19 A. B.
0.20 1.0 0.2 0.18 0.16 P19/hShhN ELISA 0.14 0.12 0.5 0.1 0.10 0.08 A.C 0.06 P19 Absorbance (490nm) Absorbance (490nm) 0.04 Absorbance (280nm) 0 0 - 1:5000 1:1000 1 2 3 4 5 6 5E1 dilution factor Fraction number
C. Standard conc. (µg)
M 1 2 4 8 sample
H
L
Fig. 6. Preparation of 5E1, a neutralizing antibody against Shh. 5E1 reacted with secreted ShhN in ELISA at dilutions up to 1:1000~5:000 (ascitic fluid) (A). The titer of 5E1 was determined by ELISA using P19/hShhN conditioned medium as an antigen and its purified by affinity chromatography (B). Purified 5E1 were measured the concentration of ShhN by coomassie blue staining (C).
20 0 µg/ml 0.3 µg/ml 3µg/ml 30 µg/ml Mouse IgG Mouse 5E1
120
100 mIgG 80
60
40 5E1
Number ofcells (%) 20
0 0 10 20 30 µg/ml
Fig. 7. Soluble Shh activity is inhibited by Shh neutralizing antibody, 5E1.
P19/hShhN cells were plated at density of 3 x 10 3 cells per well 48-well plate and cultured with DMEM supplemented 0.5% FBS for 4 days. Cells incubated with dilution of 5E1 monoclonal antibody (mAb) or IgG and the total living cell number were measured by Trypan blue dye exclusion method.
21 4. Shh induces proliferation of P19 cells
To test whether Shh regulates P19 cell growth and differentiation, we cultured cells for 96hr in the presence of 5E1, as Shh neutralizing antibody, or control IgG and analyzed the cultures by cell counting using Trypan-blue dye exclusion method.
These assays were performed in the presence or absence of specific Shh inhibitor, the
Shh neutralizing monoclonal antibody 5E1. Purified 5E1 (10µg/ml) was added to the medium and the medium was replaced every 2 days. Cultures grown in P19 cells demonstrated low proliferation rate. However, a 2-fold, significant increase in cell proliferation was observed in P19/hShhN. P19/hShhN cells were almost completely inhibited by 5E1 monoclonal antibody, but unaffected by mIgG (Figure 8 A). The hShhN effect was blocked by 5E1. To test whether secreted Shh regulates proliferation of P19 cells, we cultured for 4 days in P19 cells conditioned medium and P19/hShhN cells conditioned medium. Conditioned medium from P19/hShhN increased the proliferation of P19 cells, which was blocked by 5E1 (Fig 8 B). Unlike
P19 cells, the proliferating potential of P19/hshhN cells were maintained under the differentiation condition of P19 (Fig 8 C).
To confirm the effect of Shh on P19 cell proliferation, proliferation was studied by using 5E1 monoclonal antibody. Neutralizing activity of 5E1 monoclonal antibody was studied by incubating the antibody with 5E1 or IgG. The MTT assay was then performed after 92 hours incubation. As shown in Figure 9, P19/hShhN cells increased proliferation and inhibited by 5E1 (10 ㎍/ml) by compared to the control groups (Fig 9).
22 A. B. ) 3 400 ) 25
P19 + mIgG 3 P19 CM + mIgG P19 + 5E1 P19 CM + 5E1 P19/hShhN + mIgG P19/hShhN CM + mIgG P19/hShhN + 5E1 20 300 P19/hShhN CM + 5E1 15 200 of cellsof (x10 10 100 5 Number Numberof cells (x10 0 0 0 1 2 3 4 0 1 2 3 Days Days C.
) 30 3 4 days 25
20
15
10
Number of cells (x10 cells of Number 5 0 5E1 ━━━╋╋╋ ━━━ ╋╋╋
P19 P19/hShhN Fig. 8. Shh induces proliferation of P19 cells. P19 andP19/hShhN cells were plated at a density of 3 x 10 3 cells per well of 48-well plate and cultured with DMEM supplemented 10% FBS (A), 0.5% FBS (B) and N2 (C) for 4 days. Cells incubated with 10 µg/ml of 5E1 monoclonal antibody (mAb) or IgG and the total living cell number were measured by Trypan blue dye exclusion method. Data are expressed as a mean of duplicate per time point.
23 P19 + mIgG 3 P19 + 5E1 P19/hShhN + mIgG P19/hShhN + 5E1
2
1 Absorbance (570nm) Absorbance 0 1 2 3 4 Days
Fig. 9. Cell viability of P19, P19/hShhN cells was measured by MTT (3-(4,5 dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay. P19, P19/hShhN cells in suspension (500 l) were added to each well of a 4-well culture plate for a final concentration of 5x10 3 cells/well with 5E1 (10 g/ml) or IgG (10 g/ml) and incubated for 24h, 48h, 72h and 96h at 37°C in a CO2 incubator. At appropriate time points, 300 l of 0.5 mg/ml MTT solution were added to each well, and the cultures further incubated for 2h. Subsequently, the medium with MTT was replaced with 0.2 ml dimethyl sulphoxide. Sample (100 l) were added to each well of a
96-well culture plate. A microplate reader was used to measure absorbance at 570 nm for each well.
24 5. Shh induces neuronal differentiation of P19 cells
In vitro neuronal differentiation of P19 cells and P19/hShhN cells were grown without or with 10µM forskolin in the presence of N2 supplement for 4 days.
P19/hShhN cells formed neurite-like processes and showed a neuron-like morphology on 4 days (Figure 10 A). RT-PCR analyzed for differentiation of P19 and P19/hShhN cells into neural stem/precursors (Nestin), neurons (NF-M) (Fig 10
B). Expression of a neuron-specific protein, NF-M and β-tubulin III were increased in P19/hShhN, which were further increased by addition of 10µM forskolin.
Expression of proteins specific for oligodendrocyte (CNPase) and astrocytes (GFAP) were not obvious (Figure 10 C). Furthermore, immunocytochemistry revealed that cells were positive for neuron-specific markers Tuj1, suggesting that they could be induced into neurons (Figure 10 D).
25 A.
0µµµM FSK 10µM FSK P19 P19/hShhN
B.
P19 P19/hshhN
FSK ━━━ ╋╋╋ ━━━ ╋╋╋ 0 2 4 2 4 0 2 4 2 4 Nestin NF-M GAPDH
26 C.
P19 P19/hShhN
FSK ━━━╋╋╋ ━━━ ╋╋╋ std
βββ-tubulin III
NF-M
NCAM
GFAP
CNPase
D.
P19 P19/ShhN
━━━ ╋╋╋ Fsk ━━━ ╋╋╋ Fsk DAPI Tuj1
Fig. 10. Neuronal differentiation of P19, P19/hShhN cells. Morphological changes of P19 cells by Shh or Foskolin (10 µM) were examined under a phase contrast microscope (Magnification : x200) (A). Expression of Nestin, as neural stem cell marker, and NF-M, as neuronal marker, mRNA was measured by RT-PCR (B).
Neuronal differentiation was measured by western blot analysis with anti-Tuj1 and
NF-M specific antibody (C) and Immunocytochemistry with anti-Tuj1 specific antibody (D).
27 6. Shh promotes neuronal progenitor cell/ motor neurons survival or
proliferation
Nestin is expressed in the myotome the neural progenitor cells of the developing embryo. While the regulatory region for expression in myotome resides in the first intron of the Nestin gene, that for expression in neural progenitor cells exists in the second intron. To ascertain if Shh was important for neuronal progenitor cell survival we added Shh conditioned medium, as a secreted Shh, to cultures of
P19/pNPEeGFP cell lines (Figure 11 A). By 4 days in culture, <4% of Nestin- positive cells were present in the control conditioned medium, whereas 25-30% survive in Shh conditioned medium. GFP-positive cells were increased by secreted
Shh (Figure 11 B). The expression of Nestin was further confirmed by RT-PCR. Shh increased the GFP and Nestin expression driven by the Nestin promoter/enhancer
(Figure 11 C).
28 A.
pNPEeGFP Nestin promoter EGFP Intron II
B. Control IgG 5E1 35 30 25 20
Control CMControl 15 10 5
% nestin-GFP(+)/% Totalcells 0 IgG ╋╋╋━━━ ╋╋╋ ━━━ 5E1 ━━━╋╋╋ ━━━ ╋╋╋ ShhN CM
Control ShhN CM CM P19/pNPEeGFP C. 3
Control CM ShhN CM 2 IgG ╋╋╋ ━━━╋╋╋ ━━━
5E1 ━━━╋╋╋ ━━━╋╋╋
Nestin 1
GAPDH Nestin/GAPDHmRNA 0 IgG ╋╋╋ ━━━╋╋╋ ━━━ 5E1 ━━━╋╋╋ ━━━╋╋╋
Control ShhN CM CM Fig. 11. eGFP-labeled neuronal precursors in P19/pNPEeGFP. Construct for generation of P19/pNPEeGFP (A). P19/pNPEeGFP cells were cultured in Shh conditioned medium or control conditioned medium and counted GFP-positive cells
(B). RT-PCR analyzed expression of Nestin (C).
29 7. Shh induces motor neuron differentiation in P19 cells.
The induction of MN progenitors depends on Shh activity (Briscoe and
Ericson, 2001). To examine whether the spinal progenitors present in P19/hShhN can differentiate into MN progenitor, we monitored the expression of homeobox domain and bHLH transcription factors. In vitro neuronal differentiation of P19 cells was induced by Shh and forskolin. The P19/ShhN cells showed the morphology of the cells changed gradually. P19/hShhN cells formed neurite-like processes and showed a neuron-like morphology on 4 days. To examine whether the spinal progenitors present in P19/hShhN cells can differentiate into MN progenitors, we monitored the expression of HD and bHLH transcription factors that delineate sets of neural progenitor cells. Spinal MN progenitors are found in P19/hShhN cells and expressed
Nkx6.1, Olig2 and Ngn2. To determine whether MNs are generated from progenitor cells present in P19/hShhN cells, we analyzed the expression of Hb9 and ChAT using
RT-PCR and Immunocytochemistry. P19/ShhN cells increased expression of Hb9 and ChAT, suggesting that they could be induced into motor neurons (Fig 12).
Immunocytochemistry revealed that the differentiated P19/hShhN cells increased positive for motor neuron specific markers including Hb9 and ChAT (Fig 13 and 14).
30 0 µM FSK 10 µM FSK
0 1 2 3 4 1 2 3 4 Nkx6.1 Olig2 Ngn2 NeuroD P19 Hb9 ChAT
GAPDH
Nkx6.1 Olig2 Ngn2 NeuroD P19/hShhN Hb9 ChAT
GAPDH
Fig. 12. RT-PCR of the expression of HD, bHLH, and motor neuron specific markers in P19 and P19/hShhN. Neuronal induction of P19 cells was performed as described in materials and methods. P19 and P19/hShhN were treated with 10 µM forskolin for 4 days. The efficiency of MN differentiation were measured by expression level of motor neuron marker using RT-PCT. (-/+ indicates that forskolin treatment)
31 P19 P19/hShhN 0µM Fsk 10µM Fsk 0µM Fsk 10µM Fsk Tuj1 Hb9 Hb9 Tuj1 Hoechst Hb9
Tuj1
Fig. 13. Shh expression induces motor neuron differentiation of P19 cells.
Neuronal induction of P19 cells was performed as described in materials and methods. P19 and P19/hShhN were treated with 10 µM forskolin for 4 days. Cells were visualized by Hoechst (blue) and immuno-stained with neuron specific antibody,
Tuj1 (green) and motor neuron specific antibody, Hb9 (red). (Magnification : x200)
32 P19 P19/hShhN 0µM Fsk 10µM Fsk 0µM Fsk 10µM Fsk Tuj1 ChAT ChAT Tuj1 Hoechst ChAT
Tuj1
Fig. 14. Shh expression induces motor neuron differentiation of P19 cells.
Neuronal induction of P19 cells was performed as described in materials and methods. P19 and P19/hShhN were treated with 10 µM forskolin for 4 days. Cells were visualized by Hoechst (blue) and immuno-stained with neuron specific antibody,
Tuj1 (green) and motor neuron specific antibody, ChAT (red). (Magnification : x200)
33 8. Shh induces dopaminergic neuron and motor neuron differentiation in P19
cells
Shh is expressed in ventral regions of the spinal cord, hindbrain, midbrain, and diencephalons. The specification of MN progenitor by Shh signaling is mediated through the patterned expression of homeodomain (HD) and basic helix-loop-helix
(bHLH) transcription factors (Briscoe and Ericson, 2001). Dopaminergic neurons are induced at E9 (rat) by combinatorial action of Shh and FGF8, released by the floor plate and isthmus. To examine whether P19/hShhN can differentiate into MN progenitors, we monitored the bHLH transcription factors by RT-PCR. Olig2, a bHLH transcription factor, increased the expression in P19/hShhN cells. The induction of MN progenitors depends on Shh activity. To determine whether DAs are generated from P19 cells by Shh, we examined the expression of transcription factor and other DAs specific protein in differentiation. We showed that Shh increased the expression of TH, Nurr1 and Olig2 in P19 cells with foskolin (Fig 15). To determine whether MN progenitors generated from RA-exprosed P19/hShhN in current method, we analyzed the expression of Olig2, TH, and Nurr1 protein expressed selectively.
RA-exposed P19/hShhN increased expression of Olig2 and decreased expression of
TH and Nurr1. In the Immunocytochemistry, P19/hShhN cells increased expression of Hb9 and TH, but no Hb9+ cells co-expressed TH, a marker dopaminergic neurons
(Fig 16). These results provide evidence that Shh signaling is significant the induction of DAs and MNs in current differentiation method.
34
P19 P19/hShhN N hh /hS 9 19 10 µM FSK ━━━ ╋╋╋ ━━━ ╋╋╋ P1 P
TH TH
Nurr1 Nurr1
Olig2 Olig2
GAPDH GAPDH
RA
Fig. 15. Motor neurons and Dopamine neurons of differentiation in P19 cells.
P19 and P19/hShhN cells were differentiated for 4days with or without RA(0.5 µM) in N2 media. RT-PCR analyzed expression of TH and Nurr1, as a Dopamine neurons marker and Olig2, as a Motor neurons transcription factor.
35 P19 P19/hShhN 0µM Fsk 10µM Fsk 0µM Fsk 10µM Fsk Hb9 TH Hoechst Hb9 TH Hb9 TH Hoechst Hb9
TH Fig. 16. Shh expression induces dopamine neurons and motor neurons differentiation of P19 cells. Neuronal induction of P19 cells was performed as described in materials and methods. P19 and P19/hShhN were treated with 10 µM forskolin for 4 days. Cells were visualized by Hoechst (blue) and immuno-stained with dopamine neuron specific antibody, TH (green) and motor neuron specific antibody, Hb9 (red). (Magnification : x200)
36 9. Shh promotes neuronal differentiation in P19 cells without treatment of RA
or aggregation culture.
Our previous study suggested that P19 cells, when replated as the aggregates, could differentiate into neural cells with RA (McBurney et al., 1987). However,
P19/hShhN cells could differentiate into neurons without RA or aggregation culture.
To compare whether P19 cells were differentiated into neurons by Shh without treatment of RA or aggregation culture, P19 and P19/hShhN cells induced differentiation with and without treatment of RA or aggregation culture. Cells were differentiated in the absence or presence of 10µM forskolin. RT-PCR analysis of
RNA isolated from differentiated P19 and P19/hShhN cells, which indicated that the expression of marker for neuron, NFM, for DAs, TH and Nurr1, and for MNs, Olig2 increased by Shh in current differentiation, but not in conventional differentiation
(Figure 17). P19/hShhN cells could differentiate into neuronal cells without treatment of RA or aggregation culture. Compared to the conventional method, the current differentiation method without aggregation may provide a useful system for the study of the functions of Shh.
37
Aggregate Agg. + Differentiation Nonagg. + Differentiation
hShhN ━━━ ╋╋╋ ━━━━━━ ╋╋╋ ╋╋╋ ━━━━━━ ╋╋╋ ╋╋╋ RA ╋╋╋ ╋╋╋╋╋╋ ╋╋╋ ╋╋╋ ╋╋╋ ━━━ ━━━ ━━━ ━━━ FSK ━━━ ━━━ ━━━ ╋╋╋ ━━━╋╋╋ ━━━╋╋╋ ━━━ ╋╋╋ Nestin
NF-M
TH
Nurr1
Olig2
GAPDH
Fig. 17. Shh promotes neuronal differentiation in P19 cells without treatment of
RA or aggregation culture. P19 cells were differentiated into neurons by Shh without treatment of RA or aggregation culture, P19 and P19/hShhN cells induced differentiation with and without treatment of RA or aggregation culture. Cells were differentiated in the absence or presence of 10µM forskolin. RT-PCR analyzed expression of TH and Nurr1, as a Dopamine neurons marker and Olig2, as a Motor neurons transcription factor.
38 IV. DISCUSSION
In this study, we have further addressed the function of Shh in the proliferation and the motor neuron differentiation of P19 cells. Our studies reveal that overexpression of Shh can direct motor neuron differentiation of P19 cells in the absence of RA, when P19/hShhN cells were replated as the single sell suspension.
Furthermore, we show that Shh-overexpressing P19 cells differentiate exclusively into motor neuron.
Chemical inducers and aggregation are two key elements to impart fate choices of P19 cells. With aggregation, DMSO directs P19 cells to differentiate into mesoderm origin muscle cells. RA, however, induces P19 cells to differentiate into ectoderm-derived neural cells including neurons and astrocytes (E.M. Jones-
Villeneuve et al., 1982, 1983; M.W. McBurney et al., 1982). According to the treatment of cells, the neural differentiation of RA-induced P19 cells can be divided into two sequential stages, a stage of induction and a stage of differentiation. During the first stage, P19 cells are allowed to aggregate in the Petri dish and induced with
RA for four days. Based on cell morphology changes and gene expression profiles, it seems that pluripotent P19 embryonic carcinoma (EC) cells are determined into neural progenitor cells during the first RA-induction stage. In second stage, the induced P19 cells are replated into cell culture dish as the single cell suspension or aggregates and left to differentiate into mature neurons and astrocytes.
Shh could induce proliferation by a number of intracellular mechanisms.
39 Binding of Shh to Ptc releases this receptor’s repression of Smo, which then transduces the signal by acting on the transcription factor of Gli family. The transcriptionally activating Gli forms then upregulate Shh targets, including ptc, gli1, gli2 and Shh itself. Shh signaling may directly regulate the cell cycle, as it can upregulate the expression of G1-phase cyclins of type D and E, and Pathed can act directly on the G2-phase cyclin B. Alternatively, Shh other activity may activate other signaling system that control cell proliferation. We observed that the Shh receptor Pathed and Smoothend and the target gene Gli is expressed in P19 cells. We have showed that Shh regulates the proliferation of P19 cells using growth kinetics and MTT assay. P19/hShhN cells increased the number of total cells in growth and differentiation condition and neutralized by 5E1. The biological activity of the Shh conditioned media was almost completely inhibited by 5E1, but unaffected by IgG.
The results suggest that the secreted hShhN was responsible for the stimulation of
P19 cell proliferation .We conclude that Shh directly promotes P19 cells proliferation in vitro.
As the neurogenesis in vivo, neurons appear earler than glial cells during RA- induced P19 cell neural differentiation (E.M. Jones-Villeneuve et al., 1982).
Interestingly, our results show that P19/hShhN cells differentiate restrictively into neurons, but not glial cells. Our previous study suggested that P19/ShhN, when replated as the aggregates, could differentiate into neural cells without RA induction.
However, RA-inducted P19 cells were normally replated as the single cell suspension to enrich the cells of interest during their neural differentiation (M.W McBurney et
40 al., 1987, 1995). The wild-type P19 cells were used as the negative control. At day 3,
P19/hShhN cells started to send out long neurite-like process. At day 4, P19/hShhN cells sent out many neurite-like process to form the networks. In parallel, the expression of Tuj1 and NF-M, as a neuronal specific marker, increased during the differentiation of P19/hShhN. This suggests that Shh may promote the neuronal differentiation in P19 cells without RA or aggregation culture.
Shh is necessary for the induction of both spinal motor neurons and midbrain dopaminergic neurons. In the developing midbrain, Shh was first characterized for its ability to induce the production of dopaminergic neurons. In the developing spinal cord, the induction of motor neuron progenitors depends on Shh activity. We have showed that Shh promotes motor neuron differentiation than dopaminergic neurons in current differentiation method. P19/hShhN cells increased expression of motor neurons transcription factor, homeodomain or specific marker gene, Nkx.1, Olig2,
Ngn2, NeuroD, Isl -1, Hb9 and ChAT. But, the expression of TH decreased in
P19/hShhN cells. Nkx6.1 is expressed in progenitors for both motor neurons and ventral interneurons. The expression of Olig2 and Ngn2 was further correlated with subtype-specific neuronal marker at E12.5, the stage when progenitors actively generate various neuronal subtype. The onset of Olig2 and Ngn2 expression precedes those of Hb9 and Isl -1, indicating that they are one of the earlist transcription factors expressed in the motor neuron lineage. Thus, among many members of bHLH factors, the coexpression of Olig2 and Ngn2 is specifically correlated to motor neuron generation. Isl-1 and Hb9 are defined markers for motor neurons and their
41 progenitors in the ventral neural tube (Tsuchida et al., 1994; Arber et al., 1999;
Thaler et al., 1999). These results suggest that Shh could be promoted into motor neuron progenitor cells and motor neuron differentiation and expressed transcription factors and HD.
The results here supported previous suggestions that Shh may be useful vehicles for a variety of neurological diseases, as Parkinson disease or Spinal cord injury.
42 V. CONCLUSIOS
Shh increases both proliferation and neuronal differentiation in P19 cells and promote the neuronal differentiation in P19 cells without RA or aggregation culture.
In the neuronal differentiation, Shh may promote proliferation of neuronal precursor cells and thereby increase expression of motor neuron specific proteins. Compared to the conventional method, the current differentiation method without aggregation may provide a useful system for the study of the functions of Shh.
43 REFERENCES
1. Arber S, Han B, Mendelsohn M, Smith M, Jessell TM, Sockanathan S:
Requirement for the homeobox gene Hb9 in the consolidation of motor
neuron identity. Neuron 23(4):659-74, 1999
2. Ariel Ruiz i Altaba, Verónica Palma & Nadia Dahmane: Hedgehog-Gli
signalling and the growth of the brain. Nature Reviews Neuroscience 3(1):24-
33, 2002
3. Barberi T, Klivenyi P, Calingasan NY, Lee H, Kawamata H, Loonam K,
Perrier AL, Bruses J, Rubio ME, Topf N, Tabar V, Harrison NL, Beal MF,
Moore MA, Studer L: Neural subtype specification of fertilization and
nuclear transfer embryonic stem cells and application in parkinsonian mice.
Nat Biotechnol. 10:1200-1207, 2003
4. Barnes EA, Kong M, Ollendorff V, Donoghue DJ: Patched1 interacts with
cyclin B1 to regulate cell cycle progression. EMBO J 20(9):2214-2223, 2001
5. Bertrand S, Cazalets JR: The respective contribution of lumbar segments to
the generation of locomotion in the isolated spinal cord of newborn rat. Eur J
Neurosci 16(9):1741-1750, 2000
44 6. Briscoe J, Ericson J: Specification of neuronal fates in the ventral neural tube.
Curr Opin Neurobiol 11(1):43-49, 2001
7. Briscoe J, Ericson J: The specification of neuronal identity by graded Sonic
Hedgehog signalling. Semin Cell Dev Biol 10(3):353-362, 1999
8. Briscoe J, Pierani A, Jessell TM, Ericson J: A homeodomain protein code
specifies progenitor cell identity and neuronal fate in the ventral neural tube.
Cell 101(4):435-445, 2000
9. Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, Westphal H, Beachy
PA: Cyclopia and defective axial patterning in mice lacking Sonic hedgehog
gene function. Nature 383(6599):407-413, 1996
10. E.M. Jones-Villeneuve, M.A. Rudnicki, J.F. Harris, M.W. McBurney:
Retinoic acid-induced neural differentiation of embryonal carcinoma cells.
Mol. Cell. Biol. 3 2271–2279, 1983
11. E.M. Jones-Villeneuve, M.W. McBurney, K.A. Rogers, V.I. Kalnins:
Retinoic acid induces embryonal carcinoma cells to differentiate into neurons
and glial cells. J. Cell Biol. 94 253–262, 1982
45 12. Ericson J, Morton S, Kawakami A, Roelink H, Jessell TM: Two critical
periods of Sonic Hedgehog signaling required for the specification of motor
neuron identity. Cell 87(4):661-673, 1996
13. Ericson J, Muhr J, Placzek M, Lints T, Jessell TM, Edlund T: Sonic hedgehog
induces the differentiation of ventral forebrain neurons: a common signal for
ventral patterning within the neural tube. Cell 81(5):747-756, 1995
14. Fan H, Khavari PA: Sonic hedgehog opposes epithelial cell cycle arrest. J
Cell Biol 147(1):71-6, 1999
15. Fu M, Lui VC, Sham MH, Pachnis V, Tam PK: Sonic hedgehog regulates the
proliferation, differentiation, and migration of enteric neural crest cells in gut.
J Cell Biol 166(5):673-684, 2004
16. Goodrich LV, Scott MP: Hedgehog and patched in neural development and
disease. Neuron 21(6):1243-1257, 1998
17. Hynes M, Porter JA, Chiang C, Chang D, Tessier-Lavigne M, Beachy PA,
Rosenthal A: Induction of midbrain dopaminergic neurons by Sonic
hedgehog. Neuron 15(1):35-44, 1995
46 18. Ingham PW, McMahon AP: Hedgehog signaling in animal development:
paradigms and principles. Genes Dev 15(23):3059-3087, 2001
19. Jessell TM: Neuronal specification in the spinal cord: inductive signals and
transcriptional codes. Nat Rev Genet 1(1):20-29, 2000
20. Karen Lai, Brian K. Kaspar, Fred H. Gage and David V. Schaffer: Sonic
hedgehog regulates adult neural progenitor proliferation in vitro and in vivo.
Nat Neuroscience 654:21-27, 2003
21. Kenney AM, Rowitch DH: Sonic hedgehog promotes G(1) cyclin expression
and sustained cell cycle progression in mammalian neuronal precursors. Mol
Cell Biol 20(23):9055-9067, 2000
22. Kim JY, Koh HC, Lee JY, Chang MY, Kim YC, Chung HY, Son H, Lee YS,
Studer L, McKay R, Lee SH: Dopaminergic neuronal differentiation from rat
embryonic neural precursors by Nurr1 overexpression. J Neurochem
85(6):1443-1454, 2003
23. Lee SK, Pfaff SL: Synchronization of neurogenesis and motor neuron
specification by direct coupling of bHLH and homeodomain transcription
factors. Neuron 38(5):731-45 , 2003
47
24. Lee SK, Pfaff SL: Transcriptional networks regulating neuronal identity in
the developing spinal cord. Nat Neurosci 1183-91 , 2001
25. Lewis PM, Dunn MP, McMahon JA, Logan M, Martin JF, St-Jacques B,
McMahon AP: Cholesterol modification of sonic hedgehog is required for
long-range signaling activity and effective modulation of signaling by Ptc1.
Cell 105(5):599-612, 2001
26. Lu QR, Sun T, Zhu Z, Ma N, Garcia M, Stiles CD, Rowitch DH: Common
developmental requirement for Olig function indicates a motor
neuron/oligodendrocyte connection. Cell 109(1):75-86, 2002
27. Lu QR, Yuk D, Alberta JA, Zhu Z, Pawlitzky I, Chan J, McMahon AP, Stiles
CD, Rowitch DH: Sonic hedgehog--regulated oligodendrocyte lineage genes
encoding bHLH proteins in the mammalian central nervous system. Neuron
31(2):317-329, 2000
28. M.A. Rudnicki, M.W. McBurney: Cell culture methods and induction of
differentiation of embryonal carcinoma cell lines, in: E.J. Robertson (Ed.),
Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, IRL
Press, Washington DC, pp. 19–49, 1987
48 29. M.W. McBurney, E.M. Jones-Villeneuve, M.K. Edwards, P.J. Anderson:
Control of muscle and neuronal differentiation in a cultured embryonal
carcinoma cell line. Nature 299 165–167, 1982
30. Marti E, Bumcrot DA, Takada R, McMahon AP: Requirement of 19K form
of Sonic hedgehog for induction of distinct ventral cell types in CNS explants.
Nature. May 25;375(6529):322-325, 1995
31. Mizuguchi R, Sugimori M, Takebayashi H, Kosako H, Nagao M, Yoshida S,
Nabeshima Y, Shimamura K, Nakafuku M: Combinatorial roles of olig2 and
neurogenin2 in the coordinated induction of pan-neuronal and subtype-
specific properties of motoneurons. Neuron 31(5):757-771, 2001
32. Ningning Miao, Monica Wang, Jennifer A. Ott, Josephine S. D'Alessandro,
Tod M. Woolf, David A. Bumcrot, Nagesh K. Mahanthappa, and Kevin Pang:
Sonic Hedgehog promotes the survival of specific CNS neuron populations
and protects these cells from toxic insult in vitro. The Journal of
Neuroscience 17(15): 5891-5899, 1997
33. Novitch BG, Chen AI, Jessell TM: Coordinate regulation of motor neuron
subtype identity and pan-neuronal properties by the bHLH repressor Olig2.
Neuron 31(5):773-789, 2001
49 34. Novitch BG, Wichterle H, Jessell TM, Sockanathan S: A requirement for
retinoic acid-mediated transcriptional activation in ventral neural patterning
and motor neuron specification. Neuron 40(1):81-95, 2003
35. P.A. MacPherson, M.W. McBurney: P19 embryonal carcinoma cells: a
source of cultured neurons amenable to genetic manipulation. Methods 7
238–252, 1995
36. Roelink H, Augsburger A, Heemskerk J, Korzh V, Norlin S, Ruiz i Altaba A,
Tanabe Y, Placzek M, Edlund T, Jessell TM, et al: Floor plate and motor
neuron induction by vhh-1, a vertebrate homolog of hedgehog expressed by
the notochord. Cell 76(4):761-775, 1994
37. Roelink H, Porter JA, Chiang C, Tanabe Y, Chang DT, Beachy PA, Jessell
TM: Floor plate and motor neuron induction by different concentrations of
the amino-terminal cleavage product of sonic hedgehog autoproteolysis. Cell
81(3):445-455, 1995
38. Roussa E, Farkas LM, Krieglstein K: TGF-beta promotes survival on
mesencephalic dopaminergic neurons in cooperation with Shh and FGF-8.
Neurobiol Dis 16(2):300-310, 2004
50 39. Roy S, Ingham PW: Hedgehogs tryst with the cell cycle. J Cell Sci. 115(Pt
23):4393-4397, 2002
40. Scardigli R, Schuurmans C, Gradwohl G, Guillemot F: Crossregulation
between Neurogenin2 and pathways specifying neuronal identity in the
spinal cord. Neuron 31(2):203-17, 2001
41. Stull ND, Iacovitti L: Sonic hedgehog and FGF8: inadequate signals for the
differentiation of a dopamine phenotype in mouse and human neurons in
culture. Exp Neurol 169(1):36-43, 2001
42. Tanabe Y, Roelink H, Jessell TM: Induction of motor neurons by Sonic
hedgehog is independent of floor plate differentiation. Curr Biol 5(6):651-
658, 1995
43. Tang K, Yang J, Gao X, Wang C, Liu L, Kitani H, Atsumi T, Jing N: Wnt-1
promotes neuronal differentiation and inhibits gliogenesis in P19 cells.
Biochem Biophys Res Commun 293(1):167-73, 2002
44. Thaler JP, Lee SK, Jurata LW, Gill GN, Pfaff SL: LIM factor Lhx3
contributes to the specification of motor neuron and interneuron identity
through cell-type-specific protein-protein interactions. Cell 110(2):237-49,
51 2002
45. Tsuchida T, Ensini M, Morton SB, Baldassare M, Edlund T, Jessell TM, Pfaff
SL: Topographic organization of embryonic motor neurons defined by
expression of LIM homeobox genes. Cell 79(6):957-70, 1994
46. Wang MZ, Jin P, Bumcrot DA, Marigo V, McMahon AP, Wang EA, Woolf T,
Pang K: Induction of dopaminergic neuron phenotype in the midbrain by
Sonic hedgehog protein. Nat Med 1(11):1184-1188, 1995
47. Wechsler-Reya RJ, Scott MP: Control of neuronal precursor proliferation in
the cerebellum by Sonic Hedgehog. Neuron 22(1):103-114 , 1999
48. Wichterle H, Lieberam I, Porter JA, Jessell TM: Directed differentiation of
embryonic stem cells into motor neurons. Cell 110(3):385-397, 2002
49. Zeng X, Goetz JA, Suber LM, Scott WJ Jr, Schreiner CM, Robbins DJ: A
freely diffusible form of Sonic hedgehog mediates long-range signalling.
Nature 411(6838):716-720, 2001
50. Zeng X, Goetz JA, Suber LM, Scott WJ Jr, Schreiner CM, Robbins DJ: A
freely diffusible form of Sonic hedgehog mediates long-range signalling.
52 Nature 411(6838):716-720, 2001
53 -국문 요약-
P19 세포에서 Shh 에에에 의한 운동신경세포로의 분화 유도
아주대학교 대학원의학과 박 래 희 (지도교수 : 서 해 영)
Sonic hedgehog (Shh) 은 포유동물의 발생과정에서 Central neuvous system (CNS)의 초기 dorso-ventral 형성 과정을 유도하는 morphogen 으로서 알려졌다. 이것은 Notochord 와 floor plate 으로부터 분비되고 여러 Hh 들 중의 하나이다. 또한, Shh 은 Full length 로 발현되어 N-말단과 C-말단으로 나뉘게 된다. 여기서 ShhN-말단이 기능적인 부분으로 발생초기에 도파민성 신경세포와 운동신경세포의 분화를 유도하는 것으로 알려져 있다. 이것이 세포 밖으로 분비되어 수용체인 Patched 에 결합하면 Shh 과 관련된 세포 신호 전달이 시작된다. 최근, CNS 발달 과정 중에서 Shh 은 Oligodendrocyte 와 운동신경세포뿐만 아니라 신경전구세포의 증식과 신경돌기의 조절과 같은 다양한 세포의 특징을 결정하는 기능을 한다고 알려졌다. 본 연구에서 신경세포 분화에서 Shh 의 기능을 연구하기 위해 in vitro 에서 P19 세포를 이용하였다. P19 세포는 배아 줄기세포처럼 세배엽으로 모두 분화 할 수 있는 능력을 지녔으며 배양하기가 매우 용이 하다는 장점을 가졌다. 일반적으로 P19 세포의 분화 유도는 retinoic acid (RA)를 이용하여 약 8 일 정도 소요된다. RA 를 사용하면 세포가 많이 죽어 분화된 세포를 얻는 양이 많이 떨어진다는 단점이 있어, 본 실험에서는 일반적으로 알려진 P19 세포 분화 방법과 달리 혈청이 없는 배양 조건에서 4 일간 분화를 유도 하였다. P19 세포에 Shh 이 과 발현 되는 세포 주인 P19/hShhN 를 만들었고 P19 세포의
54 세포 증식과 분화에서 Shh 의 효과를 알아보았다. Shh 이 과 발현되고 있는 P19 세포는 일반 P19 세포 보다 세포증식 속도가 빨랐고, 분화 조건에서도 역시 세포증식 속도가 빨랐다. 또한 P19/hShhN 세포는 일반 P19 세포보다 신경세포로의 분화 비율이 높았다. 일반적으로 세포증식과 분화는 상반적인 것으로 알려져 있는데 본 실험에서는 Shh 에 의해 세포증식과 분화 모두 증가가 되어 신경줄기세포 혹은 신경전구 세포에서 특이적으로 발현하는 nestin 을 발현하는 P19/pNPEeGFP 세포를 이용하여 Shh 가 신경전구세포의 생존에 관여하고 있음을 확인하였다. 아마도 P19/hShhN 세포의 세포증식과 신경세포로의 분화 모두에서 Shh 은 P19 세포로부터 신경세포로의 운명을 결정해주고 신경세포로 분화할 수 있는 신경전구세포의 세포 증식을 유도하는 것으로 보인다. Shh 은 도파민성 신경세포와 운동신경세포의 분화를 유도하는데 중요한 역할을 한다고 알려져 있는데, 본 실험에서 나타나는 신경세포가 어떠한 신경세포로 분화되는지 각각의 신경세포 전사인자와 특이 단백질 의 발현을 알아 보았다. 그 결과 도파민성 신경세포와 운동신경세포 모두에 관여하는 전사인자와 특이 단백질의 발현이 Shh 에 의해 증가되었지만, 도파민성 신경세포보다는 운동신경세포로의 분화를 좀 더 유도하였다. 운동성신경세포가 분화되는 과정에서 Shh 은 세포들이 분화 할 수 있는 환경을 조성해준다. 이후, 운동신경세포가 분화하는데 있어서 필요한 bHLH 전사 인자와 Homeobox 유전자가 발현되고 운동신경세포 특이 단백질이 발현한다. P19/hShhN 세포에서 운동신경세포에 관여하는 Nkx6.1, Olig2 그리고 Ngn2 의 발현이 증가하였고 운동신경세포 특이 단백질인 Hb9 과 ChAT 의 발현도 증가하였다. 따라서 본 실험에서 이용한 분화 방법을 통해서 Shh 이 운동신경세포로의 분화를 유도함을 알 수 있었다. 본 연구에서, Shh 은 운명이 결정되지 않은 줄기세포의 신경세포 유도, 신경세포로 분화할 수 있는 신경전구세포의 세포증식 그리고 CNS 의 dorso- ventral 형성과 같은 다양한 기능을 갖고 있음을 확인하였다.
55
핵심어 : Sonic hedgehog, Proliferation, Differentiation, Motor neurons, P19 cells
56